Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/6686879

SNP-basedmarkersfordiscriminatingolive(OleaeuropaeaL.)cultivars

ArticleinGenome·October2006

DOI:10.1139/g06-068·Source:PubMed

CITATIONS

76

READS

159

9authors,including:

Someoftheauthorsofthispublicationarealsoworkingontheserelatedprojects:

GeneticcharacterizationofItaliancattlebreedViewproject

SilviaReale

UniversitàdegliStudidelMolise

36PUBLICATIONS264CITATIONS

SEEPROFILE

AntonellaAngiolillo

UniversitàdegliStudidelMolise

61PUBLICATIONS1,271CITATIONS

SEEPROFILE

FabioPilla

UniversitàdegliStudidelMolise

93PUBLICATIONS1,224CITATIONS

SEEPROFILE

DavidLee

85PUBLICATIONS1,528CITATIONS

SEEPROFILE

AllcontentfollowingthispagewasuploadedbyDavidLeeon03December2016.

Theuserhasrequestedenhancementofthedownloadedfile.Allin-textreferencesunderlinedinblueareaddedtotheoriginaldocument

andarelinkedtopublicationsonResearchGate,lettingyouaccessandreadthemimmediately.

SNP-based markers for discriminating olive (Oleaeuropaea L.) cultivars

S. Reale, S. Doveri, A. Dıaz, A. Angiolillo, L. Lucentini, F. Pilla, A. Martın, P. Donini,and D. Lee

Abstract: A set of 11 polymorphic markers (1 cleaved amplified polymorphic sequence (CAPS), 2 sequence-characterizedamplified regions (SCARs), and 8 single-nucleotide polymorphism (SNP) - derived markers) was obtained for olive culti-var identification by comparing DNA sequences from different accessions. Marker development was more efficient, usingsequences from the database rather than cloning arbitrary DNA fragments. Analyses of the sequences of 3 genes from 11diverse cultivars revealed an SNP frequency of 1 per 190 base pairs in exons and 1 per 149 base pairs in introns. Mostmutations were silent or had little perceptible effect on the polypeptide encoded. The higher incidence of transversions(55%) suggests that methylation is not the major driving force for DNA base changes. Evidence of linkage disequilibriumin 2 pairs of markers has been detected. The set of predominantly SNP-based markers was used to genotype 65 olive sam-ples obtained from Europe and Australia, and was able clearly to discriminate 77% of the cultivars. Samples, putatively ofthe same cultivar but derived from different sources, were revealed as identical, demonstrating the utility of these markersas tools for resolving nomenclature issues. Genotyping data were used for constructing a dendrogram by UPGMA clusteranalysis using the simple matching similarity coefficient. Relationships between cultivars are discussed in relation to theroute of olive’s spread.

Key words: Olea europaea, SNPs, SCARs, molecular markers, cultivar identification.

Resume : Onze marqueurs (1 CAPS, 2 SCAR et 8 SNP) ont ete obtenus pour des fins d’identification varietale chezl’olivier en comparant les sequences d’ADN de differentes accessions. Le developpement de tels marqueurs s’est avereplus efficace en faisant appel aux sequences des banques de donnees qu’en clonant des fragments arbitraires d’ADN.L’analyse de la sequence de trois genes chez 11 cultivars differents a revele une frequence de 1 SNP par 190 pb au seindes exons et de 1 SNP par 149 pb dans les introns. La majorite des mutations etaient silencieuses ou entraınaient peud’effets perceptibles sur le polypeptide code. L’incidence superieure de transversions (55 %) suggere que la methylationn’est pas la force majeure induisant des mutations. Des evidences de desequilibre de liaison ont ete obtenues pour deuxpaires de marqueurs. Ce jeu de marqueurs, principalement de type SNP, a ete employe pour genotyper 65 echantillonsd’olivier provenant d’Europe et d’Australie et a permis de differencier 77 % des cultivars. Des echantillons, vraisemblable-ment du meme cultivar mais obtenus de differentes sources, se sont montres identiques ce qui demontre l’utilite de cesmarqueurs pour resoudre des problemes de nomenclature. Les donnees genotypiques ont ete employees pour produire undendrogramme par groupement UPGMA a l’aide du coefficient de similarite « simple matching ». Les relations entre lescultivars sont discutees en relation avec la route qu’aurait suivie l’olivier lors de sa dissemination.

Mots cles : Olea europaea, SNP, SCAR, marqueurs moleculaires, identification varietale.

[Traduit par la Redaction]

Introduction

Olive (Olea europaea L.) is the most important oil-producing crop grown throughout the Mediterranean ba-sin. It is an outcrossing diploid species (2n = 46) thatshows differences in self-incompatibility depending onthe cultivar considered (Cuevas et al. 2001; Wu et al.2002; Dıaz et al. 2006b). Though olive is cultivatedmainly in Mediterranean countries, in the last few yearsgrowth of olive production has expanded throughout theworld to countries such as Australia, Canada, China,Peru, Chile, Argentina, and the United States.

A high occurrence of mislabelling, homonyms, and syno-nyms has been reported in olive (Barranco and Rallo 2000).Therefore, easy and accurate cultivar identification is an ur-gent necessity to manage properly the rich variability ofolive. In this sense, important efforts are being made to ob-

Received 15 June 2005. Accepted 17 May 2006. Published onthe NRC Research Press Web site at http://genome.nrc.ca on8 November 2006.

Corresponding Editor: B. Golding.

S. Reale1 and F. Pilla. Dipartimento S.A.V.A, Universita delMolise, Via de Sanctis snc, 86100 Campobasso, Italy.S. Doveri, P. Donini, and D. Lee. Molecular Research Group,NIAB, Huntingdon Road, Cambridge CB3 0LE, UK.A. Dıaz and A. Martın. Instituto de Agricultura Sostenible(IAS, CSIC), Alameda del Obispo, s/n, 14080 Cordoba, Spain.A. Angiolillo. Dipartimento S.pe.S, Universita del Molise, Viade Sanctis snc, 86100 Campobasso, Italy.L. Lucentini. Dipartimento di Biologia Cellulare e Ambientale,Universita degli Studi di Perugia, Via Pascoli, 1, 06123 Perugia,Italy.

1Corresponding author (e-mail: reale@unimol.it).

1193

Genome 49: 1193–1205 (2006) doi:10.1139/G06-068 # 2006 NRC Canada

tain a unique and unequivocal genetic profile for every cul-tivar using RAPD, AFLP, and SSR markers in the most im-portant olive collections, such as the World OliveGermplasm Bank of Cordoba (Spain; Rallo et al. 2000; Be-laj et al. 2001, De la Rosa et al. 2002; Dıaz et al. 2006a),the Germplasm Collection of Valencia (Spain; Sanz-Corteset al. 2001), the CBNMP Olive Collection (France; Khadariet al. 2003), the Olive Collection in the experimental or-chards of the University of California at Davis (USA; Fabbriet al. 1995), the National Olive Variety Assessment (NOVA)Collection at the Roseworthy Campus of the University ofAdelaide (Australia; Guerin et al. 2002), the Olive Collec-tion Orchard in Slovenia (Bandelj et al. 2002), and the OliveCollection in Israel (Wiesman et al. 1998).

Additionally, molecular markers have been employed tomeasure genetic distances of olive accessions: random ampli-fied polymorphic DNAs (RAPDs) (Fabbri et al. 1995; Besnardet al. 2001), amplified fragment length polymorphisms(AFLPs) (Angiolillo et al. 1999), inter-simple-sequence re-peats (ISSRs) (Hess et al. 2000; Vargas and Kadereit 2001),and simple sequence repeats (SSRs) (Carriero et al. 2002;Belaj et al. 2004; Dıaz et al. 2006a). All of these markershave proven powerful tools for assessing genetic variation inolive germplasm. Despite the potential advantages of usingsingle-nucleotide polymorphisms (SNPs), widely used fordifferent applications in human genetics (Collins et al.1998; Wang et al. 1998; Cargill et al. 1999; Marnellos2003; Salisbury et al. 2003) and in the major crop species(Tenaillon et al. 2001; Rafalski 2002; Schmid et al. 2003;Zhu et al. 2003; Chiapparino et al. 2004), identification ofSNP markers has not been documented in olive. Comparedwith other genetic markers, SNPs are more abundant in thegenome, are stably inherited, and can occur in coding re-gions, occasionally leading to amino acid changes in thepolypeptides encoded. They are, in most cases, bi-allelic,codominant, and amenable to high-throughput genotypingand automation.

The aim of this study was to develop cost-effectivemarkers such as SNPs, CAPS (cleaved amplified polymor-phic sequences) and SCARs (sequence-characterized ampli-fication regions) for cultivar identification in olive. Twoapproaches were used: targeted, which starts with genic se-quences available in the database, and arbitrary sampling,using fragments generated from cultivar fingerprints usingthe SRAP (sequence-related amplification polymorphism)profiling method (Li and Quiros 2001). In both approaches,polymorphisms were identified by comparison of sequencesfrom different accessions. Markers developed were used toassess the genetic variability and (or) diversity of widelycultivated olive cultivars important for oil production.

Materials and methods

Plant material and marker discovery strategies

Plant MaterialA total of 65 DNA samples (listed in Table 1) represent-

ing the most important commercial olive cultivars grown inEurope and Australia for oil production, was used in thestudy. Some cultivars were duplicated by virtue of comingfrom different geographic regions. DNAs were provided

within the EU-funded OLIV-TRACK project, except the 13Australian samples, which were provided by Prof. M. Sedgley(University of Adelaide, Australia).

PCRUnless stated otherwise, PCR amplifications were per-

formed using 40 ng of genomic DNA, 0.5 U Fastart TaqDNA polymerase (Roche Diagnostics Ltd., Lewes, UK) in1� supplied buffer, and 200 mmol/L each dNTP in 10 mL re-actions. MgCl2 concentrations and annealing temperatures(Ta) are given for each primer pair (Tables 2, 3, and 4).PCRs were performed in a Perkin Elmer 9700 thermocycler(Applied Biosystems, Warrington, UK). Cycling parameterswere as follows: initial denaturation for 4 min at 95 8C, fol-lowed by 35 cycles of denaturation (95 8C for 30 s), anneal-ing (Ta for 30 s), and extension (72 8C for 1 min), with afinal extension step of 72 8C for 6 min. Primers (Sigma-Genosys Ltd., Sawston, UK) for PCR amplification weredesigned using the primer design software Oligo# 6.45 (Na-tional Biosciences Inc., Plymouth, Minn.).

SNP discoverySNP discovery was performed by amplifying DNA frag-

ments using locus-specific (LS) primers and sequencingPCR products directly from a set of 11 cultivars (‘Frantoio’,‘Gentile di Chieti’, ‘Leccino’, ‘Arbequina’, ‘Picual’, ‘Lechınde Sevilla’, ‘Koroneiki’, ‘Kalamon’, ‘Cordovil de Serpa’,‘Meski’, and ‘Memecik’). Sequencing was performed withone or both of the PCR primers using BigDye1 Terminatorcycle sequencing in an ABI Prism1 3100 Genetic Analyzer(Applied Biosystems, Foster City, Calif.).

LS primers were obtained using 2 approaches: targetedsampling using olive gene sequences found in the GenBankdatabase at the National Centre for Biotechnology Informa-tion Web site (http://www.ncbi.nlm.nih.gov) (Table 2) andarbitrary sampling using the SRAP method (Li and Quiros2001) to generate multiple bands (Fig. 1) that could be se-quenced to provide data for LS primer design (Table 3). Inarbitrary sampling, an initial evaluation of 11 primer combi-nations in 5 olive cultivars (‘Picual’, ‘Cordovil de Serpa’,‘Lechın de Sevilla’, ‘Koroneiki’ and ‘Kalamon’) wasperformed. Two combinations, EM1 (5’-GACTGCGTA-CGAATTAAT-3’) – ME4 (5’-TGAGTCCAAACCGGACC-3’) and EM4 (5’-GACTGCGTACGAATTATGA-3’) – ME1(5’-TGAGTCCAAACCGGATA-3’) were chosen and usedto amplify genomic DNA from cultivars ‘Lechın de Sevilla’and ‘Koroneiki’.

SRAP products from ‘Lechın de Sevilla’ and ‘Koroneiki’genomic DNA were cloned using a TA cloning kit (Invi-trogen, Paisley, UK) following the manufacturer’s instruc-tions. Inserts were amplified in a volume of 10 mLincluding 2 mL of plasmid suspension (~2 ng DNA) and0.5 mmol/L of each M13 universal primer (M13-F, 5’-GTAAAACGACGGCAGTG-3’; and M13-R, 5’-GGAACA-GCTATGACCATG-3’). Thirty-two clones with inserts big-ger than 100 bp were identified and sequenced with M13universal primers in both directions as described above.

Sequence analysesPolymorphisms between the sequences were identified by

sequence alignment using Staden Package software (Staden

1194 Genome Vol. 49, 2006

# 2006 NRC Canada

et al. 2000). Furthermore, the trace outputs from the se-quencer were evaluated by eye to identify possible areasof heterozygous sequence (Fig. 2). To minimize false pos-itives due to sequencing artefacts, potential SNPs were re-sequenced in the opposite direction. Sequences obtainedfrom cloning SRAP products were submitted to ‘‘translatedquery search’’ to protein sequences in the database usingthe tBLASTx program available on the NCBI Web site(Altschul et al. 1997).

Marker development, validation, and genotyping of olivecultivars

CAPS markerSequence alignment of 2 calcium-binding protein cDNA

sequences (accession numbers AF078679 and AF078680,Ledesma et al. 2000), showed 5 putative SNPs. One SNP af-fected the recognition site of the restriction enzyme BstZI(Promega, Southampton, UK), allowing the assaying of thisSNP using a CAPS assay. The assay involved the PCR am-plification with primers Cbp-F and Cbp-R (Table 2) in a to-tal volume of 15 mL, followed by cleavage of the amplifiedmarkers using BstZI , incubating for at least 6 h at 50 8Caccording to the supplier’s recommendations. The specificamplified product (476 bp) and the cleaved products (160and 316 bp) were separated on 1.5% w/v agarose gels in 1�Tris–acetate–EDTA (TAE) buffer (Fig. 3A).

SCAR markersTesting of the LS primers revealed that primer set LS1

did not always amplify a product from all the cultivarstested. These primers became the basis of a SCAR marker.An assay employing an additional pair of primers (controlforward/reverse: 5’-CCAAACCGGATACTCCACC-3’ / 5’-GACATGTTGTATGTGGCGATTA-3’) amplifying a smallerfragment as internal control (Fig. 3B) was also performed.

Primers Sod-F and Sod-R (Table 2) were designed to ex-ploit a 48 bp duplication found in the Cu–Zn-superoxide dis-

Table 1. List of cultivars analysed in this study.

No. Cultivar name Code Population

1 ‘Frantoio’ (It) (1) AU1 Australian2 ‘Picual’ (Sp) (1) AU2 Australian3 ‘Barnea’ (Is) (1) AU3 Australian4 ‘Manzanillo’ (Sp) (1) AU4 Australian5 ‘Arbequina’ (Sp) (1) AU5 Australian6 ‘Leccino’ (It) (1) AU6 Australian7 ‘Pendolino’ (It) (1) AU7 Australian8 ‘Hojiblanca’ (Sp) (1) AU8 Australian9 ‘Coratina’ (It) (1) AU9 Australian10 ‘Sevillano’ (Sp) (1) AU10 Australian11 ‘Belle de Espagne’ (It) (1) AU11 Australian12 ‘Barouni’ (Tu) (1) AU12 Australian13 ‘Corregiola’ (It) (1) AU13 Australian14 ‘Biancolilla’ (2) IT1 Italian15 ‘Canino’ (2) IT2 Italian16 ‘Carolea’ (2) IT3 Italian17 ‘Dolce Agogia’ (2) IT6 Italian18 ‘Dritta’ (2) IT7 Italian19 ‘Frantoio’ (2) IT8 Italian20 ‘Gentile di Chieti’ (2) IT9 Italian21 ‘Leccino’ (2) IT10 Italian22 ‘Ottobratica’ (2) IT11 Italian23 ‘Nocellara del Belice’ (2) IT12 Italian24 ‘Ogliarola Leccese’ (2) IT13 Italian25 ‘Tonda Iblea’ (2) IT15 Italian26 ‘Sinopolese’ (2) IT17 Italian27 ‘Arbequina’ (2) SP1 Iberian28 ‘Comezuelo’ (2) SP2 Iberian29 ‘Hojiblanca’ (2) SP5 Iberian30 ‘Lechın de Granada’ (2) SP6 Iberian31 ‘Manzanila Cacerena’ (2) SP7 Iberian32 ‘Manzanila de Jaen’ (2) SP8 Iberian33 ‘Picual’ (2) SP9 Iberian34 ‘Picudo’ (2) SP10 Iberian35 ‘Royal de Cazorla’ (2) SP11 Iberian36 ‘Verdial de Huevar’ (2) SP12 Iberian37 ‘Blanqueta’ (2) SP13 Iberian38 ‘Changlot Real’ (2) SP14 Iberian39 ‘Farga’ (2) SP15 Iberian40 ‘Lechın de Sevilla’ (2) SP16 Iberian41 ‘Sevillenca’ (2) SP17 Iberian42 ‘Adramytini’ (2) GR1 Greek43 ‘Kerkiras’ (2) GR2 Greek44 ‘Koroneiki’ (2) GR4 Greek45 ‘Mastoidis’ (2) GR8 Greek46 ‘Mirtolia’ (2) GR9 Greek47 ‘Amigdaloia’ (2) GR12 Greek48 ‘Kalamon’ (2) GR13 Greek49 ‘Konservolea’ (2) GR14 Greek50 ‘Azeiteira’ (3) PO1 Iberian51 ‘Cordovil de Serpa’ (3) PO10 Iberian52 ‘Aglandau’ (4) FR1 French53 ‘Cailletier’ (4) FR2 French54 ‘Salonenque’ (4) FR3 French55 ‘Tanche’ (4) FR4 French56 ‘Picholine’ (5) FR6 French57 ‘Bouteillan’ (4) FR7 French

Table 1 (concluded).

No. Cultivar name Code Population

58 ‘Ghjemana’ (6) FR9 French59 ‘Zinzala’ (7) FR10 French60 ‘Sabina’ (8) FR11 French61 ‘Sigoise’ (2) AL1 French62 ‘Picholine Marocaine’ (2) MO1 French63 ‘Memecik’ (2) TUR2 French64 ‘Chemlali’ (2) TUN1 French65 ‘Meski’ (2) TUN2 French

Note: Australian cultivar origins are given in parentheses. It,Italy; Sp, Spain; Gr, Greece; Po, Portugal; Fr, France; Al, Algeria;Mo, Morocco; Tur, Turkey; Tun, Tunisia. Cultivar provenience areindicated with numbers as follows: 1, Prof. Margaret Sedgley,NOVA, National Olive Variety Assessment collection, RoseworthyCampus, University of Adelaide, Australia; 2, Dr. Luciana Baldoni,Research Insitute on Oliviculture, C.N.R. Perugia, Italy; 3, Collec-tion of the Oliviculture Department of the Portuguese National PlantBreeding Station, Elvas; 4, Porquerolles, French Nationale Collec-tion; 5, INRA Collection, Montpellier, France; 6, production orchardin the Santa Lucia di Tallano region (North Corsica, France); 7,production orchard in the Solaccaro region (South Corsica, France);8, production orchard in the Muro region (North Corsica, France).Population assignation is given.

Reale et al. 1195

# 2006 NRC Canada

mutase (SOD) gene fragment. The primers amplified frag-ments of 176 and 128 bp, allowing the assay of this codomi-nant marker using agarose gels (Fig. 3C).

SNP markersPutative SNPs were verified using the ABI Prism1 SNaP-

shotTM Multiplex System as instructed by the manufacturer(Fig. 3D). Genotyping of the SNPs in 65 olive sampleswere performed in 10 mL reactions as 3 multiplex PCRs us-ing standard protocols; multiplex PCR primers concentra-tions and annealing temperatures are given in Table 4.Primer extension reactions were performed according tosupplier’s instructions. Purified products (1–2 mL) were

added to 0.5 mL LIZ 120 internal standard (Applied Biosys-tems) and 7.5–8.5 mL Hi-Dye formamide (Applied Biosys-tems). The mixtures were denatured at 95 8C for 5 minbefore loading on an ABI Prism 3100 (Applied Biosystems)using POP-4 separation polymer at standard running condi-tions. Genescan Analysis1 v. 3.7 and Genotyper1 v. 2.1softwares were used to analyse raw data and determinepeak sizes.

Genetic diversity and data analysesFor each marker the more commonly occurring allele was

designated as the major allele and the less common allelecategorized as the minor allele. Data were scored as pres-

Table 2. Primers used for targeted amplification strategy.

Locus namePrimername Primer sequence (5’?3’)

NCBIaccession No.

[MgCl2](mmol/L) Ta (8C)

Ampliconsize (bp)

Cycloartenolsynthase

Cycl-F GCCCATTTCAGATTGCAC AB025344 2.5 57 802Cycl-R GGGATTCTCAGGTCAGGA

Lupeolsynthase

Lup-F GGAGCATGTTCATTATGAGG AB025343 2.5 58–53* 268Lup-R AAAATAACCTGCATTTTCAGG

Anthocyanidinsynthase

Ant-F GCCCAGCAACAAGTGAGTATGCAAAAC AF384050 2 58 582Ant-R AACCCAATTTTTCAACTCATTTTTCTTCACC

Chalconesynthase

Chs-F TCGGAGATTACTGCGGTTACTTTC AF384049 2 58 672Chs-R ACGCAATTTTTCGGGGTTTAGG

Cu–Zn-superoxidedismutase

Sod-F TTCCCACCGATATTGTTAAGGG AF426829 2.5 57 128/176Sod-R CATATAGCATAGCACCCGCAAC

Calcium-bindingprotein

Cbp-F CACGGACAGGAATTCCAAGCCTTCA AF078679 3 58 476Cbp-R TGCCGCTTTTGTTCGTCATCATTTTCT AF078680

Note: The sequences, MgCl2 concentration, and Ta used for PCR, and observed amplicon sizes in the PCR are given.*Six cycles at the higher annealing temperature (Ta) were carried out with the temperarute decreasing by 1 8C/cycle, followed by 29 cycles at the lower

Ta.

Table 3. List of primers developed from the arbitrary approach.

LSprimer Primer sequence (5’?3’)

Ampliconsize (bp) Ta (8C)

LS1-F AATTTCTCTATCTAAGTGGC 620 57LS1-R AAAACCAGTAGGAATCATTLS2-F CACGGCATAGTGATGAGTATTG 354 57LS2-R TCGGAACCTCCAGTAGAAGTTALS3-F ACTTTATATGTGTCCAATAGGC 319 57LS3-R TAATCATCGAACCTTCCALS4-F GTATATGCGAGTGCGATAGC 333 57LS4-R CAACCCCATATTGAGTAACTGTLS5-F AAAACCAGTAGGAATCATTATG 237 57LS5-R ATCGAACTCTCAACTTCTCALS6-F GAATTTCACCCGAAGTTTGA 400 55LS6-R TTGCACATCTTATTCCTCCATALS7-F TCTCTATCTAAGTGGCCAATCT 525 60LS7-R GACAAAGAAAGTGGGATGCLS8-F ACATTGAAGTTCCCTTGTCA 506 57LS8-R GCGTCAAAAAGAAATCTTAGAGLS9-F CTTATGTTTGCTAAGATCCTGG 208 60LS9-R AGAATGAAGCCCAACTGGLS10-R CCCATAGTGTACATGTAGCAA 218 63LS10-F GTTCAATCGGTAAGAACCATAG

Note: Sequence of locus-specific (LS) primers designed from the sequence-relatedamplified polymorphism (SRAP) clones are given together with their annealing tem-perature (Ta) and product sizes. A 2 mmol/L MgCl2 concentration was used in thePCR.

1196 Genome Vol. 49, 2006

# 2006 NRC Canada

ence or absence of major and minor alleles (homozygous) orpresence of both alleles (heterozygous) for each sample. Al-lele frequencies and expected and observed heterozygosity(He, Ho) estimations were conducted using Arlequin 3.01(Schneider et al. 2000). The same program was used tocompute the alleles frequencies for each locus within popu-lations (the accessions were arbitrarily grouped into 5 popu-lations and analysed using the 10 codominant developedmarkers, Table 1), and to test for deviation of observedgenotype frequencies from those expected under Hardy–Weinberg equilibrium. Linkage disequilibrium (LD) wastested for each pair of loci within each population using

Fisher’s exact tests (Rousset and Raymond 1995), with un-biased P values derived by a Markov chain method. Thevalue for a multiple significance test was set using the se-quential Bonferroni procedure (Rice 1989). Arlequin 3.01(Schneider et al. 2000) also allowed the analysis of molecu-lar variance (AMOVA) framework, calculating the signifi-cance of the covariance components associated with 2different levels of genetic structure (populations, cultivars)through a non-parametric permutation procedure. Power ofdiscrimination (PD) was calculated using the following for-mula (Kloosterman et al. 1993):

PD ¼ 1 �Xn

i¼1f 2i

where fi is the frequency of the ith genotype.Genetic similarity was calculated using simple matching

coefficient (Sokal and Michener 1958) and the accessionswere clustered by the unweighted pair group method witharithmetic averaging (UPGMA) using the TREECON pro-gram (Van de Peer and De Wachter 1997). Bootstrap valuewas computed.

The spatial genetic structure and spatial autocorrelationanalysis were performed through STRUCTURE (Pritchardet al. 2000). Individual admixture proportions (Q), the indi-vidual genome’s quote derived from either indigenous orimported tree, were estimated using 200 000 burn-in stepsfollowed by 1 000 000 Markov chain Monte Carlo(MCMC). Moran’s I coefficient was used to construct therelated global correlogram, which synthesized data fromeach of the alleles.

Results

Targeted samplingA search in the NCBI database (http://www.ncbi.nlm.nih.

gov) for olive sequences provided 2 copies of the calcium-binding protein cDNA, which allowed the development of aCAPS assay to differentiate between the 2 genotypes. Theassay was used on the cultivar set to show 25 samples wereheterozygous and 40 were homozygous for the major (non-cleaved) allele. Primers designed from cDNA sequences(genes listed in Table 2) to amplify gene fragments did notalways work. The reason for non-amplification could be dueto intron interference, i.e. either the existence of a large in-

Table 4. Multiplex PCR conditions and SNaPshotTM extension primers used for the genotyping of olivesamples.

MultiplexAmplifiedloci Ta (8C)

Extensionprimer name SNP extension primer sequence (5’?3’)

M1 LS5 57 LS5-SNP1-R TCGAATTGGACCACTCTCLup Lup-SNP1-F AAAAACCTAATTCTGAAGCATACAAAAG

M2 Cycl 57 Cycl-SNP1-F AACCACTGGATGCCAGGCGATTGTACycl-SNP2-F CTCCATTTCATGGATTTCAT

LS2 LS2-SNP1-R AAAAATTGACACTTAGATTGTGGATAATM3 Chs 58 Chs-SNP1-F AAACCACTTTTTCAGTTGGTTTCAGC

Ant Ant-SNP2-R GCTTCGACCCCGAGGGAnt-SNP1-F TTACCCAAAATGCCCTCAGCC

Note: Poly(A) tails have been added to some primers to prevent overlapping of fragment sizes to allow multiplex-ing. Gene abbreviations are as described in Tables 2 and 3. A 2.5 mmol/L MgCl2 concentration was used in the PCR.

Fig. 1. Example of SRAP banding patterns in olive using theSRAP primer combination EM1–ME4. Lanes 1–5 show samples‘Picual’, ‘Cordovil de Serpa’, ‘Lechın de Sevilla’, ‘Koroneiki’, and‘Kalamon’, respectively.

Reale et al. 1197

# 2006 NRC Canada

tron between the 2 primers or the phenomenon of primerbinding being affected by an intron. The problem was re-solved by designing new primers that were closer together.The average length of introns found was 257 bp, though anintron of 825 bp was observed in the cycloartenol synthasegene.

The total length of sequences analysed corresponding tothe DNA fragments of the 3 genes, cycloartenol synthase,

lupeol synthase, and Cu–Zn-superoxide dismutase, was3440 bp in 11 olive genotypes. This set of sequences com-prises 2682 bp of introns and 758 bp of exons. Twenty-twoSNPs (1 per 156 bp) and 2 indels (1 per 1720 bp) were iden-tified within these sequences and their distributions were1 SNP per 149 bp in introns and 1 SNP per 190 bp in exons.Of the 22 SNPs, 12 were transversions and 10 were transi-tions; all of the mutations in exons were silent. This high

Fig. 2. Sequence electropherogram for lupeol synthase gene obtained for sample ‘Lechın de Sevilla’, showing 2 putative SNPs identified asheterozygous sequence. The first SNP was confirmed and genotyped using the ABI Prism1 SNaPshotTM Multiplex System.

Fig. 3. Examples of the markers used in this study. (A) CAPS assay to genotype the calcium-binding protein derived marker. (B) DominantSCAR marker amplified using primer set LS1. (C) Codominant SCAR (LS1) to identify the presence of a 48 bp tandem duplication withinthe Cu–Zn-superoxide dismutase gene. (D) Genotyping of cycloartenol synthase SNP (primer Cycl-SNP1-F) using ABI Prism1 SNaPshotTM

Multiplex System. The sample names and measured sizes of the products are given.

1198 Genome Vol. 49, 2006

# 2006 NRC Canada

level of polymorphism showed a great variability in olivegermplasm, even within the coding regions, suggesting thatfurther SNP identification can be effectively performed us-ing a smaller number of olive cultivars. Fragments of the an-thocyanidin synthase (587 bp) and chalcone synthase(670 bp) genes were sequenced in 3 cultivars (‘Frantoio’,‘Leccino’, and ‘Arbequina’) to reveal a total of 9 putativeSNPs (1 SNP per 140 bp).

SNP discovery was helped by the identification of hetero-zygous sites from direct sequencing of PCR products. In theSNPs identified, the changes in the exons were silent apartfrom 2 SNPs in the anthocyanidin synthase gene thatresulted in like-for-like amino acid changes (isoleucine–leucine and threonine–alanine). The genotyping of theSOD indel revealed a new band in the French cultivar‘Zinzala’. This cultivar had an unique band of ~400 bp insize together with the smaller major allele. Though no ho-mozygotes of the minor allele were identified within thisset of cultivars, this was not considered significant owingto the low frequency of the minor allele. Based on the fre-quencies of the 2 alleles, Hardy–Weinberg principles pre-dict that, in a randomly mating population, only 2homozygotes would be expected from a population size of65 individuals.

Arbitrary samplingThirty-two clones, 19 from ‘Lechın de Sevilla’ and 13

from ‘Koroneiki’, derived from the amplification of genomicDNAs using SRAP primers, were sequenced in both orienta-tions to give a total of 9.3 kb new olive sequences. Theaverage size of the clones was 388 bp in length (size range109–869 bp) and each insert was flanked by the primersequences used to amplify them. Seven sequences were du-plicated and 1 was present 3 times. Twenty-six uniqueSRAP-derived sequences were submitted to GenBank withaccession numbers AY845058–AY845083. From the trans-lated query search to protein sequences, significant matchesto retrotransposon proteins were found for 9 clones, thoughonly 4 were unique, as well as to other proteins (Table 5).

LS primers were designed from the sequences of 10clones (Table 3) and used to amplify genomic DNA of the

2 cultivars ‘Lechın de Sevilla’ and ‘Koroneiki’. A dominantSCAR marker was identified using primer pair LS1 and anassay, containing a positive control, was developed for thisdominant marker (Fig. 3B).

PCR products for the other 9 markers were sequenced di-rectly from the same 2 cultivars. Putative SNPs were identi-fied as heterozygous sequences within a cultivar or as inter-cultivar differences. At least 1 potential SNP was identifiedfor each. Four SNPs were chosen from the sequences ofLS2, LS4, LS5, and LS9. The others were discarded eitherdue to the high frequency of SNPs found in the sequence(i.e., LS6 and LS7) or to the low quality caused by the highAT content of the clones (i.e., LS3, LS8, and LS10). Thehigh polymorphic content of the former clones was attrib-uted to being members of repeated sequence families and,as such, would not be useful as SNP markers. Pre-screeningof the markers LS4 and LS9 in 20 cultivars showed thatthey were not polymorphic (all heterozygotes) and thereforethey were not considered for the genotyping of the full setof cultivars.

Genetic relationships among olive cultivarsA set of 11 markers (1 CAP, 2 SCARs, and 8 SNP-

derived markers), comprising 9 SNPs, an indel, and a non-characterized sequence variation, was employed to establishgenetic relationships among a set of 65 olive samples. Ad-ditional SNPs were chosen from the anthocyanidin synthaseand cycloartenol synthase genes, as the sequences showedthat they provided data for further differentiation of the ge-netic loci. A summary of the allelic frequencies is shownin Table 6. Genetic relationships among the cultivar setwere established using cluster analyses (Fig. 4). Forty-seven accessions (72%) had unique profiles and hencecould be differentiated. The cultivar pairs of ‘Sevillano’and ‘Lechın de Sevilla’, ‘Carolea’ and ‘Amigdaloia’, ‘Sino-polese’ and ‘Sevillenca’, ‘Manzanilla Cacerena’ and ‘Man-zanilla de Jaen’, ‘Sigoise’ and ‘Picholine Marocaine’, aswell as the Spanish and Australian samples of ‘Picual’,‘Arbequina’, and ‘Hojiblanca’, and ‘Leccino’ from Italyand Australia, were indistinguishable. On the other hand,the 2 cultivars ‘Ottobratica’ and ‘Mirtolia’, previously con-

Table 5. Summary of protein homology search results of the cloned SRAP products.

No. of SRAPsequences tBLASTx results Source of match Positives

GenBankaccession No.

1 Ribulose-1, 5-bisphosphate carboxylase Malus 79/82 (96%) CAA798575 (2) Putative retrotranspson protein Arabidopsis 16/18 (88%) BAB099231 ABC transporter, permease protein Nocardia 19/26 (73%) YP_1174854 (2) Putative retrotranspson protein Oryza 30/57 (52%) AAT851941 Cytochrome c oxidase Encephalartos 22/34 (64%) AAD016571 Putative b helix–loop–helix protein Arabidopsis 26/34 (76%) AAP404331 Flavonoid 1–2 rhamosyltransferase Citrus 24/40 (60%) AAL066462 (1) MHC class Ia antigen Gadus 23/41 (56%) AAL145461 Cytochrome b Trichiurus 18/29 (62%) AAA321301 Attachment glycoprotein Human respiratory

syncytial virus24/46 (52%) AAS90852

3 Unknown hypothetic proteins11 (8) No significant similarity

Note: Parentheses in the first column indicate the number of unique clones where duplication was found. The term ‘‘posi-tives’’ is used to denote the correspondence levels where similar amino acids contribute to the match.

Reale et al. 1199

# 2006 NRC Canada

sidered to be synonyms (UNSEA 1949), have been clearlydistinguished here.

The accessions were arbitrarily grouped into 5 populations(Table 1) and tested to see if there was any grouping of thecultivars using the 10 codominant markers plus the domi-nant SCAR. Though the number of samples and loci is notideal, the entire 5 populations were in Hardy–Weinbergequilibrium (p >> 0.05). Exact tests for genotypic LD, bothgrouped and ungrouped, underlined the presence of 4markers exhibiting LD in pairs. Across populations andloci, 2 out of 55 comparisons were significant at a 0.001level: loci Cycl-1 vs. Cycl-2 and Ant-1 vs. Ant-2. These as-sociations were confirmed by the analysis of the percentageevaluation of significant pairwise tests conducted on a set ofrandomly chosen samples of equal size. The estimation ofthe admixture proportions assessed through STRUCTUREshowed that all cultivars were correctly assigned (p >> 0.9).

DiscussionThe easiest route to molecular marker development in any

species is e-mining (Taillon-Miller et al. 1998; Useche et al.2001; Batley et al. 2003; Somers et al. 2003). The prerequi-site is to have ample sequences for their alignment to iden-tify polymorphisms and to distinguish real genetic changesfrom those generated by sequencing errors (Barker et al.2003). However, the small number of sequences availablein olive allowed only the identification of SNPs in thecalcium-binding protein gene that was developed into aCAPS-based marker. Further marker identification and de-velopment required the generation of de novo DNA sequen-ces. This was achieved using a targeted approach whereprimers were designed and used to amplify fragments fromknown gene sequences and polymorphisms identified by thecomparison of the sequences between and within accessions.A second arbitrary approach, where products from a genericfingerprinting technique were sequenced, allowed the designof primers to amplify locus-specific regions. Amplicon com-parisons between different cultivars made possible the iden-tification of polymorphisms.

In this study, SRAP profiling was adopted because of its

proven targeting of expressed regions of the Brassica ge-nome (Li and Quiros 2001). Many of the sequences werenot identifiable as they did not show significant homologyto known proteins or those they did have not been assignedfunctions. Of the 32 sequenced SRAP products, 28%showed homology to known retrotransposon protein sequen-ces (Table 5). When redundancies are excluded, retrotranspo-son sequences account for 4 of the 23 unique sequences (17%).This high incidence may reflect a great number of retrotrans-posons in the Olea genome, in which other retrotransposon-based markers have been identified (Hernandez et al. 2001;Giordani et al. 2004). Alternatively, the selection of mostpolymorphic SRAP primers may have biased the products ifretrotransposons have been involved in generating much ge-netic diversity in the past.

The levels of polymorphisms identified in the 11 cultivarpanel initially used in the targeted sampling approach withinthe 3 genes, cycloartenol synthase, lupeol synthase, andCu/Zn-superoxide dismutase, was 1 SNP in 149 bp in in-trons and 1 SNP in 190 bp in exons. To date, SNP polymor-phism rates have not been reported in fruit trees. Thepolymorphism levels in olive are close to other out-crossingplant species like maize, where the frequencies of nucleotidechanges are 1 per 124 bp in coding regions and 1 every31 bp in non-coding regions (Ching et al. 2002) and higherthan in soybean (4.85 and 1.64 SNPs every 1 kb in non-cod-ing and coding regions, respectively (Rafalski 2002)).

The high level of SNPs found in olive genes suggests thatonly a small number of cultivars are required for effectiveSNP identification. This is supported by figures from the an-thocyanidin synthase and chalcone synthase genes (1 SNPper 140 bp) where only 3 cultivars were sequenced. Se-quencing of gene fragments amplified directly from genomicDNA not only has the advantage of not requiring cloning ofthe PCR products, but potential SNPs can be identified inthe form of heterozygotes. The average heterozygosity of44% for the 10 SNPs assayed in the 65 olive accessions(Table 6) shows that almost half of all SNPs can also beidentified from a single sample. However, heterozygousscreening is more effective in allogamous species where

Table 6. Summary of genetic diversity observed by typing 65 samples using the marker set.

MarkerMajor allelefrequency

Minor allelefrequency

Major genotypefrequency

Minor genotypefrequency Ho He PD

SOD 0:58 0:42 0:29 0:14 0:57 0:49 0:57LS1* — — 0:48 — — 0:43 0:50LS2 0.05 0:15 0.05 0:03 0:23 0:25 0:42LS5 0.04 0:31 0:48 0:09 0:43 0:43 0:58Lup 0.05 0:28 0:57 0:12 0:31 0:40 0:57Chs 0.05 0:23 0:55 0:02 0:43 0:36 0:51Cycl-1 0.04 0:31 0:42 0:03 0:55 0:43 0:51Cycl-2 0.04 0:32 0:42 0:05 0:54 0:43 0:54Ant-1 0.04 0:35 0:37 0:08 0:55 0:46 0:55Ant-2 0.05 0:27 0:55 0:09 0:35 0:39 0:56Cbp 0.05 0:19 0.04 0 0:38 0:31 0:47Average 0.05 0:28 0:50 0:07 0:43 0:40 0:52

Note: The predominant allele was defined as the major allele and Ho is the frequency of heterozygotes found. He is theheterozygote frequency predicted using the Hardy–Weinberg equation. The discriminatory power (PD) is calculated using theformula of Kloosterman et al. (1993). Gene abbreviations are as in Tables 2 and 3.*Denotes dominant SCAR marker.

1200 Genome Vol. 49, 2006

# 2006 NRC Canada

Fig. 4. Genetic relationships of the 65 olive samples based on their genotype using a set of 11 polymorphic markers, the UPGMA clusteranalysis, and the simple matching similarity coefficient. The letters after the names relate to the geographic source of the samples as fol-lows: AL, Algeria; AU, Australia; FR, France, GR, Greece; IT, Italy; MO, Morocco; PO, Portugal; SP, Spain; TUN, Tunisia; TUR, Turkey.Black and white boxes denote homozygous states for the major and minor alleles, respectively; grey denotes heterozygosity. X denotes theunique allele found for ‘Zinzala’. The bootstrap values for major lineages within the dendrogram are shown in percentages.

Reale et al. 1201

# 2006 NRC Canada

cross fertilization ensures shuffling of the alleles to produceheterozygotes. In autogamous species, SNP identificationcan still work as long as the individuals screened are theF1 progeny from wide genetic crosses.

Of the polymorphisms discovered, transversions make up55% of the 22 SNPs identified. As the deamination of 5-methyl-cytosine by ultraviolet irradiation to give thymidineresults only in transitional changes, this observation suggeststhat mutations in olive genes are not as strongly influencedby DNA methylation as generally observed for plants(Gardiner-Garden et al. 1992).

The use of 2 SNPs each for anthocyanidin synthase andcycloartenol synthase fragments has increased the numberof informative markers for differentiating between the culti-vars. The SNPs for the anthocyanidin synthase gene, Ant-1and Ant-2, have PD values of 0.55 and 0.56 (Table 6), re-spectively, and 0.74 when combined. Similarly, Cycl-1 andCycl-2, the 2 SNPs for the cycloartenol synthase gene, havePD values of 0.53 and 0.54, respectively, and 0.60 whencombined. As the 2 pairs of SNPs are separated by 6 and331 bp in the anthocyanidin synthase and cycloartenol syn-thase genes, respectively, they are expected to behave as asingle locus. A simple haplotype model predicts 3 genotypesfor each, since the close proximity of the SNPs makes it un-likely that genetic recombinations are responsible for pro-ducing most of the possible genetic combinations. Theunexpected findings were that the numbers of genotypes ob-served for each of the genes are 6 for cycloartenol synthasegenotypes and 7 for the anthocyanidin synthase gene out of9 possible permutations for 2 SNPs.

One plausible explanation is that the gene fragments thathave been genotyped are not single copied and that the mul-tiple copies are not linked. A similar situation has been ob-served while genotyping the VRN1 locus in barley cultivars:an unlinked duplication of the gene interferes with the geno-typing of the SNPs (E. Chiapparino, personal communica-tion). Similarly, microsatellites with duplicated lociamplification have also been reported in olive (Rallo et al.2000; Cipriani et al. 2002; Dıaz et al. 2006a). However,this does not invalidate the assays for cultivar assessment ofolive material. The close proximity of each pair of SNPs forthe 2 genes would explain why they exhibit LD.

The targeted approach was more efficient at deliveringmarkers as all genes tested contained at least 1 useable

SNP, whereas the arbitrary approach yielded 2 SNP and1 SCAR markers from the 10 fragments amplified using LSprimers. The markers developed and used in this study coulddifferentiate 72% of the olive samples tested. This under-states the utility of the marker, set as some of the sampleshad the same names but originated from different geo-graphic regions. When duplications (cultivars with the samenames) are excluded, 77% of the cultivars could be differen-tiated. The inability of the molecular markers to distinguishthese olive samples confirms their identity, making them po-tential cultivar authentication tools. However, the markerswere also unable to distinguish between ‘Sinopolese’ and‘Sevillenca’, ‘Sevillano’ and ‘Lechın de Sevilla’, ‘Carolea’and ‘Amigdaloia’, ‘Manzanilla Cacerena’ and ‘Manzanillade Jaen’, and ‘Sigoise’ and ‘Picholine Marocaine’. In 3 outthese 5 cases, the geographical origin zones of the cultivarpairs are very near or are coincident, with their currentgrowing areas overlapping. In this sense, it is possible thata genuine close genetic relationship exists between thesepairs of cultivars. ‘Sigoise’ and ‘Picholine Marocaine’ havealready been analysed together by several research groups.These 2 cultivars were discriminated by Belaj et al. (2002)using RAPD markers and by Angiolillo et al. (1999) usingAFLP markers with similarity indices of 0.84 and 0.75, re-spectively; however, both cultivars were classified into only1 RAPD profile by Besnard et al. (2001). In the remaining 2pairs of cultivars, their high genetic similarity can be ex-plained by the routes of olive spread (Zohary and Spiegel-Roy 1975). ‘Amigdaloia’ comes from Greece and ‘Carolea’from Italy; the former country is considered an olive secon-dary origin centre from which this crop was taken to Italy,as well as to other places. The same explanation can be ap-plied to the cultivars ‘Sinopolese’ and ‘Sevillenca’. The for-mer originated in Italy and from this tertiary centre of originthe olive would have spread throughout the western Medi-terranean basin to Spain (origin of ‘Sevillenca’). For theidentification of such closely related cultivars the utilizationof bi-allelic markers as SNPs may not be sufficient unless alarge number is used. The use of more polymorphic markerslike SSRs could be recommended as a complement.

An interesting case is represented by ‘Manzanillo’ (AU),which clusters far away from ‘Manzanilla Cacerena’ and‘Manzanilla de Jaen’ (SP). Similar results have been ob-tained by Mekuria et al. (1999) using RAPD markers. This

Fig. 5. Spatial autocorrelation analysis using Moran’s Index shows no sign of geographic isolation.

1202 Genome Vol. 49, 2006

# 2006 NRC Canada

is in agreement with the hypothesis that names similar to‘Manzanillo’ or ‘Manzanilla’ were given to different apple-shaped olive cultivars (apple is ‘‘manzana’’ in Spanish).Something similar has been reported by Dıaz et al. (2006a)on the cultivar ‘Verdial de Velez-Malaga’ with regard to‘Verdial de Badajoz’ and ‘Verdial de Huevar’, where the ge-neric term ‘‘Verdial’’ alludes to the late ripening of the fruit(green or unripe is translated into Spanish as ‘‘verde’’). Onthe other hand, the common origin of their names suggeststhat these cultivars have come from a common country (inthis case, Spain), especially as olive is not native toAustralia — much of the planting material being used issourced from trees that were imported from Europe over100 years ago. This situation leads to confusion about theidentity of cultivars currently planted in Australia (Burr1998). Such mistakes lead to homonymy and molecularmarkers are ideally suited to resolving such issues (Guerinet al. 2002), though a higher number of markers are neces-sary to make meaningful phylogenetic analyses. Even whenthe samples from newly cultivated regions (i.e., Australia)are excluded from the tree, there is no grouping of the culti-vars according to their geographical origin. This is logical,since most of the cultivars studied in the present work origi-nated in the central or western Mediterranean basin andthese 2 zones are closely connected in terms of the olivespreading history, as commented above.

No significant distances among populations (only 0.05%of variance), but significant distances among cultivars(99.5% of variance), emerged during AMOVA analysis.These data are consistent with the correlogram profile(Fig. 5) and with the expectations based on historical infor-mation. The admixture proportions underline the absence ofisolation by distance pattern. The inability to detect evidenceof geographic isolation can be explained by the followingfactors: relative short period of time that has elapsed sinceseparation, compounded by longevity of olive trees, wheregenerations can span hundreds of years; and domesticationof olives, in which cultivars are propagated by cuttings andwill serve to freeze the genetic diversity.

In the development of new genetic markers, the results ofthis work give insight into sequence diversity in olive culti-vars. The SNPs and SCARs, as described here, can be usedas genetic markers in Olea europaea for resolving nomen-clature issues, as well as for providing loci for map con-struction, association studies, and marker-assisted selectionbreeding for the olive industry.

AcknowledgementsWe thank Professor Margaret Sedgley for providing DNA

from Australian cultivars. This study has been carried outwith financial support from the Commission of the EuropeanCommunities, specific RTD program ‘‘Quality of Life andManagement of Living Resources’’, QLK1-CT-2002-02386,‘‘Traceability of origin and authenticity of olive oil by com-bined genomic and metabolomic approaches (OLIV-TRACK)’’. It does not necessarily reflect its views and inno way anticipates the Commission’s future policy in thisarea. Funding from the Food Standards Agency (Q01091) isalso acknowledged.

ReferencesAltschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z.,

Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res. 25: 3389–3402. doi:10.1093/nar/25.17.3389.PMID:9254694.

Angiolillo, A., Mencuccini, M., and Baldoni, L. 1999. Olive ge-netic diversity assessed using amplified fragment length poly-morphisms. Theor. Appl. Genet. 98: 411–421. doi:10.1007/s001220051087.

Bandelj, D., Jakse, J., and Javornik, B. 2002. DNA fingerprintingof olive varieties by microsatellite markers. Food Technol. Bio-technol. 40: 185–190.

Barker, G., Batley, J., O’Sullivan, H., Edwards, K.J., and Edwards,D. 2003. Redundancy based detection of sequence polymorph-isms in expressed sequence tag data using autoSNP. Bioinfor-matics, 19: 421–422. doi:10.1093/bioinformatics/btf881.PMID:12584131.

Barranco, D., and Rallo, L. 2000. Olive cultivars in Spain. Hortech.10: 107–110.

Batley, J., Barker, G., O’Sullivan, H., Edwards, K.J., and Edwards,D. 2003. Mining for single nucleotide polymorphisms and inser-tions/deletions in maize expressed sequence tag data. Plant Phy-siol. 132: 84–91. doi:10.1104/pp.102.019422. PMID:12746514.

Belaj, A., Trujillo, I., De la Rosa, R., Rallo, L., and Gimenez, M.J.2001. Polymorphism and discrimination capacity of randomlyamplified polymorphic markers in an olive germplasm bank. J.Am. Soc. Hortic. Sci. 126: 64–71.

Belaj, A., Satovic, Z., Rallo, L., and Trujillo, I. 2002. Genetic di-versity and relationships in olive (Olea europaea L.) germplasmcollections as determined by randomly amplified polymorphicDNA. Theor. Appl. Genet. 105: 638–644. PMID:12582515.

Belaj, A., Cipriani, G., Testolin, R., Rallo, L., and Trujillo, I. 2004.Characterization and identification of the main Spanish and Ita-lian olive cultivars by Simple-sequence-repeat markers.HortScience, 39: 1557–1561.

Besnard, G., Baradat, P., and Berville, A. 2001. Genetic relation-ships in the olive (Olea europaea L.) reflect multilocal selectionof cultivars. Theor. Appl. Genet. 102: 251–258. doi:10.1007/s001220051642.

Burr, M. 1998. Varieties. In Australian olives: a guide for growersand producers of virgin oils. Edited by M. Burr. Adelaide, Aus-tralia. pp. 106–116.

Cargill, M., Altshuler, D., Ireland, J., Sklar, P., Ardlie, K., Patil, N.,et al. 1999. Characterization of single nucleotide polymorphismsin coding regions of human genes. Nat. Genet. 22: 231–238.PMID:10391209.

Carriero, F., Fontanazza, G., Cellini, F., and Giorio, G. 2002. Iden-tification of simple sequence repeats (SSRs) in olive (Olea euro-paea L.). Theor. Appl. Genet. 104: 301–307. doi:10.1007/s001220100691. PMID:12582701.

Chiapparino, E., Lee, D., and Donini, P. 2004. Genotyping singlenucleotide polymorphisms (SNPs) in barley by tetra-primerARMS-PCR. Genome, 47: 414–420. PMID:15060595.

Ching, A., Caldwell, K.S., Jung, M., Dolan, M., Smith, O.S., Tin-gey, S., et al. 2002. SNP frequency, haplotype structure andlinkage disequilibrium in elite maize inbred lines. BMC Genet.3: 19. doi:10.1186/1471-2156-3-19. PMID:12366868.

Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., and Testo-lin, R. 2002. Microsatellites markers isolated in olive are suita-ble for individual fingerprinting and reveal polymorphism withinancient cultivars (Olea europaea L.). Theor. Appl. Genet. 104:223–228. doi:10.1007/s001220100685. PMID:12582690.

Collins, F.S., Brooks, L.D., and Chakravarti, A. 1998. A DNA

Reale et al. 1203

# 2006 NRC Canada

polymorphism discovery resource for research on human geneticvariation. Genome Res. 8: 1229–1231. PMID:9872978.

Cuevas, J., Dıaz-Hermoso, A.J., Galian, D., Hueso, J.J., Pinillos,V., Prieto, M., et al. 2001. Respuesta a la polinizacion cruzaday eleccion de polinizadores en los cultivares de olivo (Oleaeuropaea L.) ‘Manzanilla de Sevilla’, ‘Hojiblanca’ y ‘Picual’.Olivae, 85: 26–32.

De la Rosa, R., James, C.M., and Tobutt, K.R. 2002. Isolation andcharacterization of polymorphic microsatellites in olive (Oleaeuropaea L.) and their transferability to other genera in theOleaceae. Mol. Ecol. Notes, 2: 265–267. doi:10.1046/j.1471-8286.2002.00217.x.

Dıaz, A., De la Rosa, R., Martın, A., and Rallo, P. 2006a. Develop-ment, characterization and inheritance of new microsatellites inolive (Olea europaea L.) and evaluation of their usefulness incultivar identification and genetic relationship studies. TreeGenet. Genomes, 2: 165–175.

Dıaz, A., Martın, A., Rallo, P., Barranco, D., and De la Rosa, R.2006b. Self-incompatibility of ‘Arbequina’ and ‘Picual’ olive as-sessed by SSR markers. J. Am. Soc. Hortic. Sci. 131: 250–255.

Fabbri, A., Hormaza, J.I., and Polito, V.S. 1995. Identification andpatterns of relatedness among olive (Olea europaea L.) cultivarsdetermined using RAPD markers. J. Am. Soc. Hortic. Sci. 120:538–542.

Gardiner-Garden, M., Sved, J.A., and Frommer, M. 1992. Methyla-tion sites in angiosperm genes. J. Mol. Evol. 34: 219–230.doi:10.1007/BF00162971.

Giordani, T., Buti, M., Maestrini, P., Cavallini, A., and Natali, L.2004. Use of Ty1–copia retrotransposons to study genetic diver-sity in olive (Olea europaea L.) cultivars. In Proceedings of theXLVIII Italian Society of Agricultural Genetics – SIFV-SIGAJoint Meeting, Lecce, Italy, 15–18 September 2004. Edited byL. De Bellis, E. Filippone, and G. Romani. SIFV-SIGA, Gala-tina, Lecce, Italy. pp. 195–196. Available from http://www.siga.unina.it/SIGA2004/F_62.pdf.

Guerin, J.R., Sweeney, S.M., Collins, G.G., and Sedgley, M. 2002.The development of an olive database to identify olive cultivars.J. Am. Soc. Hortic. Sci. 127: 977–983.

Hernandez, P., De la Rosa, R., Rallo, L., Martın, A., and Dorado, G.2001. First evidence of a retrotransposon-like element in olive(Olea europaea): implications in plant variety identification bySCAR-marker development. Theor. Appl. Genet. 102: 1082–1087.

Hess, J., Kadereit, J.W., and Vargas, P. 2000. The colonization his-tory of Olea europaea L. in Macaronesia based on internal tran-scribed spacer 1 (ITS-1) sequences, randomly amplifiedpolymorphic DNAs (RAPD), and intersimple sequence repeats(ISSR). Mol. Ecol. 9: 857–868. doi:10.1046/j.1365-294x.2000.00942.x. PMID:10886649.

Khadari, B., Breton, C., Moutier, N., Roger, J.P., Besnard, G., Ber-ville, A., and Dosba, F. 2003. The use of molecular markers forgermplasm management in a French olive collection. Theor.Appl. Genet. 106: 521–529. PMID:12589553.

Kloosterman, A.D., Budowle, B., and Daselaar, P. 1993. PCR-amplification and detection of the human D1S80 VNTR locus.Amplification conditions, population genetics and applicationin forensic analysis. Int. J. Legal Med. 105: 257–264. doi:10.1007/BF01370382. PMID:8471543.

Ledesma, A., Villalba, M., and Rodrıguez, R. 2000. Cloning, ex-pression and characterization of a novel four EF-hand Ca(2+)-binding protein from olive pollen with allergenic activity. FEBSLett. 466: 192–196. doi:10.1016/S0014-5793(99)01790-1.PMID:10648840.

Li, G., and Quiros, C.F. 2001. Sequence-related amplified poly-morphism (SRAP), a new marker system based on a simple

PCR reaction: its application to mapping and gene tagging inBrassica. Theor. Appl. Genet. 103: 455–461. doi:10.1007/s001220100570.

Marnellos, G. 2003. High-throughput SNP analysis for genetic as-sociation studies. Curr. Opin. Drug Discov. Devel. 6: 317–321.PMID:12833663.

Mekuria, G.T., Collins, G.G., and Sedgley, M. 1999. Genetic varia-bility between different accessions of some common commercialolive cultivars. J. Hortic. Sci. Biotechnol. 74: 309–314.

Pritchard, J.K., Stephens, M., and Donnelly, P. 2000. Inference ofpopulation structure using multilocus genotype data. Genetics,155: 945–959. PMID:10835412.

Rafalski, A. 2002. Applications of single nucleotide polymorphismsin crop genetics. Curr. Opin. Plant Biol. 5: 94–100. doi:10.1016/S1369-5266(02)00240-6. PMID:11856602.

Rallo, P., Dorado, G., and Martın, A. 2000. Development of simplesequence repeats (SSRs) in olive tree (Olea europaea L.). Theor.Appl. Genet. 101: 984–989. doi:10.1007/s001220051571.

Rice, W.R. 1989. Analyzing tables of statistical tests. Evolution,43: 223–225. doi:10.2307/2409177.

Rousset, F., and Raymond, M. 1995. Testing heterozygote excessand deficiency. Genetics, 140: 1413–1419. PMID:7498780.

Salisbury, B.A., Pungliya, M., Choi, J.Y., Jiang, R., Sun, X.J., andStephens, J.C. 2003. SNP and haplotype variation in the humangenome. Mutat. Res. 526: 53–61. PMID:12714183.

Sanz-Cortes, F., Badenes, M.L., Paz, S., Iniguez, A., and Yacer, G.2001. Molecular characterization of olive cultivars using RAPDmarkers. J. Am. Soc. Hortic. Sci. 126: 7–12.

Schmid, K.J., Sorensen, T.R., Stracke, R., Torjek, O., Altmann, T.,Mitchell-Olds, T., and Weisshaar, B. 2003. Large-scale identifi-cation and analysis of genome-wide single-nucleotide poly-morphisms for mapping in Arabidopsis thaliana. Genome Res.13: 1250–1257. doi:10.1101/gr.728603. PMID:12799357.

Schneider, S., Roessli, D., and Excoffier, L. 2000. Arlequin: A soft-ware for population genetics data analysis. Ver 2.000. Geneticsand Biometry Lab, Dept. of Anthropology, University of Geneva.

Sokal, R.R., and Michener, C.D. 1958. A statistical method forevaluating systematic relationships. Univ. Kans. Sci. Bull. 38:1409–1438.

Somers, D.J., Kirkpatrick, R., Moniwa, M., and Walsh, A.2003. Mining single-nucleotide polymorphisms from hexa-ploid wheat ESTs. Genome, 46: 431–437. doi:10.1139/g03-027. PMID:12834059.

Staden, R., Beal, K.F., and Bonfield, J.K. 2000. The Staden pack-age. Methods Mol. Biol. 132: 115–130. PMID:10547834.

Taillon-Miller, P., Gu, Z., Li, Q., Hillier, L., and Kwok, P.Y.1998. Overlapping genomic sequences: a treasure trove ofsingle-nucleotide polymorphisms. Genome Res. 8: 748–754.PMID:9685323.

Tenaillon, M.I., Sawkins, M.C., Long, A.D., Gaut, R.L., Doebley,J.F., and Gaut, B.S. 2001. Patterns of DNA sequence poly-morphism along chromosome 1 of maize (Zea mays ssp. maysL.). Proc. Natl. Acad. Sci. U.S.A. 98: 9161–9166. doi:10.1073/pnas.151244298. PMID:11470895.

UNSEA. 1949. Richerche sulla biologıa fiorale di alcune varieta diolivo dell’Abruzzo, Puglie, Calabria e Sicilia. Olearia, 6–7: 5–61.

Useche, F.J., Gao, G., Harafey, M., and Rafalski, A. 2001. High-throughput identification, database storage and analysis of SNPsin EST sequences. Genome Inform. Ser. 12: 194–203.PMID:11791238.

Van de Peer, Y., and De Wachter, R. 1997. Construction of evolu-tionary distance trees with TREECON for Windows: accountingfor variation in nucleotide substitution rate among sites. Com-put. Appl. Biosci. 13: 227–230. PMID:9183524.

1204 Genome Vol. 49, 2006

# 2006 NRC Canada

Vargas, P., and Kadereit, J.W. 2001. Molecular fingerprinting evi-dence (ISSR, inter-simple sequence repeats) for a wild status ofOlea europaea L. (Oleaceae) in the Eurosiberian North of theIberian Peninsula. Flora, 196: 142–152.

Wang, D.G., Fan, J.B., Siao, C.J., Berno, A., Young, P., Sapolsky,R., et al. 1998. Large-scale identification, mapping, and geno-typing of single-nucleotide polymorphisms in the human gen-ome. Science (Washington, D.C.), 280: 1077–1082. doi:10.1126/science.280.5366.1077. PMID:9582121.

Wiesman, Z., Avidan, N., Lavee, S., and Quebedeaux, B. 1998.Molecular characterization of common olive varieties in Israel

and the West Bank using randomly amplified polymorphicDNA (RAPD) markers. J. Am. Soc. Hortic. Sci. 123: 837–841.

Wu, S.-B., Collins, G., and Sedgley, M. 2002. Sexual compatibilitywithin and between olive cultivars. J. Hortic. Sci. Biotechnol.77: 665–673.

Zhu, Y.L., Song, Q.J., Hyten, D.L., Van Tassell, C.P., Matuku-malli, L.K., Grimm, D.R., et al. 2003. Single-nucleotide poly-morphisms in soybean. Genetics, 163: 1123–1134.PMID:12663549.

Zohary, D., and Spiegel-Roy, P. 1975. Beginnings of fruit growingin the Old World. Science (Washington, D.C.), 187: 319–327.

Reale et al. 1205

# 2006 NRC Canada