Taxonomic characterization and plant colonizing abilities of some bacteria related to Bacillus...

FEMS Microbiology Ecology 48 (2004) 249–259

www.fems-microbiology.org

Taxonomic characterization and plant colonizing abilities ofsome bacteria related to Bacillus amyloliquefaciens

and Bacillus subtilis

Oleg N. Reva a, Christina Dixelius b, Johan Meijer b, Fergus G. Priest c,*

a Department of Antibiotics, Institute of Microbiology and Virology, 154 Zabolotnogo Str., 03143 Kyiv, Ukraineb Department of Plant Biology and Forest Genetics, Genetics Centre, Box 7080, Swedish University of Agricultural Sciences,

SE-750 07 Uppsala, Swedenc School of Life Sciences, Heriot-Watt University, Riccarton, Edinburgh, Scotland EH14 4AS, UK

Received 12 November 2003; received in revised form 20 January 2004; accepted 2 February 2004

First published online 1 March 2004

Abstract

The phylogenetic relationships of 17 Bacillus strains isolated from plants and soil were determined from partial sequences of

genes encoding 16S rRNA, gyraseA (gyrA) and the cheA histidine kinase. Five strains were closely related to Bacillus subtilis subsp.

subtilis, three strains were more closely related to B. subtilis subsp. spizizeni and two strains were identified as B. mojavensis. The

remaining seven strains formed a cluster closely related to, but distinct from, Bacillus amyloliquefaciens. Some of these strains

formed red-pigmented colonies. The abilities of selected strains to survive in the rhizosphere and to colonize plants were studied

using oilseed rape (Brassica napus), barley (Hordeum vulgare) and thale cress (Arabidopsis thaliana) as model plants. It was shown by

following the titre of bacteria in seedlings and by scanning electron microscopy that survival of Bacillus cells on the roots of

seedlings during the first week after treatment of seeds with spore suspensions was crucial for colonization of the rhizosphere and for

biocontrol activity. The group of strains related to B. amyloliquefaciens were generally better adapted to colonization of the rhi-

zosphere of plants than other members of the B. subtilis group and could be considered a distinct ecotype of B. amyloliquefaciens.

Bacteria in this taxon could be recognized on the basis of amplification of a PCR product with primers directed to the tetB(L) locus

but no product with primers directed to the a-amylase gene of B.amyloliquefaciens sensu stricto.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Bacillus amyloliquefaciens; Bacillus subtilis; 16S rRNA; gyrA; cheA; Identification; Plant colonization

1. Introduction

It is generally recognized that the tissues of healthy

plants can be colonized internally by microorganisms.

The use of biopesticides based on these natural endo-

phytic bacteria to control plant diseases is considered as

a promising ecological alternative to chemical treat-ments. Several attempts to manipulate the development

of plant-associated microbial communities of crop

* Corresponding author. Tel.: +44-131-451-3187/3464; fax: +44-131-

451-3009.

E-mail address: [email protected] (F.G. Priest).

0168-6496/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsec.2004.02.003

plants in order to protect the plants from disease or to

promote plant growth have been made [1–3]. Usually

these experiments involve the introduction of a large

population of a specific microorganism to the seeds or to

a furrow during planting [4–6]. Strains of Bacillus have

several advantages over other biocontrol bacteria in that

they are easy to cultivate and store. They can be appliedas spores on plant seeds or in inoculants and they show

significant protective effects towards several microbial

pathogens as well as plant growth promoting activities.

In particular, strains of Bacillus amyloliquefaciens and

Bacillus subtilis have been shown to synthesize plant

growth promoting substances such as gibberellins and

. Published by Elsevier B.V. All rights reserved.

mail to: [email protected]

250 O.N. Reva et al. / FEMS Microbiology Ecology 48 (2004) 249–259

indole-acetic acid [7], extracellular phytase [8], chitinase

[9,10] and antifungal peptides [11–14]. Seed inoculants

containing strains of B. subtilis and related species have

been shown to increase yields of various crops [1,5,

15–17].Recent taxonomic studies have revealed that B. sub-

tilis is heterogeneous and should be considered as a

complex of closely related species. Thus, isolates previ-

ously classified as B. subtilis are now recognized as Ba-

cillus atrophaeus, Bacillus mojavensis, and Bacillus

vallismortis [18–20] and B. subtilis in turn has been di-

vided into two subspecies B. subtilis subsp. subtilis and

B. subtilis subsp. spizizenii [21]. B. subtilis and B. amy-

loliquefaciens are phenotypically similar species and can

easily be confused. It is therefore not surprising that

most large-scale studies of the endophytic microflora

refer to isolates as B. subtilis without deeper analysis of

their taxonomy. However, definitive identification is

important because biocontrol and plant promotion ac-

tivities including antibacterial and antifungal polypep-

tide production, and synthesis of extracellular phytaseand chitinase, are strain-specific and may be associated

with certain species and subspecies of B. subtilis sensu

lato [8,12,14].

In this study we have used partial 16S rRNA, gyrA

and cheA sequences to assign several endophytic Bacillus

strains to a group closely associated with B. amyloliq-

uefaciens and with many of the features of a distinct

ecotype. We further show that selected strains, in par-ticular those of the B. amyloliquefaciens ecotype, colo-

nize plant roots effectively and can apparently withstand

the antibacterial effects of plant root exudates.

2. Materials and methods

2.1. Bacterial strains

The bacterial strains used in this study and the

GenBank accession numbers of corresponding se-

quences are listed in Table 1. The collection included

isolates from plants and soil (Ukranian Collection of

Microorganisms, UCM strains) which had previously

been identified to the B. subtilis/B. amyloliquefaciens

group on the basis of phenotype [22,23]. A further fivestrains of Bacillus were isolated from Arabidopsis thali-

ana seedlings which had been surface sterilized as seeds

and germinated under gnotobiotic conditions (see At

strains in Table 1). Bacteria were grown at 37 �C on

nutrient agar (Oxoid).

The antagonistic activity of Bacillus strains was tested

in vitro on potato dextrose agar (PDA). A spore sus-

pension of Leptosphaeria maculans (100 ll of 107

sporesml�1) was spread upon the plates and incubated

for 2 days at 28 �C. Bacillus cultures were inoculated on

to the centre of the same plates using a microbiological

loop and the plates incubated for 4 days at 28 �C. Zonesof inhibition of fungal growth were measured.

2.2. Plant growth conditions and treatments

Oilseed rape (Brassica napus L. cv. Westar, suscepti-

ble to Leptosphaeria maculans), barley (Hordeum vulgare

cv. Optic) and thale cress (Arabidopsis thaliana An-1),

sensitive to the phytopathogenic fungus L. maculans [24]

were used in the study.

Seeds were surface sterilized with 10% NaHClO4 for

20 min, rinsed briefly with ethanol, washed with sterile

distilled water and treated for 2 h with Bacillus sporesuspension (approximately 107 spores ml�1) produced

from cultures grown on nutrient agar at 37 �C for 4 days

generally achieving more than 99% sporulation as

judged by microscopy. Culture was removed from the

plate with sterile distilled water and adjusted to the de-

sired titre with distilled water. To determine the growth

colonization ability of Bacillus strains, plants were

grown for 4 days in a climate chamber with 70% relativehumidity and 16 h daylight at 21 �C and 8 h darkness at

17 �C in plastic vessels with Silvaperl (William Sinclair

Horticulture Ltd., Lincoln) (10 g of Silvaperl soaked

with 70 ml of liquid MS medium and sterilized at 115 �Cfor 30 min), or in pots with twice autoclaved standard

sphagnum based soil. In all plant colonization experi-

ments we used 12 plants in each test group and a neg-

ative control group (seeds treated with sterile distilledwater). Parts of roots, steams, leaves, flowers and pods

were weighed, crushed, re-suspended in 1 ml of water,

heated at 60 �C for 20 min to remove non-sporeforming

bacteria and plated on nutrient agar. Mean values and

standard deviations were calculated.

The PG2 isolate PHW 950:14 (Leroy) of L. maculans

[25] was used for plant inoculations. The fungus was

grown on potato dextrose agarose (PDA, Sigma) fortwo weeks before harvesting pycnidiospores. To assess

the protective effects of Bacillus strains, seeds of A.

thaliana (An-1) were surface sterilized as above and

treated with Bacillus spore suspension mixed with L.

maculans pycnidiospores in proportion Bacillus/L.

maculans 108/107 and 107/105 sporesml�1. In positive

and negative controls, seeds were treated with sterile

water and spore suspensions of L. maculans (in con-centrations 107 and 105 sporesml�1) respectively. The

seeds were germinated in 24-well multiwell plates (2

seeds per well) with 2 ml Murashige and Skoog (MS)

medium (ICN Biomedicals) supplemented with 1%

glucose and 1% microbiological agar.

2.3. Electron microscopy

Surface sterilized seeds of A. thaliana were treated

with Bacillus spore suspensions (approximately 107

sporesml�1) as described above and placed on sterile

Table 1

Bacterial strains used in this study, their characteristics and GenBank accession numbers of partial sequences of genes analysed in this study

Strainsa ;b Identificationc Source of Isolation/ Plant colonizatione Accession numbers in GenBankf

Commentsd 16S rRNA gyrA cheA tetB(L) promoter

region

DSM10T B. subtilis subsp. subtilis nd AJ276351 AF272021 nd nd

168 B. subtilis subsp. subtilis nd Z99124 (http://genolist.pasteur.fr/SubtiList/)

DSM 347T B. subtilis subsp. spizizenii nd AF074970 AF272020 AY212966 nd

DSM 7T B. amyloliquefaciens – AY055225 AF272015 AY212964 nd

H B. amyloliquefaciens nd nd nd nd nd

DSM 7264T B. atrophaeus Black pigmented nd AB021181 AF272016 nd nd

DSM 9205T B. mojavensis nd AB021191 AY212986 AY212965 nd

DSM 11031T B. vallismortis nd AB021198 AF272025 nd nd

UCMB-5008 Bs subsp. spizizenii Hay, black pigmented – AY211477 AY212969 AY212952 nd

UCMB-5014 Bs subsp. spizizenii Soil nd AY211479 AY212971 AY212955 nd

UCMB-5017 B. amyloliquefaciens Cotton plant + AY211472 AY212970 AY212954 AY212948

UCMB-5033 B. amyloliquefaciens Cotton plant + AY211473 AY212973 AY212957 nd

UCMB-5036 B. amyloliquefaciens Cotton plant – AY211476 AY212975 AY212953 nd

UCMB-5044 B. amyloliquefaciens Cotton plant – Not published AY212976 AY212956 AY212949

UCMB-5049 Bs subsp. subtilis Cotton plant ++ AY211469 AY212972 AY212958 nd

UCMB-5051 B. mojavensis Cotton plant nd AY211481 Not published AY212959 nd

UCMB-5075 B. mojavensis Soil nd AY211478 AY212977 AY212963 nd

UCMB-5113 B. amyloliquefaciens Soil; red-pigmented +++ AY211475 AY212974 AY212962 AY212950

UCMB-5137 Bs subsp. subtilis Soil ++ AY211471 AY212980 AY212960 nd

UCMB-5184 Bs subsp. subtilis Soil – AY211470 AY212979 AY212961 nd

At1 B. amyloliquefaciens Seedling of A. thaliana;

red-pigmented

+++ AY211483 AY212978 nd nd

At2 Bs subsp. subtilis Seedling of A. thaliana; nd AY211484 AY212983 nd nd

At3 Bs subsp. spizizenii Seedling of A. thaliana;

black-pigmented

– AY211485 AY212982 nd nd

At4 B. amyloliquefaciens Seedlings of A. thaliana;

red-pigmented

+++ AY211486 AY212985 nd nd

At5 Bs subsp. subtilis Seedlings of A. thaliana nd AY211487 AY212984 nd ndaT in superscript indicates type strains.b Strains labelled DSM were obtained from the German Collection of Microorganisms and Cell Cultures; strains labeled UCM were from the Ukranian Collection of Microorganisms, all other

strains were from our own collections.c Tentative identifications for isolates described in this study.dColour refers to pigmentation of colony.e Plant colonizing ability, +++, high, ++, medium, +, poor, –, undetectable; nd, not determined.fAccession numbers of sequences obtained in this study begin AY.

O.N

.Reva

etal./FEMSMicro

biologyEcology48(2004)249–259

251


tissue saturated with water and kept under light for 3

days in the climate chamber as described above. Bacillus

treated seeds and 4-day-old embryos of A. thaliana were

fixed in 1% glutaraldehyde in PBS buffer (20 g NaCl, 2 g

KCl, 2 g KH2PO4, 14.1 g NaH2PO4 per l�1 of distilledwater, pH 7.2) for 2 h. Samples were treated with 1%

OsO4 for 1 h, rinsed with distilled water, dehydrated in

acetone gradually by 20% (15 min per each stage) and

finally dried by the critical-point method. They were

coated with platinum/palladium before viewing in a

JEOL SEM 6320 microscope.

2.4. DNA fragment amplification, sequencing and phylo-

genetic analyses

Chromosomal DNA was isolated from late expo-

nential phase nutrient broth cultures by phenol extrac-

tion as described previously [26]. PCRs were performed

on a Hybaid PCR Express thermal cycler using Bi-

oTaqe DNA Polymerase (BioLine). The primers used

and annealing temperatures are shown in Table 2. PCRproducts were electrophoresed in 1.5% agarose (Seakem

LE agarose, Flowgen). PCR products were sequenced in

both directions using an ABI 310 capilliary sequencing

system as described previously [27]. Sequences were

aligned using BioEdit 5.0.9 (http://www.mbio.ncsu.edu/

BioEdit/bioedit.html) and edited manually.

The chromosomal loci upstream to tetB(L) were

prepared by PCR amplification with two inverted PCRprimers TetL_Up and TetB_Dn (Table 2). Chromo-

somal DNA preparations from B. amyloliquefaciens

strains UCMB-5017, B-5113 and B-5044 were cleaved

with HindIII for which no sites were present in the part

of the gene to be amplified, ligated using T4 DNA ligase

and used as template for PCR reactions. The PCR

Table 2

Primers used in this study

Primer Sequence

27f AGAGTTTGATCMTGGCTCAG

685r TCTACGCATTTCACCGCTAC

ABa3 GCACGCTGATGCAGTATTTTGAATGG

ABa4 GGAGCTGTCACCTTCCCTCGTCC

ABs3 ACAGGATCCTCCAGTCTTCACATC

ABs4 GTTCATCATTAAGGATCCTTCAGG

GyrA_F CAGTCAGGAAATGCGTACGTCCTT

GyrA_R CAAGGTAATGCTCCAGGCATTGCT

CheA_F AGGGCTGCCCATACATTAAAAGGAATGAGC

CheA_R AGTTTCAACCGGGACCATTCTCATATTCAG

CheA_MF GAAACGGAKAYATGGMAGTBACMTCARACTGG

CheA_MR TGCTCRAGACGCCCGCGGWCAATGACAAGCTC

YyaO_F GGAACCAGTCCACAGGGTTGTGG

YyaR_F CGATTGAGTGGGCRAAGGAGAATCATTTWTGY

TetB_R CCATATAGAGCTGTTCCAATGGAGAAG

TetL_Up TGAGGGCAGACGCAGTTTATAGGGTCATTGATA

TetB_Dn GCCTTTATGTTAACCTTYTCCATYGGAACWGCT

products derived from templates of ligated HindIII di-

gests of chromosomal DNA were sequenced using the

primer TetL_Up.

Phylogenetic trees were constructed by Neighbour-

Joining and the UPGMA algorithm within BioEdit5.0.9.

3. Results

3.1. Plant colonization by Bacillus isolates

The ability of selected strains to colonize roots ofseedling was tested using both a cereal (barley; H.

vulgare) and a dicotyledonous plant species (oilseed

rape; B. napus). Colonies of inoculant strains were

identified visually and verified by microscopy. No col-

onies of sporeforming bacteria were detected in control

plants treated with sterile water. Of 12 bacterial strains

examined, the red-pigmented strains At1, At4 and

UCMB-5113 were the most efficient at colonizing theroots of seedlings of both barley and oilseed rape. After

growth for four days they could be recovered from root

tissues of both plants in high numbers (approximately

1–2� 106 CFUg�1 wet root tissue; indicated as ‘+++’ in

Table 1). Of the non-pigmented strains of Bacillus,

UCMB-5049 and B-5137 colonized roots reasonably

successfully (approximately 106 CFUg�1 of 4-day-old

barley roots but only 1.0� 0.5� 105 CFUg�1 of 4-day-old oilseed rape roots; indicated as ‘++’ in Table 1).

While strains UCMB-5017 and B-5033 colonized barley

seedling roots efficiently (around 105 CFUg�1) only a

few colonies were isolated from oilseed rape seedling

roots (indicated as ‘+’ in Table 1). The recovery of all

other strains (UCMB-5008, B-5036, B-5044, B-5184 and

Target gene Annealing

temperature (�C)References

16S rRNA 45 This work

16S rRNA 45 This work

amyA 50 [8]

amyA 50 [8]

amyS 50 [8]

amyS 50 [5]

gyrA 50 [29]

gyrA 50 [29]

cheA 50 This work

cheA 50 This work

CTG cheA 50 This work

TTC cheA 50 This work

yyaO 50 This work

GGT yyaR 50 This work

tetB 55 This work

CGC tetL 55 This work

CTR tetB 55 This work

http://www.mbio.ncsu.edu/BioEdit/bioedit.html

http://www.mbio.ncsu.edu/BioEdit/bioedit.html

Table 3

Protection of Arabidopsis thaliana (An-1) against Leptosphaeria maculans (Leroy) and in vitro inhibition of L. maculans by Bacillus strains

Bacillus strains Zone of inhibitiona

(mm)

Protective effect of Bacillus spores applied with a spore suspension of L. maculans in the following

proportions (bacterium/fungus)

107/107 107/105

Dead plants Healthy plants % Dead plants Dead plants Healthy plants % Dead plants

UCMB-5017 15� 3 10 2 83 3 8 27

UCMB-5137 18� 4 8 3 73 0 12 0

UCMB-5033 16� 3 10 2 83 0 12 0

UCMB-5036 14� 3 11 1 92 6 6 50

UCMB-5113 9� 2 0 11 0 0 12 0

Control (infected) 11 1 92 11 1 92

Control (non-infected) 0 12 0 0 12 0a Zone of inhibition of growth of the fungus around colony of the Bacillus (see Section 2 for details).

O.N. Reva et al. / FEMS Microbiology Ecology 48 (2004) 249–259 253

At3) was too low to allow an accurate estimation of

bacterial numbers (indicated as ‘–’ in Table 1).

Oilseed rape plants grown from seeds treated with

spores of Bacillus did not differ from control plants, with

no signs of disease or growth inhibition. However, the

red-pigmented colonies of strains At1, At4 and UCMB-

5113 could be isolated from stems, leaves, flowers and

pods of the treated plants in titres of around1.0� 103CFUg�1 tissue after one month of growth.

Fig. 1. Micrograph of A. thaliana (An-1) seed surface with cells of B.

amyloliquefaciens UCMB-5017 one day after seed treatment with

spores.

Fig. 2. Micrograph of two cells of B. amyloliquefaciensUCMB-5113 on

the surface of A. thaliana (An-1) seeds showing apparent attachment

structures between bacterium and root.

3.2. Plant protection by Bacillus isolates

The abilities of Bacillus strains to protect plants

against phytopathogens relates to antibacterial and

antifungal polypeptide biosynthesis, and to the abilities

of these strains to survive on plant roots. In our exper-iments, seeds of A. thaliana were treated with Bacillus

spore suspensions mixed with spores of the phytopath-

ogenic fungus L. maculans. The fungal growth was

registered after incubation for one week. Concomi-

tantly, the antagonistic activity of the Bacillus strains

was tested in vitro as zones of inhibition of fungal

growth. Strains UCMB-5017 and UCMB-5036 showed

high antifungal activity on plates but protected only halfof the phytopathogen-treated A. thaliana seeds (Table

3), while the red-pigmented strain (UCMB-5113) was

characterized by a relatively weak antagonistic activity

on plates but complete protection of the plant seedlings.

Plant–microbe interactions often involve release of

bacteriocidal substances by the plant to suppress bac-

terial growth in the rhizosphere. We investigated the

effects of root secretions by A. thaliana on the develop-ment of two strains, the successful root colonizer,

UCMB-5113 (red-pigmented) and strain UCMB-5017

which is non-pigmented and a poor root colonizer. After

treatment of the seeds with Bacillus spores, the seed

surface was periodically examined during seed germi-

nation for the presence of spores and vegetative cells by

SEM. Spores of both strains successfully germinated on

the seed surface after one day (Fig. 1) and, in the case of

the more successful plant-colonizing strain, structures

apparently attaching the bacterium to the root surfacewere apparent (Fig. 2). Seed germination started 2–3

days after treatment (Fig. 3(a) and (b)). At this time

changes in cell morphology were apparent in strain

UCMB-5017. The cells near the root of the seedling

were depressed (Fig. 3(c)) perhaps due to the release of

bacteriocidal substances by plant roots. One day later,

no cells of strain UCMB-5017 were visible, only empty

cell walls were observed on the seed surface (Fig. 4(a)).Conversely, cells of strain UCMB-5113 formed a cell

Fig. 3. A general view of a 3-day-old seedling of A. thaliana (An-1); (b)

magnified view of a region marked by white rectangle on picture (a)

with multiple cells of B. amyloliquefaciens UCMB-5017 apparent (in-

dicated by arrows); (c) bacterial cells with decomposed structures.


layer on the seed surface (Fig. 4(b)) and microcolonies

were apparent in the root hair zone (not shown).

3.3. Taxonomy of plant-associated Bacillus isolates

We were also interested to characterize the Bacillus

strains taxonomically to determine if plant colonizingand protective features correlated with phylogenetic

groups. We amplified and compared the hypervariable

50-regions (nucleotides 115–485) of the 16S rRNA genes

Fig. 4. A. thaliana (An-1) seed coats inoculated with spores of B. amyloliquef

the presence of Bacillus by SEM after 4 days of germination. Only empty cel

seed surface heavily.

of the strains since this region has been observed to be

useful for classification and identification of endospore-

forming bacteria [8,28]. Nine polymorphic taxon-spe-

cific sites within the partial 16S rRNA sequences of the

strains were determined (Table 4). Analysis of the sec-ondary structure of the rRNA molecules revealed that

the variable nucleotides were located outside of base

paired regions (loops), or that they comprised base pairs

within stem structures, for example at sites 185/202 and

465/483. The 465/483 nucleotide pair showed two al-

ternatives: A/T (B. mojavensis and B. subtilis) or G/C (B.

amyloliquefaciens, B. atrophaeus and B. vallismortis).

Similarly, the T/A pair at positions 185/202 was presentin most of the reference strains but it was altered to C/G

in the plant-associated strains of B. amyloliquefaciens.

However, the type strain of B. amyloliquefaciens had the

unmatched pair T/G at positions 185/202 (Table 4).

Analysis of the 16S rRNA gene sequences revealed

that strains UCMB-5017, B-5033, B-5036, B-5044, B-

5113, At1 and At4 were closely related to the type strain

of B. amyloliquefaciens but distinguished by the poly-morphisms noted above and the bright red colony pig-

mentation apparent with strains UCMB-5113, At1 and

At4. Strains UCMB-5051 and B-5075 were associated

with B. mojavensis species. Strains UCM B-5049, B-

5137, B-5184, At2 and At5 were assigned to B. subtilis

on the basis of the partial 16S rRNA sequence com-

parisons, but it was impossible to refer them to sub-

species subtilis or spizizenii.In order to clarify further the classification of these

bacteria we analysed the gyrA gene, which has previ-

ously been shown to be effective for resolving these

closely related taxa of the B. subtilis group [29]. We

amplified and aligned sequences from nucleotides 226 to

1015 of gyrA for our isolates and built a neighbour-

joining tree (Fig. 5). Most strains isolated from plants,

including the red-pigmented strains, comprised amonophyletic lineage encompassing the type strain of B.

amyloliquefaciens. A second cluster of strains (based on

UCMB-5137) was recovered close to B. subtilis subsp.

aciens strains UCMB-5017 (a) and UCMB-5113 (b) were analysed for

l walls of strain B-5017 were present while strain B-5113 colonized the

Table 4

Comparison of hypervariable regions of 16S rRNA sequences of selected plant-associated strains and reference strains

Strains and alleles Positions of variable nucleotides

180 185 202 234 271 285 465 472 483

B. amyloliquefaciens DSM 7T C T G G C G G A C

B. amyloliquefaciens UCMB-5017, B-5033,

B-5036, B-5044, B-5113, At1, At4

G C G G C G G A C

B. atrophaeus DSM 7264T C T A G C A G A C

B. mojavensis DSM 9205T, UCMB-5051 C T A G C A A G T

B. mojavensis UCMB-5075 C T A A C A A G T

B. subtilis subsp. subtilis DSM10T,

UCMB-5184, At2, At5

G T A G C A A G T

Bs subsp. subtilis UCMB-5049, B-5137 G T A G T A A G T

Bs subsp. subtilis 168 alleles

rrnB, D, G, H, W G T A G C A A G T

rrnE, I G T A G T A A G T

rrnA G T A G C G A G T

rrnO G T A G C G G G T

rrnJ G T A G T A G G T

B. subtilis subsp. spizizenii DSM 347T C T A G T A A G T

Bs subsp. spizizenii UCMB-5008 C T A A C A A G T

Bs subsp. spizizenii UCMB-5014 C T A A T A A G T

Bs subsp. spizizenii AT3 C T A G C A A G T

B. vallismortis DSM11031T C T A G T A G A C


subtilis (strains DSM 10T and 168). Strains UCMB-5051

(not shown, only a partial sequence was obtained) and

UCMB-5075 were recovered close to B. mojavensis. Fi-

nally, two black-pigmented strains, UCMB-5008 and

At3, had almost identical sequences and shared 95%

similarity with the type strain of B. subtilis subsp. spiz-

izenii. A non-pigmented strain UCMB-5014 was also

located near here.To evaluate the gyrA phylogeny, we analysed the

cheA gene for selected strains. This key enzyme of bac-

terial chemotaxis is broadly distributed among all

Gram-positive and Gram-negative eubacteria and is

crucial for effective plant colonization by endophytic

Pseudomonas [30]. This background suggested that cheA

may reveal particular variation in this collection of

Fig. 5. Phylogenetic tree based on partial gyrA nucleotide sequences.

The scale bar indicates 0.1 nucleotide substitutions per nucleotide

position. Letter T marks type strains.

plant-associated bacteria. Two primers (CheA_F/

CheA_R) were derived from the B. subtilis 168 genome

sequence targeted to positions 127–156 and 1048–1077,

respectively. Sequences of the PCR products obtained

for selected reference strains were then used to design

primers CheA_MF/CheA_MR (Table 2). PCR products

amplified with these new primers were sequenced,

aligned and a neighbour-joining tree was constructedfrom the region between positions 325 and 891 of the B.

subtilis 168 cheA gene (Fig. 6). The topology and allo-

cation of strains to clades in the cheA tree were similar

to the gyrA tree, and the group of plant-associated

strains related to B. amyloliquefaciens was again evident.

The well characterized a-amylase genes of B. subtilis

and B. amyloliquefaciens have been used for distin-

Fig. 6. Phylogenetic tree based on partial cheA nucleotide sequences.

The scale bar indicates 0.1 nucleotide substitutions per nucleotide

position. Letter T marks type strains.

Fig. 7. Gene organization of regions near tetB(L) in chromosomes of B. subtilis subsp. subtilis 168 and B. amyloliquefaciens strains UCMB-5113, B-

5017 and B-5044. Arrowheads show parts of DNA targeted by primers TetB_R,YyaO_F and YyaR_F.


guishing strains of these closely related species. We

consequently amplified this gene using two pairs of

standard primers ABa1/ABa2 and ABs1/ABs2 specific

for the a-amylase genes of B. amyloliquefaciens and B.

subtilis respectively [8]. Primers ABs1/ABs2 were diag-nostic for B. subtilis subsp. subtilis strains and failed to

produce a product when DNA from B. subtilis subsp.

spizizenii DSM 347T was used as template. Primers

ABa1/ABa2 produced a product of the correct size with

DNA from B. amyloliquefaciens strains DSM 7T and H

and B. mojavensis DSM 9205T and strains UCMB-5051

and B-5075, but failed with all the plant-associated

strains of B. amyloliquefaciens.The ability to survive in the plant rhizosphere envi-

ronment, which is replete with antibiotics, may rely on

an effective system of efflux proteins that limit the ac-

cumulation of antibacterial substances in the cytoplasm.

One such transporter that confers maintenance of gen-

eral homeostasis and antibiotic resistance is the anti-

porter encoded by genes tetB-tetL [31,32]. These genes

are located near the origin of replication in B. subtilis

168 [33]. Chromosomal rearrangements were detected in

the strains of B. amyloliquefaciens compared to B. sub-

tilis 168 (Fig. 7). The gene yyaR (function unknown)

located 2003 bp downstream to tetB(L) in B. subtilis

168 appeared upstream next to tetB(L) in the B. amy-

loliquefaciens strains. In B. subtilis 168, tetB(L) are

adjacent to yyaO. To confirm this arrangement in the

other strains, two primers YyaO_F and YyaR_F de-rived from the 30-end of yyaO and yyaR were designed

and used for PCR amplification together with the re-

Table 5

Discrimination by PCR of plant-associated bacteria related to B. amylolique

Species and strains

B. amyloliquefaciens DSM 7T, H

B. amyloliquefaciens AT1, AT4, UCMB-5017, B-5033, B-5036, B-5044, B-5

B. atrophaeus DSM 7264T

B. mojavensis DSM 9205T UCMB-5051, B-5075

B. subtilis subsp. subtilis DSM 10T At2, At5, UCMB-5049, B-5137, B-518

B. subtilis subsp. spizizenii DSM 347T At3, UCMB-5008, B-5014

B. vallismortis DSM 11031T

‘+’, PCR products of expected size were detected by gel electrophoresis.

‘–’, PCR products of expected size were not detected by gel electrophore

versed primer TetB_R targeted to the 50-end of tetB.

PCR products were amplified using the primer pair

TetB_R/YyaR_F from all B. amyloliquefaciens strains

including the type strain and strain H, but no products

were amplified with strains of all other taxa used in thisstudy. Conversely, the primer pair TetB_R/YyaO_F

worked solely with B. subtilis subsp. subtilis strains and

did not amplify sequences from all other strains in-

cluding the type strain of B. subtilis subsp. spizizenii

(Table 5).

4. Discussion

The ability to colonize plants is a multifactorial

process requiring resistance to plant defence systems as

well as the ability to initiate growth on plant surfaces,

invade tissues and develop within the plant. In return for

a safe and nutrient rich environment, the bacterium may

provide the host with resistance to plant pathogens

through the synthesis of antibiotics and enzymes andpromote plant growth [1,5,15–17]. Indeed, it seems that

some bacteria become intimately associated with the

plant since strains of B. amyloliquefaciens (At1, At4 and

UCMB-5113) could be isolated in reasonably high titres

from stems, leaves and pods of oilseed rape plants one

month after initial treatment of the seed. Moreover,

vertical transmission of these strains from plant to plant

via the seeds was indicated by the isolation of severalstrains, including At1 and At4, from seedlings derived

faciens and B. subtilis

Target genes/regions and primer pairs

amyS (Abs3/

Abs4)

amyA (Aba3/

Aba4)

tetB YyaO_F/

TetB_R

tetB YyaR_F/

TetB_R

– + – +

113 – – – +

– – – –

– + – –

4 + – + –

– – – –

– – – –

sis.


from surface sterilized seeds and grown in a gnotobiotic

environment.

For effective initiation of colonization, the bacterium

must attach to the seed surface, primary roots and root

hairs, and survive the bacteriocidal substances releasedby roots. A comparison of a relatively poor colonizing

bacterium, B. amyloliquefaciens strain UCMB-5017, and

the more efficient colonizer, B. amyloliquefaciens

UCMB-5113, revealed that the latter formed a thick

layer on the seed surface while the former was appar-

ently inhibited and subsequently killed, maybe by bac-

teriocidal substances from the root. Moreover, strain

UCMB-5113 produced surface structures that appearedto anchor the bacterium to the root surface (Fig. 2). It

would seem that this bacterium is well adapted to seed

and root colonization. This effective plant colonization

ability for B. amyloliquefaciens UCMB-5113 was asso-

ciated with a high level of protection against the phy-

topathogen L. maculans, although it showed limited

antagonistic activity against the fungus in vitro. In

contrast other strains had distinct antifungal activity invitro but showed limited in vivo protection (Table 3).

The most probable explanations for this are that (i)

colonizing ability is a key to successful plant protection

and (ii) the environment within the plant may induce the

bacterium to synthesize antifungal compounds that are

not produced in vitro. Moreover, inoculation of plants

with endophytic bacteria can result in induced systemic

resistance in the host plant. The phenomenon of inducedsystemic resistance involves release of antibiotic sub-

stances in response to bacterial challenge and was first

demonstrated with an endophytic Pseudomonas strain,

but has also been noted when B. amyloliquefaciens was

used as a biocontrol agent [34–36]. These findings sug-

gest that in vitro antifungal bioassays can be misleading

in assessing the biocontrol properties of an organism.

The bacteria included in this study were largely iso-lated from plants or from soil intimately associated with

plant roots. However, the abilities to colonize plants in

the laboratory may not necessarily relate to their ori-

gins. For example, some strains isolated from the inner

tissues of cotton plants, such as B. amyloliquefaciens

UCMB-5036 and UCM B-5044, did not colonize the

roots of barley or oilseed rape plants to any appreciable

extent. This indicates specificity of bacterial strains to-wards certain host plants. Moreover, while various

strains, including some that produced red-pigmented

colonies, colonized our test plants effectively, others did

not. We therefore characterized the bacteria to deter-

mine any relationships between taxonomy and plant

colonizing ability.

Sequence analysis of partial 16S rRNA genes revealed

that all strains were closely related to B. amyloliquefac-

iens and B. subtilis. This is consistent with several pre-

vious studies in which strains of these species have been

commonly encountered as plant colonizing bacteria

[5,6,9,16,37]. While the partial 16S rRNA sequences

provided insufficient resolution to distinguish the vari-

ous subspecies and close relatives of B. subtilis, a group

of strains was evident characterized by a G residue at

position 202, typical of B. amyloliquefaciens, and yethaving a unique C at position 185. This suggested a

group of strains closely related to, but distinct from B.

amyloliquefaciens. All strains in this group were isolated

from plants and many had good plant colonizing

properties. Three red-pigmented strains were included in

this group. Such pigmentation is rare in B. amylolique-

faciens and in Bacillus in general.

In order to analyse more thoroughly this group ofplant-associated strains, we compared partial gyrA se-

quences which have been shown to be useful for dis-

tinguishing B. subtilis from its close relatives [29]. gyrA

sequences of the seven B. amyloliquefaciens-like strains

formed a monophyletic group with the sequences from

the three red-pigmented strains clustering together

(Fig. 5) and two strains (UCMB-5036 and B-5044)

which failed to colonize barley and oilseed rape rootsforming another subgroup. All seven bacteria were

closely related to the type strain of B. amyloliquefaciens

on the basis of gyrA sequences. Other isolates were

identified according to their nearest relative, although it

is apparent that there is some sequence variation in the

B. subtilis subsp. spizizenii, B. subtilis subsp. subtilis, and

B. mojavensis clades. It is not clear how much variation

in gyrA may be associated with a taxon since, with theexception of B. subtilis subsp. subtilis, branches in the

original study were represented by single strains. Al-

though the results from our strains support the use of

this gene for species recognition in this group since it

enabled approximate assignment of strains to a taxon,

we sought further evidence from a second gene, cheA.

Plant colonization is believed to be an active process

that requires bacteria to respond to the complex envi-ronment of the plant rhizosphere which is replete with

antibiotics and chemical signals. It may be expected,

therefore, that endophytic bacteria have evolved sensi-

tive and finely tuned chemotactic responses. Indeed,

cheA mutants of Pseudomonas fluorescens are defective

in both flagella-driven chemotaxis and tomato root

colonization [30]. We therefore used the cheA gene as a

phylogenetic marker for the B. amyloliquefaciens strainsisolated from plants. The resultant tree (Fig. 6) was to-

pologically consistent with the gyrA tree and confirmed

strain allocation to taxa. It also revealed that cheA was

changing approximately five times faster than gyrA in

these organisms. Moreover, while the gyrA alleles con-

tained many synonymous changes, the cheA alleles were

characterized by non-synonymous changes, insertions

and deletions, suggesting rapid adaptation to the rhi-zosphere environment by these bacteria.

A simple PCR-based diagnostic procedure for iden-

tification of B. amyloliquefaciens and the related plant-


associated taxa would be useful for identification of

strains isolated from plants or used for biocontrol pur-

poses. The existing PCR test for identification of B.

amyloliquefaciens strains based on the a-amylase gene of

the organism [5] was not useful since the primers failedto amplify a product from the plant-associated strains.

We therefore analysed the tetB(L) antiporter genes of

these strains. A different organization of these genes was

discovered in B. amyloliquefaciens strains compared

with strains of B. subtilis subsp. subtilis (Fig. 7) which

enabled the design of diagnostic primers YyaR_F/

TetB_R that amplified a product from B. amylolique-

faciens DNA (both the type strain and plant-associatedstrains) but not from DNA of strains of B. atrophaeus,

B. mojavensis, B. subtilis subsp. subtilis and subsp.

spizizenii. Thus the plant-associated strains can be

recognized by a positive reaction with the tetB(L)

primers and a negative reaction with those for a-amylase

(Table 5).

The precise taxonomic status of the plant-associated

strains of B. amyloliquefaciens remains unclear. Theseorganisms have much in common with B. amylolique-

faciens sensu stricto, the tetB(L) region of the chromo-

some has the same arrangement and cheA is very

similar. But in other aspects they are distinguishable,

there is a signature base in the 16S rRNA gene (C/G at

positions 185/202 in the plant-associated strains of B.

amyloliquefaciens compared with the unmatched pair T/

G in the type strain, see Table 4), the a-amylase geneappears to be dissimilar from that of the type strain

since it is not amplified by amyA primers, and the gyrA

sequences vary. In many respects these bacteria have the

properties of an ecotype which Cohan defines as ‘‘a set

of strains using the same or similar ecological resources’’

[38]. The ecotype concept includes consideration of

competition between adaptive mutants and is similar to

the clone in bacterial population genetics [39]. A bac-terial ecotype can be identified as a sequence cluster [38]

just as multilocus sequence typing indicates clones in

bacterial species [40]. On the basis of the cheA and the

gyrA sequence data and other information presented

here, it would seem that the plant-associated strains of

B. amyloliquefaciens could be considered a distinct

ecotype within this species.

Acknowledgements

Reva O. is grateful to the Society for General Mi-

crobiology of United Kingdom and the Swedish Insti-

tute (SI) with C.F. Lundstr€oms Stifftelse for financial

support of this work through the International Research

Fellowships Grant scheme and New VISBY ProgramFellowship Grant respectively. We are grateful to Hans

Ekwall, Dept. of Anatomy and Histology, the Swedish

University of Agricultural Sciences (SLU), for assistance

with the scanning electron microscopy. Inger Happsta-

dius, Sval€ov-Weibull AB is gratefully acknowledged for

providing B. napus seeds and the fungal isolate and we

thank Dr. Peter Morris, Heriot-Watt University, for

providing barley seeds and assistance with barley ex-periments.

References

[1] Chanway, C.P. (1998) Bacterial endophytes: ecological and

practical implication. Sydowia, 149–170.

[2] Cook, R.J. (1990) Twenty-five years of progress towards biolog-

ical control. In: Biological Control of Soil-borne Plant Pathogens

(Hornby, D., Ed.), pp. 1–14. CAB International, Wallingford,

UK.

[3] Gilbert, G.S. and Parke, J.L. (1993) Effects of an introduced

bacterium on bacterial communities on roots. Ecology 74, 840–

854.

[4] Chanway, C.P., Shishido, M., Nairn, J., Jungwirth, S., Markham,

J., Xiao, G. and Holl, F.B. (2000) Endophytic colonization and

field responses of hybrid spruce seedlings after inoculation with

plant growth-promoting rhizobacteria. Forest Ecol. Manag. 133,

81–88.

[5] Emmert, E.A.B. and Handelsman, J. (1999) Biocontrol of plant

disease: a (Gram-) positive perspective. FEMS Microbiol. Lett.

171, 1–9.

[6] Sharga, B.M. and Lyon, G.D. (1998) Bacillus subtilis BS 107 as an

antagonist of potato blackleg and soft rot bacteria. Can. J.

Microbiol. 44, 777–783.

[7] Turner, J.T. and Backman, P.A. (1991) Factors relating to peanut

yield increases after seed treatment with Bacillus subtilis. Plant

Dis. 75, 347–353.

[8] Idriss, E.E., Makarewicz, O., Farouk, A., Rosner, K., Greiner, R.,

Bochow, H., Richter, T. and Borriss, R. (2002) Extracellular

phytase activity of Bacillus amyloliquefaciens FZB45 contributes

to its plant-growth-promoting effect. Microbiology 148, 2097–

2109.

[9] Manjula, K. and Podile, A.R. (2001) Chitin-supplemented

formulations improve biocontrol and plant growth promoting

efficiency of Bacillus subtilis AF1. Can. J. Microbiol. 47, 618–

625.

[10] Wang, S.L., Shih, I.L., Liang, T.W. and Wang, C.H. (2002)

Purification and characterization of two antifungal chitinases

extracellularly produced by Bacillus amyloliquefaciens V656 in a

shrimp and crab shell powder medium. J. Agric. Food Chem. 50,

2241–2248.

[11] Leifert, C., Li, H., Chidburee, S., Hampson, S., Workman, S.,

Sigee, D., Epton, H.A. and Harbour, A. (1995) Antibiotic

production and biocontrol activity by Bacillus subtilis CL27 and

Bacillus pumilus CL45. J. Appl. Bacteriol. 78, 97–108.

[12] Pinchuk, I.V., Bressollier, P., Sorokulova, I.B., Verneuil, B. and

Urdaci, M.C. (2002) Amicoumacin antibiotic production and

genetic diversity of Bacillus subtilis strains isolated from different

habitats. Res. Microbiol. 153, 269–276.

[13] Raaijmakers, J.M., Vlami, M. and de Souza, J.T. (2002) Antibi-

otic production by bacterial biocontrol agents. Antonie Van

Leeuwenhoek 81, 537–547.

[14] Walker, R., Powell, A.A. and Seddon, B. (1998) Bacillus isolates

from the spermosphere of peas and dwarf French beans with

antifungal activity against Botrytis cinerea and Phytium species. J.

Appl. Microbiol. 84, 791–801.

[15] Hallmann, J., Quadt-Hallmann, A., Mahafee, W.F. and Kloep-

per, J.W. (1997) Bacterial endophytes in agricultural crops. Can. J.

Microbiol. 38, 303–308.


[16] Krebs, B., Hoding, B., Kubart, S., Workie, M.A., Junge, H.,

Schmiedeknecht, G., Grosch, R., Bochow, H. and Hevesi, M.

(1998) Use of Bacillus subtilis as biocontrol agents. I. Activity and

characterization of Bacillus subtilis strains. J. Plant Dis. Protect.

105, 181–197.

[17] Wipat, A. and Harwood, C.R. (1999) The Bacillus subtilis genome

sequence: the molecular blueprint of a soil bacterium. FEMS

Microbiol. Ecol. 28, 1–9.

[18] Nakamura, L.K. (1989) Taxonomic relationship of black-pig-

mented Bacillus subtilis strains and proposal for Bacillus atropha-

eus sp. nov. Int. J. Syst. Bacteriol. 39, 295–300.

[19] Roberts, M.S., Nakamura, L.K. and Cohan, F.M. (1994) Bacillus

mojavensis sp. nov., distinguishable from Bacillus subtilis by

sexual isolation, divergence in DNA sequence, and differences

in fatty acid composition. Int. J. Syst. Bacteriol. 44,

256–264.

[20] Roberts, M.S., Nakamura, L.K. and Cohan, F.M. (1996) Bacillus

vallismortis sp. nov., a close relative of Bacillus subtilis, isolated

from soil in Death Valley, California. Int. J. Syst. Bacteriol. 46,

470–475.

[21] Nakamura, L.K., Roberts, M.S. and Cohan, F.M. (1999) Rela-

tionship of Bacillus subtilis clades associated with strains 168 and

W23: a proposal for Bacillus subtilis subsp. subtilis subsp. nov. and

Bacillus subtilis subsp. spizizeni subsp. nov. Int. J. Syst. Evolut.

Microbiol. 49, 1211–1215.

[22] Reva, O.N., Sorokulova, I.B. and Smirnov, V.V. (2001) Simplified

technique for identification of the aerobic spore-forming

bacteria by phenotype. Int. J. Syst. Evolut. Microbiol. 51, 1361–

1371.

[23] Sorokulova, I.B., Reva, O.N., Smirnov, V.V., Pinchuk, I.V.,

Lapa, S.V. and Urdaci, M.C. (2003) Genetic diversity and

involvement in bread spoilage of Bacillus strains from flour and

ropy bread. Lett. Appl. Microbiol. 37, 169–173.

[24] Bohman, S., Staal, J., Thomma, B.P.H.J., Wang, M. and Dixelius,

C. (2004) Characterisation of an Arabidopsis–Leptosphaeria mac-

ulans pathosystem: resistance partially requires camalexin biosyn-

thesis and is independent of salicylic acid, ethylene and jasmonic

acid signalling. Plant J. 37, 9–20.

[25] Koch, E., Song, K., Osborn, T.C. and Williams, P.W. (1991)

Relationship between pathogenicity and phylogeny based on

restriction fragment length polymorphism in Leptosphaeria mac-

ulans. Mol. Plant–Microbe Interact. 4, 341–349.

[26] De Silva, S., Pettersson, B., Aquino de Muro, M. and Priest, F.G.

(1998) A DNA probe for the detection and identification of

Bacillus sporothermodurans using the 23S-16S rDNA spacer region

and phylogenetic analysis of some field isolates of Bacillus which

form highly heat resistant spores. Syst. Appl. Microbiol. 21, 398–

407.

[27] van Beek, S. and Priest, F.G. (2002) Evolution of the lactic acid

bacterial community during malt whisky fermentation: a poly-

phasic study. Appl. Environ. Microbiol. 68, 297–305.

[28] Goto, K., Omura, T., Hara, Y. and Sadaie, Y. (2000) Application

of the partial 16S rDNA sequence as an index for rapid

identification of species in the genus Bacillus. J. Gen. Appl.

Microbiol. 46, 1–8.

[29] Chun, J. and Bae, K.S. (2000) Phylogenetic analysis of Bacillus

subtilis and related taxa based on partial gyrA gene sequences.

Antonie van Leeuwenhoek 78, 123–127.

[30] de Weert, S., Vermeiren, H., Mulders, I.H., Kuiper, I., Hendrickx,

N., Bloemberg, G.V., Vanderleyden, J., De Mot, R. and Lugten-

berg, B.J. (2002) Flagella-driven chemotaxis towards exudate

components is an important trait for tomato root colonization by

Pseudomonas fluorescens. Mol. Plant–Microbe Interact. 15, 1173–

1180.

[31] Bechhofer, D.H. and Stasinopoulos, S.J. (1998) tet A(L) mutants

of a tetracycline-sensitive strain of Bacillus subtilis with the

polynucleotide phosphorylase gene deleted. J. Bacteriol. 180,

3470–3473.

[32] Cheng, J., Guffanti, A.A. and Krulwich, T.A. (1994) The

chromosomal tetracycline resistance locus of Bacillus subtilis

encodes a Naþ/Hþ antiporter that is physiologically important

at elevated pH. J. Biol. Chem. 44, 27365–27371.

[33] Kunst, F., Ogasawara, N. and Moszer, I., et al. (1997) The

complete genome sequence of the Gram-positive bacterium

Bacillus subtilis. Nature 390, 249–256.

[34] Ahn, I.P., Park, K. and Kim, C.H. (2002) Rhizobacteria-induced

resistance perturbs viral disease progress and triggers defense-

related gene expression. Mol. Cells 13, 302–308.

[35] Benhamou, N. and Nicole, M. (1999) Cell biology of plant

immunization against microbial infection: the potential of induced

resistance in controlling plant diseases. Plant Physiol. Biochem.

37, 703–719.

[36] Hammond-Kosack, K.E. and Jones, J.D.G. (1997) Plant disease

resistance genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,

575–607.

[37] Misaghi, I.J. and Dondelinger, C.R. (1990) Endophytic bacteria in

symptom-free cotton plants. Phytopathology 9, 808–811.

[38] Cohan, F.M. (2002) What are bacterial species? Annu. Rev.

Microbiol. 56, 547–587.

[39] Smith, M.J., Feil, E.J. and Smith, N.H. (2000) Population

structure and evolutionary dynamics of pathogenic bacteria.

BioEssays 22, 1115–1122.

[40] Feil, E.J., Maiden, M.C., Achtman, M. and Sprat, B.G. (1999)

The relative contributions of recombination and mutation to the

divergence of clones of Neisseria meningitides. Mol. Boil. Evol. 16,

1496–1502.

Taxonomic characterization and plant colonizing abilities of some bacteria related to Bacillus...

Documents

Transcript of Taxonomic characterization and plant colonizing abilities of some bacteria related to Bacillus...