Cell, Vol. 104, 619–629, February 23, 2001, Copyright 2001 by Cell Press

TBX1 Is Responsible for Cardiovascular Defectsin Velo-Cardio-Facial/DiGeorge Syndrome

fects can be partially rescued by a human BAC con-taining the TBX1 gene. Mice heterozygous for a nullmutation in Tbx1 develop conotruncal defects. These

Sandra Merscher,1,12 Birgit Funke,1,12

Jonathan A. Epstein,4,12 Joerg Heyer,1

Anne Puech,2 Min Min Lu,4 Ramnik J. Xavier,8

Marie B. Demay,7 Robert G. Russell,3 results together with the expression patterns of Tbx1suggest a major role for this gene in the molecularStephen Factor,3 Kazuhito Tokooya,5

Bruno St. Jore,2 Melissa Lopez,1 Raj K. Pandita,1 etiology of VCFS/DGS.Marie Lia,1 Danaise Carrion,1 Hui Xu,2

Hubert Schorle,9 James B. Kobler,10 IntroductionPeter Scambler,6 Anthony Wynshaw-Boris,5

Arthur I. Skoultchi,2 Bernice E. Morrow,1,11 Velo-cardio-facial/DiGeorge syndrome (VCFS, MIMand Raju Kucherlapati1,11 192,430/DGS, MIM 188,400) is a complex developmental1Department of Molecular Genetics disorder associated with cardiac outflow tract abnor-2Department of Cell Biology malities, mild facial dysmorphology, velopharyngeal in-3Department of Pathology sufficiency, submucous cleft palate, thymic, and para-Albert Einstein College of Medicine thyroid gland hypoplasia or aplasia (DiGeorge, 1965;1300 Morris Park Avenue Shprintzen et al., 1978; Goldberg et al., 1993). Many ofBronx, New York 10461 the structures affected in the patients are derived from4Cardiovascular Division the pharyngeal arches. Ablation of cardiac neural crestUniversity of Pennsylvania cells that migrate into the pharyngeal arches results inPhiladelphia, Pennsylvania 19104 malformations similar to those observed in VCFS/DGS5Department of Medicine patients (Kirby et al., 1983; Bockman and Kirby, 1984;UCSD School of Medicine Bockman et al., 1987; Kirby and Waldo, 1990). It, there-La Jolla, California 92093 fore, seems possible that VCFS/DGS may result from6Institute for Child Health improper migration or function of neural crest cells re-University of London College of Medicine sulting in anomalies of the pharyngeal arch derivatives.London, United Kingdom Most VCFS/DGS patients are hemizygous for a 3 Mb7Endocrine Unit region on human chromosome 22 (HSA22q11) while oth-8Department of Molecular Biology ers have a smaller 1.5 Mb nested deletion (Morrow etMassachusetts General Hospital al., 1995; Carlson et al., 1997). These observations sug-Boston, Massachusetts 02114 gested that haploinsufficiency of one or more genes on9Foschungszentrum Karlsruhe human chromosome 22 is responsible for its etiology.Institut fuer Toxikologie und Genetik Several different approaches have been used to identifyPostfach 3640 candidate genes in the 1.5 Mb deleted region. With the76133 Karlsruhe completion of the sequence of chromosome 22 (Dun-Germany ham et al., 1999), as well as traditional approaches, 2410H. P. Mosher Laryngological Research Laboratory genes have been identified (Figure 1A). Despite intenseDepartment of Otology and Laryngology efforts, the gene(s) responsible for the main clinical find-Harvard Medical School ings of DGS/VCFS has not yet been identified.Massachusetts Eye and Ear Infirmary To extend the human molecular genetic approaches243 Charles Street to identify the VCFS/DGS gene(s), we and others initi-Boston, Massachusetts 02114 ated efforts to generate deletions in mice in the region

on mouse chromosome 16 (MMU16) that correspondsto the 1.5 Mb region of HSA22q11 (Figure 1B). Kimberet al. (1999) generated mice with a 150 kb deletion cov-Summaryering the proximal part of the 1.5 Mb deleted region.Mice hemizygous for this deletion were normal. LindsayVelo-cardio-facial syndrome (VCFS)/DiGeorge syn-

drome (DGS) is a human disorder characterized by a et al. (1999) described mice carrying a hemizygous dele-tion of an estimated 1.2 Mb region from Es2 to Ufd1l onnumber of phenotypic features including cardiovascu-

lar defects. Most VCFS/DGS patients are hemizygous MMU16. This region contains the orthologs of 18 genespresent in the human 1.5 Mb region and one nonortholo-for a 1.5–3.0 Mb region of 22q11. To investigate the

etiology of this disorder, we used a cre-loxP strategy gous gene, Vpreb2. The mutant mice, referred to asDf1/1 mice, had cardiac outflow tract defects similar toto generate mice that are hemizygous for a 1.5 Mb

deletion corresponding to that on 22q11. These mice those observed in VCFS/DGS patients and some hemi-zygous mice died soon after birth. These results sug-exhibit significant perinatal lethality and have cono-

truncal and parathyroid defects. The conotruncal de- gested that critical genes for these defects are locatedin this region. We recently described mice with a 550kb deletion from Idd to Arvcf on MMU16 (Puech et al.,11To whom correspondence should be addressed (email: kucherla@2000) that overlaps significantly with the region deletedaecom.yu.edu or morrow@aecom.yu.edu).

12These three investigators contributed equally to this work. in the Df1/1 mice (Figure 1B). These mice did not exhibit

Cell620

Figure 1. Map of a Part of Human Chro-mosome 22q11 (HSA22q11) and Its Corre-sponding Region on Mouse Chromosome 16(MMU16)

(A) The relative order of genes on HSA22q11and the orthologous genes on MMU16 areshown. Genes are indicated by circles.Arrows show differences in gene organizationbetween the two species. Genes localizedbetween IDD and CTP show the same orderwhereas genes localized between RANBP1and HIRA are inverted in mouse comparedto human. DGCR6 and PRODH are locatedproximal to IDD in human but inserted be-tween Slc20a3 and Ranbp1 in mice. Nonor-thologous genes are boxed(B) Mouse models that have been generatedare shown in the lower part of the figure.

conotruncal abnormalities, allowing us to exclude 13 spring from Idd 1/2; Hira 1/2 X 1/1; 1/1 matings. Ofthese, 352 (49%) were Idd 1/2 and 352 (49%) weregenes in this region as being solely responsible, when

haploinsufficient, for the outflow tract defects. Hira 1/2. The remaining 11 resulted from recombinationbetween the Idd and Hira loci and one of them carriedWe now report the generation and characterization

of mice with a hemizygous deletion from Idd to Hira the mutant alleles in cis (cis-Idd/Hira-KO). Cis-Idd/Hira-KO mice were mated with Zp3-Cre transgenic mice(Lgdel/1 mice), a region containing 24 genes that contains

five more genes than in the Df1/1 mice. We show that (Lewandoski et al., 1997), to introduce the Cre trans-gene, and mice containing all three modifications werenearly 50% of these mice exhibit conotruncal anomalies

and that the deletion also leads to parathyroid gland mated with C57BL/6 (B6) mice to delete the region fromIdd to Hira (Figure 2B). From 20 such matings, we recov-aplasia and significant perinatal lethality. Attempts to com-

plement the deletion with a duplication of the Idd-Arvcf ered 105 mice, of which 66 (63%) were wild type (WT),13 (12%) were cis-Idd/Hira-KO, and the remaining 26region and three different BAC transgenes, that together

cover the 1.5 Mb region spanned by the Lgdel, allowed (25%) carried a chromosome with a deletion. Deletion-carrying mice were identified by a series of PCR reac-us to define a 200 kb region containing four genes,

Wdvcf (Wdr14, Funke et al., 2001), Tbx1 (Chapman et tions (Figure 2C). Of the 26 mice that had a deletion, 14were mosaic and the remaining 12 were the result ofal., 1996; Chieffo et al., 1997), Gp1bb (Yagi et al., 1994),

and Pnutl (McKie et al., 1997), to be critical for the cono- a germline transmission event. We designated thesedeletion heterozygotes Lgdel/1.truncal phenotypes observed in the Lgdel/1 mice. We

generated mice that carry a human BAC containingthese four genes. Embryos heterozygous for the trans- Perinatal Lethality of Lgdel/1 Mice

In the Idd, Hira/11, Zp3-Cre/1 X WT crosses describedgene exhibit cardiovascular abnormalities. We also ex-amined the expression patterns of these four genes and above, we noted that 25% of Lgdel/1 mice, 14% of the

mosaic Lgdel/1 mice, and 8% of Idd, Hira/11 micefound that one of them, Tbx1, is expressed in the pharyn-geal arches. Based on these data, Tbx1 can be consid- died after birth compared to less than 2% of similar

deaths among WT siblings. Examination of offspringered a candidate for some of the phenotypes in VCFS/DGS patients. To test this feature, we generated mice from Lgdel/1 X WT matings confirmed the perinatal

lethality of Lgdel/1 mice. Genotyping of 256 mice fromwith a null mutation in the Tbx1 gene. Mice heterozygousfor this mutation developed cardiovascular defects. 48 litters revealed that 184 (72%) of them were WT and

72 (28%) were Lgdel/1. To assess the stage of lethalityThese results provide strong evidence that haploinsuffi-ciency of TBX1 is responsible for the cardiovascular of Lgdel/1 mice, we examined the genotypes of em-

bryos at 10.5, 11.5, 12.5, and 18.5 days of embryogene-defects seen in VCFS/DGS patients.sis. Lgdel/1 embryos were recovered in the expectedMendelian ratio from all stages of embryogenesis exam-Resultsined, suggesting that a significant percentage of theLgdel/1 mice died at or shortly after birth. We foundTargeted In Vivo Deletion of the Chromosomal

Region between Idd and Hira in Mice that several newborns die during the first day of life.To generate mice with a targeted deletion of the chromo-somal region from Idd to Hira (Figure 1), we bred mice Phenotypic Analysis of the Lgdel/1 Mice

Cardiovascular Defects in Lgdel/1 Embryosthat were homozygous for the Idd mutant allele (Puechet al., 2000) with mice heterozygous for the Hira mutant Cardiac defects are observed in z80% of VCFS/DGS

patients (Shprintzen et al., 1985; Van Mierop and Kutsche,allele (A. W.-B. and P. S., unpublished data). Both theIdd and the Hira mutant alleles included insertions con- 1986; Goldberg et al., 1993; Ryan et al., 1997) and were

detected in Df1/1 mice (Lindsay et al., 1999). We exam-taining loxP sites in the same orientation (Figure 2A).To obtain mice that have the two mutant alleles on ined embryos from 18.5 day pregnant B6 females that

were mated with Lgdel/1 males. A total of 156 embryosthe same chromosome in cis, we genotyped 715 off-

Important Role for TBX1 in VCFS/DGS621

from 20 litters were analyzed. 80 embryos (51%) werehemizygous for the deletion and 76 (49%) were WT. Theheart appeared normal in size and shape in all mice(data not shown). To identify vascular patterning defects,corrosion casts were prepared by injecting red and bluemethylmethacrylate into the left and right ventricles, re-spectively. After hardening, the soft tissues were dissolvedleaving a mold of the vasculature (see Experimental Pro-cedures). Representative results are shown in Figure 3.We found that 47% of the Lgdel/1 embryos had abnor-mal patterning of the great vessels, while all of the wild-type littermates were normal (Figure 3A).

Twelve of the 80 Lgdel/1 embryos examined (15%)had defects that would be considered critical or lethalin human infants. These included 4 cases (5%) of a right-sided aortic arch with a left-sided ductus arteriosus (Fig-ure 3B). In these cases, the aortic arch was posterior tothe esophagus and trachea (not shown) such that avascular ring capable of causing compression of thetrachea was present. The left common carotid arteryarose ectopically from the proximal ascending aorta.We observed 8 cases (10%) of complete interruption ofthe aortic arch, which were always of the type B variety,i.e., the interruptions occurred between the left carotidartery and the left subclavian artery (Figure 3C). In casesof complete interruption of the aortic arch, blood supplyto the descending aorta is provided by flow throughthe patent ductus arteriosus. At birth, when the ductuscloses, concomitant with increased oxygen tension,blood supply to the descending aorta would be compro-mised and neonatal lethality would be expected. Thesesevere vascular defects account for at least some of theperinatal lethality observed in Lgdel/1 newborn mice.

Less severe vascular anomalies were also detectedin Lgdel/1 embryos. The right subclavian artery aroseectopically in many cases. In 5 of 80 (6%) heterozygousembryos examined, the right subclavian arose from theascending aorta instead of arising as a branch of theinnominate artery (data not shown). This is considereda normal variant in humans, but we never observed thisanomaly in the wild-type murine embryos examined. In13 cases (16%), the right subclavian artery arose fromthe distal portion of the aortic arch and traveled posteri-orly to the right foreleg indicating a retroesophageal

Figure 2. Strategy to Generate an In Vivo Deletion from Idd to Hira subclavian artery (Figures 3D and 3E). In 7 cases (9%),(A) Schematic representation of the Idd and Hira targeting con- the innominate artery was unusually long (more thanstructs. The exons of both genes are shown as white boxes. The twice normal) prior to the origin of the subclavian arteryPGK Neo cassettes and a solitary PGK promoter (P) are represented (Figure 3F). These defects would not be expected toby black boxes and the loxP sites by black triangles. PCR primers cause significant morbidity or mortality.used for genotyping and detection of the gene-targeting events are

We examined four E13.5 embryos for cardiac anoma-indicated by arrows.lies. We found that in one case, there was a ventricular(B) Steps involved in generating an in vivo deletion from Idd to Hira.septal defect (VSD) and associated thin myocardium.Briefly, mice containing mutant alleles of Idd and Hira in trans were

mated with C57BL/6 mice. The offspring are screened by PCR for Evidence for VSD was also noted in some Lgdel/1 E18.5a meiotic recombination event between the Idd and Hira loci and embryos when methylmethacrilate was observed tothe identified cis-Idd/Hira-KO mice were mated with ZP3-Cre mice quickly and easily cross the ventricular septum. VSDto enter the Cre transgene. To delete the region comprised within was reported as a feature in VCFS/DGS patients.the two loxP sites (black triangles), mice containing all three modifi-

The cardiac and vascular defects that we observedcations were then crossed with C57BL/6 mice. A deletion event canare similar to those reported in VCFS/DGS patients andbe detected by PCR using the primers for PGK1 and Neo5F ascan all be related to defects in persistence or regressionindicated by the black arrows (see also Figure 2C).

(C) Genotyping by PCR analysis. Mice containing the Lgdel chromo- of aortic arches 3, 4, and 6. Neural crest cells populatesome, a duplication from Idd to Arvcf, or mice with a Idd/Hira-cisKO these aortic arches during development, a process thattargeted chromosome can be easily distinguished from wild-type is critical for regulation of the remodeling process. Simi-mice by PCR. The primer pairs used are indicated on the right side lar vascular defects have been observed after ablationof the Figure (see also Experimental Procedures).

of neural crest in chick embryos (Kirby et al., 1983).

Cell622

Figure 3. Cardiovascular and Parathyroid Abnormalities in Lgdel/1 E18.5 Embryos

Corrosion casts were prepared (see Experimental Procedures) from wild-type and Lgdel/1 E18.5 embryos by injection of blue acrylic into theright ventricle and red acrylic into the left ventricle.(A) Normal anatomy in a wild-type embryo. The ascending aorta gives rise to the innominate artery (IA) that bifurcates into right subclavianartery (RSA) and right common carotid (RCC). The next arteries branching from the aortic arch (AA) are left common carotid (LCC) and leftsubclavian artery (LSA). (DAo 5 descending aorta.)(B) Right-sided aortic arch with a left-sided ductus arteriosus.(C) Interrupted aortic arch of the type B variety (IAA-B).(D and E) Retro-esophageal subclavian artery. The RSA arises from the distal portion of the aortic arch and travels along a posterior route tothe right arm.(F) The innominate artery is more than twice as long as normal and arises prior to the origin of the subclavian artery.AA 5 aortic arch; IA 5 innominate artery; RCC/LCC, right/left common carotid arteries; RSA/LSA 5 right/left subclavian arteries.(G and H) Cross sections of thyroid and parathyroid from WT(G) and Lgdel/1 (H) mice stained with H&E. The absence of parathyroid wasdetermined by examining more than 150 consecutive serial sections from each mouse.

These results suggest that haploinsufficiency of func- roid glands (Goldberg et al., 1993; Ryan et al., 1997;Scuccimarri and Rodd, 1998). A deficit in thymic functiontions encoded by the region of mouse chromosome 16

between Idd and Hira regulate neural crest patterning can result in a deficiency of T cells and can be demon-strated by measuring the proportion of CD41 lympho-of the aortic arches.

Phenotypic Analysis of the Thymus, Thyroid, cytes. To determine whether these features are alsopresent in the Lgdel/1 mice, we analyzed E18.5 embryosand Parathyroid Glands in Lgdel/1 Mice

In addition to conotruncal defects, VCFS/DGS patients for thymic hypo- or aplasia as well as T cell immunedefects. All of the 24 embryos (7 Lgdel/1 embryos andshow absence or hypoplasia of the thymus and parathy-

Important Role for TBX1 in VCFS/DGS623

17 WT embryos) analyzed had an intact and normal three BACs. Transgenics that retained the intact BACwere used for further study. Studies of expression pat-sized thymus. Flow cytometry analysis of the T cell pop-

ulations in the thymus was performed using CD3, CD4, terns of the transgenes revealed that all of them wereexpressed in the same spatio-temporal pattern as theirand CD8 markers and no significant differences were

found in Lgdel/1 mice compared to their WT littermates mouse counterparts (results not shown). Transgenicsfrom BACs 467 and 339 did not have any discernable(data not shown).

Rhombencephalic neural crest cells together with the phenotypes. We observed that two lines of transgenicsfrom BAC316, 316.23, and 316.27 had abnormal ratiosendoderm of the primitive pharynx give rise to the thy-

roid, parathyroid, and thymus glands (Le Douarin, 1981). of WT:Tg mice, 63:37 (n5428) and 61:39 (n5193) re-spectively indicating significant neonatal lethality ofIn histological sections, the thyroid gland is located ad-

jacent to the rostral larynx. The parathyroid glands are transgenic mice. To ascertain if this lethality is due tocardiovascular defects, we examined the cardiovascularembedded within the posterolateral regions of the thy-

roid gland. We examined a total of 13 newborns for system of E18.5 embryos by the corrosion cast tech-nique. We examined 26 transgenic embryos and 37 WTdefects in the thyroid and parathyroid glands. Out of 13

mice analyzed, 6 were WT and 7 were Lgdel/1 mice. The littermates. Representative results are shown in Figure 4.Fourteen of 26 (54%) 316.23 transgenic embryos hadthyroid gland was normal in size and shape in all mice. In

contrast, while the size and shape of the parathyroid vascular defects involving the aortic arch and/or greatvessels. Five embryos had retroesophageal subclavianglands were normal in all WT mice, 5 of 7 Lgdel/1

mice had no detectable parathyroid glands (Figures 3G arteries (Figure 4B). Three embryos had pulmonary atre-sia (Figure 4C). In these embryos, the pulmonary vascu-and 3H).lature filled retrograde via the patent ductus arteriosus.In these embryos, a ventricular septal defect was pres-Definition of the Critical Regionent. Five embryos displayed a persistent right-sided aor-for Conotruncal Defectstic arch. In these embryos, the left carotid artery wasThe Idd-Hira region in the mouse genome encompassesthe first major branch of the ascending aorta instead ofan estimated 1.5 Mb region and contains 24 genes. Ourthe innominate artery (e.g., Figure 4D). A left-sided duc-earlier studies showed that a deletion of the 550 kb Idd-tus arteriosus was present. Since the right-sided aorticArvcf region did not lead to neonatal lethality in thearch travels posterior to the esophagus and trachea, ahemizygous state nor did the mice exhibit any physicalvascular ring was present with the potential for com-malformations including conotruncal defects at 18.5pressing these structures. In one case (Figure 4D), pul-days of embryogenesis (Puech et al., 2000). To confirmmonary atresia and a right-sided aortic arch were pres-these observations and to better define the localizationent in the same embryo. In this case, the ductusof the gene responsible for the phenotypes, we per-arteriosus anastomosed with the left subclavian arteryformed intercrosses of Lgdel/1 mice with a line thatinstead of the descending aorta and served to fill thecarried a duplication of the 550 kb region spanning Iddpulmonary vasculature. One newborn transgenic animalto Arvcf designated Dup (Puech et al., 2000).also had an interrupted aortic arch, type B (not shown).We examined 141 mice from matings between Lgdel/1An E18.5 embryo had a complex outflow tract malforma-mice and Dup Idd-Arvcf mice. Complementation of neo-tion and a ventricular septal defect (Figure 4E). All ofnatal lethality observed in Lgdel/1 mice would lead tothese defects are related to inappropriate persistencean equal proportion of mice carrying the deleted andor regression of aortic arch arteries three, four, and six.the duplicated chromosome (Dup/Lgdel) and those thatMigrating cardiac neural crest cells populate these threeare Dup/1. Of the adult 141 mice examined, 97 (69%)aortic arches. Therefore, the phenotypes observed arewere Dup/1 while 44 (31%) were Dup/Lgdel. Seven oflikely due to abnormalities in this aspect of development.51 (14%) Lgdel/Dup mice died soon after birth, com-No vascular defects were observed in any of the wild-pared to only 1% (1/98) of their Dup/1 littermates. Thesetype embryos examined. These results suggested thatresults confirmed our earlier finding that the region fromone or more of the genes on BAC316 are dosage sensi-Idd to Arvcf is not responsible for the lethality phenotypetive and an increased level of expression of this gene(s)observed in Lgdel/1 mice. These results also suggestcauses cardiovascular anomalies.that functional hemizygosity of the region Arvcf-Hira,

carrying ten genes, is sufficient to lead to neonatal le-thality. Thymus Hypoplasia and Maldescent

in BAC Transgenic MiceIncomplete migration of the thymus tissue from the phar-BAC Transgenic Mice

To further narrow the region harboring the gene(s) re- ynx into the mediastinum was detected with variableseverity in BAC316.23 transgenic mice (n 5 9; Figuressponsible for conotruncal heart defects and perinatal

mortality, we generated three strains of transgenic mice 4F and 4G). Specifically, the two mediastinal lobes ofthe thymus were smaller in size and the superior borderscontaining human BACs encompassing the region from

ARVCF to NLVCF (Figure 1B). Human BACs were chosen extended as long slender strands into the neck 7–9 mmabove the clavicles (n 5 6; Figure 4G). Occasionally,to unambiguously ascertain the expression pattern of

the transgenes. BAC467 contained three genes, ARVCF, there were small ectopic lobules at the cranial ends ofthese strands, which was confirmed by FACS analysisCOMT, and TRXR2. BAC316 contained four genes,

WDVCF, TBX1, GP1Bb , and PNUTL. BAC339 contained of this tissue. Fluorescence-activated cell sorting (FACS)was performed using thymocytes from the 316.23.FVBfour genes, TMVCF, CDC45L, UFD1L, and NLVCF. We

generated several founders from injection of each of the line. All thymocyte subpopulations, CD41, CD81, CD31,

Cell624

Figure 4. Cardiovascular and Thymus Defects in 316.23 Transgenic Mice

Examples of corrosion casts in E18.5 wild-type (A) and transgenic littermates (B–D). The left ventricle was injected with red methylmethacrylateand the right ventricle was injected with blue methylmethacrylate. The patent ductus arteriosus (DA) prior to birth allows mixing of red andblue. The venous system has been removed.(A) Wild-type embryo. The ascending aorta (Ao) gives rise to the braciocephalic artery that quickly bifurcates into the right subclavian artery(RSA) and the right carotid artery (RCC). The next branch is the left carotid artery (LCC) followed by the left subclavian artery (LSA). Theproximal pulmonary artery (PA) gives rise to the right and left pulmonary arteries (RPA, LPA) and the ductus arteriosus that joins the descendingaorta.(B) Transgenic embryo with a retroesophageal right subclavian artery (arrows) that originates from the descending aorta and travels posteriorly.(C) Transgenic embryo with pulmonary atresia. The RPA and LPA fill retrograde through the DA with red methylmethacrylate. No proximalpulmonary artery is present. (Location where the proximal PA should be seen is marked with arrowhead).(D) Transgenic embryo with a right aortic arch and pulmonary atresia. The first branch of the ascending aorta is the LCC, followed by theRCC and RSA. No brachiocephalic artery is seen. The aortic arch travels posteriorly. The RPA and LPA fill retrograde via the DA, whichbranches from the LSA (arrowhead) instead of from the descending aorta. This embryo represents a variant of a congenital “vascular ring”defect seen in some human infants.(E) H&E stained cross section through the heart of an E18.5 transgenic embryo reveals a ventricular septal defect (VSD) connecting the leftventricle (LV) and right ventricle (RV).(F and G) Representative thymi from normal (E) and transgenic littermates (F) within the body cavity of six-week-old mice.

and CD4-/CD82, were present in normal ratios but were showing that, in contrast to thymus development, over-expression of the transgenes did not affect parathyroidreduced in number in the transgenic mice compared

to wild-type littermates, consistent with their smaller development or function.thymus size (data not shown). No obvious defects werefound in the parathyroid glands of eight 316.23 transgenic Complementation of the Phenotypes in Lgdel/1

Mice by BAC Transgenicsand three wild-type littermates. Consistent with this find-ing, circulating parathyroid hormone levels in these trans- To ascertain if the gene(s) on BAC316 is also responsible

for the cardiovascular defects seen in VCFS/DGS pa-genics were also in the normal range (60.3 1/2 11.6)

Important Role for TBX1 in VCFS/DGS625

Figure 5. Expression Pattern of Tbx1 in E10.5Mouse Embryos

(A) Cross section of E10.5 embryo at the levelof the cardiac outflow tract reveals mesen-chymal expression of Tbx1 surrounding thethird aortic arch artery (3), the dorsal aorta(DA), and the cardinal vein (CV).(B) Sagittal section of E10.5 embryo throughthe pharyngeal arches reveals Tbx1 expres-sion surrounding the aortic arch arteries(numbered 2,3,4), especially around aorticarch artery 4. Br, brain; Ht, heart; NT, neuraltube. Sense probe yielded no signal (notshown).

tients, we mated the 316.23 mice with the Lgdel/1 mice. gested that TBX1 has an important role in the cardiovas-cular defects observed in VCFS/DGS patients.Similar crosses were also made with the two other BAC

transgenics.We analyzed 120 mice from a mating of Lgdel/1 mice Mice with a Mutation in Tbx1

To definitively assess the role of Tbx1 in the phenotypesand mice heterozygous for the TMVCF-NLVCF BACtransgenes. This mating should yield four classes of observed in Lgdel/1 mice, we generated mice that carry

a mutation in this gene. The gene targeting constructmice, two of which carry the Lgdel chromosome. Amongthe offspring of this mating, mice carrying the Lgdel used for this purpose is shown in Figure 6A. Correct

gene targeting was verified by Southern blot analysischromosome were underrepresented (38%). Among the45 mice carrying the Lgdel chromosome, 20 contained (Figure 6B). Embryonic stem (ES) cells carrying the modi-

fied locus were injected into B6 embryos and severalthe transgene while the rest did not. Similar results wereobtained in crosses between Lgdel/1 mice and ARVCF- chimeric mice were generated. The highly chimeric

mice from two independently derived ES cell lines wereTRXR2 BAC transgenic mice. These results suggest thatthe genes responsible for the neonatal lethality may lie mated with B6 females and 18.5 day embryos were geno-

typed and examined for conotruncal defects. Fourteenin the Wdvcf-Pnutl region. The 316 BAC transgenic mice,containing different numbers of transgene copies, ex- Tbx11/2 embryos and 14 wild-type littermates were

examined. We observed that 7/14 (50%) of the Tbx11/2hibited a number of phenotypes that are similar to thoseobserved in VCFS/DGS patients including conotruncal embryos had abnormalities of patterning of the great

vessels including two that had an abnormal origin ofdefects. Therefore, we examined the ability of the 1-2copy line to complement the conotruncal defects seen the right subclavian artery (RSA, Figure 7A), two with

retroesophageal RSA (Figure 7B), one with an inter-in Lgdel/1 mice. From several matings of Lgdel/1 XTg316/1 mice, we examined a total of 82 embryos. All rupted aortic arch and a retroesophageal RSA (Figure

7C), one with an RSA that arose from the pulmonaryof the 1/1 and Tg316/1 embryos were normal. While50% of the Lgdel/1 embryos had some sort of conotrun- artery instead of from the systemic vasculature (Figure

7D), and one with an abnormally high aortic arch (“cervi-cal defect, only 14% of the Lgdel/1, Tg316/1 mice hadvascular anomalies. These results suggested that the cal arch”, not shown). The majority of these haploinsuffi-

cient phenotypes would be compatible with postnataltransgene is capable of partially rescuing the vasculardefects observed in Lgdel/1 embryos. survival. No vascular defects were seen in the wild-type

embryos examined. These observations clearly showthat reduced dosage of Tbx1 results in conotruncal de-Expression Pattern of Tbx1 Gene

We examined the expression patterns of the four genes fects in mice.on BAC316. Since VCFS/DGS is the result of develop-mental defects, we determined the sites of expression Discussionof the four genes by in situ hybridization of histologicalsections and by whole mount hybridization of E9.5–11.5 VCFS/DGS is a common developmental disorder that

results from haploinsufficiency of a part of human chro-embryos. No signals were detected for Wdvcf andGp1bb in these embryos and Pnutl was expressed in mosome 22. Among the most common phenotypes

found in VCFS/DGS patients are cardiovascular anoma-the developing nervous tissue (results not shown). Incontrast, Tbx1 was expressed in the core mesenchyme lies. Since many of the organ systems affected in VCFS/

DGS patients are of neural crest origin, the syndromeof the pharyngeal arches surrounding the aortic archarteries, the mesenchyme near the paired dorsal aortae is considered a developmental disorder resulting from

deficiency or improper migration of neural crest cells.to the pharynx and the cells surrounding the aortic archarteries (Figure 5). Taken together, these results sug- To understand the genetic etiology and to generate a

Cell626

Figure 6. Strategy to Generate a Null Muta-tion in the Mouse Tbx1 Gene

Hygro refers to a selection cassette con-taining PGK-Hygro and pNeo.

mouse model of VCFS/DGS, we generated mice carrying also showed that a large proportion of the Lgdel/1 micehad parathyroid abnormalities. Both cardiac and para-two deletions. One of them is designated Lgdel and

encompasses a 1.5 Mb region (this report). The other thyroid phenotypes can be explained by an alterationin the fate of cardiac neural crest cells during em-deletion designated Idd-Arvcf deletion covers a 550 kb

region (Puech et al., 2000). bryogenesis. During gestation, pairs of branchial archarteries form and all of the caudal arch arteries developWe observed that the Lgdel/1 mice have three fea-

tures of VCFS/DGS patients. First, there is a significant symmetrically until around E11.5. They then undergodramatic remodeling to establish the embryonic asym-perinatal lethality among the Lgdel/1 mice. Most cases

of DGS are incompatible with life (DiGeorge, 1965; Finley metric circulatory system. This remodeling process in-cludes the asymmetrically programmed regression andet al., 1977; Conley et al., 1979). Careful observation of

the number of newborn pups in each mating and the persistence of specific arch arteries (for reviews seeCreazzo et al., 1998; Sucov, 1998; Epstein and Buck,number that remain after one day suggests that most,

if not all, of the lethality occurs during the first day after 2000). Aortic arch remodeling requires the presence ofcardiac neural crest cells. The cardiovascular pheno-birth. Some of the newborns were cyanotic, suggesting

that death could be related to cardiovascular disorders. types described in the Lgdel/1 embryos can be ex-plained by a failure of remodeling of the fourth and sixthSimilar to most human VCFS/DGS patients, a significant

fraction of Lgdel/1 mice have cardiac conotruncal de- arch arteries. Likewise, portions of the parathyroid glandare derived from the cranial neural crest. In summary,fects. Parathyroid abnormalities, another common fea-

ture of VCFS/DGS, were also observed in Lgdel/1 mice. our results indicate that monosomy for the region fromIdd to Hira impairs normal development of several struc-Based on these results, Lgdel/1 mice can serve as a good

model for at least some of the features of VCFS/DGS. tures derived from the neural crest, the parathyroid/heart, and great vessels emerging from the heart.Four different deletions covering portions of mouse

chromosome 16 homologous to HSA22q11 have now To identify the critical region harboring the gene(s)responsible for the conotruncal defects observed in thebeen described (Kimber et al., 1999; Lindsay et al., 1999;

Puech et al., 2000; and this report). The largest of these Lgdel/1 mice, we attempted to complement this dele-tion by breeding Lgdel/1 mice with mice carrying ais the Idd-Hira deletion described here and the second

largest is the deletion of the Dgs-i-Ufd1l region (Df1) duplication of the region from Idd to Arvcf and with micecontaining BAC transgenes of the region from TMVCF(Lindsay et al., 1999). Df1/1 mice show perinatal lethality

although with a lower frequency than that observed in to NLVCF (Figure 1B). We showed that neither the dupli-cation of the region from Idd to Arvcf nor additionalLgdel/1 mice. Since five more genes are hemizygous

in the Lgdel/1 mice, it is possible that the increased copies of the region from TMVCF to NLVCF or fromTRXR2 to ARVCF can partially rescue the phenotypelethality is the result of the deletion of these additional

genes. The other two smaller deletions did not cause observed in the Lgdel/1 mice. These results indicatethat the gene(s) responsible for cardiac outflow defectsperinatal lethality in the hemizygous state (Kimber et al.,

1999; Puech et al., 2000). Taken together, these results and neonatal lethality is located in a region of about 200kb containing four known genes, WDVCF, TBX1, GP1Bb,suggest that haploinsufficiency of the region from Arvcf-

Ufd1l is sufficient to result in perinatal lethality. and PNUTL. This view was substantiated by the obser-vation that a substantial proportion of transgenic miceWe observed that 47% of E18.5 Lgdel/1 embryos

had cardiovascular defects (Figures 3B–3F). Most of the containing the BAC with these four genes die soon afterbirth and cardiac and conotruncal defects can be de-vascular anomalies seen in the Lgdel/1 embryos have

also been observed in VCFS/DGS patients (Shprintzen tected. Previously, mice with a mutation in Gp1bb havebeen described. They were shown to mimic a humanet al., 1985; Goldberg et al., 1993; Ryan et al., 1997). We

Important Role for TBX1 in VCFS/DGS627

Figure 7. Conotruncal Defects in Tbx1 1/2 Mouse Embryos

(A) Abnormal origin of the right subclavian artery (RSA) is noted in this embryo (arrowhead). Note the unusually distal bifurcation of the rightinnominate artery into the RSA and the right common carotid artery (RCC) and the medial direction of the proximal RSA. AAo 5 ascendingaorta.(B) Retroesophageal RSA is evident (arrowheads). The RSA arises from the descending aorta just distal to the origin of the left subclavianartery (LSA) and travels posteriorly to the right forelimb.(C) Complete interruption of the aortic arch with retroesophageal RSA is evident in this embryo in which the right ventricle injection only isshown. The main pulmonary artery (PA) is indicated giving rise to the right and left pulmonary arteries (RPA and LPA) and to the ductusarteriosus (DA). This injection fills the descending aorta as well as the subclavian arteries. The RSA arises from the descending aorta andtravels posteriorly (arrowheads). The aortic arch is not filled by this injection. The proximal ascending aorta arising from the left ventricle gaverise to the carotid arteries (not shown). Mixing of blue and red colors in this cast indicates the presence of a ventricular septal defect.(D) Right posterior oblique view reveals the origin of the RSA from the proximal PA at the point where the PA bifurcates into RPA and LPA.Normally, the RSA arises from the right innominate artery, which bifurcates in to RCC and RSA. LCC is left common carotid. AAo is ascendingaorta.

autosomal recessive bleeding disorder Bernard-Soulier early embryogenesis in the pharyngeal arches, pouches,and otic vesicle (Chapman et al., 1996; Chieffo et al.,syndrome. This syndrome bears no resemblance to

VCFS/DGS (Ware et al., 2000). Of the three remaining 1997). The Tbx genes are a family of dosage-sensitivegenes and two of its members have been associatedgenes, Wdvcf is a WD40 repeat containing gene that is

ubiquitously expressed at low levels in a variety of hu- with dominant human disorders. Mutations in TBX5 re-sult in Holt-Oram syndrome that is associated with heartman and mouse adult and fetal tissues (Funke et al.,

2001). The Pnutl gene also referred to as Cdcrel-1 is defects (Basson et al., 1997; Li et al., 1997; Basson et al.,1999). Tbx3 mutations cause mammary-ulnar syndromeexpressed predominantly in the nervous system (Maldo-

nado-Saldivia et al., 2000) and is suggested to be in- (Bamshad et al., 1997).To test the involvement of TBX1 in the phenotypesvolved in the regulation of synaptic vesicle function

(Beites et al., 1999). It is not expressed in the pharyngeal associated with VCFS/DGS, we generated mice with anull mutation in this gene. Mice that are hemizygousarches or outflow tract of the heart, suggesting that

this gene may not be responsible for the conotruncal for the Tbx1 mutation had cardiovascular phenotypessimilar to those in the Lgdel/1 mice and in VCFS/DGSanomalies in the Lgdel/1 mice. Tbx1 is a member of a

phylogenetically conserved family of genes that share patients. These results clearly show that TBX1 plays acritical developmental role in the formation of at leasta common DNA binding domain, termed the T box. T

box genes are transcription factors involved in the regu- some of the organ systems derived from neural crestincluding the cardiovascular system.lation of developmental processes. Tbx1 is expressed

across a wide range of embryonic stages from blasto- It has to be noted that neither the Tbx1 mutant hetero-zygotes nor the Lgdel/1 mice have all of the phenotypescyst through gastrulation and early organogenesis

(Chapman et al., 1996). Mouse Tbx1 is expressed during observed in VCFS/DGS patients. The involvement of

Cell628

BACSP6-F (GCTGCAGATCCCTAAACAGC) and BAC probe-R (AGCother linked or unlinked genes in the manifestation of allGCTATATGCGTTGATGC) were used to generate a PCR productof the phenotypes seen in VCFS/DGS patients requiresfrom the SP6 end of the same vector that was also used as a probeadditional investigation.for genomic Southern analysis (see below). FVB or C57B1/6 micewere used to establish colonies from the founder animals.

Experimental Procedures

Analysis of Embryos and MiceGeneration of Idd and Hira Heterozygous MiceMice were kept on a 12 hr light/dark cycle and noon of the plugTwo separate targeting vectors for the Idd and the Hira locus weredate was considered as 0.5 d.p.c. DNA for genotyping was preparedconstructed to generate an in vivo deletion of the chromosomalfrom tail using the DNeasy Tissue Kit from Qiagen and following theregion between Idd and Hira in mice.instructions of the manufacturer.In one, the Idd locus was disrupted by homologous recombination

resulting in the deletion of a 2 kb segment including Idd exons 4Genotyping by PCRand 5 (Puech et al., 2000; Figure 2A) and in the second, the HiraThe following primers were used for genotyping of the mice andlocus was disrupted by deleting a 1.5 kb region including the 39 partembryos:of exon 8 (A. W.-B. and P. S., unpublished data; Figure 2A).

PGK1, GCTAAAGCGCATGCTCCAGAC; Neo5F, ACCGCTATCAGA PGKNeo cassette and a loxP site in the same orientation haveGACATAGCGT;also been included in both targeting vectors. The vectors were trans-

Idd-KO1, CTGTTGTTGACACAGCACATG; 6x32t3, AACTCTACCTfected separately into embryonic stem (ES) cells and ES cell clonesGTTCCTACTG;bearing the mutant alleles were used to generate chimeric mice.

Idd-KO2, CACGTTGTCATTCTCAGACATG; HiraR1, GTGATGCHeterozygous offspring for both mutant alleles were generated byTAGTCTCTAGCTG;further crossing the chimeric founders with B6 females.

HiraF1, TCTTGCAACTCTGAGAGGTC; CreF, GGACATGTTCAGGGATCGCCAGGCG; CreR, GCATAACCAGTGAAACAGCATTGCTG.Tbx1 Gene TargetingThe primers were combined as follows (Figure 2C): Idd-KO2/Neo5FThe genomic sequence of Tbx1 (GenBank Accession numberor Idd-KO1/PGK1 for identification of a homologous recombinationAC003066) was used to generate an exon/intron and restrictionevent at the Idd locus, Idd-KO1/6x32t3 for amplification of the Iddenzyme map. A 13 kb SpeI-EcoRV fragment from BAC 213A6 (RPCIwild-type allele, HiraF1/Neo5F for identification of a homologous21; http://www.chori.org/bacpac/) containing Tbx1 exon 1 throughrecombination event at the Hira locus, and HiraF1/HiraR1 for amplifi-part of exon 6 was subcloned into pZErO-2 (Invitrogen). The plasmid

was digested with AatII and NruI to release a 4.9 kb Tbx1 genomic cation of the Hira wild-type allele. To amplify the junction fragmentfragment including exons 1 and 2 (exon 2 contained the ATG). This of the Idd and Hira target vectors after a deletion event, the primersinterval was blunt-ended and replaced with a hygromycin resistance PGK1/Neo5F were used. Cre-F/Cre-R primers were used for amplifi-cassette. To generate the targeted embryonic stem (ES) cell clones, cation of the Cre transgene. 7 ul of DNA was used as a template in30 ug of linearized targeting vector was electroporated into 2.5 3 the PCR reaction. The PCR conditions were 948C for 4 min, one107 WW6 ES cells and selected for hygromycin resistance. Colonies cycle; 588C for 45 s, 728C for 45 s, and 948C for 30 s (35 cycles);were picked after ten days and their DNA was screened by PCR 728C for 1 min, one cycle.using the forward primer from the hygromycin cassette, 59-AGGTCCCTCGAAGAGGTTCA-39 and reverse primer from exon 6, 59-GTC Corrosion CastsCACATAGACAACATGGAA-39. The reaction was performed using Embryos were isolated of 18.5 days pregnant B6 females insemi-the Expand Long Template PCR System for amplification of a 3.2 nated by Lgdel/1 males and the heart exposed by a thoracic incisionkb product (Buffer 3; Roche Pharmaceuticals). Chimeric mice were and rib removal. Batson no. 17 acrylic (Polysciences, Inc) was in-generated by injecting C57Bl/6 blastocysts with 8–12 ES cells de- jected into the right and left ventricle until the entire embryonicrived from clone 7D6 or 1C3. Both lines gave rise to male chimeric vasculature was filled. After hardening, the tissue was removed withanimals that were mated with C57Bl/6 females. Germline transmis- Maceration Solution (Polysciences, Inc) at 508C for 72 hr. Photo-sion was demonstrated by genomic Southern blot analysis to detect graphs were obtained digitally and processed with Photoshopthe rearranged Tbx1 locus. F1 heterozygotes were used in the software.analysis.

Analysis of Thyroid and Parathyroid GlandsScreening of the BAC Library Mice were sacrificed at E18.5. The thyroid gland (with associatedHigh-density gridded membranes containing a BAC library (RPCI 11, parathyroids) of each animal was completely resected with associ-170 kb average insert size, 253 fold redundant; http://www.chori. ated trachea, fixed and embedded in paraffin. Paraffin blocks wereorg/bacpac) were screened with 32P-labeled (random primed DNA completely sectioned at 4–5 mm. At most, only a few sections werelabeling Kit, Boehringer Mannheim Corp.) PCR products correspond

lost during cutting on the microtome. Sections were stained withto six different loci within the distal half of the 1.5 Mb region deleted

hematoxylin and eosin, and examined at 203 magnification for thein VCFS/DGS patients. The positive clones were isolated and DNA

presence of easily identified parathyroid glands anywhere withinwas prepared (Qiagen Corp.). The ends of the identified clones were

the thyroid sections. One hundred to 125 sections were examinedsequenced using ABI377 automated sequencing machines. Each

for each animal.sequence was compared to those in GenBank (http://www.ncbi.nlm.nih.gov/BLAST/) to determine the exact size and location

Immunofluorescence Staining and Flow Cytometric Analysisof the BACs in the genomic sequence of chromosome 22.Thymocytes (1 3 106) were rinsed with flow cytometry buffer (HANKSsolution containing 0.1% bovine serum albumin and 0.1% sodiumPurification of BAC DNA and Generation of Transgenic Miceazide), pelleted by centrifuge, and doubly stained with phycoer-BAC DNA was isolated using an alkaline lysis and cesium chlorideythrin(PE)-labeled anti-CD4 mAb (PharMingen, San Diego, CA) andgradient ultracentrifugation protocol. Rnase-treated DNA was fur-FITC-conjugated anti-CD8 mAb (PharMingen) on ice for 20 min.ther purified using the Endo-free Plasmid Maxi Kit (Gibco, BRL). Trans-Cells were then washed twice with staining flow cytometry buffer.fer into injection buffer was achieved by passing the DNA over aCells were singly stained with FITC-conjugated anti-CD3 epsilonSepharose CL4b-column (Pharmacia) that was equilibrated with injec-chain mAb (PharMingen). After washing, cells were fixed with 2%tion buffer (10 mM Tris HCl, pH 7.5; 0.1 mM EDTA; 100 mM NaCl).paraformaldehyde in PBS. Stained cells were analyzed on EpicsCircular BAC DNA was injected into the pronucleus of fertilizedflow cytometer (Coulter, Miami, FL).FVB zygotes at a concentration of 3 ng/ml. The Transgenics and

Gene Targeting Facility of the Albert Einstein College of MedicineAcknowledgmentsperformed all injections. Founders were identified by two methods:

Primers BACT7-F (AATGCTCATCCGGAGTTCC) and BACT7-R (ACTThe work described here was inspired by Robert Shprintzen andGGTGAAACTCACCCAGG) were used to amplify the T7 end of BAC

vector pBACe3.6 (http://www.chori.org/bacpac/home.htm). Primers Rosalie Goldberg. We thank J. Horner and K. Chen for microinjec-

Important Role for TBX1 in VCFS/DGS629

tions, L. Edelmann and T. Van De Water for scientific discussions, Kimber, W.L., Hsieh, P., Hirotsune, S., Yuva, P.L., Sutherland, H.F.,Chen, A., Ruiz, L.P., Hoogstraten, M.S., Chien, K.R., Paylor, R., et al.and J. Sterio for technical assistance. This work is supported by

grants from the NIH (HD34980 to R. K., B. E. M., and A. I. S.; HL (1999). Deletion of 150 kb in the minimal DiGeorge/velocardiofacialsyndrome critical region in mouse. Hum. Mol. Genet. 8, 2229–2237.61475, HL 62974 to J. A. E.; AI01472 to R. J. X.), the WW Smith

Chartitable Trust (J. A. E.), the American Heart Association (B. M.), Kirby, M.L., and Waldo, K.L. (1990). Role of neural crest in congenitalthe British Heart Foundation (P. J. S.), and the Deutsche Forschungs- heart disease. Circulation 82, 332–340.gemeinschaft (H. S.). Kirby, M.L., Gale, T.F., and Stewart, D.E. (1983). Neural crest cells

contribute to normal aorticopulmonary septation. Science 220,Received January 3, 2001; revised January 29, 2001. 1059–1061.

Le Douarin, N.M. (1981). The Neural Crest. (Cambridge, MA: Cam-Referencesbridge University Press).

Lewandoski, M., Wassarman, K.M., and Martin, G.R. (1997). Zp3-Basson, C.T., Bachinsky, D.R., Lin, R.C., Levi, T., Elkins, J.A., Soults,cre, a transgenic mouse line for the activation or inactivation ofJ., Grayzel, D., Kroumpouzou, E., Traill, T.A., Leblanc, S.J., et al.loxP-flanked target genes specifically in the female germ line. Curr.(1997). Mutations in human TBX5 cause limb and cardiac malforma-Biol. 7, 148–151.tion in Holt-Oram syndrome. Nat. Genet. 15, 30–35.Li, Q.Y., Newbury, E.R., Terrett, J.A., Wilson, D.I., Curtis, A.R., Yi,Basson, C.T., Huang, T., Lin, R.C., Bachinsky, D.R., Weremowicz,C.H., Gebuhr, T., Bullen, P.J., Robson, S.C., Strachan, T., et al.S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G., et(1997). Holt-Oram syndrome is caused by mutations in TBX5, aal. (1999). Different TBX5 interactions in heart and limb definedmember of the Brachyury (T) gene family. Nat. Genet. 15, 21–29.by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci. USA 96,

2919–2924. Lindsay, E.A., Botta, A., Jurecic, V., Carattini, R.S., Cheah, Y.C.,Rosenblatt, H.M., Bradley, A., and Baldini, A. (1999). CongenitalBamshad, M., Lin, R.C., Law, D.J., Watkins, W.C., Krakowiak, P.A.,heart disease in mice deficient for the DiGeorge syndrome region.Moore, M.E., Franceschini, P., Lala, R., Holmes, L.B., Gebuhr, T.C.,Nature 401, 379–383.et al. (1997). Mutations in human TBX3 alter limb, apocrine and

genital development in ulnar-mammary syndrome. Nat. Genet. 16, Maldonado-Saldivia, J., Funke, B., Pandita, R.K., Schuler, T., Mor-311–315. row, B.E., and Schorle, H. (2000). Expression of cdcrel-1 (Pnutl1), a

gene frequently deleted in velo-cardio-facial syndrome/DiGeorgeBeites, C.L., Xie, H., Bowser, R., and Trimble, W.S. (1999). The septinsyndrome. Mech. Dev. 96, 121–124.CDCrel-1 binds syntaxin and inhibits exocytosis. Nat. Neurosci. 2,

434–439. McKie, J.M., Sutherland, H.F., Harvey, E., Kim, U.J., and Scambler,P.J. (1997). A human gene similar to Drosophila melanogaster pea-Bockman, D.E., and Kirby, M.L. (1984). Dependence of thymus de-nut maps to the DiGeorge syndrome region of 22q11. Hum. Genet.velopment on derivatives of the neural crest. Science 223, 498–500.101, 6–12.Bockman, D.E., Redmond, M.E., Waldo, K., Davis, H., and Kirby,Morrow, B., Goldberg, R., Carlson, C., Das, G.R., Sirotkin, H., Collins,M.L. (1987). Effect of neural crest ablation on development of theJ., Dunham, I., O’Donnell, H., Scambler, P., Shprintzen, R., et al.heart and arch arteries in the chick. Am. J. Anat. 180, 332–341.(1995). Molecular definition of the 22q11 deletions in velo-cardio-Carlson, C., Sirotkin, H., Pandita, R., Goldberg, R., McKie, J., Wadey,facial syndrome. Am. J. Hum. Genet. 56, 1391–1403.R., Patanjali, S.R., Weissman, S.M., Anyane, Y.K., Warburton, D., etPuech, A., Saint-Jore, B., Merscher, S., Russell, R.G., Cherif, D.,al. (1997). Molecular definition of 22q11 deletions in 151 velo-cardio-Sirotkin, H., Xu, H., Factor, S., Kucherlapati, R., and Skoultchi, A.I.facial syndrome patients. Am. J. Hum. Genet. 61, 620–629.(2000). Normal cardiovascular development in mice deficient for 16Chapman, D.L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S.I.,genes in 550 kb of the velocardiofacial/DiGeorge syndrome region.Gibson, B.J., Cebra, T.J., Bollag, R.J., Silver, L.M., and Papaioannou,Proc. Natl. Acad. Sci. USA 97, 10090–10095.V.E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, duringRyan, A.K., Goodship, J.A., Wilson, D.I., Philip, N., Levy, A., Seidel,early mouse development. Dev. Dyn. 206, 379–390.H., Schuffenhauer, S., Oechsler, H., Belohradsky, B., Prieur, M., etChieffo, C., Garvey, N., Gong, W., Roe, B., Zhang, G., Silver, L.,al. (1997). Spectrum of clinical features associated with interstitialEmanuel, B.S., and Budarf, M.L. (1997). Isolation and characteriza-chromosome 22q11 deletions: a European collaborative study. J.tion of a gene from the DiGeorge chromosomal region homologousMed. Genet. 34, 798–804.to the mouse Tbx1 gene. Genomics 43, 267–277.Scuccimarri, R., and Rodd, C. (1998). Thyroid abnormalities as aConley, M.E., Beckwith, J.B., Mancer, J.F., and Tenckhoff, L. (1979).feature of DiGeorge syndrome: a patient report and review of theThe spectrum of the DiGeorge syndrome. J. Pediatr. 94, 883–890.literature. J. Pediatr. Endocrinol. Metab. 11, 273–276.

Creazzo, T.L., Godt, R.E., Leatherbury, L., Conway, S.J., and Kirby,Shprintzen, R.J., Goldberg, R.B., Lewin, M.L., Sidoti, E.J., Berkman,M.L. (1998). Role of cardiac neural crest cells in cardiovascularM.D., Argamaso, R.V., and Young, D. (1978). A new syndrome involv-development. Annu. Rev. Physiol. 60, 267–286.ing cleft palate, cardiac anomalies, typical facies, and learning dis-

DiGeorge, A. (1965). A new concept of the cellular basis of immunity. abilities: velo-cardio-facial syndrome. Cleft Palate J. 15, 56–62.J. Pediatr. 67, 907–908.

Shprintzen, R.J., Wang, F., Goldberg, R., and Marion, R. (1985). TheDunham, I., Shimizu, N., Roe, B.A., Chissoe, S., Hunt, A.R., Collins, expanded velo-cardio-facial syndrome (VCF): additional features ofJ.E., Bruskiewich, R., Beare, D.M., Clamp, M., Smink, L.J., et al. the most common clefting syndrome. Am. J. Hum. Genet. 37, A77.(1999). The DNA sequence of human chromosome 22. Nature 402,

Sucov, H.M. (1998). Molecular insights into cardiac development.489–495.Annu. Rev. Physiol. 60, 287–308.

Epstein, J.A., and Buck, C.A. (2000). Transcriptional regulation ofVan Mierop, L.H., and Kutsche, L.M. (1986). Cardiovascular anoma-cardiac development: implications for congenital heart disease andlies in DiGeorge syndrome and importance of neural crest as aDiGeorge syndrome. Pediatr. Res. 48, 717–724.possible pathogenetic factor. Am. J. Cardiol. 58, 133–137.

Finley, J.P., Collins, G.F., de Chadarevian, J.P., and Williams, R.L.Ware, J., Russell, S., and Ruggeri, Z.M. (2000). Generation and res-(1977). DiGeorge syndrome presenting as severe congenital heartcue of a murine model of platelet dysfunction: the Bernard-Soulierdisease in the newborn. Can. Med. Assoc. J. 116, 635–640.syndrome. Proc. Natl. Acad. Sci. USA 97, 2803–2808.

Funke, B., Pandita, R.K., and Morrow, B.E. (2001). Isolation andYagi, M., Edelhoff, S., Disteche, C.M., and Roth, G.J. (1994). Struc-characterization of a novel gene containing WD40 repeats from thetural characterization and chromosomal location of the gene encod-region deleted in velo-cardio-facial/DiGeorge syndrome on chromo-ing human platelet glycoprotein Ib beta. J. Biol. Chem. 269, 17424–some 22q11. Genomics, in press.17427.

Goldberg, R., Motzkin, B., Marion, R., Scambler, P.J., and Shprint-zen, R.J. (1993). Velo-cardio-facial syndrome: a review of 120 pa-tients. Am. J. Med. Genet. 45, 313–319.