Taxonomic study of stripe rust, Puccinia striiformis sensu lato, based on molecular and...

f u n g a l b i o l o g y 1 1 4 ( 2 0 1 0 ) 8 8 1e8 9 9

journa l homepage : www.e lsev ier . com/ loca te / funb io

Taxonomic study of stripe rust, Puccinia striiformis sensu lato,based on molecular and morphological evidence

Miao LIU1, Sarah HAMBLETON*

Biodiversity (Mycology and Botany), Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 Carling Avenue,

Ottawa K1A 0C6, Canada

a r t i c l e i n f o

Article history:

Received 23 June 2009

Received in revised form

17 August 2010

Accepted 18 August 2010

Available online 26 August 2010

Corresponding Editor:

Joseph W. Spatafora

Keywords:

Basidiomycota

Phylogenetic analysis

Pucciniales

Yellow rust

* Corresponding author. Tel.: þ1 613 759 1769E-mail addresses: [email protected] (M

1 Current address: Cereal Disease Laborato1878-6146/$ e see front matter CrownCopyrigdoi:10.1016/j.funbio.2010.08.005

a b s t r a c t

Phylogenetic analyses of ITS and b-tubulin DNA sequences for 30 Puccinia striiformis speci-

mens from wide geographic and host ranges revealed four strongly supported monophy-

letic lineages. Based on comparisons of morphological characteristics, and after

consideration of previous classifications, the lineages were recognized as P. striiformis sensu

stricto, Puccinia pseudostriiformis, Puccinia striiformoides and one new species, Puccinia gansen-

sis. A new series (Puccinia Series Striiformis) was erected to accommodate this strongly sup-

ported monophyletic group of four species within Puccinia. Expanded descriptions,

illustrations and a tabular identification key are provided. The morphological differences

among species are subtle but host association and combinations of other characters can

be used successfully for identification. Puccinia striiformis s.str. has the widest host range,

within the tribe Triticeae (Aegilops, Elymus, Hordeum and Triticum) but it is less diverse

than previously documented. The other three species are restricted to single genera in

Poeae (P. pseudostriiformis on Poa; P. striiformoides on Dactylis) or Stipeae (P. gansensis on Ach-

natherum). Urediniospore size and surface echinulation, especially as seen by SEM, germ

pore number, shape of uredinial paraphyses, and teliospore hilumwidth were themain fea-

tures used to differentiate species. Relying solely on the symptomof linearly aligned uredinia

on chlorotic stripes on leaves, fromwhich the commonname “stripe rust” was derived, is not

recommended because sori of other leaf rust species may also form in a linear series.

Crown Copyright ª 2010 Published by Elsevier Ltd on behalf of The British Mycological Society.

All rights reserved.

Introduction epidemiology, disease forecasting, interaction of virulence

Stripe rust of wheat, commonly referred to as Puccinia striifor-

mis f. sp. tritici, has been the focus ofmuch research because of

the economic importance of wheat products. Over the last

century, progress wasmade in our understanding of the path-

ogen through studies covering almost all aspects of the dis-

ease, i.e. plant breeding for resistance cultivars,

; fax: þ1 613 759 1701.. Liu), sarah.hambleton@

ry, 1551 Lindig Ave., St. Phtª 2010 Published by Else

and resistance, virulence spectrum, and genetic diversity

(see reviews by Wellings & McIntosh 1990; Roelfs et al. 1992;

McIntosh & Brown 1997; Line 2002; Yahyaoui et al. 2002; Wan

et al. 2007). In contrast, other infraspecific forms of P. striiformis

sensu lato (s.l.) have received less attention and subspecific

classification of the species has been fragmentary, and in

some cases contradictory. A comprehensive and formal

agr.gc.ca (S. Hambleton)

aul. MN 55108, USA.vier Ltd on behalf of The BritishMycological Society. All rights reserved.

mailto:[email protected]

mailto:[email protected]

http://www.elsevier.com/locate/funbio

http://dx.doi.org/10.1016/j.funbio.2010.08.005



882 M. Liu, S. Hambleton

assessment of these classifications is needed, incorporating

phylogenetic analyses of DNA sequence data. One study in

2005 included ITS sequence analyses but was limited in taxo-

nomic and geographic scope (Abbasi et al. 2005 [2004]). Other

DNA-based studies published so far have used randomly am-

plified polymorphic DNA (RAPD) or amplified fragment length

polymorphism (AFLP) (Becerra et al. 2007; Hovmøller &

Justesen 2007).

The fungus now known as P. striiformis s.l. was first de-

scribed as Uredo glumarum by Schmidt, probably before 1819

according to Eriksson & Henning (1896) although they also

cite a later publication by Schmidt (1827), for the uredinial

form of the fungus. The teleomorph was described twice, as

Puccinia striaeformis Westend. 1854, and as Puccinia glumarum

Eriks. & Henn. 1894. Stubbs (1985) noted that the name

P. glumarum was in use until Hylander et al. (1953), and later

Cummins & Stevenson (1956), correctly applied the name

used by Westendorp, with the orthographic correction to

P. striiformis. An earlier teleomorph name Trichobasis glumarum

Lev. 1848 [1849] is invalid because the combinations were not

formally made (ICBN, Art. 33.1, McNeill et al. 2006).

Although assumed to have a macrocyclic, heteroecious life

cycle, pycnia and aecia were not documented for P. striiformis

s.l. until very recently, on Berberis spp. (Jin et al. 2010). Herbar-

ium and literature records based upon the uredinial and telial

stages suggest that P. striiformis s.l. can naturally or artificially

infect 320 grass species classified in 50 genera, in ten tribes

and three subfamilies of the grass family, Poaceae

(Hassebrauk 1965). The most susceptible genera are Aegilops,

Agropyron, Bromus, Elymus, Hordeum, Secale and Triticum

(Stubbs 1985). Eriksson & Henning (1894) originally divided

the species into five formae speciales (f. sp.), correlated with

five of the genera listed above, i.e. f. sp. agropyri, elymi, hordei,

secalis, and tritici. These subdivisions were criticized by Sydow

& Sydow (1904), Newton & Johnson (1936) and Straib (1935,

1936) (all of these authors used the name P. glumarum) because

inoculation experiments showed that host ranges overlapped

among the forms. More recently, cross-inoculations using

stripe rust samples fromwheat and various wild grasses dem-

onstrated that isolates from Agropyron, Bromus, Elymus, Hor-

deum and Triticum produce identical symptoms on wheat

and consequently they all appeared to belong to the same sub-

specific taxon (Tollenaar & Houston 1967).

On the other hand, inoculation studies showed that the

form on blue grass (Poa pratensis) and the form on orchard

grass (Dactylis glomerata) exhibit distinct host specificity and

multiple authors suggested that both should be recognized

as separate taxa (Manners 1960; Tollenaar & Houston 1967).

Manners (1960) formalized this distinction and proposed the

name P. striiformis var. dactylidis, observing that it differs mor-

phologically from the type variety by having smaller uredinio-

spores. The form on Poa was recognized only as a formae

specialis because of the lack of detailed morphological differ-

ences (Tollenaar & Houston 1967) although Niks (1989) later

suggested the form should be ranked as a variety based on

his discovery of distinct infection structures. Although widely

used for host-restricted rusts and other parasitic fungi, the

names for formae speciales are not governed by the ICBN

(Art. 4, Note 4, McNeill et al. 2006) and therefore the priority

of such names is not considered, nor does it affect other ranks

of subspecific names. However, as a consequence under Art.

26.1, the recognition of P. striiformis var. dactylidis by

Manners (1960) automatically established the varietal name

P. striiformis var. striiformis as an autonym, to be cited without

any authority. In a recent study, Abbasi et al. (2005 [2004]) sam-

pled four P. striiformis specimens from Iran for phylogenetic

analysis, one from each of four hosts: D. glomerata, Hordeum

geniculatum, P. pratensis and Triticum aestivum. The collections

on wheat and barley clustered together, while the two speci-

mens on D. glomerata and P. pratensis branched separately.

Based on this evidence, aswell asmorphological assessments,

P. striiformis was divided into three species: P. striiformis sensu

stricto (s.str.), Puccinia pseudostriiformis (on Poa) and Puccinia

striiformoides (on Dactylis). In contradiction, DNA polymor-

phism (RAPD) analyses by Chen et al. (1995) provided evidence

that the taxa on wheat and barley were genetically distinct

from each other.

The objective of this study was to assess taxonomic treat-

ments of P. striiformis s.l., based on an extensive sampling of

morphological characters and DNA sequences. Specimens

from eight international herbaria were obtained to maximize

geographic origin and host range, supplemented with new

collections from the field. Phylogenetic analyses were con-

ducted for two gene regions, nuclear rRNA internal tran-

scribed spacer (ITS) and b-tubulin (BT), to define taxa and

their host ranges in the P. striiformis species complex. Detailed

illustrations and a tabular key are presented to facilitate iden-

tifications of each taxon.

Material and methods

Fungal specimens

Fungal specimens were obtained either from herbaria or as

new collections from the field. Eight international herbaria

loanedmaterial (see Table 1 footnotes for list) and all new col-

lections were deposited in National Mycological Herbarium in

Ottawa, Canada (DAOM) except for three held as DNA extracts

only. Herbarium voucher numbers, plant host, origin, year col-

lected and GenBank accession numbers for specimens suc-

cessfully sequenced in this study and included in the

analyses are listed in Table 1. Host identifications are listed

as determined by the original collector, except for PUR

N5378 (see footnote “e” in Table 1).

Genomic DNA extraction

Small pieces of rust-infected plantmaterial, 1e4� 0.1e0.8 cm,

were used for molecular analyses. Efforts were made to sam-

ple highly infected areas to minimize the amount of plant tis-

sue included. Selected pieces were excised from each

specimen, after cleaning by gentle wiping using a Kimwipe

(KimTech, Inc., Louisville, KY) wetted with 75 % ethanol to

remove any accidental contaminating organisms on the sur-

face of the plant tissue. DNA was extracted using the

E.Z.N.A. Fungal DNA Extraction Kit (Omega Bio-Tek, Inc., Nor-

cross, GA), with some minor modifications to the manufac-

turer’s protocol, as follows. The selected plant material with

fungal sori was put into handmade Lysing Matrix tubes,

Table 1 e List of fungal specimens used in the phylogenetic analyses.

Voucher numbera Fungus name(P.¼ Puccinia)

Host Origin Collection date GenBank accession

ITSf b-Tubulin

Series Striiformis

DAOM 240065 (T)b P. gansensis Achnatherum inebrians China 1998 HM057115 HM067986

DAOM 220657c P. pseudostriiformis Poa pratensis Canada Sep. 1996 HM057113 HM067984

PUR N5368 P. pseudostriiformis Poa pratensis USA May 1956 HM057133 e

PUR 59733c P. pseudostriiformis Poa pratensis Canada Jul. 1969 HM057131 HM067996

PUR N5354 P. pseudostriiformis Poa nemoralis USA Apr. 1956 HM057134 e

PUR F17111 P. striiformis Aegilops ligustica Turkey Jun. 1960 HM057127 e

PUR 60028c P. striiformis Elymus elymoides USA Sep. 1963 HM057130 HM067995

BPI 195217 P. striiformis Hordeum comosum Argentina Feb. 1970 HM057136 e

PUR N1249 P. striiformis Hordeum jubatum USA Aug. 1993 HM057108 HM067980

K(M) 78118c P. striiformis Hordeum secalinum UK Jun. 2000 HM057124 e

PUR F19515 P. striiformis Hordeum sp. Argentina Feb. 1970 HM057128 HM067994

PUR F15603 P. striiformis Hordeum vulgare India Mar. 1950 HM057126 e

BPI 193871 P. striiformis Triticum aestivum Afghanistan Jul. 1970 HM057135 HM067998

DAOM 240066 P. striiformis Triticum aestivum China 2006 HM057116 HM067987

DAOM 240067 P. striiformis Triticum aestivum China Jun. 2006 HM057117 HM067988




HMAS 79075 P. striiformis Triticum aestivum China Aug. 1996 HM057114 HM067985

PUR 61492 P. striiformis Triticum aestivum USA Aug. 1963 HM057132 HM067997

PUR 66275 P. striiformis Triticum aestivum USA Jun. 1981 HM057112 e

RS 477 P. striiformis Triticum aestivum China 2006 HM057120 e

RS 479 P. striiformis Triticum aestivum China 2006 HM057122 HM067992

RS 480 P. striiformis Triticum aestivum China 2006 HM057123 HM067993

BR MYCO 114717-63 (T)b P. striiformis Unknown cereales Belgium 1854 e HM368437

BPI 199096 P. striiformoides Dactylis glomerata China Aug. 1986 HM057137 HM067999

K(M) 108141 P. striiformoides Dactylis glomerata UK Sep. 1977 HM057125 e

PUR N1254 P. striiformoides Dactylis glomerata Canada Aug. 1994 HM057110 HM067982

PUR N5374 P. striiformoides Dactylis glomerata USA Aug. 1992 HM057111 HM067983

PUR N5383 P. striiformoides Dactylis glomerata Chile Nov. 1966 HM057129 e

PUR N5378 P. striiformoides Dactylis glomeratae USA Aug. 1992 HM057109 HM067981

Outgroup

DAOM 240064 P. coronata s.l. Avena sp. Canada Jul. 2006 HM057140 HM068002

DAOM 240063 P. coronata s.l. Bromus inermus Canada Jul. 2006 HM057139 HM068001

BP 89076 P. coronata s.l. Calamagrostis epigejos Hungary Sep. 1991 HM057141 HM068003

DAOM 183691 P. coronata s.l. Elymus repens Canada Jul. 1982 HM057138 HM068000

PRC 247 P. coronata s.l. Rhamnus saxatilis Slovakia May 2002 HM057142 HM068004

PUR N1189 P. graminis Poa pratensis USA Jun. 2001 HM057143 HM068005

BP 88883 P. graminis Triticum aestivum Hungary Jun. 1993 HM057144 HM068006

DAOM 240068 P. hordei Hordeum vulgare Canada Jul. 2006 HM057147 HM068009

DAOM 193284 P. poarum Poa pratensis Canada Jul. 1983 HM057149 e

DAOM 240188 P. poarum Tussilago farfara Canada Aug. 2006 HM057150 e

BPI 1100377 P. poarum Tussilago farfara Canada 1983 HM057151 e

DAOM 189681 P. poae-nemoralis Arctagrostis latifolia Canada Aug. 1980 HM057153 e

DAOM 240189 P. poae-nemoralis Koeleria litvinowii China Sep. 1996 HM057155 e

DAOM 212041 P. poae-nemoralis Poa pratensis Canada Sep. 1990 HM057152 HM068011

PDD 60181 P. poae-nemoralis Poa annua New Zealand Nov. 1991 HM057154 e

DAOM 192559 P. recondita Triticum aestivum Australia Nov. 1982 HM057145 HM068007

PUR N1253d P. triticina Elymus repens Canada Aug. 1994 HM057146 HM068008

PUR N5371d P. sp Poa secunda USA May 1956 HM057156 e

PUR N5352d P. sp Poa compressa USA Apr. 1956 HM057157 e

DAOM 216236 Uromyces dactylidis Dactylis glomerata Hungary Jul. 1992 HM057148 HM068010

a BP: Hungarian Natural History Museum, BUDAPEST, Hungary; BPI: US National Fungus Collections, BELTSVILLE, Maryland, USA; DAOM:

Agriculture and Agri-Food Canada, Ottawa, Ontario, Canada; HMAS: Institute of Microbiology, Academia Sinica, Beijing, Beijing, People’s Repub-

lic of China; K: Royal Botanic Gardens, Kew, UK, England; PDD: Landcare Research, Auckland, New Zealand; PRC: Charles University in Prague,

Praha, Czech Republic; PUR: Purdue University, West Lafayette, Indiana, USA; RS: three samples held by SH as DNA vouchers only.

b T¼ type specimen.

c Four specimens belonging to Series Striiformis but received as: P. brevicornis (PUR 60028), P. gibberosa (PUR 59733), P. graminis (K(M) 78118), and

P. poarum (DAOM 220657).

d Three specimens received as P. striiformis (also listed in Table 2).

e The host was originally identified as Lolium perenne on the specimen label but is re-identified here based on sequence data for the DNA

barcoding gene matK (a maturase-encoding gene located within the intron of the chloroplast trnK gene).

f Deposited sequences comprise either partial ITS1, 5.8S and ITS2 (bold font) or partial 5.8S and ITS2 (regular font).


prepared by adding 180 mg of sterilized sea-sand and two ¼00

Zirconium Oxide Cylinders (Fox Industries, Baltimore, MD)

into 2 ml O-ring microfuge tubes (Molecular Bioproducts,

Inc., San Diego, CA). Samples were soaked in reagent FG1 for

0.5e1 h. Homogenization was done using a FastPrep FP120

Cell Disrupter (Qbiogene, Inc., Carlsbad, CA) for 40 s at speed

5. DNA precipitation tubes were put on ice for over 15 min to

increase yields. DNA pellets were rehydrated in 80e100 ml elu-

tion buffer and stored in �80 �C (voucher aliquots are held by

SH).

PCR amplification and sequencing

Ourmain source of fungal material was from dried herbarium

specimens. Because of the possibility of DNA degradation

from poor initial drying methods or specimen aging, it can

be challenging to amplify long fragments, therefore we tar-

geted shorter fragments. The complete ITS region or the sec-

ond spacer (ITS2) only was amplified by using forward

primer ITS1rustF10d (Barnes & Szabo 2007) or Rust2inv

(Aime 2006) respectively, with the reverse primer ITS4

(White et al. 1990).

PCR was performed in 10 ml reactions containing 0.1 mM

dNTPs (Invitrogen Canada Inc., Burlington, ON), 0.8 pmol of

each primer, 1 ml 10� TitaniumTM Taq buffer, 0.1 ml 50� Tita-

niumTM Taq DNA Polymerase (BD Biosciences, Mississauga,

ON). Touch-down thermal cycling conditions were used:

95 �C for 3 min followed by 10 cycles of 95 �C for 30 s, 63 �C (de-

creasing 0.5 �C per cycle) for 20 s, and 72 �C for 2 min, then

26e30 cycles of 95 �C for 30 s, 58 �C for 20 s, 72 �C for 2 min, fol-

lowed by a final extension of 72 �C for 8 min and hold at 10 �C.Concentrations of dNTPs and primers were optimized to be

completely consumed after 36e40 cycles, therefore PCR prod-

ucts were sequenced without purification (Allain-Boule et al.

2004). Successful amplification of PCR products was assessed

using agarose gel electrophoresis. Weak first-round PCR prod-

ucts were re-amplified as follows. Faint PCR bands were ex-

cised from the gel and the agarose plug frozen briefly in

microfuge tubes at �20 �C. The frozen plug was placed be-

tween two small pieces of parafilm (Pechiney Plastic Packag-

ing, Inc., Chicago, IL), and after melting, a drop of liquid was

collected with a pipette from the plug by squeezing it. One ml

of the liquid was used as template DNA in the second round

amplification (Tautz & Renz 1983). The re-amplification was

performed using Expand High FidelityPlus PCR Taq System

(Roche Applied Science, Indianapolis, IN) in 10 ml reactions

containing 0.2 mM dNTPs, 2 pmol of each primer, 2 ml 5� Ex-

pand High Fidelity PCR buffer, 0.35 units of the Taq enzyme

and 0.8 ml extra 25 mM MgCl2.

To obtain b-tubulin partial sequences, a first-round PCR

was performed using primers B-tub1317f (van der Merwe

et al. 2007) and B-tub2662rm2 (GAAYTCCATCTCGTCCATTC)

and the same touch-down program described above. This

was followed by a second round of PCR: a nested reaction us-

ing B-tub3f (GATCGTATGATGGCCACCTTC, van der Merwe

pers. comm.) and PsBt2QR (TAGCAGTCGAGTTTCCGA-

TAAATG) for Puccinia striiformis s.l.; or a semi-nested reaction

using B-tub3f and B-tub2662rm1 (GAAYTCCATCTCGTC-

CATTCTG) for other species. The new primers B-tub2662rm1

and B-tub2662rm2 were modified from B-tub2662R (van der

Merwe et al. 2007) by comparing the primer sequence with pu-

tative BT homologs extracted from the published P. graminis

whole genome sequence (http://www.broad.mit.edu/annota-

tion/genome/Puccinia_graminis). PsBt2QR was designed as

a species-specific primer for P. striiformis s.l. based on se-

quence differences between the available data for the target

fungus and its close relatives. Products from first-round PCR

were diluted 1:50 before conducting the second round reaction

using the following PCR conditions: 95 for 3 min, followed by

39 cycles of 95 �C for 30 s, 63 �C for 20 s and 72 �C for 2 min,

and final extension at 72 �C for 8 min. For the type specimen

of P. striiformis s.str. (BR e MYCO 114717 e 63), PCR as

described above did not successfully amplify either ITS or BT

regions. Instead, using an unpublished assay developed in-

house (data not shown), a 150 bp BT fragment was amplified

by real-time PCR and sequenced. This 150 bp sequence was

included in the phylogenetic analyses.

PCR products were direct-sequenced using BigDye� Termi-

nator v. 3.1 Cycle Sequencing Reaction Kit (ABI Prism/Applied

Biosystems, Streetsville, ON) in 10 ml sequencing reactions us-

ing the PCR primers (from round two reaction for BT). The re-

action mix included 1.75 ml 5� buffer, 0.5 ml 2.5� BDT

sequencingMix and 1.6 pmol primer. Ampliconswere purified

by ethanol/sodium acetate precipitation and analyzed by Ap-

plied Biosystems 3130�1 Genetic Analyzer (Applied Biosys-

tems, Streetsville, ON).

Sequences were edited using Sequencher� ver 4.8 (Gene

Codes Corporation, Ann Arbor, MI) and compiled using BioEdit

Sequence Alignment Editor 7.0.5.3 (Hall 1999). The compiled

sequences were submitted to a web-based utility (http://

align.genome.jp/mafft/) for alignment by MAFFT ver.5 (Katoh

et al. 2005). The strategy FFT-NS-I was selected. Sequence

alignments were eye-adjusted to correct any obvious mis-

alignment by the computer algorithm.

Phylogenetic analyses

Partitioned and combined data matrices were subjected to

three approaches for phylogenetic analysis: maximum parsi-

mony (MP), baysian (BA) and maximum likelihood (ML). Parsi-

mony analyses were performed in PAUP* 4.0b10 (Swofford

1998). Heuristic searches with 10 replicates of random step-

wise addition and tree bisectionereconnection branch swap-

ping were conducted. Usually the searches became stuck in

a single tree island and exhausted the available computer

memory before completion. Therefore, we conducted

a Ratchet search using PAUPRat (Sikes & Lewis 2001) to explore

more tree islands and increase the possibility of finding the

shortest tree (Nixon 1999). Twenty ratchets were performed,

each with 200 iterations and 15 % characters perturbed. Boot-

strapping analyses were set to run 1000 replicates using the

full heuristic search algorithm, 20 replicates of random step-

wise addition and a TBR setting rearrangement limit of 5000

per replicate. Partition homogeneity test was conducted with

100 replicates of heuristic search.

Bayesian analyses were conducted using MrBayes 3.1

(Huelsenbeck & Ronquist 2001). DNA substitution models for

each gene were estimated with Modeltest 3.6 (Posada &

Crandall 1998). Four chains of 5 000 000 Markov chain Monte

Carlo generations were run. Trees generated before the

http://www.broad.mit.edu/annotation/genome/Puccinia_graminis

http://www.broad.mit.edu/annotation/genome/Puccinia_graminis

http://align.genome.jp/mafft/

http://align.genome.jp/mafft/

Table 2 e Redetermined and excluded specimens based on DNA sequence data.

Name based on DNAanalyses in this study

Voucher numbera Host Host tribec Country Collection date

Puccinia recondita B 70 0012410 Elymus caninus Oryzeae Romania Sep. 1974

Puccinia triticina BP 88134 Aegilops cylindrica Triticeae Hungary Jun. 1992

Puccinia hordei BPI 0105021 Secale cereale Triticeae Japan Nov. 1960

Puccinia hordei BPI 0105109 Triticum aestivum Triticeae France Apr. 1956

Puccinia recondita BR 59352-85 Elymus repens Oryzeae Belgium May 1996

Puccinia triticina BR 67026-96 Triticum aestivum Triticeae Belgium Jul. 1997

Puccinia hordei BR 68612-33 Hordeum murinum Triticeae Belgium Aug. 1997

Puccinia coronata BR 8665 Agropyron coninum Oryzeae Belgium Jul. 1993

Puccinia sp. K(M) 107810 Bromus sterilis Bromeae England Aug. 1998

Puccinia hordei K(M) 78624 Hordeum murinum Triticeae England Aug. 2000

Puccinia graminis PUR 59697 Poa arachnifera Poeae USA May 1956

Puccinia recondita PUR N1028 Elymus repens Oryzeae Canada Aug. 1994

Puccinia coronata PUR N1029 Agrostis sp. Aveneae Canada Aug. 1994

Puccinia sp. PUR N1250 cf Holcus Aveneae Canada Aug. 1994

Puccinia coronata PUR N1251 Holcus lanatus Aveneae USA Aug. 1992


Puccinia triticina PUR N1253b Elymus repens Oryzeae Canada Aug. 1994

Puccinia sp. PUR N5352b Poa compressa Poeae USA Apr. 1956

Puccinia sp. PUR N5371b Poa secunda Poeae USA May 1956

Puccinia coronata PUR N5372 Agrostis cf stolonifera Aveneae USA Aug. 1992

Puccinia sp. PUR N5375 Agropyron repens Triticeae USA Aug. 1992


a B: Botanischer Garten und Botanisches Museum Berlin-Dahlem, Zentraleinrichtung der Freien Universitat Berlin, Berlin, Germany; for other

herbarium abbreviations see Table 1 footnotes.

b Included in phylogenetic analyses as outgroup taxa (also listed in Table 1).

c Classification of host at the tribe level is according to Germplasm Resources Information Network, United States Department of Agriculture,

Agriculture Research Service, Beltsville.

Taxonomic study of stripe rust, P. striiformis s.l. 885

posterior probabilities reached equilibrium were discarded

(burn-in), and the remaining trees were pooled to PAUP* to ob-

tain posterior probabilities by 50 % majority-rule consensus.

Maximum likelihood analyses were performed using GARLI

0.96 (Zwickl 2006) with specified models. Two independent

runs each with 10000000 generations were performed. Boot-

strap replicates were 1000 with default settings.

Morphology

Prior to morphological examination of dried herbarium mate-

rial, specimens were softened in a moist chamber for at least

30 min. Entire fungal sori or clumps of spores were removed

using tweezers and mounted on microscope slides in lactic

acid cotton blue media. All cross-sections were cut free-

hand using a single-edged blade. Slidemountswere examined

using an Olympus BX51 Differential Interference Contrast

Light Microscope (Olympus Canada Inc., Markham, ON). Mac-

roscopic morphology was examined using a Zeiss Discovery

v12 Stereomicrosope (Carl Zeiss MicroImaging GmbH,

Germany). Colors of sori were recorded using Kornerup &

Wanscher (1967). Digital micrographs were taken with an

Olympus DP 70 camera and analyzed by Image-Pro Plus ver-

sion 6.0 Image Processing andAnalysis Software (MediaCyber-

netics, Inc., Bethesda, MD). To observe urediniospore germ

pores, spore masses were mounted in lactic acid cotton blue

followed by slight heating and tapping of the coverslip.

Scanning electron microscopy (SEM) was conducted using

a Philips XL-30E Microscope (FEI, USA). Infected leaf material

from dried herbarium specimens was rehydrated in a moist

chamber for 1e2 h. Small pieces of rehydrated leaf with fungal

sori and spores were mounted on stubs and sputter coated

with Hummer V Sputter Coater (Technics Inc., USA). Photo-

graphs were taken under 7.5 kV, 3 spot, with a working dis-

tance of 7.5 for 3500� magnification or 10 for lower

magnifications 1750� and 875�.

Results

DNA extraction and sequencing

Of 95 specimens received or identified as Puccinia striiformis, 48

weresuccessfully amplifiedandsequenced for the ITS (w50 %).

Seventeen specimens selected as outgroup taxa were also se-

quenced. For some specimens, attempts to sequence the com-

plete ITS region were unsuccessful, therefore approximately

350 bases (bp) including partial 5.8 S and the complete ITS2 re-

gion, were used for subsequent analyses. BLAST searches, of

our in-house reference sequence database and on GenBank

(http://blast.ncbi.nlm.nih.gov/Blast.cgi), and phylogenetic

analyses of the 48 P. striiformis ITS sequences indicated that

22 were misidentified (Table 2), of which three were included

in theanalyses as outgroup fungi (listed inTables 1 and2). Con-

versely for the outgroup species sampled, four specimens re-

ceived as Puccinia brevicornis (PUR 60028), Puccinia gibberosa

(PUR 59733), Puccinia graminis (K(M) 78118), and P. poarum

(DAOM 220657) were re-identified as P. striiformis s.l. (Table 1)

and included in the analyses. These re-identifications were

http://blast.ncbi.nlm.nih.gov/Blast.cgi

PUR N1249 Hordeum jubatum USA 1993PUR 66275 Triticum aestivum USA 1981

HMAS 79075 Triticum aestivum China 1996DAOM 240066 Triticum aestivum China 2006DAOM 240067 Triticum aestivum China 2006DAOM 240069 Triticum aestivum China 2006DAOM 240070 Triticum aestivum China 2006

RS477 Triticum aestivum China 2006DAOM 240071 Triticum aestivum China 2006RS479 Triticum aestivum China 2006RS480 Triticum aestivum China 2006K 78118 Hordeum secalinum UK 2000PUR F15603 Hordeum vulgare India 1950PUR F17111 Aegilops ligustica Turkey 1960PUR F19515 Hordeum sp. Argentina 1970PUR 60028 Elymus elymoides USA 1963PUR 61492 Triticum aestivum USA 1963BPI 0193871 Triticum aestivum Afghanistan 1970BPI 0195217 Hordeum comosum Argentina 1970

DAOM 240065 Achnatherum inebrians China 1998 (T) PUR N5378 Dactylis glomerata USA 1992

BPI 0199096 Dactylis glomerata China 1986PUR N5374 Dactylis glomerata USA 1992K 108141 Dactylis glomerata UK 1977

PUR N1254 Dactylis glomerata Canada 1994PUR N5383 Dactylis glomerata Chile 1966DAOM 220657 Poa pratensis Canada 1996PUR N5368 Poa pratensis USA 1956PUR N5354 Poa nemoralis USA 1956PUR 59733 Poa pratensis Canada 1969

DAOM 212041 P. poae-nemoralis Poa pratensis CanadaDAOM 189681 P. poae-nemoralis Arctagrostis latifolia Canada

PDD 60181 P. poae-nemoralis Poa annua New ZealandDAOM 240189 P. poae-nemoralis Koeleria litvinowii China

DAOM 193284 P. poarum Poa pratensis CanadaDAOM 240188 P. poarum Tussilago farfara CanadaBPI 1100377 P. poarum Tussilago farfara Canada

DAOM 183691 P. coronata Agropyron repens CanadaDAOM 240064 P. coronata Avena sp. CanadaBP 89076 P. coronata Calamagrostis epigejos Hungary

DAOM 240063 P. coronata Bromus inermus CanadaPRC 247 P. coronata Rhamnus saxatilis SlovakiaPUR N1189 P. graminis Poa pratensis USA

BP 88883 P. graminis Triticum aestivum HungaryPUR N5352 P. sp Poa compressa USA

DAOM 192559 P. recondita Triticum aestivum AustraliaPUR N1253 P. triticina Elymus repens Canada

PUR N5371 P. sp Poa secunda USADAOM 240068 P. hordei Hordeum vulgare CanadaDAOM 216236 Uromyces dactylidis Dactylis glomerata Hungary

5 changes

Subclade 1: P. striiformis

Subclade 4: P. gansensis

Subclade 3: P. pseudostriiformis

Subclade 2: P. striiformoides

91/97/97

86/96/100

58/<50/<50

95/95/90

94/98/100

84/99/10084/91/100

70/92/94

100/100/100

100/100/100

85/84/100

91/<50/77

SeriesStriiformis

A

Fig 1 e Phylograms from parsimony analyses based on ITS (A) and b-tubulin (B). The three numbers on the branches are

bootstrap values from MP and ML and posterior probability from Bayesian analyses, respectively. (A) Of 435 characters

included in the analysis, 77 characters were parsimony informative; L[ 249; CI[ 0.602; RI[ 0.842; RC[ 0.507; HI[ 0.398;

G-fit[L58.555. (B) Of 867 characters included in the analysis, 228 characters were parsimony informative; L[ 620; CI[

0.700; RI[ 0.836. Taxa in Series Striiformis clade labeled as “voucher number_host name_origin_year collected”. (T) indicates

a type specimen.


PUR N1249 Hordeum jubatum USA 1993

RS480 Triticum aestivum China 2006

PUR 60028 Elymus elymoides USA 1963

PUR F19515 Hordeum sp Argentina 1970

PUR 61492 Triticum aestivum USA 1963

HMAS 79075 Triticum aestivum China 1996

DAOM 240066 Triticum aestivum China 2006




RS479 Triticum aestivum China 2006

BPI 0193871 Triticum aestivum Afghanistan 1970


DAOM 220657 Poa pratensis Canada 1996

PUR 59733 Poa pratensis Canada 1969

DAOM 240065 Achnatherum inebrians China 1998 (T)

PUR N5378 Dactylis glomerata USA 1992

PUR N1254 Dactylis glomerata Canada 1994

PUR N5374 Dactylis glomerata USA 1992

BPI 0199096 Dactylis glomerata China 1986

DAOM 183691 P. coronata Agropyron repens Canada

DAOM 240063 P. coronata Bromus inermus Canada

PRC 247 P. coronata Rhamnus saxatilis Slovakia

DAOM 240064 P. coronata Avena sp. Canada

BP 89076 P. coronata Calamagrostis epigejos Hungary

DAOM 212041 P. poae-nemoralis Poa pratensis Canada

PUR N1189 P. graminis Poa pratensis USA

BP 88883 P. graminis Triticum aestivum Hungary

DAOM 192559 P. recondita Triticum aestivum Australia

PUR N1253 P. triticina Elymus repens Canada

DAOM 240068 P. hordei Hordeum vulgare Canada

DAOM 216236 Uromyces dactylidis Dactylis glomerata Hungary

10 changes

Subclade1: P. striiformis




98/90/100

100/100/100

59/83/91

100/100/100

95/94/82

55/75/91

100/100/100

100/100/100

100/96/97

100/100/100

100/100/100

SeriesStriiformis

BR MYCO 114717-63 Unknown grass Belgium 1854 (T)

B

Fig 1 e (continued).


based primarily on sequence comparisons but were further

confirmed by morphological assessment wherever possible.

As a result, the final ITS2 datamatrix comprised 30 representa-

tives of P. striiformis s.l. and 20 specimens representing eight

outgroup species (Table 1). BT sequences approximately

650 bp long were obtained for a subset comprising 20 P striifor-

mis s.l. and 12 outgroup rust fungi.

Phylogenetic analysis

The P value from a partition homogeneity test for the ITS and

BT data sets equaled 0.75 indicating the null hypothesis of

congruence could not be rejected, thuswe conducted phyloge-

netic analyses for both partitioned and combined data sets.

Each analysis performed in this study (MP, ML and BA for

Subclade 1: P. striiformis




PUR N1249 Hordeum jubatum USA 1993PUR 66275 Triticum aestivum USA 1981PUR F19515 Hordeum sp Argentina 1970PUR 60028 Elymus elymoides USA 1963

RS480 Triticum aestivum China 2006PUR 61492 Triticum aestivum USA 1963

DAOM 240067 Triticum aestivum China 2006RS477 Triticum aestivum China 2006K 78118 Hordeum secalinum UK 2000HMAS 79075 Triticum aestivum China 1996DAOM 240066 Triticum aestivum China 2006PUR F15603 Hordeum vulgare India 1950DAOM 240069 Triticum aestivum China 2006DAOM 240070 Triticum aestivum China 2006RS479 Triticum aestivum China 2006DAOM 240071 Triticum aestivum China 2006BPI 0195217 Hordeum comosum Argentina 1970PUR F17111 Aegilops ligustica Turkey Jun1960BPI 0193871 Triticum aestivum Afghanistan J1970

DAOM 240065 Achnatherum inebrians China 1998 (T)DAOM 220657 Poa pratensis Canada 1996

PUR 59733 Poa pratensis Canada 1969PUR N5354 Poa nemoralis USA 1956PUR N5368 Poa pratensis USA 1956

PUR N5378 Dactylis glomerata USA 1992PUR N5374 Dactylis glomerata USA 1992PUR N5383 Dactylis glomerata Chile 1966K 108141 Dactylis glomerata UK 1977PUR N1254 Dactylis glomerata Canada 1994BPI 0199096 Dactylis glomerata China 1986

DAOM 212041 P. poae-nemoralis Poa pratensis CanadaPDD 60181 P. poae-nemoralis Poa annua New Zealand

DAOM 240189 P. poae-nemoralis Koeleria litvinowii ChinaDAOM 189681 P. poae-nemoralis Arctagrostis latifolia Canada

DAOM 183691 P. coronata Agropyron repens CanadaDAOM 240063 P. coronata Bromus inermus CanadaPRC 247 P. coronata Rhamnus saxatilis SlovakiaDAOM 240064 P. coronata Avena sp. Canada

BP 89076 P. coronata Calamagrostis epigejos HungaryPUR N1189 P. graminis Poa pratensis USA

BP 88883 P. graminis Triticum aestivum HungaryDAOM 192559 P. recondita Triticum aestivum AustraliaPUR N1253 P. triticina Elymus repens Canada

PUR N5371 P. sp. Poa secunda USADAOM 240068 P. hordei Hordeum vulgare Canada

DAOM 193284 P. poarum Poa pratensis CanadaDAOM 240188 P. poarum Tussilago farfara CanadaBPI 1100377 P. poarum Tussilago farfara Canada

PUR N5352 P. sp. Poa compressa USA.DAOM 216236 Uromyces dactylidis Dactylis glomerata Hungary

5 changes

95/99/100

76/93/100

<50/70/80

93/100/100

100/100/100

99/100/99<50/73/86

84/92/98

65/<50/<50

91/97/100

100/100/100

100/100/100

100/100/100

100/99/100

100/97/100

88/92/100

SeriesStriiformis

BR MYCO 114717-63 unknown grass Belgium 1854 (T)

Fig 2 e A phylogram from parsimony analyses based on combined data set. In total 1532 characters are included, of which

310 are parsimony informative; L[ 972; CI[ 0.699; RI[ 0.835; RC[ 0.583; HI[ 0.301; G-fit[L248.817. The three numbers

on branches are bootstrap values from MP and ML and posterior probability from Bayesian analyses respectively. Taxa in

Series Striiformis clade labeled as “voucher number_host name_origin_year collected”. (T) indicates a type specimen.


ITS, BT and the combined data set) recovered awell-supported

clade comprising all representatives of Puccinia striiformis s.l.

(Figs 1, 2). Within the complex, three well-supported sub-

clades and a single taxon subclade were recovered, indicating

the presence of four distinct lineages within the species com-

plex. Three lineages correspond to the three species recog-

nized by Abbasi et al. (2005 [2004]). Subclade 1 (P. striiformis

s.str.) included 19 specimens on Aeg. ligustica, E. elymoides,

Hordeum spp., and T. aestivum from Afghanistan, Argentina,

China, India, Turkey, UK and USA. Subclade 2 (Puccinia striifor-

moides) included six specimens on Dactylis glomerata from

Canada, Chile, China, UK and USA. Subclade 3 (Puccinia pseu-

dostriiformis) included four specimens on Poa spp. from British

Columbia and Quebec (Canada), and Indiana (USA). Subclade 4

Table 3 e Synoptic tabular key to four species of Puccinia Series Striiformis. Up to three states (normal font, bold font or underlined bold) for each character are shown.

Character/Species P. striiformis s.str. P. striiformoides P. pseudostriiformis P. gansensis

Uredinial or telial host On Aegilops, Elymus,Hordeum, Triticum

On Dactylis glomerata On Poa On Achnatherum inerbrians

Urediniospores Germ pores Number (6)8e14(18) (6)8e14(18) (5)6e8(10) (6)8e14(18)

Mean diameter 2.0e2.5 (medium) <2.0 (small) 2.0e2.5 (medium) 2.5e3.0 (large)

Wall surface Height of

echinulaea0.5e0.8 mm (relatively

uniform and short)

0.5e1.2 mm (variable size) 0.9–1.5 mm (obviously long) 0.5e1.2 mm (variable size)

Distance between

echinulae at apexa

1.3e1.4(1.6) mm

(closely spaced)

1.6e1.8 mm (medium spaced) ‡2.0 mm (distantly spaced) 1.3e1.4(1.6) mm

(closely spaced)

Spore size Length (16)18e29(34) mm (14)17e25(29) mm (relatively smaller

than other varieties)

(16)18e29(34) mm (16)18e29(34) mm

Width (17)20e27(28) mm (11)14e22(26)mm (relatively smaller

than other varieties)

(16)18e24(27) mm (17)20e27(28) mm

Shape of uredinial paraphyses Mostly pyriform saccate,

or collapsed to cylindrical,

no constricted “neck”

Mostly pyriform saccate, or collapsed

to cylindrical, no constricted “neck”

Mostly pyriform saccate,

or collapsed to cylindrical,

no constricted “neck”

Clavateecapitate, some

with a constricted “neck”

Telia Shape Oblong Oblong Round (pulvinate) Oblong

Presence of locules Loculate with peripheral

paraphyses

Not or slightly loculate with

paraphyses

Not or slightly loculate

with paraphyses

Loculate with peripheral

paraphyses

Teliospores Shape Mostly oblongeclavate,

not or slightly constrict

at septum

Mostly short clavate, constricted

at septum

Mostly oblongeclavate,

not or slightly constrict

at septum

Mostly oblongeclavate, not

or slightly constrict

at septum

Number of cells Predominantly 2ecelled,

occasionally 1ecelled,

or 3ecelled

Predominantly 2ecelled, occasionally

1ecelled, or 3ecelled

Mostly 2–celled, but

1–celled common, no 3–celled

Only 2ecelled

Length Longer than 40 mm Shorter than 40 mm Shorter than 40 mm Longer than 40 mm

Mean width of hilum 4.5e6 mm <4.5 mm 4.5e6 mm ‡6 mm

a Measurements were made from SEM examination.

Taxonom

icstu

dyofstrip

eru

st,P.striiform

iss.l.

889


comprised a single specimen on Achnatherum inebrians from

China, which is recognized as a new species (Puccinia gansen-

sis; see Taxonomy section). The four species together formed

a strongly supported monophyletic group recognized at the

Series level within Puccinia (Ser. Striiformis; see Taxonomy sec-

tion) based on the analyses presented here (Figs 1, 2) but also

based on a broader sampling of Pucciniales (data not shown).

Although the delimitations of the terminal clades were con-

gruent in the trees generated from both genes by three search-

ing algorithms, relationships among the clades were partially

discordant. The ITS analyses supported the close relationship

of P. striiformis s.str. and P. gansensis (Fig 1A), but BT did not. For

BT, values supporting a close relationship for P. striiformis

s.str., P. pseudostriiformis and P. gansensis varied depending

on the algorithm used, with relatively high support from BA

and medium to low from ML and MP analyses. The relation-

ship of P. striiformis s.l. to other species was also uncertain;

the well-supported close relationship to P. poae-nemoralis in

the ITS tree was not supported by the BT phylogeny.

Morphology

The morphological characters examined included: uredinio-

spore size, shape, echinulation, germ pore number and size,

shape of paraphyses; telium shape, presence of paraphyses

and locules; teliospore shape, size, septation, width of pedicel

hilum. While no single character was diagnostic for distin-

guishing each of the four lineages suggested by the molecular

analyses, combinations of characters could successfully be

used for identification. Host association, urediniospore size

and surface echinulation, especially as seen by SEM, germ

pore number, shape of uredinial paraphyses, and teliospore

hilumwidth were the main features used to differentiate spe-

cies. A synoptic identification key is presented in Table 3.

Taxonomy

Puccinia Series Striiformis Liu & Hambleton, ser. nov.

Mycobank # MB 518859

Uredinis et telis pulvinatis et oblongis in striis flavis vel seriebuslinearibus; uredinisporis subtiliter ad irrgulariter echinulatis;poris germinaritibus disperses, obscures admanifestis; teliosporisbicellularis vel unicellularis vel interdum tricellularis, clavitis,truncates vel rotudatis ad apice

Uredinia pulvinate to oblong, pale yellow to orange yellow

(4A3e4A5), mainly adaxial, aligned on obvious yellow necrotic

stripes, or scattered. Urediniospores broadly ellipsoidal to

broadly obovoid, (14e)17e30(e34)� (11e)14e28 mm (n¼ 664),

surface finely, unevenly or distantly echinulate, echinulae

0.3e0.8 mm wide at base, 0.5e1.2(e1.5) mm high, 1.0e2.0 mm

betweencenters; germpores (5e)6e13(e15), scattered, oftenob-

scure, but clearly visible when mounted in lactic acid cotton

blue followed by slight heating and tapping of the coverslip;

wall 0.6e1.5 mm. Paraphyses thin-walled, few to abundant, pyr-

iform-saccate, collapsed cylindrical, clavate-saccate, capitate

clavate, some constricted at the apex.Telia amphigenous or ab-

axial, mixed with uredinia, dark brown to black, pulvinate to

elongated, sometimes loculated with orange brown paraphy-

ses. Teliospores typically 2-celled, but commonly 1-celled in

some species, occasionally 3-celled, clavate, short clavate to ob-

ovoid, (24e)28e56(e65)� (9e)14e25(e29) mm (n¼ 239), some-

time constricted at septum; wall 2.0e5.0 mm at apex,

occasionallywith a few small protrusions, up to 7.5 mmhigh; hi-

lum orange yellow, 3e8 mmwide; pedicel remnants subhyaline.

(Description is based on all collections examined in this study.)

Type species: Puccinia striiformis Westend.

Notes: Puccinia is a large genus including almost half of all

the known rust species (Arthur & Cummins 1962). Cummins

& Hiratsuka (1983) estimated 3000 species and the on-line In-

dex Fungorum database has 5241 records for the genus

(http://www.speciesfungorum.org/Names/Names.asp, Aug.

06, 2010). To understand species relationships within such

a large genus, a new taxonomic framework incorporating

subgeneric classification levels is necessary. Arthur &

Cummins (1962) saw the need for such structure e they di-

vided Puccinia into two Sections, Eupuccinia and Bullaria, based

on the hypothesis that differences in aecial morphology re-

flect developmental evolution. A recent study by van der

Merwe et al. (2007) examined the phylogenetic relationships

of selected Puccinia and Uromyces species, based on protein-

coding genes, and revealed multiple cohesive groups which

could eventually be classified at a subgeneric level. In our

study, the four species clearly formed a cohesive group

with high support. To reflect this close relationship taxonom-

ically, we chose to erect a rank close to species (Series) for

the group.

Morphologically, species in this Series are characterized by

having serial arrangement of sori on chlorotic stripes (a con-

spicuous feature for wide-leaf hosts), moderately obscure ure-

diniospore germ pores compared to Puccinia recondita and

Puccinia hordei with clearer pores and Puccinia coronata with

more obscure pores, and telial locules that are most often

complete compared to P. recondita and P. coronata with mostly

incomplete locules (Savile 1984).

Puccinia striiformis Westend. Bulletin de L’Academie Royale

des Sciences de Belgique, Classes des Sciences [No. 8] 21(2):

235. 1854 (Figs 3A, B, 4AeD, 5A, B, 6A, B)

Synonyms: Puccinia straminis Fuckel, Jahrb. Vereins Naturk. Her-zogth. Nassau 15: 9e10. 1860 (in part) (fide Cummins, 1971;Mulder & Booth, 1971).Puccinia neglecta Westend., Bull. Soc. Roy. Bot. Belgique 2: 248.1863 (fide Hylander et al. 1953; Arthur, 1962; Cummins, 1971).Puccinia glumarum Eriks. & Henn., Z. Pflanzenkrankh. 4: 197. 1894(fide Hylander et al. 1953; Arthur, 1962; Cummins, 1971; Mulder &Booth, 1971; Savile, 1983).Puccinia glumarum Eriks. & Henn. f. sp. tritici , Z. Pflanzenkrankh.4: 197. 1894 (fide Hylander et al. 1953; Arthur, 1962; Cummins,1971; Mulder & Booth, 1971; Savile, 1983).Dicaeoma glumarum (Eriks. & Henn.) Arthur & Fromme, N. Am.Flora 7(4e5): 338. 1920 (fide Arthur, 1962).Puccinia lineatula Bubak. Ann. K. K. Naturhist. Hofmus. 28: 193.1914 (fide Cummins, 1971).Puccinia striiformis Westend. f. sp. tritici auct.

Uredinia mostly on adaxial leaf surface, light yellow to

orange yellow (4A4e4A6), oblong, 0.4e0.7 mm long, 0.1 mm

wide; aligned on obvious yellow necrotic stripes.

http://www.speciesfungorum.org/Names/Names.asp

Fig 3 e P. striiformis (A, B), P. striiformoides (C, D), P. pseudostriiformis (E, F) and P. gansensis (G, H). Uredinia and telia on leaves

(A, C, E, G) showing the obvious (A, C, G) and non-obvious “stripe” symptom (E). Cross-section of telia (B, D, F, H) from four

species showing loculate (B, H; arrows) and non-loculate (D, F) sori. Scale bar: 1 unit[ 1 mm (A, C, E, G) or 20 mm (B, D, F, H).


Urediniospores broadly ellipsoidal to broadly obovoid, (16e)

18e30(e32)� (15e)17e27(e28) mm, mean 24.5� 21.6 mm

(n¼ 337); surface closely echinulate, echinulae 0.3e0.6 mm

wide at bottom (mean 0.5 mm), 0.5e0.8 mm high (mean

0.66 mm), distances between echinulae 1.1e1.6 mm (mean

1.4 mm); number of germ pores (6e)9e14(e18), scattered,

diameters 1.5e3.0(e3.5) mm(mean2.5 mm);wall 0.5e1.5 mm.Par-

aphyses pyriform-saccate, collapsed cylindrical, 25e50 mm

long, 10e15 mm wide. Telia amphigenous or abaxial, usually

mixed with uredinia, black, covered by epidermis, pulvinate to

oblong, 0.2e0.7 mm long, 0.1 mmwide, linearly alignedon clear

orange yellow to brownish necrotic stripes; loculate with

Fig 4 e P. striiformis (AeD), P. striiformoides (EeH), P. pseudostriiformis (IeL) and P. gansensis (MeP). Light microscopy (LM)

of urediniospore median view (A, E, I, M), surface view showing echinulation (B, F, J, N) and the number of germ pores

(C, G, K, O), and paraphyses (D, H, L, P) showing the difference between P. gansensis (P) and the other species

(note arrowheads indicating constriction at the apex). Scale bar[ 20 mm.


peripheral paraphyses.Teliosporesvariable,mostly oblong-cla-

vate, (24e)31e56(e65)� (11e)14e25(e29) mm, predominantly

2-celled, upper cell (12e)15e25(e28)� (11e)14e25(e29) mm

(mean 20.1� 18.4 mm, n¼ 167), lower cell (12e)16e31(e37)�(7e)10e20 mm (mean 23.7� 14.9 mm); apical cell wall 4e9.5 mm,

pedicel short, rupturing at the middle or at the teliospore

base, remnants 0e15 mmlong, hila 3e8 mmwide; 1-celled spores

occasionally present, ovoid or clavate, (18e)20e35(e38)�10e19 mm; 3-celled spores rarely present, similar in size to the

2-celled.

Lectotype (here designated): Herb. Crypt. Belg. “No. 1077

Puccinia striaeformis West., West. 4� notice sur les Crypt. Ined.

De la Fl. Belge., pag. 10, no. 40. Sur les chaumes cereales aux

environs de Courtrai.” (BR e MYCO 114717 e 63). Type seen!

Isolectotype FH 00300478 (Harvard University Herbarium,

Cambridge, MS USA).

Hosts: Aegilops ligustica, Elymus elymoides, Hordeum

comosum, H. jubatum, H. secalinum, H. vulgare, Triticum aestivum

(only the hosts for samples included in the phylogenetic anal-

yses are listed here. Host range might be broader).

Fig 5 e P. striiformis (A, B), P. striiformoides (C, D), P. pseudostriiformis (E, F) and P. gansensis (G, H). SEM of urediniospores.

Scale bar[ 10 mm (A, C, E, G) or 20 mm (B, D, F, H).


Distribution: cosmopolitan

Other specimens examined: Afghanistan, “oberes Darrah-

kayan, bei Dahane Ahanfalad, alt. 2150 m, Baghlan”, on Triti-

cum aestivum, Jul. 1970, M. Steiner (BPI 0193871) e Argentina,

“Perito Moreno, margen del call en mel puebl, bastante copio-

psamente”, Santa Cruz, on Hordeum comosum, Feb. 1970

(BPI 0195217). Santa Cruz, Perito Moreno, ca. 46�360S, 71�W,

roadside in the town, on Hordeum sp. Feb. 1970, H. Roivainen

(PUR F19515) e China, P.R., Gansu, Yuzhong, Gansu Agricul-

ture Institue Experiment Farm, on Triticum aestivum, 2006,

Tuo Yao (DAOM 240066, 240067); urediniospore samples

from Triticum aestivum 2006, Shelin Jin (DAOM 240069,

240070). Qinghai, Huangyuan, on Triticum aestivum, 1996,

Jian-yun Zhuang and Shu-xia Wei (HMAS 79075) e India,

New Delhi, Agronomy, Indian Agric. Res. Inst., on Hordeum

vulgare, Mar. 1950, Ved Parkash (PUR F15603)e Turkey, Maras,

Goksun-Elbistan, edge of field, alt. 1400 m. onAegilops ligustica,

Jun. 1960, Stainton & Henderson (PUR F17111) e UK, England,

Surrey, near Richmond, on Hordeum secalinum, Jun. 2000, N.W.

Legon (K(M) 78118) e USA, Idaho, Aberdeen, on Hordeum

Fig 6 e P. striiformis (A, B), P. striiformoides (C, D), P. pseudostriiformis (E, F) and P. gansensis (G, H). LM of teliospores, showing

normal two-celled spores (A, C, E, G) and abnormal 1-celled or 3-celled spores (B, D, F, H) for each taxon. Scale bar[ 20 mm.


jubatum, Aug. 1993, Alan P. Roelfs (PUR N1249). Indiana, North-

west of W. Lafayette, Purdue University, Agronomy Farm, on

Triticum aestivum, Jun. 1981, Gregory Shaner (PUR 66275). Mon-

tana, Gallatin, Gallatin National Forest, Lion Head Ski Run

area, on Elymus elymoides, Sep. 1963, Paul D. Keener

(PUR 60028). Utah, Cache, North Logan, on Triticum aestivum,

Aug. 1963, R.S. Peterson (PUR 61492).

Notes: This species was determined to occur on hosts in

multiple genera, i.e. Aegilops, Elymus, Hordeum and Triticum.

Isolates onTriticummaybe identifiedeasily by the conspicuous

necrotic stripes, although for hosts with narrower leaves, the

stripes are usually not obvious. However, identifications based

on this symptom alone can be incorrect because sori of other

leaf rust species may also form in a linear series when


infection is heavy. Type specimens of the synonyms were not

examined. Two species listed as synonyms by other authors

are excluded here. P. tritici Ørsted (1863) is invalid based on

Art 34.1 (ICBN, McNeill et al. 2006): in the text “(ad interim)”

was written after the species name, interpreted by Hylander

et al. (1953) to be the same as “nomen provisorium”. Puccinia

stapfiolae Mundkur and Thirumalachar, (1946) was described

as having “[urediniospore] sparsely echinulate”, a feature

more consistent with Puccinia pseudostriiformis (see species

notes for more discussion).

Although Hylander et al. (1953) recorded “lectotype on

T. aestivum”, the specimen and herbarium were not specified,

thus the lectotypification is invalid (ICBN, Art. 8.1, McNeill

et al. 2006). We searched for the specimen collected by West-

endorp and potentially the one he used for his description of

the species. A specimen from BR has the label as “No. 1077.

Puccinia striaeformis West., West. 4� notice sur les Crypt.

Ined. De la Fl. Belge., pag. 10, no 40. Sur les chaumes cereales

aux environs de Courtrai (BR e MYCO 114717 e 63)”. Most of

the information agreed with the original description by

Westendorp (1854), except the pagination, which was given

as page 235 in the publication but page 10 on the specimen la-

bel. A further search of Westendorp’s collections in Taxo-

nomic Literature (TL, Stafleu & Cowan 1988) indicated that

“Quatrieme notice sur quelques crytogames recemment decouvertes

en belgique” was published independently with pagination

from 1 to 21 and noted in TL as “Extrait du tome xxi, no. 8

du Bulletrin de l’Academie .Belgique.1854”. This suggests

that Westendorp based his description on the specimen

BReMYCO 114717e 63 and therefore it is selected here to lec-

totypify the species.

We attempted DNA sequencing to confirm the placement

of the type specimen in our phylogeny. The specimenwas col-

lected before 1854 and PCR of the ITS2 region (fragment

w380 bp) failed even after DNA repair. We then used an un-

published species-specific real-time PCR assay (developed by

ML) to attempt amplification of a short DNA fragment con-

tained within the larger BT fragment analyzed for this study.

One of sixteen replicate reactions was positive and was di-

rectly sequenced, resulting in a 152 bp sequence which

matched our data for P. striiformis s.str. There was one nucle-

otide mismatch from the positive control, confirming the

identification but also indicating the data were not the result

of accidental cross-contamination during the real-time reac-

tion set-up.

A question remains concerning the type specimen. The

host, identified only as “cereales”, was later assessed to be

Secale by Henderson, as he annotated on the herbarium label

in 1961. We managed to sequence 251 bp of host chloroplast

DNA in the intergenic region between TrnH and psbA but

there was insufficient publicly available data for this gene

for positive identification of the host.

Puccinia striiformoides M. Abbasi, Hedjaroude & M. Scholle, in

Abbasi et al., Rostaniha 5: 75. 2005 [2004]

(Figs 3C, D, 4EeH, 5C, D, 6C, D).

Synonyms: Puccinia striiformis Westend var. dactylidis Manners;Transactions of the British Mycological Society 43: 65. 1960Puccinia striiformis f. sp. dactylidis Tollenaar, Canadian Journal of

Botany 45(3): 294. 1967 Mar.

Uredinia amphigenous, light orange (5A4e5A5), oblong,

0.3e0.5 mm long, <0.1 mm wide. Urediniospores broadly ob-

ovoid or subglobose (14e)17e25(e29)� (11e)14e22(e26) mm,

mean 21.5� 19.7 mm (n¼ 160), surface unevenly echinulate,

echinulae 0.4e0.8 mm wide at base (mean 0.56 mm), 0.7e1.2

(e1.5) mm high (mean 1.0 mm), distance between echinulae

at apices 1.6e1.8 mm (mean 1.7 mm); number of germ pores

8e13(e16), 1.5e2.5 mm diam (mean 2.0 mm), wall 0.5e1.0

(e1.5) mm. Paraphyses pyriform-saccate, collapsed cylindri-

cal, 20e30 mm long, 9e16 mm wide; Telia amphigenous or ab-

axial, usually mixed with uredinia, black, covered by

epidermis, pulvinate to elongate, 0.2e0.5 mm long, 0.1 mm

wide, linearly aligned on clear brownish necrotic stripes.

Sori slightly loculate. Teliosporesmostly short clavate, taper-

ing at apex and to base, constricted at septum, (25e)31e41

(e44)� (14e)17e22 mm, upper cell (10e)15e20� (14e)

17e22 mm (mean 16.5� 17.1 mm, n¼ 46), lower cell (13e)

16e21(e24)� 14e17(e23) mm (mean 17.8� 16.6 mm); wall

1.5e4.5 mm at apex, oak brown, smooth; pedicel subhyaline,

remnants 0e13 mm, hila 3e6 mm wide (mean 4.0 mm). 1-celled

spores ovoid or obovoid clavate, 22e26� 13e17 mm. 3-celled

spores were not observed.

Holotype: Iran, Facham near Teheran, on Dactylis glomerata

var. hispanica, Jul., 1957 G. Viennot-Bourgin (IMI 76632). Type

seen!

Hosts: Dactylis glomerata

Known distribution: Canada, Chile, China P.R., India, Iran,

UK, USA

Other specimens examined: Canada, British Columbia, Uni-

versity of British Columbia campus, on Dactylis glomerata,

Aug. 1994, A.P. Roelfs (PUR N1254)e Chile, Valdivia, on Dactylis

glomerata, Nov. 1966, E. Oehrens (PURN5383)e China P.R., Xin-

jiang, on Dactylis glomerata, Aug. 1986, Jianyun Zhuang (BPI

0199096) e UK, Scotland, The Barra Isles, Isle of Mingulay, on

Dactylis glomerata, Sep. 1977, R. Dennis (K(M) 108141). Wales,

Burry Port, Carmarthenshire, Vice County Code (VCC) No. 44,

National Grid Reference (NGR) SN462013, onDactylis glomerata,

Oct. 2008, R. Nigel Stringer and Richard H. Davies (DAOM

240795); Llansaint Cementery, Carmarthenshire, VCC No. 44,

NGR SN391078, on Dactylis glomerata, Aug. 2008, R. Nigel

Stringer (DAOM 240796) e USA, Oregon, Washington County,

roadside along US Highway 30, 2 miles south of Rainier, on

Dactylis glomerata, Aug. 1992, John W. McCain (PUR N5374).

Minnesota, Portland, on Dactylis glomerata, Aug. 1992, John

W. McCain (PUR N5378).

Notes: Manners (1960) noted that this taxon differs in hav-

ing smaller urediniospores. Niks (1989) agreed but stated that

dimensions of spores examined in his study were 10e20 %

larger than those given by Manners. Our measurements of

the type specimen correspond with those by Abbasi et al.

(2005 [2004]) and Manners (1960), and the other specimens

sampled for DNA analyses correspond well morphologically

with the type. The type specimen is sparse and therefore

was not sampled for DNA analysis. Based on our measure-

ments, the average size of the urediniospores is within previ-

ously published ranges although the upper range of spore

sizes can overlap with the range for P. striiformis s.str. Fur-

thermore, the average sizes of uredinia, uredinio-paraphy-

ses, telia and teliospores were all smaller than the type

species.


Puccinia pseudostriiformisM. Abbasi, Hedjaroude &M. Scholler,

in Abbasi et al., Rostaniha 5: 76. 2005 [2004]

(Figs 3E, F, 4IeL, 5E, F, 6E, F)

Urediniamostly on adaxial leaf surface, pale yellow to light

yellow (4A3e4A4), pulvinate to elongate, 0.2e0.5 mm long,

0.1e0.2 mm wide. Urediniospores broadly obovoid or subglo-

bose, (18e)20e29(e32)� (16e)18e24(e27) (mean 23.1�20.4 mm, n¼ 167); wall 0.5e1.0 mm, hyaline to subhyaline, sur-

face distantly echinulate, echinulae 0.5e0.8 mm wide at base,

(0.8e)0.9e1.4(e1.5) mm high, distances between echinulae at

apices 2.0e2.1 mm (mean 2.1 mm); number of germ pores (5e)

6e8(e10), diameter 2.0e3.0(e4.0) mm (mean 2.7 mm). Paraphy-

ses pyriform-saccate, collapsed cylindrical, 25e50 mm long,

9e14 mm wide. Telia mostly abaxial, black, covered with gla-

brous epidermis, pulvinate, 0.2e0.3 mm long, 0.1e0.2 mm

wide, arranged in line, bead-string like. Paraphyses not ob-

served, sori not loculate. Teliospores obovoid clavate or ob-

ovoid, (25e)28e37(e41)� (9e)13e21 mm, upper cell 13e15

(e17)� 13e21 (mean 14.7� 17.1 mm, n¼ 26), lower cell (12e)

15e22(e24)� (9e)13e16(e18) mm; apical cell wall 2.1e3.5 mm,

pedicel remnants 0e13 mm long, hila 3e6 mm wide; 1-celled

spores common, ovoid or clavate, 22e32(e42)� 13e16 mm;

3-celled spores rarely observed.

Holotype: On Poa pratensis L., Campus University of Califor-

nia, Davis, USA, 14 Dec. 1964, H. Tollenaar (PUR 59844).

Host: Poa spp.

Known distribution: Canada, USA.

Other specimens examined: Canada, British Columbia, Van-

couver Island, 4795 Timber Place, Cordova Bay, on Poa praten-

sis, Jul. 1969, W.G. Ziller (PUR 59733). Quebec, Cantley, on Poa

pratensis, Sept. 1996, G. Ginns (DAOM 220657). e USA, Indi-

ana, Tippecanoe, on Poa pratensis, May 1956, M.P. Britton

(PUR N5368); on Poa nemoralis, Apr. 1956, M.P. Britton (PUR

N5354).

Notes: The most distinctive features of this species are

the reduced number and larger size of the urediniospore

germ pores. In addition, urediniospore echinulae are more

widely separated compared with other species in Ser. Strii-

formis. This taxon might be difficult to distinguish morpho-

logically from P. poarum. Both species produce a similar

number of germ pores but those of P. poarum are less

conspicuous.

There is a possibility that P. stapfiolae Mundk. & Thirum.

1946, listed as synonym of P. striiformis by Cummins (1971), is

the older name of P. pseudostriiformis based on urediniospores

described as sparsely echinulate. However, the host listed as

“Stapfiola bipinnata (L.) Kuntze (¼Desmostachya bipinnata (L.)

Stapf, ¼Eragrostis cynosuroides Beauv.)” is classified in the sub-

family Chloridoideae, while P. pseudostriiformis is so far only

knownonPoa spp. (subfamily Pooideae).Wehavenot examined

or sequenced the typespecimenbutconsider itdoubtful the two

fungi are the same, given the phylogenetic distance between

the host taxa.

Puccinia gansensis Liu & Hambleton, sp. nov.

(Figs 3G, H, 4MeP, 5G, H, 6G, H)

Mycobank # MB 518860

Uredosoris paraphyses abundis, clavatis-saccatis, capitatis velclavatis, 40e70 mm longis, 7e14(17) mm latiso ad apicem; teliosorisloculatis, teliosporis latibasis 5e8 mm.

Uredinia mostly on adaxial leaf surface, light yellow to or-

ange yellow (4A4e4A5), oblong 0.4e1.0 mm long, 0.1e0.2 mm

wide. Necrotic stripes not obvious. Urediniospores broadly

ellipsoidal (19e)21e29(e34)� (17e)20e26 mm (mean 24.9�21.8 mm, n¼ 56); finely echinulate, echinulae 0.3e0.7 mm wide

at base, 0.5e1.2 mmhigh, distance between echinulae at apices

1.2e1.5 mm (mean 1.3 mm), number of germ pores (9e)10e14

(e16), diameter (1.5e)2.0e3.0(e3.5) mm (mean 2.5 mm). Paraph-

yses abundant, clavate-saccate, capitate, clavate, generally

look longer and narrower than other species; 40e70 mm long,

apical width 7e14(e17) mm, some conspicuously constricted

at the apex. Telia almost always on opposite side from ure-

dinia, abaxial, embedded in leaf surface, in linear arrange-

ments, mostly merged into long lines. Necrotic stripes are

not obvious. Sori loculate with peripheral paraphyses.

Teliospores obovoid clavate, (33e)37e50(e56)� (12e)

14e17 mm, upper cell (16e)18e22(e24)� (12e)14e17 mm

(mean 20.4� 15.3 mm, n¼ 20 mm), lower cell (17e)19e28

(e32)� (9e)11e14 mm (mean 24.2� 12.5 mm); apical cell wall

3.0e5 mm, pedicel remnants 0e14 mm long, hila 5e8.0 mm

wide (mean 6.0 mm); 1-celled or 3-celled spores not observed.

Holotype: China P.R., Gansu Province, on Achnatherum ine-

brians, 1998, Chunjie Li (DAOM 240065).

Etymology: gansensis for the location.

Host: Achnatherum inebrians

Known distribution: Gansu Province, China

Notes: This species differs from others in Ser. Striiformis by

having telia completely embedded in host tissue, rather than

more or less elevated above the leaf surface. Microscopically,

teliospores have much broader pedicels and hila, such that

the lower cell is less tapered at the basal end. Urediniospores

are similar to P. striiformis, and therefore the two species are

difficult to identify based on this spore stage alone. The only

reported Puccinia species on Ach. inebrians in China is

P. stipae-sibiricae, which is distinguished from P. gansensis by

long persistent teliospore pedicels. Puccinia stipae-sibiricae

has been reported from China and Japan.

Discussion

Species recognition

In contrast with virulence/avirulence genes subjected to strong

host selection, house-keeping genes evolving neutrally are con-

sidered ideal for studies on population structure and macro-

evolution (Taylor et al. 1999). DNA sequences for the ribosomal

RNA internal transcribed spacer (ITS) and partial b-tubulin

(BT) gene have proven suitable for exploring relationships at

the species level (White et al. 1990; Schardl et al. 1994). Based

on a broad sampling of P. striiformis s.l. collections, our phyloge-

netic analyses revealed fourmonophyletic lineagesdiagnosable

by unique combinations of character states, a criterion for the

phylogenetic species concept as defined by Cracraft (1983) and

others (Nelson& Platnick 1981; Nixon&Wheeler 1990). Molecu-

lar evidence strongly supported the recognition by Abbasi et al.

(2005 [2004]) of three taxa at the species level: two have limited

uredinial and telial host associations on genera of Poeae

(Puccinia striiformoides on Dactylis and Puccinia pseudostriiformis

on Poa) while the third, P. striiformis s.str., has a broader host


range limited to Triticeae. The fourth species described here,

Puccinia gansensis, is known so far from only one collection

fromChina. It is distinct by havingmore deeply embedded telia,

a wide hilum on teliospores, and longer andwider uredinio-pa-

raphyses. This is the first report of Ser. Striiformis on this host,

Ach. inebrians, which is distributed in alpine and subalpine

grasslands in northwestern China (Shi 1997).

Host range of P. striiformis s.str.

Puccinia striiformis s.str. was sampled from a wide geographic

distribution and comprised all specimens collected onHordeum

spp. and Triticum spp. From this it can be inferred that all wheat

and barley stripe rusts from various origins belong to the same

lineage. Based on our sampling, in addition to Hordeum and Tri-

ticum spp., this species also infects Aeg. ligustica and E. ely-

moides, but not other grass genera, suggesting a telial host

range that is narrower than previously documented, i.e. 50 gen-

era in ten tribes of Poaceae (Hassebrauk 1965). Although we ex-

amined additional specimens identified as P. striiformis on

various other hosts, many were re-identified as other leaf

rust species occurring on grasses, most commonly Puccinia cor-

onata but also Puccinia hordei and Puccinia recondita, among

others. Interestingly, the redetermined specimens spanned

the wide host range previously attributed to the type species,

i.e. ten grass genera in five tribes. Aecial hosts of P. striiformis

(and Puccinia pseudostriiformis), unknown until recently, were

shown to be in the genus Berberis by Jin et al. (2010), based on in-

oculation experiments and DNA sequence comparisons.

An important factor in determining pathogen host ranges

is the accurate identification of their hosts. Most rust herbar-

ium specimens include little associated plant material, and

rarely those parts needed for taxonomic assessment. On the

other hand, analysis of molecular characters provides a pow-

erful approach for identification verification, requiring only

a small amount of plant tissue for DNA extraction. A compre-

hensive assessment of the host range of this species will need

to incorporate such verifications, along with a consideration

of current classification systems for Poaceae. This was beyond

the scope of our study, except in one case. Identification of the

grass host of PUR N5378, Lolium perenne, was re-examined us-

ing chloroplast gene data (data not shown) and re-identified as

Dactylis glomerata, based on BLAST searches on GenBank, sup-

porting previous observations of a strict host association for

Puccinia striiformoides with the genus Dactylis. Our attempts

to identify the host of the type specimen of P. striiformis using

DNA data were inconclusive e this remains an important

question requiring additional work.

Phylogenetic relationships of Puccinia striiformis s.l.

The phylogenetic relationships of P. striiformis s.l. to selected

cereal rust species, inferred from our analyses of ITS and BT,

data were not concordant. The ITS tree suggested that the

closest relative might be another rust species on Poa, P. poae-

nemoralis. One hypothesis is that Puccinia pseudostriiformis,

poorly supported as the basal lineage of the complex, diverged

from P. poae-nemoralis, followed by other species. The ITS anal-

yses suggest a trend within Ser. Striiformis, in which host di-

versity increases from basal to the most recently diverged

species. Puccinia striiformis s.str. has the widest host range in

the tribe Triticeae while two lineages have restricted host as-

sociations in the tribe Poeae. Both tribes are relatively derived

lineages in the subfamily of Pooideae (Soreng & Davis 2000).

This trend appears to imply a certain degree of co-speciation

of the rust and its host (Anikster & Wahl 1979). However, the

host of Puccinia gansensis, in the tribe Stipeae, is distantly re-

lated to Poeae and Triticeae in grass phylogenies based onmo-

lecular data (Soreng & Davis 2000). The explanation for this

pattern could be a host jump, a phenomenon commonly

observed in the evolution of Puccinia and other rust genera

(Leppik 1959; Savile 1971; van der Merwe et al. 2008).

However, our hypotheses based on the ITS results were

not supported by BT, in which Puccinia coronata grouped as

the closest relative, although statistical support was weak

for this relationship. In general, the lack of concordance in

the deeper branches of the two gene genealogies could be

caused by recombination events within populations, incom-

plete lineage sorting, introgressive hybridization or deficient

taxon sampling (see review by Doyle 1992; Soltis et al. 1992).

Technical challenges

In our search for specimens, we found that the number of Puc-

cinia striiformis s.l. collections deposited in most herbaria were

limited, especially from the last 40 y, as compared to some of

the other agriculturally important cereal rusts. Our success

rate for generating ITS sequences (w50 %) was affected by

the predominance of older specimens sampled. Herbarium

accessions may be correlated, in part, with boom-and-bust

disease cycles, but the situation may also be attributable to

a lack of taxonomists globally working on this pathogen or

the accumulation of research collections that have not been

deposited in herbaria.

The high percentage (w45 %) of morphological misidentifi-

cations of other leaf rusts as stripe rust is understandable be-

cause there are few distinctive characters. The subtle

differences among urediniospores produced by cereal rust spe-

cies (Puccinia coronata, Puccinia hordei, P. striiformis s.l., and Pucci-

nia triticina, etc.) are not readily distinguished by the untrained

eye. Teliospore shape can be highly variable; nevertheless

when teliospores are present, the differences in shape could

be used to distinguish Ser. Striiformis from some species, such

as P. coronata and Puccinia graminis. A commonly used character

for identification appears to have been the symptomof linearly

aligned uredinia on chlorotic stripes on leaves. Certainly, the

rust fungi on grass hosts with narrower leavesweremore often

misidentified than thoseonwider leavessuchaswheatandbar-

ley, in part because the “stripe” symptoms are not as clear on

narrow leaves. The descriptions and tabular keys provided

here combinedwith theuseofDNAsequence-based techniques

will increase the accuracy of identifications in the future.

Acknowledgements

This study was part of a broader project (CRTI-040045RD)

funded by the Canadian Chemical, Biological, Radiological-

Nuclear, and Explosives (CBRNE) Research and Technology


Initiative (CRTI). We are grateful to the following herbaria and

persons for generously providing specimens: BP, BPI, DAOM,

HMAS, K, PDD, PRC, PUR, T. Fetch, S.-L. Jin and C.-J. Li. We

also thank E. McCabe, R. Assabgui and J. Chapados for DNA se-

quencing technical support; A.-F. Yang for teaching ML SEM

techniques; J. Saarela for providing matK primers, and J. Bis-

sett, J.A. Parmelee, S.A. Redhead, K.A. Seifert, R.A. Shoemaker

and anonymous reviewers for valuable comments on the

manuscript.

r e f e r e n c e s

Abbasi M, Hedjaroude G, Scholler M, Goodwin SB, 2005 [2004].Taxonomy of Puccinia striiformis s.l. in Iran. Rostaniha 5: 71e82,199e224.

Aime MC, 2006. Toward resolving family-level relationships inrust fungi (Uredinales). Mycoscience 47: 112e122.

Allain-Boule N, Levesque CA, Martinez C, Belanger RR,Tweddell RJ, 2004. Identification of Pythium species associatedwith cavity-spot lesions on carrots in eastern Quebec. Cana-dian Journal of Plant Pathology 26: 365e370.

Anikster Y, Wahl I, 1979. Coevolution of the rust fungi onGraminae and Liliaceae and their hosts. Annual Review ofPhytopathology 17: 367e403.

Arthur JC, Cummins GB, 1962. Puccinia Pers., 1794. In: Manual of theRusts in United States and Canada. Hafner Publishing Company,New York, p. 100.

Arthur JC, Fromme, 1920. Dicaeoma glumarum (Schmidt) Arthur &Fromme. North American Flora 7: 338.

Barnes CW, Szabo LJ, 2007. Detection and identification of fourcommon rust pathogens of cereals and grasses using real-time polymerase chain reaction. Phytopathology 97: 717e727.

Becerra V, Paredes M, Madariaga R, Bariana HS, Mellado M, Rojo C,2007. High genetic diversity in Chilean populations of wheatyellowrust (Puccinia striiformis f. sp. triticiWest.) assessedbyRAPDand AFLP. Australian Journal of Agricultural Research 58: 525e531.

Bubak F, 1914. Puccinia lineatula Bub. Annalen des K.K. Naturhistor-ischen Hofmuseums 28: 193.

Chen XM, Line RF, Leung H, 1995. Virulence and polymorphicDNA relationships of Puccinia striiformis f. sp. hordei to otherrusts. Phytopathology 85: 1335e1342.

Cracraft J, 1983. Species concepts and speciation analysis. CurrentOrnithology 1: 159e187.

Cummins GB, Hiratsuka Y, 1983. Illustrated Genera of Rust Fungi, 3rdedn. The American Phytopathological Society, St. Paul, MN.

CumminsGB,StevensonJA,1956.Acheck listofNorthAmericanrustfungi (Uredinales). Plant Disease Reporter(Suppl. 240): 109e193.

Doyle JJ, 1992. Gene trees and species trees: molecular systemat-ics as one-character taxonomy. Systematic Botany 17: 144e163.

Eriksson J, Henning E, 1894. Die Hauptresultate einer neuen Unter-suchung uber die Getreiderostpilze. Zeitschrift fur Pflanzenkrank-heiten 4: 197e203.

Eriksson J, Henning E, 1896. 3. Puccinia glumarum (Schm.) Eriks. &Henn.dGelbrost. In: Eriksson J, Henning E (eds), Die Getreider-oste. P.A. Norstedt & Soner, Stockholm, pp. 141e145.

Fuckel L, 1860. Enumeratio Fungorum Nassoviae series I. Jahr-bucher des Vereins fur Naturkunde Herzogthum Nassau 15: 9e10.

Hall TA, 1999. BioEdit: a user-friendly biological sequence align-ment editor and analysis program for Windows 95/98/NT.Nucleic Acids Symposium Series 41: 95e98.

Hassebrauk K, 1965. Nomenklatur, geographische verbreitungund wirtsbereich des gelbrostes, Puccinia striiformis West.Mitteilungen aus der Biologischen Bundesanstalt fur Land- undForstwirtschaft, Berlin-Dahlem 116: 1e75.

Hovmøller MS, Justesen AF, 2007. Appearance of atypical Pucciniastriiformis f. sp. tritici phenotypes in north-western Europe.Australian Journal of Agricultural Research 58: 518e524.

Huelsenbeck JP, Ronquist F, 2001. MRBAYES: Bayesian inferenceof phylogeny. Bioinformatics 17: 754e755.

Hylander N, Jørstad I, Nannfeldt JA, 1953. Enumeratio uredinea-rum scandinavicarum. Opera Botanica 1: 75.

Jin Y, Szabo LJ, Carson M, 2010. Century-old mystery of Pucciniastriiformis life history solved with the identification of Berberisas an alternate host. Phytopathology 100: 432e435.

Katoh K, Kuma K-i, Toh H, Miyata T, 2005. MAFFT version 5:improvement in accuracy of multiple sequence alignment.Nucleic Acids Research 33: 511e518.

Kornerup A, Wanscher JH, 1967. Methuen Handbook of Colour. Me-thuen, London.

Leppik EE, 1959. Some viewpoints on the phylogeny of rust fungi.III. Grass rusts. Mycologia 51: 512e528.

Line RF, 2002. Stripe rust of wheat and barley in North America:a retrospective historical review. Annual Review of Phytopa-thology 40: 75e118.

Manners JG, 1960. Puccinia striiformis Westend. dactylidis var. nov.Transactions of British Mycological Society 43: 65e68.

McIntosh RA, Brown GN, 1997. Anticipatory breeding for resis-tance to rust diseases in wheat. Annual Review of Phytopathol-ogy 35: 311e326.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL,Marhold K, Nicolson DH, Prado J, Silva PC, Skog JE,Wiersema JH, Turland NJ (eds), 2006. International Code ofBotanical Nomenclature (Vienna Code) Adopted by the SeventeenthInternational Botanical Congress Vienna, Austria, July 2005.Gantner Verlag, Ruggell, Liechtenstein.

Mundkur BB, Thirumalachar MJ, 1946. Revisions of and additionsto Indian fungi. I. Mycological Papers 16: 14.

van der Merwe M, Ericson L, Walker J, Thrall PH, Burdon JJ, 2007.Evolutionary relationships among species of Puccinia and Ur-omyces (Pucciniaceae, Uredinales) inferred from partial proteincoding gene phylogenies. Mycological Research 111: 163e175.

van der Merwe MM, Walker J, Ericson L, Burdon JJ, 2008. Coevo-lution with higher taxonomic host groups within the Pucci-nia/Uromyces rust lineage obscured by host jumps. MycologicalResearch 112 (PT12): 1387e1408.

Nelson G, Platnick N, 1981. Systematics and Biogeography: cladisticsand vicariance. Columbia Univ. Press, New York.

Newton M, Johnson T, 1936. Stripe rust, Puccinia glumarum inCanada. Canadian Journal of Research Section G 14: 89e108.

Niks RE, 1989. Morphology of infection structures of Pucciniastriiformis var. dactylidis. European Journal of Plant Pathology 95:171e175.

Nixon KC, 1999. The parsimony ratchet, a new method for rapidparsimony analysis. Cladistics 15: 407e414.

Nixon KC, Wheeler QD, 1990. An amplification of the phylogeneticspecies concept. Cladistics 6: 211e223.

Ørsted AS, 1863. Puccinia tritici (ad interim). Om Sygdomme hosPlanterne. Forlagt af J.H. Schubothes Boghandel, Kjøbenhavn,p. 93.

Posada D, Crandall KA, 1998. Modeltest: testing the model of DNAsubstitution. Bioinformatics 14: 817e818.

Roelfs AP, Singh RP, Saari EE, 1992. Rust Diseases of Wheat: conceptsand methods of disease management. CIMMYT, Mexico, D.F.

Savile DBO, 1971. Coevolution of the rust fungi and their hosts.The Quarterly Review of Biology 46 (3): 211e218.

Savile DBO, 1984. Taxonomy of the cereal rust fungi. In:Bushnell WR, Roelfs AP (eds), The Cereal Rusts: Origins, Speci-ficity, Structure, and Physiology. Academic Press, New York.

Schardl CL, Leuchtmann A, Tsai H-F, Collett MA, Watt DM,ScottDB, 1994.Origin of a fungal symbiont of perennial ryegrassby interspecific hybridization of a mutualist with the ryegrasschoke pathogen, Epichloe typhina. Genetics 136: 1307e1317.


Schmidt JK, 1827. Uredo glumarum Schmidt. Allgemeine Okono-misch-technische Flora 1: 27.

Shi ZC, 1997. Important Poisonous Plants of China Grassland (in Chi-nese). China Agricultural Press, Beijing.

Sikes DS, Lewis PO, 2001. Beta Software, Version 1. PAUPRat: PAUP*Implementation of the Parsimony Ratchet. Distributed by the au-thors. Department of Ecology and Evolutionay Biology, Uni-versity of Connecticut, Storrs, USA.

Soltis PS, Soltis DE, Doyle JJ, 1992. Molecular Systematics of Plants.Chapman and Hall, New York.

Soreng RJ, Davis JI, 2000. Phylogenetic structure in Poaceae sub-family Pooideae as inferred from molecular and morphologi-cal characters: misclassification versus reticulation. In:Jocobs SWL, Everett J (eds), Grasses: Systematics and Evolution.CSIRO, Melbourne, pp. 61e74.

Stafleu FA, Cowan RS, 1988. Taxonomic Literature: a Selective Guideto Botanical Publications and Collections with Dates, Commentariesand Types. Bohn, Scheltema & Holkema and Dr. W. Junk b.v.Publishers, Utrecht/Antwerpen, Hague/Boston.

Straib W, 1935. Infektionsversuche mit biologische rassen desgelbrostes auf grasern. Arbeiten aus der Biologischen Reichsan-stalt fur Land und Forstwirtschaft 21: 483e497.

Straib W, 1936. Uber gelbrostanfalligkeit und resistenz der ger-stenarten. Arbeiten aus der Biologischen Reichsanstalt fur Land undForstwirtschaft 21: 467e473.

Stubbs RW, 1985. Stripe rust. In: Bushnell WR, Roelfs AP (eds), TheCereal Rusts: Diseases, Distribution, Epidemiology, and Control.Academic Press, New York, pp. 61e99.

Swofford DL, 1998. PAUP*. Phylogenetic Analysis Using Parsimony(*and Other Methods). Version 4 (Computer Program). SinauerAssociates, Sunderland, MA.

SydowP,SydowH,1904.MonographiaUredinearumLeipzig,Germany.Tautz D, Renz M, 1983. An optimized freeze-squeeze method for

the recovery of DNA fragments from agarose gels. AnalyticalBiochemistry 132: 14e19.

Taylor JW, Jacobson DJ, Fisher MC, 1999. The evolution of asexualfungi: reproduction, speciation and classification. AnnualReview of Phytopathology 37: 197e246.

Tollenaar H, Houston BR, 1967. A study on the epidemiology ofstripe rust, Puccinia striiformis West., in California. CanadianJournal of Botany 45: 291e307.

Wan AM, Chen XM, He ZH, 2007. Wheat stripe rust in China.Australian Journal of Agricultural Research 58: 605e619.

Wellings CR, McIntosh RA, 1990. Puccinia striiformis f. sp. tritici inAustralasia: pathogenic changes during the first 10 years. PlantPathology 39: 316e325.

Westendorp GD, 1854. Puccinia striaeformis. Bulletin de L’AcademieRoyale des Sciences de Belgique, Classes des Sciences 21: 235.

Westendorp GD, 1863. No. 33. Puccinia neglecta. Bulletin de la Societeroyale de botanique de Belgique 2: 248.

White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and directsequencing of fungal ribosomal RNA genes for phylogenies.In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCRProtocols: a Guide to Methods and Applications. Academic Press,San Diego.

Yahyaoui AH, Hakim MS, Naimi ME, Rbeiz N, 2002. Evolution ofphysiologic races and virulence of Puccinia striiformis on wheatin Syria and Lebanon. Plant Disease 86: 499e504.

Zwickl DJ, 2006. Genetic algorithm approaches for the phyloge-netic analysis of large biological sequence datasets under themaximum likelihood criterion. Ph.D. dissertation, TheUniversity of Texas at Austin.

Taxonomic study of stripe rust, Puccinia striiformis sensu lato, based on molecular and...

Documents

Transcript of Taxonomic study of stripe rust, Puccinia striiformis sensu lato, based on molecular and...