Histochem Cell BiolDOI 10.1007/s00418-010-0713-y

123

ORIGINAL PAPER

Roles of human !-defensins in innate immune defense at the ocular surface: arming and alarming corneal and conjunctival epithelial cells

Fabian Garreis · Thomas Schlorf · Dieter Worlitzsch · Philipp Steven · Lars Bräuer · Kristin Jäger · Friedrich P. Paulsen

Accepted: 18 May 2010! Springer-Verlag 2010

Abstract Human !-defensins are cationic peptides pro-duced by epithelial cells that have been proposed to be animportant component of immune function at mucosal sur-faces. In this study, the expression and inducibility of!-defensins at the ocular surface were investigated in vitroand in vivo. Expression of human !-defensins (hBD) wasdetermined by RT-PCR and immunohistochemistry in tis-sues of the ocular surface and lacrimal apparatus. Culturedcorneal and conjunctival epithelial cells were stimulatedwith proinXammatory cytokines and supernatants of diVer-ent ocular pathogens. Real-time PCR and ELISA experi-ments were performed to study the eVect on the inducibilityof hBD2 and 3. Expression and inducibility of mouse!-defensins-2, -3 and -4 (mBD2–4) were tested in a mouse

ocular surface scratch model with and without treatment ofsupernatants of a clinical Staphylococcus aureus (SA) iso-late by means of immunohistochemistry. Here we showthat hBD1, -2, -3 and -4 are constitutively expressed in con-junctival epithelial cells and also partly in cornea. Healthytissues of the ocular surface, lacrimal apparatus and humantears contain measurable amounts of hBD2 and -3, withhighest concentrations in cornea and much lower concen-trations in all other tissues, especially tears, suggestingintraepithelial storage of !-defensins. Exposure of culturedhuman corneal and conjunctival epithelial cells to proin-Xammatory cytokines and supernatants of various bacteriarevealed that IL-1! is a very strong inductor of hBD2 andStaphylococcus aureus increases both hBD2 and hBD3production in corneal and conjunctival epithelial cells. Amurine corneal scratch model demonstrated that !-defen-sins are only induced if microbial products within the tearWlm come into contact with a defective epithelium. OurWnding suggests that the tear Wlm per se contains so muchantimicrobial substances that epithelial induction of!-defensins occurs only as a result of ocular surface damage.These Wndings widen our knowledge of the distribution,amount and inducibility of !-defensins at the ocular surfaceand lacrimal apparatus and show how !-defensins are regu-lated speciWcally.

Keywords Human !-defensins · Mouse !-defensins · Ocular surface · Staphylococcus aureus · ProinXammatory cytokines

AbbreviationsHCE Human corneal epithelial cellsHCjE Human conjunctival epithelial cellsIL InterleukinTNF Tumor necrosis factor

F. Garreis · T. Schlorf · L. Bräuer · K. Jäger · F. P. PaulsenDepartment of Anatomy and Cell Biology, Martin Luther University of Halle-Wittenberg, Große Steinstraße 52, 06108 Halle (Saale), Germany

D. WorlitzschDepartment of Hygiene, Martin Luther University of Halle-Wittenberg, Große Steinstraße 52, 06108 Halle (Saale), Germany

P. StevenDepartment of Ophthalmology, University Medical Center Schleswig-Holstein, Campus Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany

F. Garreis (&) · F. P. Paulsen (&)Department of Anatomy II, Friedrich Alexander University Erlangen-Nürnberg, Universitätsst. 19, 91054 Erlangen, Germanye-mail: fabian.garreis@anatomie2.med.uni-erlangen.de

F. P. Paulsene-mail: friedrich.paulsen@anatomie2.med.uni-erlangen.de

Histochem Cell Biol

123

hBD1 Human !-defensin 1hBD2 Human !-defensin 2hBD3 Human !-defensin 3hBD4 Human !-defensin 4mBD2 Mouse !-defensin 2mBD3 Mouse !-defensin 3mBD4 Mouse !-defensin 4

Introduction

So far, several classes of antimicrobial proteins have beendescribed, which have diverse structures and mechanismsof action. Among these, defensins are the best character-ized, and the fact that they are conserved across many phylais a testament to their importance as part of a primordialand highly eVective system of host defense.

Mammalian defensins are small in size (29–45 aminoacids), cationic and are characterized by the presence of sixconserved cysteine residues forming three intra-moleculardisulWde bonds (Bowdish et al. 2006). Based on the distri-bution of the cysteines and the linkage of the disulWdebonds, defensins are classiWed into three subfamilies,referred to as ", ! and #. In humans, six "-defensins havebeen identiWed, particularly in high concentrations in neu-trophils [human neutrophil peptides (HNP)-1-4] (Ganzet al. 1985; Wilde et al. 1989), in intestinal Paneth cells andin the female reproductive tract [human defensin (HD)-5and -6] (Jones and Bevins 1992, 1993; Quayle et al. 1998).Six !-defensins have been identiWed, though more defensingenes were found by computational search (Schneider et al.2005; Schutte et al. 2002). #-defensins are not translated inhuman based on premature stop codons (Nguyen et al.2003). Among !-defensins, hBD1 to hBD3 are produced bykeratinocytes, mucosal epithelial cells of various tissues,and immune cells such as monocytes, dendritic cells, andmacrophages (for review see Schneider et al. 2005). HBD4is found in testis and uterus, and the expression of hBD5and -6 is restricted to epididymis (Yamaguchi et al. 2002).

!-defensins have also attracted much attention. Severalstudies, including our own, have suggested in the last yearsthat they are multifunctional peptides, which also have amultitude of non-antimicrobial functions such as cell prolif-eration and death (Aarbiou et al. 2002; Li et al. 2006;Murphy et al. 1993), wound healing (Aarbiou et al. 2004;Oono et al. 2002), extracellular matrix remodeling (Varogaet al. 2005), cell migration (Grigat et al. 2007; Niyonsabaet al. 2004, 2007; Yang et al. 2000), or functions on pigmen-tation (hair color) or feeding behavior among several others(Beisswenger and Bals 2005; Candille et al. 2007; McDer-mott 2004). Moreover, an abnormal !-defensin expressionis associated with inXammatory diseases such as psoriasis,atopic dermatitis, Crohn’s disease, and cystic Wbrosis

(Zaiou 2007) and overexpression has been shown to induceprogressive muscle degeneration in mice (Yamaguchi et al.2007).

Defensins are also the major antimicrobial peptides atthe ocular surface besides LL-37, a 37 amino acid longcathelicidin (for review see McDermott 2008). At the ocu-lar surface, "-defensins were Wrst detected in inWltratingneutrophils and later, production and secretion by ocularsurface epithelial cells were also shown (McDermott 2008).Zhou et al. (2004) detected the presence of HNP1 to -3 intear Wlm (0.2–1 !g/ml) using liquid chromatography massspectrometry, no evidence for HD5 and HD6 productionwas found. Corneal and conjunctival epithelial cells arebathed in tears that contain low concentrations of neutro-phil defensins in normal (open eye) conditions and becomeelevated after surgery (Zhou et al. 2007).

Also, !-defensins hBD1, -2, and -3 have been shown tobe expressed in ocular surface epithelial cells (for review,see McDermott 2008). However, the protein form of any ofthese !-defensins has not yet been identiWed in tears so far.From this, Li et al. (2009) suggested a low concentration ofpeptides at the ocular surface. The functional impact of!-defensins is further questionable as the eVect of physio-logical salt concentrations of human tears on !-defensinactivity markedly revealed reduction or even loss at lowpeptide concentrations (Huang et al. 2006, 2007). HBD1and hBD3 mRNA were identiWed in normal human cornealand conjunctival epithelial cells (McDermott et al. 2003;Narayanan et al. 2003). HBD3 was shown to have broad-spectrum antimicrobial activity that is less salt sensitivethan other defensins located at the ocular surface (Balset al. 1998a, b; Batoni et al. 2006; Huang et al. 2007).Unlike that of hBD1 or -3, hBD2 expression was low orundetectable in normal healthy corneal and conjunctivalepithelial cells, but increased in cells associated withinXammation such as dry eye syndrome (McDermott et al.2003; Narayanan et al. 2003). It was further shown thatpathogens and proinXammatory cytokines such as IL-1 andTNF" stimulated the production of hBD2 in cultured cor-neal epithelial cells and in epithelia of other tissues(McDermott 2004). On the other hand, Li et al. (2009)demonstrated that hBD2 and -3 selectively increase thesecretion of speciWc proinXammatory cytokines in conjunc-tival epithelial cells in a time- and concentration-dependentmanner suggesting a supporting role to the innate immunesystem of the ocular surface. Finally, it should be men-tioned that in a recent study, the group of Dua et al.(Abedin et al. 2008) detected the expression of a novel!-defensin, DEFB-109, which was detected in ocularsurface epithelia and unexpectedly showed decreasedexpression during inXammation and infection.

Although much information is available regarding theantimicrobial function of !-defensins at the ocular surface,

Histochem Cell Biol

123

several questions remain. Therefore, we set up this study toexpand the current knowledge by performing in vitro and invivo studies to get deeper insights into the regulation andfunction of these small cationic peptides at the ocular sur-face. Due to their broad-spectrum antimicrobial activity andmultiple other actions, !-defensins hold signiWcant promiseas therapeutic agents (Liu et al. 2008). And since a greaterunderstanding of their regulation and biological roles isgained, it is conceivable that an antimicrobial peptide-basedproduct may have a future place in the armamentarium ofeye care professionals who daily deal with bacterial kerati-tis and conjunctivitis which, besides dry eye, are the mostcommon problems.

Materials and methods

Tissues and cell lines

The study was approved by Institutional Review Board reg-ulations, informed consent regulations, and the provisionsof the Declaration of Helsinki.

Tissues of the ocular surface and the lacrimal apparatuswere obtained from cadavers (eight male, ten female, aged44–88 years) donated to the Department of Anatomy andCell Biology, Martin Luther University Halle-Wittenberg,Germany. The donors were free of recent trauma, eye andnasal infections or diseases involving or aVecting lacrimalfunction. All used tissues were dissected from the cadaverswithin a time frame of 4 h up to 24 h post-mortem. Afterdissection, tissues were prepared for paraYn embedding(right eye) by 4% paraformaldehyde Wxation or were usedfor molecular biological investigation (left eye) and wereimmediately frozen at ¡80°C.

SV40-transformed human corneal epithelial cells (HCEcells, a kind gift from Kaoru Araki-Sasaki, Tane MemorialEye Hospital, Osaka, Japan) (Araki-Sasaki et al. 1995), aswell as a human spontaneously immortalized epithelial cellline from normal human conjunctiva [IOBA-NHC, herereferred to as HCjE cells, a kind gift from Yolanda Diebold,University Institute of Applied Ophthalmobiology (IOBA),University of Valladolid, Valladolid, Spain] (Diebold et al.2003) were cultured as monolayers and used for stimulationexperiments.

Cell culture

HCE cells were cultured in Dulbecco modiWed Eaglemedium (DMEM/HAMs F12 1:1; PAA LaboratoriesGmbH, Pasching, Austria) containing 10% Fetal calf serum(FCS; Biochrom AG, Berlin, Germany) and HCjE cellswere cultured in DMEM/HAMs F12 1:1 containing 10%FCS (Biochrom AG, Berlin, Germany), insulin (1 !g/ml;

Sigma-Aldrich, Steinheim, Germany) and hydrocortisone(5 !g/ml; Sigma-Aldrich, Steinheim, Germany) in a humi-diWed 5% CO2 incubator at 37°C. For stimulation experi-ments, HCE and HCjE cells (5 £ 106) were seeded in Petridishes and incubated. At conXuence, before treatment cellswere washed in phosphate-buVered saline (PBS) and incu-bated in serum-free media overnight. Cells were thentreated with diVerent dilutions of supernatants of Burk-holderia cenocepacia, Pseudomonas aeruginosa, Staphylo-coccus aureus and Escherichia coli or were exposed tointerleukin (IL)-1! (5–50 ng/ml; ImmunoTools, Friesoythe,Germany) or tumor necrosis factor (TNF)-" (5–50 ng/ml;ImmunoTools, Friesoythe, Germany) in serum-free mediafor various incubation times (all values are given as Wnalconcentration). In each experiment, supernatants of bacteriacells were incubated with Tryptone Soy Broth (TSB)medium as a control or in case of proinXammatory cyto-kines stimulated with the cytokine solvent. All experimen-tal procedures were performed under normoxic conditions.On completion of each experiment, cells and culture super-natants were collected and stored at ¡80°C until they wereprocessed for RNA extraction (cells) or analysis of human!-defensin secretion (culture supernatants) by ELISAexperiments.

Production of bacterial supernatants

Laboratory strains of P. aeruginosa PAO1 (ATCC 15692),Burkholderia cenocepacia J2315 (LMG 16656), and E. coli(ATCC 8739) as well as S. aureus isolates from patientswith respective ocular surface inXammation/corneal ulcera-tion were grown overnight at 37°C by shaking in TryptoneSoy Broth (Oxoid, Basingstoke, England). Thereafter ten-fold bacterial dilutions were plated on Columbia agar sup-plemented with 10% sheep blood (Heipha, Eppelheim,Germany), incubated overnight at 37°C, and plate countswere performed. Bacteria were centrifuged twice at6,000 rpm for 30 min. Supernatants were Wltered twiceusing Wlters impermeable to bacteria (0.22 !m pore size;Millipore, Eschborn, Germany). Aliquots of the superna-tants were proven to be sterile by overnight incubation onagar. Supernatants were adjusted to a bacterial concentra-tion of 5 £ 107 cfu/ml. TSB growth medium (diluted1:100) served as medium control.

RNA preparation and complementary DNA (cDNA) synthesis

For conventional reverse transcriptase polymerase chainreaction (RT-PCR), tissue biopsies of the ocular surface(cornea and conjunctiva, n = 18, respectively) and the lacri-mal apparatus (lacrimal gland and nasolacrimal ducts,n = 18, respectively) were crushed in an agate mortar under

Histochem Cell Biol

123

liquid nitrogen, then homogenized with a homogenizer(Polytron, Norcross, GA). Total RNA was extracted fromthe tissue biopsies by using RNeasy® Mini Kit (Quiagen,Hilden, Germany).

Total RNA from cultured HCE and HCjE cells wasextracted using TRIZOL® reagent (Invitrogen, Ger-many). Crude RNA was puriWed with isopropanol andrepeated ethanol precipitation, and contaminated DNAwas destroyed by digestion with RNase-free DNase I(30 min, 37°C; Boehringer, Mannheim, Germany). TheDNase was heat-inactivated for 10 min at 65°C. Reversetranscription of all RNA samples to Wrst-strand cDNAwas performed by RevertAid™ H Minus M-MuL VReverse Transcriptase Kit (Fermentas, St. Leon-Rot,Germany) according to manufacturer’s protocol. Twomicrogram total RNA and 10 pmol Oligo (dT)18 primer(Fermentas, St. Leon-Rot, Germany) were used for eachreaction. The ubiquitously expressed !-actin whichproved ampliWable in each case with the speciWc primerpair, served as the internal control for the integrity of thetranslated cDNA.

Polymerase chain reaction (PCR)

For conventional PCR, each reaction was prepared with1 !l cDNA (from each sample), 23.72 !l H2O, 0.9 !l50 mM MgCl2, 0.5 !l 10 mM dNTPs, 3 !l 10 £ PCRbuVer, 0.18 !l (1.25 U) Taq-Polymerase (Invitrogen, Ger-many) and 0.6 !l 10 pmol of each primer mix. Reactionunderwent an initial cycle at 95°C for 5 min followed by 35cycles of 95°C for 20 s, primer speciWc annealing tempera-ture (hBD1, -2 and -3, 60°C; hBD4, 59°C) for 30 s, 72°Cfor 40 s, and a Wnal elongation at 72°C for 5 min. The RT-PCR primers were as follows: hBD1, 5!- CCCAGTTCCTGAAATCCTGA -3! (forward) and 5!- CAGGTGCCTTGAATTTTGGT -3! (reverse) resulting in a 215 bp product;hBD2, 5!- ATCAGCCATGAGGGTCTTGT -3! (forward)and 5!- GAGACCACAGGTGCCAATTT -3! (reverse)(172 bp); hBD3, 5!- AGCCTAGCAGCTATGAGGATC -3!(forward) and 5!- CTTCGGCAGCATTTTCGGCCA -3!(reverse) (206 bp); hBD4, 5!- CCAGCATTATGCAGAGACTTG -3! (forward) and 5!- CATGCATAGGTGTTGGGACA -3! (reverse) (178 bp); !-actin, 5!- TCCTTCTGCATCCTGTCGGCA -3! (forward) and 5!- CAAGAGATGGCCACGGCTGCT -3! (reverse) (275 bp). The primerswere synthesized at MWG-Biotech AG, Ebersberg,Germany. For PCR control samples (labeled as Ø), Revert-AidTM 14 H Minus M-MuL V reverse transcriptase wasreplaced by RNase- and DNase-free water during cDNAsynthesis. Ten microliters of the PCR were loaded on a1.5% agarose gel and the ampliWed products were visual-ized via Xuorescence after electrophoresis. Base pair (bp)values were compared with Genbank data. PCR products

were also conWrmed by sequencing (BigDye; Applied Bio-systems, Foster City, CA).

Quantitative real-time PCR

Samples were analyzed by real-time PCR using an Opticon2 System (MJ Reseach, Waltham, MA). Real-time PCRwas performed using hBD2 and hBD3 primers (see above)to allow calculation of the relative abundance of transcripts.One PCR reaction contained 10 !l SYBR Green MasterMix (Applied Biosystems, Darmstadt, Germany), 0.4 !l10 pmol of each primer mix and 1 !l of each cDNA in aWnal volume of 20 !l. Each plate was run at 50°C for 2 min,then 40 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for40 s, followed by a melting curve proWle (55–95°C) to con-Wrm ampliWcation of speciWc transcripts. A standard curvewas generated by fourfold serial dilutions of cDNA fromnon-stimulated cells. To standardize mRNA concentrationtranscript levels of the housekeeping gene, small ribosomalsubunit (18S rRNA) was determined in parallel for eachsample, and relative transcript levels were corrected by nor-malization based on the 18S rRNA transcript levels. Theprimers for 18S rRNA 5!- CGCTCCACCAACTAAGAACGG -3! (forward) and 5!- ACTCAACACGGGAAACCTCACC -3! (reverse) resulting in a 111 bp product.All real-time PCRs were performed in triplicate, and thechanges in gene expression were calculated by delta deltaCt method (PfaZ 2001). To conWrm the ampliWcation, theresulting real-time PCR products were visualized in an aga-rose gel.

Immunohistochemistry

For analysis by immunohistochemistry lacrimal glands,upper eye lids with conjunctiva, corneae and nasolacrimalsystems from cadavers were Wxed in 4% formalin, embed-ded in paraYn, sectioned (7 !m) and dewaxed. Immunohis-tochemical staining was performed with antibodies tohBD1 (1:100; sc-10849, Santa Cruz, Heidelberg, Ger-many), hBD2 (1:50; sc-10858, Santa Cruz, Heidelberg,Germany), hBD3 (1:100; sc-10860, Santa Cruz, Heidel-berg, Germany) and hBD4 (1:100; ab14419-50, Abcam®,Cambridge, MA). Sections were microwaved for 10 min in10 mM citrate buVer (pH 6.0) containing 0.1 mol citric acidand 0.1 mol sodium citrate in ddH2O and nonspeciWc bind-ing was inhibited by incubation with secondary antibodyspeciWc normal serum (DAKO, Glostrup, Denmark) 1:5 inTris-buVered saline (TBS). The primary antibody wasapplied overnight at 4°C. The secondary antibody wasincubated at room temperature for at least 2 h. Visualiza-tion was achieved with horseradish peroxidase-labeledstreptavidin–biotin complex (StreptABComplex/HRP;DAKO, Glostrup, Denmark) and 3-amino-9-ethylcarbazole

Histochem Cell Biol

123

(AEC; DAKO, Glostrup, Denmark) for at least 5 min. Aftercounterstaining with hemalum, the sections were mountedin Aquatex (Boehringer, Mannheim, Germany). Two nega-tive control sections were used in each case: one was incu-bated with the secondary antibody only, the other with theprimary antibody only. Furthermore, control sections wereincubated with non-immune IgG to determine possibleunspeciWc binding of IgG. Positive control sectionsincluded human skin (hBD1), osteoarthritic cartilage(hBD2, hBD3) (Varoga et al. 2004, 2005), and healthy lung(hBD4) (Yanagi et al. 2005). The slides were examinedwith a Zeiss Axiophot microscope.

ELISA

HBD2 and -3, released in the cell-free supernatant fromnon-stimulated or stimulated HCE or HCjE cells, as well ashBD2 and -3 concentrations in samples from human cor-neae, conjunctivae, lacrimal glands, and nasolacrimal ductsof cadavers (n = 18) and reXex tears of ten healthy volun-teers were measured with an enzyme-linked immunosor-bent assay (ELISA). For sandwich ELISA, 96-wellimmunoplates (MaxiSorp, Nunc, Roskilde, Denmark) werecoated at 4°C over night with 0.5 !g/ml of capture antibody(goat anti-hBD2, 500-P161G; rabbit anti-hBD3, 500-P241;PeproTech Inc., Rocky Hill, USA). One hundred microli-ters of supernatants of each sample were analyzed asdescribed before (Varoga et al. 2005). Wells were incu-bated for 1 h at room temperature with 0.2 !g/ml of biotin-ylated detection antibody (biotinylated goat anti-HBD-2,500-P161GBt; biotinylated rabbit anti hBD3, 500-P241Bt;PeproTech Inc., Rocky Hill, USA). Absorbance was mea-sured at 405 nm with a multichannel photometer. Humanrecombinant hBD2 (300-49; PeproTech Inc., Rocky Hill,USA,) and recombinant hBD3 (300-52; PeproTech Inc.,Rocky Hill, USA) served as the standard with the followingconcentrations: 0, 0.078, 0.156, 0.31, 0.625, 1.25, 2.5 ng/mlrecombinant hBD2 and 0, 0.156, 0.31, 0.625, 1.25, 2.5, 5,10 ng/ml recombinant hBD3. Standard, sample superna-tants and negative controls were performed in duplicates.

Murine model of defective ocular surface barrier function

Expression of mouse !-defensins was examined in an ocu-lar surface scratch murine model using mBD2, -3, and -4antibodies (1:500; Santa Cruz, Heidelberg, Germany).Inbred male, 8–12-week-old BALB/c mice (n = 24) wereused in all experiments. They were housed in the animalfacility of the University of Kiel, Germany under standardlight and temperature conditions.

Three diVerent experimental mice groups were built(n = 8, for each group): group one only received cornealscratching, group two only obtained administration of bac-

terial supernatant on the intact ocular surface, and groupthree was treated by both corneal scratching and adminis-tration of bacterial supernatant onto the ocular surface. Forexperiments, mice of all three groups were anesthetized byintraperitoneal inoculation. The eyes were then checked forcorneal clarity using a stereomicroscope prior to initiationof the experiments. All right eyes of all three groups servedas untreated control eyes. All left corneae of mice groupsone and three obtained three parallel scratches (length,»1.5 mm) by strickling very carefully over the epitheliallining using a sterile 25 5/8-gauge needle. Strickling wasdone so gently that the created defect did not lead to a dele-tion of superWcial epithelial cells but only resulted in epi-thelial cell membrane leakage of scraped superWcialepithelial cells. Each mouse of groups two and three gotadministration of a volume of 10 !l bacterial supernatant,containing 107 colony-forming units (CFU) of S. aureus/mlon the ocular surface of the left eye immediately after thecorneae of mice groups one and three were scratched. Ani-mals of group two were administered with the same volumeof phosphate buVered saline (PBS). Six hours after admin-istration of bacterial supernatant (groups two and three) orPBS (group one), the mice were killed and the heads wereremoved, freed of coat and Wxed in 4% paraformaldehydefor immunohistochemistry studies. After 1-week Wxation,the heads were demineralized using a procedure that wasdescribed in detail recently (Varoga et al. 2004). Sectionsof mouse skin and small intestine were used as positivecontrols. The animal study was approved by the Ministry ofEnvironment, Nature and Forests (Schleswig–Holstein,Germany) (permission no. V742-72241.121-1 [23-4/03])and performed in accordance with the German PositionPaper on Use of Animals in Research.

Statistical analysis

Data is expressed as the mean § standard error (SEM) oftested samples. Statistical signiWcance was evaluated withthe student’s t-test using InStat Statistical software (Graph-pad Software, San Diego, CA, USA). p Values of less than0.05 were considered statistically signiWcant.

Results

HBD1, -2, -3, and -4 are constitutively expressed in conjunctiva and partly also in cornea

Expression of hBD1-4 in tissues of the ocular surface andlacrimal apparatus from cadavers was monitored by RT-PCR and immunohistochemistry. HBD1 speciWc cDNAampliWcation products (215 bp) were detected in all tissuespecimens analyzed (n = 18 for each tissue; Fig. 1). In

Histochem Cell Biol

123

terms of hBD2 and hBD4, RT-PCR revealed ampliWedbands at 172 and 178 bp, in corneal and conjunctival sam-ples, but no expression was obvious in lacrimal glands ornasolacrimal ducts. HBD3 (206 bp) expression was regu-larly detectable in conjunctiva, but not in cornea, lacrimalgland, or nasolacrimal ducts. Negative signals in the PCRcontrol reactions performed without reverse transcriptaseduring cDNA synthesis conWrmed speciWc ampliWcation ofonly cDNA and to exclude primer binding to genomicDNA. The !-actin control PCR was positive and of similaramount for all investigated tissues, indicating adequatecDNA yields had been obtained by the methods used. Basepair values were equivalent to the expected DNA productscompared with GenBank data, and PCR products were alsoconWrmed by sequencing and sequence alignment (data notshown).

ParaYn-embedded 7 !m sections from lacrimalgland, cornea, conjunctiva and nasolacrimal ducts fromthe 18 diVerent cadavers were used for immunohisto-chemical detection of hBD1, -2, -3, and -4. Control sec-tions (non-immune IgG) were negative (unstained) foreach of the investigated tissues (Fig. 2; labeled asØ).Tissue sections used for positive control indicatedthat the method applied worked well (not shown). Cor-nea: HBD1 expression was visible intracytoplasmati-cally in all layers of epithelial cells of healthy corneafrom cadavers (Fig. 2a). Corneal stroma and endothelialcells also revealed some reactivity. SuperWcial cornealepithelial cells revealed weak expression of hBD2 and-3, whereas all other corneal layers showed no reactivity(Fig. 2b, c). None of the corneal sections showed any

reactivity with regard to the antibody against hBD4(Fig. 2d). Conjunctiva: All sections of conjunctivarevealed positive intracellular reactivity with all fourantibodies against hBDs (Fig. 2f–i). All four hBD pep-tides were localized intracytoplasmatically in highcolumnar epithelial cells of the superWcial epitheliallayer revealing subjectively strong staining near the epi-thelial surface. The secretory product of goblet cellsdemonstrated no reactivity (Fig. 2 insets f and g). More-over, staining with antibodies against hBD1, -2, and -3also revealed intracytoplasmatic reactivity in epithelialcells of the basal cell layer as well as in several cellswithin the lamina propria beneath the epithelium whichhistologically had the appearance of macrophages(Fig. 2f–h). The antibody against hBD4 demonstrated noreactivity in these cells (Fig. 2i). Lacrimal gland: Posi-tive reactivity was detected intracytoplasmatically inacinus cells of all healthy lacrimal glands from cadaverswith antibodies against hBD1 and -3 (Fig. 2k, m)whereas antibodies against hBD2 and -4 demonstratedno positive reactivity in any lacrimal gland analyzed(Fig. 2l, n). Nasolacrimal ducts: Positive reactivity wasdetected intracytoplasmatically in high columnar epithe-lial cells of the superWcial epithelial layer but did notstain the secretory product of goblet cells. Moreover,staining with antibodies against hBD1 and -3 alsorevealed intracytoplasmatic reactivity in epithelial cellsof the basal cell layer as well as in several cells withinthe lamina propria beneath the epithelium which had his-tologically the appearance of macrophages (Fig. 2p, r).The antibodies against hBD2 and hBD4 demonstratedpositive reactivity in the apical surface of high prismaticepithelial cells of nasolacrimal ducts and also very weakintra- and subepithelially (Fig. 2q, s).

Healthy cadaveric tissues of the ocular surface, lacrimal apparatus and human tears from healthy volunteers contain measurable amounts of hBD2 and -3

To quantify and compare our results obtained by RT-PCRand immunohistochemistry, we analyzed the hBD2 and -3peptide concentration in diVerent healthy tissues of the ocu-lar surface and lacrimal apparatus of cadavers and in thetear Xuid of healthy volunteers by enzyme-linked immuno-sorbent assay (ELISA). Total protein of cornea (n = 5),conjunctiva (n = 4), lacrimal gland (n = 8), nasolacrimalducts (n = 7) and tear Xuid (n = 8) were extracted andexamined for hBD2 and -3 concentration by ELISA. HBD2and -3 peptides were present in all tissues analyzed and alsoin tear Xuid (Fig. 3). For hBD2, highest amounts were mea-sured in the cornea (1595 § 237.5 pg/mg total protein)of cadavers. Tear Xuid contained 386.8 § 232.9 pg/mg,conjunctiva 310.2 § 19.4 pg/mg, lacrimal gland 226.1 §

Fig. 1 RT-PCR analysis of human !-defensin 1–4 expression in tis-sues of the ocular surface and lacrimal apparatus. The Wgure showsrepresentative results for ethidium bromide-stained agarose gels forvisualization of PCR ampliWcation products from following samples:LG lacrimal gland, Cj conjunctiva, Cr cornea, ND nasolacrimal ducts.PCR controls (Ø) were performed without reverse transcriptase duringcDNA synthesis. To estimate quantitative correlation, a !-actin PCRwas performed for each investigated tissue (275 bp). In accordancewith DNA marker, the distinct DNA bands are visible at 215 bp forhBD1, at 172 bp for hBD2, at 206 bp for hBD3, and at 178 bp forhBD4

Histochem Cell Biol

123

68.9 pg/mg, and nasolacrimal ducts 305.4 § 127.5 pg/mg(Fig. 3a). In contrast, hBD3 concentration in tear Xuid wasmuch lower (141.8 § 71.2 pg/mg), whereas tissue samplescontained clearly higher amounts: cornea (1,793 § 706 pg/mg total protein), conjunctiva (690.3 § 250.9 pg/mg), lac-rimal gland (456.8 § 49.8 pg/mg), and nasolacrimal ducts(557.7 § 214 pg/mg) (Fig. 3b).

IL-1! strongly induces hBD2 and to a much lower content hBD3 in HCE cells whereas weaker eVects are seen in HCjE cells or after stimulation with TNF"

To analyze whether conditions like inXammation induceexpression of hBDs, expression and secretion of hBD2 and-3 were studied by real-time PCR and ELISA in culturedHCE and HCjE cells (real-time PCR was only performed inHCE cells). Therefore, cells were treated with diVerent con-centrations of IL-1! and TNF" for 24 h. Basal hBD2mRNA levels strongly increased up to 1,800-fold afteraddition of diVerent IL-1! concentration for 24 h in HCEcells (Fig. 4a). Real-time PCR indicated an up-regulation ofthe hBD2 transcript after stimulation with 5 ng/ml(3,839 § 313 fold), 10 ng/ml (2,082 § 453 fold), 20 ng/ml(1,869 § 250 fold) and 50 ng/ml IL-1! (3,467 § 630 fold)

compared to unstimulated samples (medium alone). Treat-ment of cultured HCE cells with diVerent TNF" concentra-tion for 24 h exposed induction of hBD2 mRNA at 10 ng/ml (2.8 § 0.9 fold) and 20 ng/ml (9.2 § 5.2 fold) whereas 5and 50 ng/ml TNF" had no signiWcant eVect (Fig. 4b).HBD3 mRNA expression was only induced at a concentra-tion of 50 ng/ml IL-1! (3.0 § 0.2 fold) whereas all otherconcentrations had no signiWcant eVect (Fig. 4c). HBD3mRNA was induced at 10 ng/ml (21.3 § 5.9 fold), 20 ng/ml (32.2 § 10.4 fold), and 50 ng/ml TNF" (4.8 § 1.9 fold)whereas 5 ng/ml had no signiWcant eVect (Fig. 4d).

ELISAs were performed to analyze the amount ofsecreted hBD2 and -3 in the culture medium of HCE andHCjE cells after challenge with 50 ng/ml TNF-" or 50 ng/ml IL-1! for 24 h (Fig. 4e, f). HBD2 and -3 peptides wereexpressed by both untreated and stimulated cells on proteinlevel. IL-1! signiWcantly induced hBD2 secretion in bothcell lines (Fig. 4e): over 14-fold in HCE cells and nearly1.5-fold in HCjE compared to untreated controls (mediumalone). Secretion of hBD3 signiWcantly rose up to twofoldin both cell lines after 50 ng/ml IL-1! treatment for 24 h(Fig. 4f). Treatment of HCE cells with 50 ng/ml TNF" for24 h had no eVect on hBD2 expression, whereas hBD3secretion into the culture supernatant was diminished in

Fig. 2 Immunohistochemistry of tissues from ocular surface and lac-rimal apparatus. Pictures shown are representative of human cornea(a–e), conjunctiva (f–j), lacrimal gland (k–o) and nasolacrimal ducts(p–t). Immunostaining was performed using antibody preparation

against hBD1 (a, f, k, p), hBD2 (b, g, l, q), hBD3 (c, h, m, r), hBD4(d, i, n, s) and non-immune goat IgG (Ø) (e, j, o, t). Insets: magniWedindividual goblet cells (f and g). Positive reactivity is visible by redstaining. Scale bars: a–e, p–t 42.5 !m; f–o 176 !m (n = 18, for all)

Histochem Cell Biol

123

cultured HCE cells up to 70% compared to non-stimulatedcells. By contrast, 24 h stimulation with 50 ng/ml TNF"increased the hBD2 and -3 peptide levels released by HCjEcells up to twofold. Advanced stimulation experiments inboth cell lines with IL-1! and TNF" (5, 10, and 20 ng/ml)for 12–48 h showed comparable results (not shown).

Supernatant of Staphylococcus aureus induces hBD2 and -3 production in HCE and HCjE cells

We next assessed whether products of bacteria that are fre-quently involved in ocular surface infection aVect theexpression and secretion of human hBD2 and -3 in cell cul-ture model in vitro. For this purpose, real-time PCR wasperformed to test the inducibility of hBD2 and -3 geneexpression in cultured HCE and HCjE cells after challengewith the Gram-positive bacterium S. aureus for 16 h. Basal

hBD2 mRNA levels increased up to 25.8 § 8.6 fold inHCE and 2.4 § 0.6 fold in HCjE cells compared to unstimu-lated cells (Fig. 5a). HBD3 real-time PCR (Fig. 5b) alsoexposed an induction of the hBD3 gene transcript(9.7 § 3.2 fold) in cultured HCjE cells after exposure tosupernatant of S. aureus for 16 h. Almost no change of thehBD3 mRNA level was obvious in HCE cells after treat-ment with the S. aureus supernatant.

ELISAs were performed to analyze hBD2 and -3 pro-duction on protein level after stimulation with supernatantof S. aureus. In addition to S. aureus, we also stimulatedHCE and HCjE cells with supernatants of B. cenocepacia,E. coli and P. aeruginosa. A signiWcant increase of hBD2peptide was measured after stimulation with supernatantsof P. aeruginosa (1.9 fold) and S. aureus (1.2 fold) in HCEcells after 16 h stimulation (Fig. 5c). In HCjE cells, anincrease of hBD2 was only detected after stimulation withS. aureus (1.5 fold) compared to untreated cells (mediumonly). No induction was visible after stimulation withsupernatants of B. cenocepacia or E. coli in both cell lines.Basal hBD3 peptide levels strongly increased up to 32-foldin HCE cells and 34-fold in HCjE cells after treatment withsupernatant of S. aureus (16 h stimulation; Fig. 5d), invitro. No inducibility of hBD3 was seen after challengewith supernatants of P. aeruginosa in HCE or HCjE cells,but in contrast to hBD2 expression, we found that superna-tants of B. cenocepacia slightly induced hBD3 secretion inHCjE cells. No hBD3 induction could be detected afteraddition of E. coli supernatant in both cell lines.

In addition, ELISAs were performed to quantify hBD3production after stimulation with S. aureus over severaltime points (5 min up to 24 h) in HCE cells (Fig. 6). A sig-niWcant increase of the hBD3 peptide concentration wasalready observed after 5 min (5.1 § 0.3-fold) and persistedup to 24 h (62.5 § 2.4-fold) with maximum protein expres-sion at 12 h (98.7 § 2.8-fold). HBD2 also revealed a sig-niWcant induction from 12 h up to 24 h of stimulation withsupernatant of S. aureus (data not shown). In contrast tohBD3, no eVect was observed before 12 h stimulation.

In vivo, ! defensins are only induced if microorganisms get into the tear Wlm and come across a defective epithelium

Expression and induction of mBD2, -3 and -4 were testedin vivo in a murine ocular surface scratch model. To exam-ine the ocular surface barrier function in mice, we tested (1)the insertion of inactivated supernatant of S. aureus into thetear Wlm alone (Fig. 7a–f), (2) insertion of inactivatedsupernatant of S. aureus combined with corneal scratchingof the ocular surface (Fig. 7g–l), and (3) corneal scratchingalone (Fig. 7m–r). Afterwards, immunohistochemistry wasperformed using antibodies against mBD2, -3 and -4(Fig. 7). Scratching alone had no eVect on the induction of

Fig. 3 QuantiWcation of hBD2 (a) and -3 (b) concentrations in diVer-ent tissues of the lacrimal apparatus of cadavers and in the tear Xuid ofhealthy volunteers. Total protein of cornea (n = 5), conjunctiva (n = 4),lacrimal gland (n = 8) and nasolacrimal ducts (n = 7) was extracted anddetermined by enzyme-linked immunosorbent assay (ELISA). TearXuid obtained from healthy volunteers (n = 8) was also examined byhBD2 and -3 ELISA. Each bar represents the mean § SEM of each tis-sue and tear Xuid, respectively. Amounts of hBD2 and -3 concentra-tions were normalized with total protein concentration from tissueextracts and tear Xuid

Histochem Cell Biol

123

any of the investigated mBDs, neither in cornea nor inconjunctiva. Insertion of supernatant of an ocular patho-genic S. aureus strain into the tear Wlm (dropping into the

conjunctival sac) led to a slight induction of mBD3 and -4in superWcial conjunctival epithelial cells (Fig. 7d, f). NoeVect was seen in cornea for any mBD tested or for mBD2

Fig. 4 ProinXammatory cytokines induce human hBD2 and -3 expres-sion and secretion in cultured human corneal (HCE) and conjunctivalepithelial (HCjE) cells. HCE and HCjE cells were stimulated with pro-inXammatory cytokines for 24 h. HBD2 and -3 mRNA levels and pep-tide release into the media supernatant was determined by real-timePCR (a–d) and ELISA (e, f) experiments. Real time data represent thefold increase in hBD2 and hBD3 transcript levels versus untreated cells

(medium).The concentration of released hBD2 (e) and 3 peptides (f)into the culture supernatant after stimulation of HCE (open bars) andHCjE (diagonal stripes) cells with 50 ng/ml IL-1! or TNF" for 24 hwas measured by ELISA. Values were compared between stimulatedand non-stimulated cells (medium alone). Each bar represents themean § SEM of four independent experiments. *p < 0.05; **p < 0.01;***p < 0.001

Histochem Cell Biol

123

in conjunctiva. A combination of both scratching of thecornea and insertion of S. aureus supernatant, led to astrong induction of mBD3 and -4 in all layers of corneal(Fig. 7i, k) and conjunctival (Fig. 7j, l) epithelial cells.Moreover, slight induction of mBD2 in superWcial epithe-lial cells of conjunctiva but not of cornea was also observed(Fig. 7h, g). Interestingly, secretion products of conjuncti-val goblet cells also stained positive with the antibodyagainst mBD3 after the combined treatment (Fig. 7j).

Discussion

The innate immune system at the ocular surface plays a keyrole in the resistance of epithelial surfaces to microbial col-onization and protection from pathogen attacks. The human!-defensins are principal components of this defense bar-rier in vivo. Both cornea and conjunctiva epithelial cells aswell as epithelial cells of the nasolacrimal ducts express!-defensins. HBD1 is constitutively expressed whereas theexpression of hBD2 has been found to be variable, as it isexpressed by normal tissues only occasionally (Hattenbachet al. 1998; Haynes et al. 1998; Lehmann et al. 2000;McDermott et al. 2003; McNamara et al. 1999; Narayananet al. 2003; Paulsen et al. 2001). Our present results conWrmconstitutive expression of hBD1 on mRNA and protein lev-els in all tissues under investigation including lacrimalgland. However, in contrast to the above mentioned investi-gations, we also found constitutive expression of hBD2 inboth conjunctiva and cornea (n = 18 samples from diVerentpersons) on mRNA and protein levels whereas hBD2mRNA was not detectable in lacrimal gland and nasolacri-mal ducts. Immunohistochemistry revealed positive stain-ing in conjunctival epithelial cells and weakly in superWcialepithelial cells of cornea and nasolacrimal ducts but not inlacrimal gland. HBD2 ELISA showed that the peptide ispresent in all tissues under investigation with unexpectedhighest concentrations in cornea (>1,500 pg/ml total pro-tein) and concentrations between 300 and 500 pg/ml totalprotein in lacrimal gland, conjunctiva and nasolacrimalducts. The observed diVerences between the methodsapplied allow several conclusions. It might be hypothesizedthat hBD2 is stored and/or bound to epithelial cells of thediVerent tissues which would explain the measured concen-trations by ELISA and would allow the cells to directlysecrete stored peptide due to a relevant stimulus. In corneaand conjunctiva, there is additional constitutive hBD2expression on mRNA and protein levels; in lacrimal glandand nasolacrimal ducts, hBD2 mRNA and protein are onlyinduced after a relevant stimulus. DiVerences in the immu-nohistochemical staining pattern might be due to problemsof the used antibodies to detect proforms of hBD2.Although lacrimal gland shows the lowest hBD2 concentra-tion which might be below the detection level of the usedantibody, this does not correlate to the Wvefold higherhBD2 levels in cornea detected by ELISA and the veryweak immunohistochemical staining of superWcial cornealepithelial cells. A further explanation for the observeddiVerences might be that we used tissues from cadavers. Ifblood Xow stops after death, epithelial cells and colonizingmicroorganisms are still alive for a while. This could leadto induction of antimicrobial peptides in the epithelial cells.However, this does not explain why both hBD2 and hBD3are expressed the highest in cornea which is per se avascular

Fig. 5 Supernatant of Staphylococcus aureus (Sa) induce the produc-tion and secretion of hBD2 and -3 in cultured human corneal (HCE)and conjunctival epithelial (HCjE) cells. Cell lines were stimulatedwith supernatants of Burkholderia cenocepacia (Bc), Pseudomonasaeruginosa (Pa), Eschericha coli (Ec) and S. aureus (Sa) for 16 h.HBD2 and -3 mRNA levels and peptide release into the media super-natant was determined by real-time PCR (a, b) and ELISA (c, d). Real-time experimental (a, b) data represent the fold increase of hBD2 and-3 transcript levels versus untreated cells (medium). In ELISA experi-ments (c, d) values were compared between stimulated and non-stim-ulated cells (medium alone). Each bar represents the mean § SEM ofthree independent experiments. *p < 0.05, ***p < 0.001 versuscontrols

Histochem Cell Biol

123

or why expression is not induced in the nasolacrimal ducts,which are intensively colonized by bacteria.

Corneal and conjunctival epithelial cells also expresshBD3 (McDermott et al. 2003; McIntosh et al. 2005;Narayanan et al. 2003). This is in line with our present Wnd-ings. However, hBD3 mRNA is only constitutivelyexpressed in conjunctiva, whereas cornea, lacrimal glandand nasolacrimal ducts show no constitutive expression.ELISA and immunohistochemistry indicate that hBD3 ispresent in all four tissues without relevant stimulus. Com-parable to hBD2, hBD3 concentrations are highest in cor-nea and lowest in lacrimal gland. Here too, corneal stainingintensity is not in line with the hBD3 concentrations mea-sured by ELISA.

Whilst McIntosh et al. (2005) detected expression ofhBD4 in cultured ocular surface cells, this defensin wasfound only infrequently in non-cultured samples. Huanget al. (2007) did not detect hBD4 as well as hBD5 or -6 inocular surface cells. Our present results indicate constitu-tive expression of hBD4 mRNA in cornea and conjunctiva.Immunohistochemistry revealed weak reactivity at the sur-face of conjunctiva epithelial cells and in epithelial cells ofthe nasolacrimal ducts whereas lacrimal gland and corneawere not reactive. DiVerences between mRNA and proteindetection might be the same as those already discussed forhBD2.

Our ELISA investigations clearly show that hBD2 ispresent in the tear Wlm. The concentration is comparable to

Fig. 6 EVect of diVerent incu-bation times with supernatant of Staphylococcus aureus (Sa) on the expression of hBD3. HCE cells were incubated with 1:100 dilution of supernatant of Sa for 5 min up to 24 h. Secretion of hBD3 peptide into medium was analyzed by ELISA. Values are the mean § SEM of three inde-pendent experiments. **p < 0.01, ***p < 0.001 versus controls (medium alone)

Fig. 7 Immunohistochemical detection of mouse !-defensins-2, -3and -4 (mBD2-4) in a murine ocular surface scratch model with andwithout treatment of inactivated supernatant of Staphylococcus aureus(Sa). Picture shown are representative of mouse cornea (a, c, e, g, i, k,m, o and q) and conjunctiva (b, d, f, h, j, l, n, p and r) in a murine oc-ular surface scratch model with and without treatment of inactivatedsupernatant of Sa. a–f Murine ocular surface after insertion of superna-tant of Sa into the tear Wlm (dropping into the conjunctival sac).

g–l Murine ocular surface after combination of scratching of the corneaand insertion of Sa supernatant. m–r Murine ocular surface afterscratching the corneal surface alone. Immunostaining was performedusing antibody preparation against mBD2 (a, b, g, h, m and n), mBD3(c, d, i, j, o and p) and mBD4 (e, f, k, l, q and r). Positive reactivity isvisible by red staining. ParaYn section (6 !m) counterstained withhematoxylin. Scale bars 82.5 !m for all panels (n = 8, for all)

Histochem Cell Biol

123

conjunctiva, lacrimal gland and nasolacrimal ducts. Thetear Wlm also contains hBD3 but its concentration is muchlower (141.8 § 71.2 pg/mg). The relatively low concentra-tions of both peptides might be based on the fact that weonly investigated reXex tears and this might also be why, incontrast to "-defensins, !-defensins were not detected in thetear Wlm so far (Huang et al. 2007; Zhou et al. 2004). Ocu-lar surface hBD2 expression is known to be inducible byexposure to both Gram-negative and -positive bacteria andbacterial products such as lipopolysaccharide (LPS), pepti-doglycan and lipoproteins (Kumar et al. 2004, 2006, 2007;Li et al. 2008; McNamara et al. 1999). These eVects arechieXy mediated via activation of TLRs such as TLR2 (Liet al. 2008). Cytokines such as IL-1 and TNF" have alsobeen shown to induce hBD2 (McDermott et al. 2003;Narayanan et al. 2003; Shin et al. 2004). So far, hBD3upregulation has not been observed in ocular surface epi-thelial cells (Narayanan et al. 2003) whereas some studieshave indicated that expression of this defensin is inducibleby TNF" and interferon $ (Garcia et al. 2001; Harder et al.2001; Nomura et al. 2003). Our present studies expandthese Wndings. We demonstrate that IL-1! is an unexpectedstrong inductor of hBD2 in corneal epithelial cells increas-ing its mRNA production up to 1,800-fold and protein up to14-fold. With regard to this Wnding, further research will beof interest as it has been shown just recently that Th17 cellsmainly produce IL-1! besides IL-6 and IL17. Th17 signal-ing promotes inXammation, tissue injury, and autoimmu-nity and is increased and involved in dry eye disease(Chauhan et al. 2009). Our Wndings further show that hBD3production is also increased by IL-1!, but only 2.5 fold.SigniWcant eVects are also obvious in conjunctival epithe-lial cells. However, the eVects are much lower in compari-son with corneal cells. In addition, TNF" upregulates bothhBD2 and -3 in corneal and conjunctival epithelial cells andthis is in clear contrast to the Wndings by Narayanan et al.(2003).

In vitro studies have also shown that defensins are activeagainst ocular pathogens. HBD3 has good activity againstboth P. aeruginosa and S. aureus, while hBD2 has onlygood activity against Gram-negative bacteria (e.g. P. aeru-ginosa) but show only weak antimicrobial activity againstGram-positive S. aureus strains. HBD1 is the least eVectiveof the ocular surface defensins tested, having only moderateactivity against P. aeruginosa and none against staphylo-coccal strains (Huang et al. 2007). Here, we show that thesupernatant of P. aeruginosa strongly upregulates hBD2expression in corneal epithelial cells whereas it has noeVect on conjunctival epithelial cells or on hBD3 upregula-tion. In contrast, supernatant of S. aureus strongly induceshBD2 and hBD3 expression in both cell lines suggestingthat hBD3 also belongs to the innate immune system actingagainst S. aureus at the ocular surface.

In vitro antimicrobial activity is rapid (15–90 min)(McDermott 2008). Interestingly, we could measure signiW-cant hBD3 peptide concentrations already 5 min after expo-sure to the bacterial supernatant. This could mean thatpeptide production is extensively fast or as already dis-cussed above, already produced hBD3 is stored in epithelialcells and is immediately laid oV after exposure to the bacte-rial supernatant. With regard to storage of AMPs, studieshave revealed that in skin, defensins are localized to struc-tures called lamellar bodies, which are lipid-containing ves-icles secreted into the extracellular space and which havethe eVect of raising the local concentration of these anti-microbial peptides (Oren et al. 2003). However, the veryfast reactivity of hBD3 after already 5 min was notobserved for hBD2. The latter Wrst signiWcantly increased12 h after exposure to supernatant of S. aureus. Both AMPshBD2 and -3 had their peak at 12 h and then their productiondecreased again but nevertheless was still signiWcantlyupregulated 24 h after exposure to the stimulus.

Two issues regarding defensin activity that have fre-quently been raised are whether or not suYciently high lev-els can be achieved in vivo to ensure adequateantimicrobial activity and whether they are active in a saltsolution, i.e. the tear Wlm. The eVect of physiological saltconcentrations and human tears on AMP antimicrobialactivity has been tested in vitro. Huang et al. (2006, 2007)found that antimicrobial activity was markedly reduced oreven lost at low AMP concentrations but at higher concen-trations, it was not as much aVected. This implies that ele-vated AMP levels would indeed have signiWcantantimicrobial activity. However, it must be noted that athigh concentrations, AMPs frequently become cytotoxic tomammalian cells including those of the ocular surface(Huang et al. 2006; Paulsen et al. 2005). Interestingly, inthe presence of human tears, the in vitro activity of hBD1and -2 was virtually eliminated even at high peptide con-centrations (Huang et al. 2007) whereas this was not thecase for hBD3.

Expression of hBD2 has been shown to be upregulatedin the cornea in response to injury (McDermott 2001) andin the conjunctival epithelium of patients with dry eye(Kawasaki et al. 2003; Narayanan et al. 2003). Further-more, Wu et al. (2009) demonstrate in a current study thatmouse !-defensins (mBD)-3 and -4 together promote resis-tance to P.aeruginosa keratitis in a murine model. To fur-ther elucidate these aspects, we performed an in vivocorneal scratch model in mice. The corneal scratch modelshowed that induction of mouse !-defensins (mBD) is veryspeciWc. Relevant induction of mBD (mBD3 and -4) occursonly if supernatant of S. aureus gets into the tear Wlm andcomes across a damaged epithelial layer. If the epitheliallayer is injured alone or only supernatant of S. aureus isinserted into the tear Wlm without corneal damage, nearly

Histochem Cell Biol

123

no induction of mBDs occurs. This implies that the tearWlm per se contains so much antimicrobial substances (forexample secretory phospholipase A2 that has been shownto be well able to kill S. aureus) (Qu and Lehrer 1998)which act against S. aureus that no induction of mBDs isnecessary. Moreover, the experiment demonstrates thatmBDs if induced are not only expressed at sites of tissuedamage (cornea) but also in the non-injured conjunctivalepithelium. It might be that the tight junctions of the intactcornea likely prevent penetration of S. aureus pathogen-associated molecular patterns (PAMPs) whereas the moreleaky conjunctiva may not. Moreover, it may also berelated to the distribution of TLRs, which are going to bethe primary responders to S. aureus PAMPs. However,whether !-defensin induction occurs via activation acrossthe tear Wlm or maybe also a neuronal route needs to bedetermined in further experiments. It should be mentionedthat during the animal experiment, the mouse homologue ofhBD3 was still unknown. Therefore, we investigated mBD-2, -3, and -4. MBD3 and mBD4 are known to be the mousehomologues of hBD2 (Burd et al. 2002; Semple et al.2006), and mBD14 has been shown in the meantime to bethe mouse homologue of hBD3 (Hinrichsen et al. 2008).

In conclusion, although a huge bulk of knowledge existswith regard to !-defensins at the ocular surface, the presentWndings widen our knowledge of the distribution, amountand inducibility of these small peptides and demonstratehow speciWcally they are regulated at the ocular surface andin the lacrimal apparatus.

Acknowledgments We thank Ute Beyer, Stephanie Beilecke, Sus-ann Möschter, Karin Stengel and Regine Worm for excellent technicalassistance and Dr. Bernhard Nölle (Department of Ophthalmology,Christian Albrecht University of Kiel) for providing us with clinicalsamples. Moreover, we are grateful to Deike Varoga (Department ofTrauma Surgery, University Hospital of Schleswig-Holstein, CampusKiel, Germany) for helpful advice and discussion with regard to thecorneal scratch model as well as Ute Schulze and Sylvia Dyczek fortheir help with the translation. This work was supported by the Deut-sche Forschungsgemeinschaft (DFG)–program grants PA 738/9-1 andPA 738/9-2, BMBF–Wilhelm Roux Program, Halle, Germany–pro-gram grants FKZ 09/16, 14/25, and 16/35, as well as Sicca For-schungsförderung of the professional Association of GermanOphthalmologists.

ConXict of interest statement The authors have no Wnancial con-Xict of interest.

References

Aarbiou J, Ertmann M, van Wetering S, van Noort P, Rook D, RabeKF, Litvinov SV, van Krieken JH, de Boer WI, Hiemstra PS(2002) Human neutrophil defensins induce lung epithelial cellproliferation in vitro. J Leukoc Biol 72:167–174

Aarbiou J, Verhoosel RM, Van Wetering S, De Boer WI, Van KriekenJH, Litvinov SV, Rabe KF, Hiemstra PS (2004) Neutrophil

defensins enhance lung epithelial wound closure and mucin geneexpression in vitro. Am J Respir Cell Mol Biol 30:193–201

Abedin A, Mohammed I, Hopkinson A, Dua HS (2008) A novel anti-microbial peptide on the ocular surface shows decreased expres-sion in inXammation and infection. Invest Ophthalmol Vis Sci49:28–33

Araki-Sasaki K, Ohashi Y, Sasabe T, Hayashi K, Watanabe H, TanoY, Handa H (1995) An SV40-immortalized human corneal epi-thelial cell line and its characterization. Invest Ophthalmol VisSci 36:614–621

Bals R, Goldman MJ, Wilson JM (1998a) Mouse beta-defensin 1 is asalt-sensitive antimicrobial peptide present in epithelia of the lungand urogenital tract. Infect Immun 66:1225–1232

Bals R, Wang X, Wu Z, Freeman T, Bafna V, ZasloV M, Wilson JM(1998b) Human beta-defensin 2 is a salt-sensitive peptide antibi-otic expressed in human lung. J Clin Invest 102:874–880

Batoni G, Maisetta G, Esin S, Campa M (2006) Human beta-defensin-3: a promising antimicrobial peptide. Mini Rev Med Chem6:1063–1073

Beisswenger C, Bals R (2005) Functions of antimicrobial peptides inhost defense and immunity. Curr Protein Pept Sci 6:255–264

Bowdish DM, Davidson DJ, Hancock RE (2006) Immunomodulatoryproperties of defensins and cathelicidins. Curr Top MicrobiolImmunol 306:27–66

Burd RS, Furrer JL, Sullivan J, Smith AL (2002) Murine beta-defen-sin-3 is an inducible peptide with limited tissue expression andbroad-spectrum antimicrobial activity. Shock 18:461–464

Candille SI, Kaelin CB, Cattanach BM, Yu B, Thompson DA, NixMA, Kerns JA, Schmutz SM, Millhauser GL, Barsh GS (2007) A-defensin mutation causes black coat color in domestic dogs. Sci-ence 318:1418–1423

Chauhan SK, El Annan J, EcoiYer T, Goyal S, Zhang Q, Saban DR,Dana R (2009) Autoimmunity in dry eye is due to resistance ofTh17 to Treg suppression. J Immunol 182:1247–1252

Diebold Y, Calonge M, Enriquez de Salamanca A, Callejo S, CorralesRM, Saez V, Siemasko KF, Stern ME (2003) Characterization ofa spontaneously immortalized cell line (IOBA-NHC) from nor-mal human conjunctiva. Invest Ophthalmol Vis Sci 44:4263–4274

Ganz T, Selsted ME, Szklarek D, Harwig SS, Daher K, Bainton DF,Lehrer RI (1985) Defensins. Natural peptide antibiotics of humanneutrophils. J Clin Invest 76:1427–1435

Garcia JR, Jaumann F, Schulz S, Krause A, Rodriguez-Jimenez J,Forssmann U, Adermann K, Klüver E, Vogelmeier C, Becker D,Hedrich R, Forssmann W-G, Bals R (2001) IdentiWcation of anovel, multifunctional ß-defensin (human ß-defensin 3) with spe-ciWc antimicrobial activity. Cell Tissue Res 306:257–264

Grigat J, Soruri A, Forssmann U, Riggert J, Zwirner J (2007) Chem-oattraction of macrophages, T lymphocytes, and mast cells is evo-lutionarily conserved within the human alpha-defensin family.J Immunol 179:3958–3965

Harder J, Bartels J, Christophers E, Schroder JM (2001) Isolation andcharacterization of human beta-defensin-3, a novel human induc-ible peptide antibiotic. J Biol Chem 276:5707–5713

Hattenbach LO, Gumbel H, Kippenberger S (1998) IdentiWcation ofbeta-defensins in human conjunctiva. Antimicrob Agents Chemo-ther 42:3332

Haynes RJ, Tighe PJ, Dua HS (1998) Innate defence of the eye by anti-microbial defensin peptides. Lancet 352:451–452

Hinrichsen K, Podschun R, Schubert S, Schroder JM, Harder J, Pro-ksch E (2008) Mouse beta-defensin-14, an antimicrobial orthologof human beta-defensin-3. Antimicrob Agents Chemother52:1876–1879

Huang LC, Petkova TD, Reins RY, Proske RJ, McDermott AM (2006)Multifunctional roles of human cathelicidin (LL-37) at the ocularsurface. Invest Ophthalmol Vis Sci 47:2369–2380

Histochem Cell Biol

123

Huang LC, Jean D, Proske RJ, Reins RY, McDermott AM (2007) Oc-ular surface expression and in vitro activity of antimicrobial pep-tides. Curr Eye Res 32:595–609

Jones DE, Bevins CL (1992) Paneth cells of the human small intestineexpress an antimicrobial peptide gene. J Biol Chem 267:23216–23225

Jones DE, Bevins CL (1993) Defensin-6 mRNA in human Panethcells: implications for antimicrobial peptides in host defense ofthe human bowel. FEBS Lett 315:187–192

Kawasaki S, Kawamoto S, Yokoi N, Connon C, Minesaki Y, KinoshitaS, Okubo K (2003) Up-regulated gene expression in the conjunc-tival epithelium of patients with Sjogren’s syndrome. Exp EyeRes 77:17–26

Kumar A, Zhang J, Yu F-SX (2004) innate immune response of cor-neal epithelial cells to Staphylococcus aureus infection: role ofpeptidoglycan in stimulating proinXammatory cytokine secretion.Invest Ophthalmol Vis Sci 45:3513–3522

Kumar A, Zhang J, Yu FS (2006) Toll-like receptor 2-mediatedexpression of beta-defensin-2 in human corneal epithelial cells.Microbes Infect 8:380–389

Kumar A, Yin J, Zhang J, Yu F-SX (2007) Modulation of cornealepithelial innate immune response to Pseudomonas Infection byXagellin pretreatment. Invest Ophthalmol Vis Sci 48:4664–4670

Lehmann OJ, Hussain IR, Watt PJ (2000) Investigation of beta defen-sin gene expression in the ocular anterior segment by semiquanti-tative RT-PCR. Br J Ophthalmol 84:523–526

Li J, Raghunath M, Tan D, Lareu RR, Chen Z, Beuerman RW (2006)Defensins HNP1 and HBD2 stimulation of wound-associated re-sponses in human conjunctival Wbroblasts. Invest Ophthalmol VisSci 47:3811–3819

Li Q, Kumar A, Gui JF, Yu FS (2008) Staphylococcus aureus lipopro-teins trigger human corneal epithelial innate response throughtoll-like receptor-2. Microb Pathog 44:426–434

Li J, Zhu HY, Beuerman RW (2009) Stimulation of speciWc cytokinesin human conjunctival epithelial cells by defensins HNP1, HBD2,and HBD3. Invest Ophthalmol Vis Sci 50:644–653

Liu S, Zhou L, Li J, Suresh A, Verma C, Foo YH, Yap EP, Tan DT,Beuerman RW (2008) Linear analogues of human beta-defen-sin 3: concepts for design of antimicrobial peptides withreduced cytotoxicity to mammalian cells. Chembiochem9:964–973

McDermott AM (2001) Human beta-defensin 2 is up-regulated duringre-epithelialization of the cornea. Curr Eye Res 22:64–67

McDermott AM (2004) Defensins and other antimicrobial peptides atthe ocular surface. Ocul Surf 2:229–247

McDermott AM (2008) The role of antimicrobial peptides at the ocularsurface. Ophthalmic Res 41:60–75

McDermott AM, Redfern RL, Zhang B, Pei Y, Huang L, Proske RJ(2003) Defensin expression by the cornea: multiple signallingpathways mediate IL-1beta stimulation of hBD-2 expression byhuman corneal epithelial cells. Invest Ophthalmol Vis Sci44:1859–1865

McIntosh RS, Cade JE, Al-Abed M, Shanmuganathan V, Gupta R,Bhan A, Tighe PJ, Dua HS (2005) The spectrum of antimicrobialpeptide expression at the ocular surface. Invest Ophthalmol VisSci 46:1379–1385

McNamara N, Van R, Tuchin OS, Fleiszig SM (1999) Ocular surfaceepithelia express mRNA for human beta defensin-2. Exp Eye Res69:483–490

Murphy CJ, Foster BA, Mannis MJ, Selsted ME, Reid TW (1993)Defensins are mitogenic for epithelial cells and Wbroblasts. J CellPhysiol 155:408–413

Narayanan S, Miller WL, McDermott AM (2003) Expression of hu-man beta-defensins in conjunctival epithelium: relevance to dryeye disease. Invest Ophthalmol Vis Sci 44:3795–3801

Nguyen TX, Cole AM, Lehrer RI (2003) Evolution of primate theta-defensins: a serpentine path to a sweet tooth. Peptides 24:1647–1654

Niyonsaba F, Ogawa H, Nagaoka I (2004) Human beta-defensin-2functions as a chemotactic agent for tumour necrosis factor-alpha-treated human neutrophils. Immunology 111:273–281

Niyonsaba F, Ushio H, Nakano N, Ng W, Sayama K, Hashimoto K,Nagaoka I, Okumura K, Ogawa H (2007) Antimicrobial peptideshuman beta-defensins stimulate epidermal keratinocyte migra-tion, proliferation and production of proinXammatory cytokinesand chemokines. J Invest Dermatol 127:594–604

Nomura I, Goleva E, Howell MD, Hamid QA, Ong PY, Hall CF, DarstMA, Gao B, Boguniewicz M, Travers JB, Leung DY (2003)Cytokine milieu of atopic dermatitis, as compared to psoriasis,skin prevents induction of innate immune response genes.J Immunol 171:3262–3269

Oono T, Shirafuji Y, Huh WK, Akiyama H, Iwatsuki K (2002) EVectsof human neutrophil peptide-1 on the expression of interstitialcollagenase and type I collagen in human dermal Wbroblasts. ArchDermatol Res 294:185–189

Oren A, Ganz T, Liu L, Meerloo T (2003) In human epidermis, beta-defensin 2 is packaged in lamellar bodies. Exp Mol Pathol74:180–182

Paulsen FP, Pufe T, Schaudig U, Held-Feindt J, Lehmann J, SchroderJM, Tillmann BN (2001) Detection of natural peptide antibioticsin human nasolacrimal ducts. Invest Ophthalmol Vis Sci42:2157–2163

Paulsen F, Varoga D, Steven P, Pufe T (2005) Antimicrobial peptidesat the ocular surface. In: Zierhut M, Stern ME, Sullivan DA (eds)Immunology of lacrimal gland and tear Wlm. Taylor & Francis,London, pp 97–104

PfaZ MW (2001) A new mathematical model for relative quantiWca-tion in real-time RT-PCR. Nucleic Acids Res 29:e45

Qu XD, Lehrer RI (1998) Secretory phospholipase A2 is the principalbactericide for staphylococci and other gram-positive bacteria inhuman tears. Infect Immun 66:2791–2797

Quayle AJ, Porter EM, Nussbaum AA, Wang YM, Brabec C, Yip KP,Mok SC (1998) Gene expression, immunolocalization, and secre-tion of human defensin-5 in human female reproductive tract. AmJ Pathol 152:1247–1258

Schneider JJ, Unholzer A, Schaller M, Schafer-Korting M, Korting HC(2005) Human defensins. J Mol Med 83:587–595

Schutte BC, Mitros JP, Bartlett JA, Walters JD, Jia HP, Welsh MJ, Ca-savant TL, McCray PB Jr (2002) Discovery of Wve conserved beta-defensin gene clusters using a computational search strategy.Proc Natl Acad Sci USA 99:2129–2133

Semple CA, Gautier P, Taylor K, Dorin JR (2006) The changing of theguard: molecular diversity and rapid evolution of beta-defensins.Mol Divers 10:575–584

Shin JS, Kim CW, Kwon YS, Kim JC (2004) Human beta-defensin 2is induced by interleukin-1 beta in the corneal epithelial cells. ExpMol Med 36:204–210

Varoga D, Pufe T, Harder J, Meyer-HoVert U, Mentlein R, SchroderJM, Petersen WJ, Tillmann BN, Proksch E, Goldring MB, Paul-sen FP (2004) Production of endogenous antibiotics in articularcartilage. Arthritis Rheum 50:3526–3534

Varoga D, Pufe T, Mentlein R, Kohrs S, Grohmann S, Tillmann B,HassenpXug J, Paulsen F (2005) Expression and regulation ofantimicrobial peptides in articular joints. Ann Anat 187:499–508

Wilde CG, GriYth JE, Marra MN, Snable JL, Scott RW (1989) PuriW-cation and characterization of human neutrophil peptide 4, a novelmember of the defensin family. J Biol Chem 264:11200–11203

Wu M, McClellan SA, Barrett RP, Zhang Y, Hazlett LD (2009) Beta-defensins 2 and 3 together promote resistance to Pseudomonasaeruginosa keratitis. J Immunol 183:8054–8060

Histochem Cell Biol

123

Yamaguchi Y, Nagase T, Makita R, Fukuhara S, Tomita T, TominagaT, Kurihara H, Ouchi Y (2002) IdentiWcation of multiple novelepididymis-speciWc beta-defensin isoforms in humans and mice.J Immunol 169:2516–2523

Yamaguchi Y, Nagase T, Tomita T, Nakamura K, Fukuhara S, AmanoT, Yamamoto H, Ide Y, Suzuki M, Teramoto S, Asano T, Kang-awa K, Nakagata N, Ouchi Y, Kurihara H (2007) Beta-defensinoverexpression induces progressive muscle degeneration in mice.Am J Physiol Cell Physiol 292:C2141–C2149

Yanagi S, Ashitani J, Ishimoto H, Date Y, Mukae H, Chino N, Nakaz-ato M (2005) Isolation of human beta- defensin-4 in lung tissueand its increase in lower respiratory tract infection. Respir Res6:130

Yang D, Chen Q, Chertov O, Oppenheim JJ (2000) Human neutrophildefensins selectively chemoattract naive T and immature den-dritic cells. J Leukoc Biol 68:9–14

Zaiou M (2007) Multifunctional antimicrobial peptides: therapeutictargets in several human diseases. J Mol Med 85:317–329

Zhou L, Huang LQ, Beuerman RW, Grigg ME, Li SF, Chew FT, AngL, Stern ME, Tan D (2004) Proteomic analysis of human tears:defensin expression after ocular surface surgery. J Proteome Res3:410–416

Zhou L, Beuerman RW, Huang L, Barathi A, Foo YH, Li SF, ChewFT, Tan D (2007) Proteomic analysis of rabbit tear Xuid: defensinlevels after an experimental corneal wound are correlated towound closure. Proteomics 7:3194–3206