UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA"

FACOLTA' DI MEDICINA

DOTTORATO DI RICERCA IN BIOTECNOLOGIE DELLA RIPRODUZIONE E DELLO SVILLUPPO

CICLO DEL CORSO DI DOTTORATO XX

Titolo della tesi

REGOLAZIONE DELL'ESPRESSIONE GENICA NELLECELLULE GERMINALI MASCHILI

Nome e Cognome del dottorando ANNARITA DI SAURO

Docente Guida/Tutor: Prof. Pellegrino Rossi - Prof. Claudio Sette

Coordinatore: Prof. Raffaele Geremia

1

INDEX

INTRODUCTION .................................................................................................................... 3

I) Spermatogenesis.................................................................................................................. 4

I.1) Generals................................................................................................................... 4

I.2) Transcription Regulation........................................................................................ 7

I.3) Translation Regulation ......................................................................................... 10

II) Regulation of Cap Dependent Translation....................................................................... 18

RESULTS ................................................................................................................................ 24

I) [35S]methionine incorporation in isolated testis germ cells ............................................. 25

II) Immunohistochemistry analisys of adult mice testis sections ......................................... 28

III) Analysis of the expression of factors involved in the control of translational activity .. 29

IV) Analysis of [35S]methionine incorporation in cells treated with inhibitors of protein

synthesis................................................................................................................................ 31

V) Analysis of cap-dependent initiation complex formation in the presence of rapamycin

and Mnk inhibitor ................................................................................................................. 32

VI) Analisys of translational activity of spermatocytes after ocadaic acid (OA) treatment 34

VII) Analysis of formation of the translational initiation complex in different germ cell

types ...................................................................................................................................... 37

DISCUSSION .......................................................................................................................... 39

MATERIALS AND METHODS ........................................................................................... 44

Cell isolation, culture and treatment ..................................................................................... 45

Preparation of cell extracts and Western blot analysis. ........................................................ 46

7-methyl-GTP-Sepharose chromatography. ......................................................................... 46

REFERENCES........................................................................................................................ 48

ONGOING PROJECT ........................................................................................................... 55

Ongoing Project: RNA Interference in Vivo to study the role of Germ cell specific proteins

.............................................................................................................................................. 56

LAVORI PUBBLICATI......................................................................................................... 68

2

Transcriptome analysis of differentiating spermatogonia .................................................... 69

stimulated with kit ligand ..................................................................................................... 69

Dynamic Regulation of Histone H3 Methylation at Lysine 4 in Mammalian

Spermatogenesis ................................................................................................................... 70

3

INTRODUCTION

4

I) Spermatogenesis

I.1) Generals

In male mammals, development and differentiation of the germline is a dynamic process.

Primordial germ cells (PGCs) migrate to the developing testis where they form

prospermatogonia that subsequently enter mitotic arrest and remain in this state for the

duration of fetal development. Shortly after birth in the mouse, these cells resume mitotic

activity and a subset of these cells seed basal compartments of the developing seminiferous

tubules to form stem spermatogonia. The spermatogonial stem cell population replicates

mitotically to both maintain itself and ultimately give rise to differentiating spermatogonia.

These cells then enter meiosis as primary spermatocytes that proceed through the first and

second meiotic divisions to yield postmeiotic spermatids that differentiate via the process of

spermiogenesis to form spermatozoa. (Jeremy Wang et al, 2005).

Spermatogenesis is the differentiation process of male germ cells to produce mature

spermatozoa, and is divided into three distinct stages: the mitotic proliferation of

spermatogonial stem cells, meiotic division of spermatocytes, and spermiogenesis of haploid

spermatids (Zirkin, 1993). In mice, the proliferation of spermatogonia occurs soon after birth,

at around 5 days post-partum (dpp), and this is followed by the first wave of spermatogenic

differentiation, which gives rise to primary spermatocytes at around 10 dpp, haploid round

spermatids at 20 dpp, and mature spermatozoa at 35 dpp (Bellve et al., 1977; Zhao and

Garbers, 2002). This differentiation takes place in the seminiferous tubules, in which

spermatogonia and Sertoli cells sit on the basement membrane, with spermatocytes interior to

spermatogonia, and spermatids and mature spermatozoa facing the lumen (Figs. 1A and B).

Through the continuous proliferation of spermatogonia and subsequent differentiation,

functional spermatozoa are produced throughout male life. (Shoji et al, 2005)

5

Figura 1 (A) Schematic representation of spermatogenesis in mouse seminiferous tubule. (B) Differentiation time course of the first wave of spermatogenesis.

Spermiogenesis is divided into 16 steps in mice and 19 steps in rats based partially on

morphological features of the nucleus and acrosome, an spermatogenic cell-specific (SCS)

secretory organelle derived from the Golgi apparatus (Russell et al., 1990). Cells in steps 1±8,

round spermatids, have round transcriptionally active nuclei, whereas cells in steps 9±11,

elongating spermatids, undergo nuclear elongation and progressive transcriptional

inactivation. Transcriptional activity is not detectable by electron microscopic visualization of

transcription in elongated spermatids in mice (steps 12±16), a very sensitive procedure

(Kierszenbaum and Tres, 1975). Spermiogenesis ends with the elimination of the cytoplasm as

a residual body and the release of spermatozoa into the lumen of the seminiferous tubule. The

testis also has several somatic cell types. The development of male germ cells is intimately

associated with Sertoli cells, which form the basal membrane of the seminiferous tubules.

Several interstitial cell types, including Leydig cells (which produce testosterone) lie between

the tubules (Russell et al., 1990).

The differentiation of spermatozoa involves profound changes in the structure of organelles

and the synthesis of many SCS proteins. Some of the genes encoding SCS proteins are not

homologous to any genes that are expressed in somatic cells. For example, the transition

proteins and protamines, a family of highly basic chromosomal structural proteins that

sequentially replace the histones during elongating and elongated spermatids, convert

6

chromatin from a nucleosomal organization to smooth fibrils (Meistrich,1989). (Kleene C. K,

2001)

7

I.2) Transcription Regulation

Transcriptional and translational control plays a crucial role during the spermatogenesis. The

pattern of ribonucleic acid synthesis during germ cell development from the stem cell to the

mature spermatid was studied in the mouse testis, by using uridine-H3 labelling.

Autoradiographic studies in the mouse (Monesi, 1964, 1965, 1971) have shown that the

incorporation of tritiated precursors into the RNA, occurs in spermatogonia. RNA synthesis is

a continuous process throughout the cell division cycle in spermatogonia and stops only for a

very short interval (1 hour) during metaphase and anaphase. (Monesi 1964). The rate of RNA

synthesis in the autosomes is very low in early meiotic prophase: leptotene, zygotene and in

the first half of pachytene, then rises rapidly to a peak in middle-late pachytene and decreses

again in diplotene until a complete arrest in diakinesis and metaphase-anaphase1. After

meiosis, RNA synthesis is resumed in early spermiogenesis but stops completely in mid-

spermiogenesis after the beginning of nuclear elongation ( Monesi et al 1978) Fig 2

Figure 2. Pattern of 3H uridine and 3H arginine incorporation into RNA and nuclear protein, respectively, 1h after intratesticular administration of radioactive precursors.

Pachytene spermatocytes

Round spermatids Elongating spermatids

Mitoticspermatogonia

(arginine(uridine

Adjusted from Monesi V., 1971

8

Expression profiling analysis has been conducted with RNA from testes of animals of

different ages (Almstrup et al., 2004; Shima et al., 2004) or with RNA from highly enriched

cell populations (Schlecht et al., 2004). A recent study of RNA from purified cell types

reported 405 transcripts expressed in mitotic spermatogonial cells (Schlecht et al., 2004). Over

200 of the transcripts in this study were uncharacterized mRNAs that were upregulated in

spermatogonia. Among about 60 loci associated with spermatogonia in the literature were

messages of genes required for cell cycle regulation (Ccnd2), components of extracellular

matrix (Col3a1 and Mgp), hormone signal transduction (Cfgf, Egr1, Fgfr1, Igfbp2, Igfpb3,

Pdgfa, and Vegf), and serum response and transcriptional regulation (Jun, JunB, Id2, Klf9,

Stat3, and Zfp36) Expression levels of about one-half of the genes increase in spermatogonia

and decrease at later meiotic stages including some histones (H1f0 and H3f3b), ribosomal

proteins (Rpl35, Rps3, and Rps4), and motor proteins (Mrlcb, Myh9, Mylc2a, Tpm1, and

Tpm4) (Schlecht et al., 2004).

Similar progress has been made in the study of control of gene expression in spermatocytes.

DNA replication does not occur in spermatocytes, but DNA repair is critical during this time

period. A more recent study reveals that approximately 442 transcripts are highly induced in

spermatocytes (Schlecht et al., 2004). Transcripts identified in that study include genes

involved in synaptonemal complex (SC) formation (Sycp2 and Sycp3), DNA repair (Polh),

and chromatin condensation (topoisomerase 2a, Top2a). The metalloproteases (Adam2,

Adam3, and Adam5), factors necessary for ubiquitin-mediated protein degradation (Ube2d2

and Psmc3), transcriptional regulators (Crem and Miz1), and enzymes involved in energy

metabolism (Cyct and Ldhc) are expressed. (Grimes 2004).

Six novel genes specifically expressed in pachytene spermatocytes has been observed: a

chromatin remodeling factor (chrac1/YCL1), a homeobox gene (hmx1), a novel G-coupled

receptor for an unknown ligand (Gpr19), a glycoprotein of the intestinal epithelium (mucin 3),

a novel RAS activator (Ranbp9), and the A630056B21Rik gene (predicted to encode a novel

zinc finger protein). (Rossi et al., 2004)

Another factor that has been found to have a differentially expression in the postnatal testis of

mouse is the c-kit transmembrane tyrosine-kinase receptor . It is expressed in type A

spermatogonia and its transcription ceases at the meiotic phase of spermatogenesis. On the

other hand alternative, shorter c-kit transcript is expressed in post-meiotic germ cell. This

9

transcript encodes a truncated version of the c-kit protein (tr-kit), lacking the extracellular, the

transmembrane and part of the intracellular tyrosine kinase domain. It contains only the

phosphotransferase domain and the carboxyterminal tail of c-kit and it is catalytically inactive

because it lacks the ATP binding site (Rossi et al., 1992)

The alternative mRNA is transcribed from an haploid-specific alternative promoter localized

within the 16th intron of the c-kit gene, is active in postmeiotic haploid cells and the protein is

expressed in spermatids and mature spermatozoa (Rossi et al., 1992; Albanesi et al., 1996)

Many experimental works allow to candidate tr-kit as a sperm factor at fertilization. Infact the

microinjection of recombinant tr-kit protein or of synthetic tr-kit RNA in MII oocytes induces:

the parthenogenetic activation of the oocytes and the extrusion of the 2nd polar body, the

formation of pronuclei and the reaching of two blastomere stage in the activated eggs (Sette et

al., 2004). The microinjection of tr-kit into metaphase-arrested oocytes triggers cell cycle

resumption via the sequential activation of Fyn and PLC 1 (Sette et al., 2002). Several data

suggest that tr-kit promotes the formation of a multimolecular complex composed of Fyn,

PLC 1, and Sam68, which allows phosphorylation of PLC 1 by Fyn, and may modulate RNA

metabolism (Paronetto et al., 2003)

10

I.3) Translation Regulation

Protein synthesis occurs at nearly all stages of spermatogenesis in the mouse, with elevated

incorporation of labeled amino acids during the pachytene stage of meiosis (Monesi, 1965,

1967). Other proteins are synthesized in a stage specific manner during meiosis and

spermiogenesis are retained in spermatozoa (O’Brien and Bellvè. 1980 a,b). These include a

number of germ cell specific proteins such as lactate dehydrogenase C4, synthesized at

maximal levels in late pachytene spermatocytes and both protamines and phosphoglycerate

kinase B which are sinthesized during the haploid stages.

An accurate analysis of the stage specific protein synthesis by isolated spermatogenic cells

throughout meiosis and early spermiogenesis in the mouse has been made by O’Brien (1987).

Spermatogenic cells from prepubertal and adult mice were separated by unit gravity

sedimentation. Pre-leptotene, leptotene/zygotene, and pachytene spermatocytes were isolated

from 17-day-old mice. Adult pachytene spermatocytes and round spermatids were isolated

from mature animals. These germ cells were then cultured in defined medium with [35S]

methionine for 4-5 h. For each cell type, relative [35S] met incorporation was determined and

labelled proteins were compared by two dimensional (2D) polyacrilammide gel

electrophoresis and autoradiography. Levels of [35S] met incorporation by isolated germ cells

correlate closely with previous autoradiographic estimates of protein synthesis during

spermatogenesis (Monesi, 1967). Pachytene spermatocytes from prepuberal mice incorporate

the highest levels of [35S] met. Similar patterns of incorporation were observed when the data

were expressed as cpm/106 cells or cpm/mg protein. However, greater differences between cell

types were apparent when incorporation was expressed per 106 cells, reflecting the marked

changes in cell size and protein content that occur during germ cell differentiation.

Preleptotene, leptotene/zygotene, and 17d pachytene spermatocytes exhibited progressive

increase in incorporation that correlated with advancing stages of meiosis. Maximal levels of

incorporation were detected for 17d pachytene spermatocytes. Adult pachytene spermatocytes

incorporated 30% less [35S] met than the 17 pachytene population. On a per cell basis,

pachytene spermatocytes incorporated 4-6 times more [35S] met than round spermatids. (Fig 3)

11

Figure 3. Incorporation of 35S methionine 35S met into trichloracetic acid (TCA )-precipitabie macromolecules for purified spermatogenic cells. preleptotene (PL), leptotene/zygotene (LZ), and pachytene (1 7P) spermatocytes were isolated from 17-day-old mice. Adult pachytene spermatocytes (AP) and round spermatids (RS) were isolated from mature animals. Cells were incubated with 35S met (50 Ci/ml) for 4 h at 320C prior to TCA precipitation. For each cell type, data are expressed both as incorporation/106 cells and as incorporation/mg protein. Bars represent mean values for triplicate determinations and vertical lines represent SE.

12

Comparisons of 2D autoradiograms indicated that many proteins, including actin and tubulins,

are synthesized at approximately equal levels in all stages examined. Other proteins, including

heat-shock proteins and multiple plasma membrane constituents, are synthesized in a stage

specific manner in leptotene/zygotene spermatocytes, pachytene spermatocytes and round

spermatids (O’Brien 1987)

At the onset of spermiogenesis, transcription and translation become temporally uncoupled

because elongating spermatids are transcriptionally incompetent for remodelling and

condensation of the chromatin due to replacement by protamines of DNA-binding histones

(reviewed in Steger 1999)

During spermiogenesis infact, transcription ceases prior to the differentiation of the mature

cells. To complete germ cell differentiation and initiate early embryogenesis, proteins are

synthesized from pre-existing mRNAs that are stored for several days. Some mRNAs are

stored for more than a week before they are recruited for translation at specific times during

sperm morphogenesis (Braun 2000).

De novo protein synthesis is ensured by the mRNAs that elongating spermatids inherit from

primary spermatocytes and round spermatids and that are translated several days after their

synthesis (Braun, 2000).

The pattern of translational activity during spermatogenesis varies according to the cellular

differentiation of germ cells (Kleene, 1996). Similarly to proliferating somatic cells, mitotic

spermatogonia readily utilize the transcribed mRNAs (Cataldo et al., 1999). By contrast,

although the transcriptional activity of primary spermatocytes and round spermatids is

copious, only a very small percentage (5–10%) of these mRNAs are actively translated and

most of them are accumulated as ribonucleoproteins (RNPs; Biggiogera et al., 1990).

Most of the testicular mRNAs known to be translationally regulated are initially transcribed in

postmeiotic cells. Because protein synthesis occurs on polysomes and translationally inactive

mRNAs are sequestered as ribonucleoproteins (RNPs), movement of mRNAs between these

fractions is indicative of translational up- and down-reguation (Iguchi et al., 2006)

Microarrays analysis of mRNAs in RNPs and polysomes from testis extracts of prepuberal

and adult mice (17d and 22d) has been made to characterized the translational state of

individual mRNAs as spermatogenesis proceeds. It was observed that many of the

translationally delayed postmeiotic mRNAs shift from the RNPs into the polysomes: 742

13

mouse testicular transcript show a dramatic shift between RNPs and polysomes. One subgroup

of 35 genes containing the known translationally delayed phosphoglicerate kinase 2 (Pgk2) is

initially transcribed during meiosis and is translated in later stage cells. Another subgroup of

82 meiotically expressed genes is translationally down regulated late in spermatogenesis

(Iguchi et al., 2006)

The fundamental role played by RNPs during gametogenesis is suggested by their high levels

of expression in germ cells (Venables and Eperon, 1999).

Accordingly, knockout mouse models for RNA-binding proteins expressed in different

phases of gametogenesis, like MSY2, Tenr, Miwi, Mili, and Dazl (Deng and Lin, 2002;

Saunders et al., 2003; Kuramochi-Miyagawa et al., 2004; Connolly et al., 2005; Yang et al.,

2005), display a sterile phenotype. Remarkably, gametogenesis is under a tight translational

control of gene expression by RNA-binding proteins also in lower organisms like

Caenorhabditis elegans and Drosophila melanogaster (Kuersten and Goodwin, 2003).

About two-thirds of all mRNAs in adult mammalian testes is mRNP particle-associated

(Kleene 1993, 1996; Cataldo et al. 1999; Schmidt et al. 1999). While some mRNP particle-

associated mRNAs share conserved sequences others exhibit no obvious sequence similarities

(Kleene 1996).

In mouse and rat, both mRNP particles and chromatoid bodies, electron dense material in the

vicinity of the nucleus, can be observed in pachytene spermatocytes and round spermatids

(Biggiogera et al. 1990; Moussa et al. 1994). Within chromatoid bodies, mRNAs have been

demonstrated by 3H-uridine incorporation (Söderström 1981), ethidium bromide

phosphotungstic acid staining (Biggiogera et al. 1990), and immunocytochemistry. Therefore,

it is assumed that chromatoid bodies may serve as storage organelle for translationally

repressed mRNAs (Review Steger 2001)

Among the mRNAs that are under translation control in spermatids are protamine 1 (Prm1)

and 2 (Prm2). The protamines mediate nuclear condensation during the terminal stages of

spermatid differentiation. They substitute the nucleosomal histones operating a profound

remodelling of the chromatin and rendering the nucleus more compact and unable to

transcribe new messengers (Sassone- Corsi., 2002) (Fig 4). Translational delay of the Prm1

message is essential for normal spermatogenesis in mammals.

14

Figure 4 Histone-to-protamine exchange during spermatogenesis requires three developmental steps: first, part of somatic histones are replaced by testis-specific histones; second, both somatic histones and testis-specific histones are exchanged by transition proteins; third, transition proteins are replaced by protamines. The DNA protamine-interactions result in increased chromatin condensation causing cessation of transcription. Therefore, in haploid spermatids, gene expression requires temporal uncoupling of the processes of transcription and translation (SCN Sertoli cell nucleus, Sg spermatogonia, Scy I primary spermatocyte, Scy II secondary spermatocyte, rSpd round spermatid eSpd elongated spermatid)

15

Mutations that result in premature translation of the Prm1 mRNA cause precocious nuclear

condensation and sterility (Lee et al., 1995)

Like many localized or stored mRNAs, sequences responsible for the translational silencing of

Prm1 lie within the 3’ UTR of its mRNA (Braun et al., 1989). The 17-nucleotide translational

control element (TCE) mediates translational repression of the Prm1 mRNA. Mutation of the

TCE causes premature synthesis of protamine protein and sterility. The Prm1 mRNA is stored

as a cytoplasmatic ribonucleoprotein (mRNP) particle in spermatids. Contained within the

particle are several members of the Y box family of nucleic acid binding proteins. The murine

Y box proteins MSY1, MSY2 and MSY4 bind in a sequence-dependent manner to a

conserved region in the proximal portion of the Prm1 3’ UTR. Sequence-specific binding by

MYS4 to the Y box recognition sequence (YRS) is dependent on the highly conserved cold

shock domain, possibly through the RNP1 and RNP2 motifs present within it. The Y box

proteins may function as translational repressor in vivo. Alternatively their primary function

may be to protect mRNAs from degradation during their extended period of storage.

Translational activation of stored mRNAs is essential for the completion of gametogenesis.

Proper translational activation of the Prm1 in elongated spermatids requires the cytoplasmatic

double-stranded RNA binding protein TARBP2. Tarbp2 is expressed at low levels in many

cells but is expressed at robust levels in late stage meiotic cells and in postmeiotic spermatids.

Mice mutant for Tarbp2 are defective in proper translational activation of the Prm1 and Prm2

mRNAs and are sterile. (Braun 2000)

Another protein that may be implicated in translational control of spermatogenesis is Sam68, a

protein belonging to the STAR family (signal transduction and activation of RNA

metabolism), involved in RNA homeostasis (Vernet and Artzt 1997) STAR proteins are

conserved across eukaryotes and may represent a direct link between signal transduction

pathways and RNA metabolism. They bind RNA through a GSG (Grp33/Sam68/GLD-1)

domain, which contains a single KH domain (hnRNP K homology domain) flanked by

conserved N- and C-terminal sequences named QUA1 and QUA2 domains required for

homodimerization and specificity in RNA binding (Vernet and Artzt, 1997; Lukong and

Richard, 2003). It has been observed that Sam68 is down-regulated at the onset of meiosis and

it accumulates again during the pachytene stage and until spermiogenesis begins (Paronetto et

al., 2006). Interestingly, Sam68 is localized in the cytoplasm during the meiotic divisions and

16

it associates with the polysomes engaged in active translation Translocation of Sam68 from

the nucleus to the polysomes correlates with its phosphorylation by ERK1/2 and MPF.

Moreover, direct cloning experiments reveals that Sam68 binds mRNAs encoded by genes

required for the spermatogenetic program. Thus, these studies suggest a novel role for Sam68

as mRNA carrier that shuttles from the nucleus to the cytoplasm and may facilitate translation

during the meiotic divisions. (Paronetto et al., 2006)

17

Figure 5. Sam68 cosediments with the polysomes in secondary spermatocytes. Germ cells isolated from mouse testis by elutriation were analyzed for DNA content by FACS. Cells from fraction 5 (A), 4 (B), or 3 (C) were fixed in 1% paraformaldehyde and stained with propidium iodide for the analysis. Nuclei of cells obtained from the same fractions were processed for cytological analysis and stained with Giemsa (D–F). Fractionation on sucrose gradients of cell extracts obtained from fraction 5 (G), or 4 (H), or 3 (I): absorbance profiles at 254 nm show the distribution of soluble RNP, single ribosome and polysomes (top panels); Western blot analyses of each fraction from the gradients indicate the distribution of Sam68 (second row panels), of the ribosomal S6 protein (third row panels), used as standard of distribution of the ribosome (80S) and the polysomes, and of initiation factor eIF4E (bottom panels), used as standard of distribution of smaller RNPs.

18

II) Regulation of Cap Dependent Translation

Translational control plays a key role in temporal regulation of development events that must

be executed largely in the absence of transcription. Emerging evidence suggests that distinct

mechanisms of translational repression and activation act on specific mRNAs at different steps

in the cell cycle progression.

A key regulatory point for translational control in eukaryotes is initiation, instigated by

binding of the translational initiation complex to the 5’ cap of the mRNA, leading to

recruitement of the ribosomal subunits (Backer and Fuller., 2007)

Ribosome binding is facilitated by a number of translation initiation factors that guide the

ribosome to an mRNA’5 end, except for mRNAs which initiate by binding to an internal

ribosome-binding site (IRES). The 5’ end of all nuclear-transcribed mRNAs possess a cap

structure (m7GpppN, in which “m” represents a methyl group and “N”, any nucleotide) that is

specifically recognized by eukaryotic translation initiation factor 4E (eIF4E). eIF4E binds the

5’ cap as a subunit of a complex (termed eIF4F) containing two other proteins, one of two

large scaffolding proteins, termed eIF4GI and eIF4GII

(encoded by two different genes), and the RNA helicase eIF4A (Review Sonenberg 2006)).

Following its binding to the 5’ cap, eIF4F is thought to unwind the mRNA 5’-proximal

secondary structure to facilitate the binding of the 40S ribosomal subunit in association with

several other initiation factors (Gingras et al. 1999b). Unwinding requires another initiation

factor, eIF4B (Hershey and Merrick., 2000)

19

Figure 6. (A) Assembly of the mammalian ribosome initiation complex at the 5’end of an mRNA. eIF4E, as part of the eIF4F complex, binds them7G-cap structure. eIF4G binds eIF3, which, in turn, recruits the 40S ribosomal subunit along with its associated ternary complex (eIF2/Met-tRNA/GTP). Not shown are other initiation factors that participate in ribosome recruitment. 4E-BPs binds the dorsal convex surface of eIF4E to prevent its interaction with eIF4G, thereby abrogating ribosome binding.

Strikingly, several components of the ribosome recruitment machinery as well as ribosomal

components are either direct or indirect targets of mTOR. These include eIF4B, eIF4G, and

eIF4E, the latter of which is activated by the phosphorylation of its repressors, the 4EBP

proteins. In addition, S6K and its targets, the ribosomal protein S6 and elongation factor 2

(eIF2 ), are also targets of this pathway.

The interaction between eIF4E and eIF4G is regulated by members of the eIF4E-binding

proteins (4E-BPs), a family of translational repressor proteins. The mammalian family consists

of three low molecular weight proteins, 4E-BP1, 4E-BP2, and 4E-BP3, encoded by three

separate genes.

The 4E-BPs compete with eIF4G proteins for an overlapping binding site on eIF4E, such that

the binding of a 4E-BP or an eIF4G protein is mutually exclusive (Haghighat et al. 1995;

Mader et al. 1995; Marcotrigiano et al. 1999).

20

Whereas hypophosphorylated 4E-BPs bind with high affinity to eIF4E, the

hyperphosphorylation of 4E-BPs prevents this interaction (Sonenberg., 2006).

mTOR regulates protein synthesis through the phosphorylation and inactivation of the

repressor of mRNA translation, eukaryotic initiation factor 4E-binding protein (4E-BP1), and

through the phosphorylation and activation of S6 kinase (S6K1). These two downstream

effectors of mTOR whose phosphorylation is inhibited by rapamycin in vivo, can be

phosphorylated by recombinant mTOR in vitro (Brunn et al. 1997; Burnett et al. 1998).

Moreover, substitution of Asp 2338 with alanine in the catalytic domain of mTOR is sufficient

to inhibit mTOR kinase activity toward S6K1 and 4E-BP1 in vivo and in vitro.

Thus, S6K1 or 4E-BP1 phosphorylation is often used as an in vivo readout of mTOR activity

(Sonenberg., 2006).

The most widely used inhibitor of mTOR activity is rapamycin, a natural compound that acts

as non competitive inhibitor. It acts by forming an inhibitory complex with its intracellular

receptor, the FK506-binding protein, FKBP12, which binds a region in the C terminus of TOR

proteins termed FRB (FKB12–rapamycin binding), thereby inhibiting TOR activity (Chen et

al. 1995; Choi et al. 1996).

The mammalian ortholog of the yeast TOR proteins was independently cloned and identified

by using an FKBP12–rapamycin affinity purification by four groups and named FRAP

(FKBP–rapamycin-associated protein) RAFT1 (rapamycin and FKBP target), or RAPT1

rapamycin target; (Brown et al. 1994;). mTOR is the master regulator of cap-dependent

mRNA translation and ribosomal biogenesis. Its activity is regulated by growth factors by the

PI3K/Akt signalling pathway. This pathway lead to phosphorylation and inhibition of TSC2

by Akt and to the subsequent activation of Rheb, which activates mTOR by an as yet unknown

mechanism Fig 7 (Sonenberg., 2006)

21

Figure 7. The regulation mTOR activity by growth factors is mediated by the PI3K/Akt signaling pathway leading to phosphorylation and inhibition of TSC2 by Akt and to the subsequent activation of Rheb, which activates mTOR by an as yet unknown mechanism. In addition, TSC2 is activated by AMPK (+) Activation; (-) inhibition.

22

The RAS/MAPK pathway integrates mTOR function in the activation of the eIF4F complex.

Its activation cause the activation of MAP Kinase interacting Kinase 1 (MNK1), the kinase

that phosphorylates eIF4E on serine 209 (Sonenberg., 2006) (Fig 8)

Figure 8. Schematic representation of the signal transduction pathways involved in the regulation of mRNA translation mediated by growth factors. Only some mediators of PI3K/Akt/mTOR and MAPK pathways are indicated. The inhibitors used in this study and their targets are indicated.

Mnk1 is associated with the eIF4F complex via its interaction with the C-terminal region of

eIF4G. According with the model proposed by Pyronnet and coauthours (Embo.,1999), the

phosphorylation of eIF4E occurs in the eIF4F complex, suggesting that eIF4F assembles prior

to eIF4E phosphorylation. eIF4E can interact in a mutually exclusive manner with either

eIF4G or 4EBPs. The association of eIF4E with eIF4Gs enhances binding of eIF4E to the 5’

cap structure and brings Mnk1 into the vicitity of eIF4E. The resulting phpsphorylation of

23

eIF4E might enhance its affinity for eIF4Gs and stabilize its interaction with the mRNA 5’ end

(Fig 9).

Figure 9. Mnk1 phosphorylates eIF4E as a component of the eIF4F complex. The model shows that phosphorylation of eIF4E occurs in the eIF4F complex, suggesting that eIF4F assembles prior to eIF4E phosphorylation. eIF4E can interact in a mutually exclusive manner with either eIF4Gs or 4E-BPs. The association of eIF4E with eIF4Gs enhances binding of eIF4E to the 59 cap structure (Haghighat and Sonenberg, 1997; Ptushkina et al., 1998) and brings Mnk1 into the vicinity of eIF4E. The resulting phosphorylation of eIF4E might enhance its affinity for eIF4Gs (Bu et al., 1993) and stabilize its interaction with the mRNA 59 end (Minich et al., 1994).

24

RESULTS

25

Results

Study of the translational activity during the various differentiation steps of

spermatogenesis.

An important question, regarding how sequential developmental events can be ordered by

translational control, is how the translational initiation machinery can become targeted to and

activated at specific subsets of mRNAs, and how this machinery might change in different cell

types and stages during spermatogenesis.

Indeed, an important mechanism that controls differentiative events during spermatogenesis is

exerted at the translational regulation level.

Translational control plays a key role in temporal regulation of developmental events that

must be executed largely in the absence of transcription. As stated in the introduction section,

it has been observed that pachytene spermatocytes incorporate the highest levels of

[35S]methionine indicating a major protein syntesis in these cells compared to round

spermatids (O’Brien 1987)

We have studied whether and how these data correlate with biochemical parameters that

characterize the control operated at the level of the translational initiation machinery.

I) [35S]methionine incorporation in isolated testis germ cells

Before analysing the translational activity at the level of the formation of the initiation

machinery, we re-evaluated the rate of [35S]methionine incorporation in germ cells at different

developmental stages.

Germ cells were isolated from adult mice testis by elutriation technique to obtain cell

populations enriched in specific cellular types. Isolated spermatocytes, round spermatids and

elongating spermatids, were used to examine alterations in [35S]methionine incorporation

26

during differentiation. In these experiments cells were cultured for 1h in MEM medium in the

presence of [35S]met.

Fig 1, shows that the [35S]met incorporation into TCA precipitable proteins detectable in

different cellular types is maximal for spermatocytes when expressed either as cpm/106cells or

as cpm/mg protein. Round spermatids and elongating spermatids incorporate less [35S]met

than spermatocytes. However, greater differences between cell types were apparent when

incorporation was expressed on a per cell base, reflecting the marked changes in cell size and

protein content that occur during germ cell differentiation, as already published by O’Brien

(1987)

Similar variations in [35S]met incorporation were observed in two separate triplicate

experiments.

[35S]met incorporation in elongating spermatids is slightly more elevated compared with round

spermatids.

050

100150200250300350400450

cpm/ncellx(10x10³)cpm/prote

cpm/ncellx(10x10³) 392 33,33 19,8

cpm/prote 169,1091954 64,41223833 79,33333333

sp.cytes sp.tides elong.sp.tides

Figure 1 shows that the [35S]met incorporation into TCA precipitable proteins detectable in different cellular types is maximal for spermatocytes when expressed either as cpm/106cells or as cpm/mg protein.

27

In perfect agreement with this observation, we found, by western blot, a strongly reduced level

of S6 phosphorylation in round spermatids compared to spermatocytes, and an increase in

elongating spermatids when compared to round spermatids, as showed in Figure 2. Indeed,

phosphorylation of S6 is a well known marker of active translation. The western blot analysis

was confirmed by immunocytochemistry studies on testis sections from adult mice.

Figure 2. Western Blot analysis reveals a reduced level of S6 phosphorylation in round spermatids compared to spermatocytes, and an increase in elongating spermatids when compared to round spermatids

28

II) Immunohistochemistry analisys of adult mice testis sections

Figure 3 shows that strong immunoreactivity with an antibody directed against pS6240/244

was evident in middle-late pachytene spermatocytes (stage 9-10 of the cycle of the

seminiferous epithelium), in spermatocytes undergoing the meiotic divisions (stage 12), in the

cytoplasm of elongating spermatids (stage 2-6), whereas no or, at least, little staning was

evident in lepto-zygotene (stages 9-10 and 12), early pachytene (stages 2-6), round spermatids

(stage 2-6, 7-8, 9-10) and spermatozoa near to the spermiation (stage 7-8)

Figure 3 Immunohistochimestry analysis direct against pS6240/244 reveals a strong immunoreactivity of antibody in middle-late pachytene spermatocytes (stage 9-10 of the cycle of the seminiferous epithelium), in spermatocytes undergoing the meiotic divisions (stage 12), in the cytoplasm of elongating spermatids (stage 2-6), wherease no or, at least, little staning was evident in lepto-zygotene (stages 9-10 and 12), early pachytene (stages 2-6), round spermatids (stage 2-6, 7-8, 9-10) and spermatozoa near to the spermiation (stage 7-8)

29

III) Analysis of the expression of factors involved in the control of

translational activity

To study at the biochemical level how translational control can operate in different cellular

types during sequential developmental events of spermatogenesis, we analyzed the expression

of some proteins involved in the pathway that modulate translational activity.

Figure 4 shows that all factors analysed are present in different cellular types. mTor

expression decreases progressively in round spermatids and in elongating spermatids

compared to spermatocytes, wherease eIF4E levels do not change significantly, eIF4G seems

more abundant in round spermatids with respect to meiotic cells; PABP levels substantially do

not change.

30

Figure 4 Analysis by western blot of expression of some proteins involved in the pathway that modulate translational activity.

31

IV) Analysis of [35S]methionine incorporation in cells treated with

inhibitors of protein synthesis

To evaluate whether the traslational ativity seen in spermatocytes, round spermatids is affected

by the inhibition of mTor or Erk-dependent pathways, we performed [35S]methionine

incorporation experiments after pre-incubation with specific inhibitors of these pathways, i.e.

Rapamycin for the mTor pathway and Mnk inhibitor for Erk-dependent pathways.

Spermatocytes and round spermatids were isolated by elutriation technique and cultured in

MEM medium in the precence of rapamycin, or Mnk inhibitor. Cells were treated with these

drugs for 3 h, and [35S]met was added in the last hour of incubation. The analysis of [35S]met

incorporation into TCA-precipitable proteins of spermatocytes revealed that both rapamycin

and Mnk inhibitor reduce the [35S]met incorporation of 20% compared to untreated control,

whereas no apparent effect was evident in spermatids( Fig 5)

0

100

200

300

400

500

600

citi c citi rapa citi Mnk Tidi c Tidi rapa Tidi Mnk

cpm/n cellcpm/prot

Figure.5 Spermatocytes, round spermatids isolated by elutriation technique and cultured in MEM medium in the precence of rapamycin, or Mnk inhibitor for 3 h were analysed for [35S]met incorporation. [35S]met was added in the last hour of incubation.

32

V) Analysis of cap-dependent initiation complex formation in the presence

of rapamycin and Mnk inhibitor

To better understand the role of cap dependent translational activity in different cellular types

during spermatogenesis, we analysed the assembly of the translation initiation complex by

assaying binding of eIF4F components to m7-GTP-sepharose beads (mimicking the cap

mRNA structure) in the presence or absence of rapamycin or Mnk inhibitor.

Spermatocytes, round spermatids and elongating spermatids were isolated from adult mouse

testis and cultured for 3 h in medium supplemented with rapamycin or Mnk inhibitors. Cells

were harvested and the extracts processed for binding to m7-GTP-sepharose beads.

Figure 6 shows that treatment with both drugs decreases the binding of several components

that take part to the translation initiation complex formation in spermatocytes, such as eIF4G,

PABP, eIF4A and eIF4E. 4EBP1 (which competes with eIF4G for the binding site on eIF4E,

thus inhibiting cap-dependent translational initiation) appears to increase its binding to m7-

GTP-sepharose beads after rapamycin, but not after Mnk inhibitor treatment, in agreement

with the notion that it is specific target of phosphorylation by mTor. Indeed we also noticed in

rapamycin treated samples an increase of a faster migrating 4EBP1 band, indicative of

dephosphorylation. On the contrary eIF4E phosphorylation was completely blocked, as

expected, by inhibition of Mnk. Finally both drugs inhibited S6 phosphorylation

In round spermatids no effect was observed by treatment with these drugs (with the exception

of inhibition of eIF4E phosphorylation by the Mnk inhibitor), whereas sensitivity to both

drugs was evident again in elongating spermatids.

33

Figure 6 Binding of eIF4F components to m7-GTP-sepharose beads in the presence or absence of rapamycin or Mnk inhibitor. Spermatocytes, round spermatids and elongating spermatids isolated from adult mouse testis and cultured for 3 h in medium supplemented with rapamycin or Mnk inhibitors were harvested and the extracts processed for binding to m7-GTP-sepharose beads

34

VI) Analisys of translational activity of spermatocytes after ocadaic acid

(OA) treatment

Treatment of spermatocytes with the phosphatase inhibitor ocadaic acid OA induces their

meiotic progression, in particular it induces their entry into methaphase I (MI), characterized

by normal condensation of bivalent chromosomes and synaptonemal complex breakdown

(Wiltshire et al., 1995). It has been described that OA-induced meiotic progression requires

activation of the maturation promoting factor (MPF; Wiltshire et al., 1995), a complex of

cyclin-dependent kinase cdc2 and the regulatory subunit cyclin B1, and of the extracellular

signal-regulated protein kinases (ERKs; Sette et al., 1999), also known as the mitogen-

activated protein kinases (MAPKs). To determine whether OA treatment increase the

translational activity concomitant with the entry of spermatocytes into the meiotic divisions

induced by OA, we first evaluated the rate of phosphorylation of some factors which normally

correlates with an increase in translational activity.

Fig 7 shows an increase in the phosphorylation state of Akt, S6 and eIF4E after OA treatment.

35

Figure 7 Phosphorylation rate analysis of some factors which normally correlates with an increase in translational activity. by western blot in spermatocytes treated with ocadaic acid (OA).

Another approach was to analyse the assembly of the translation initiation complex by

assaying binding of eIF4F components to m7-GTP-sepharose beads after OA treatment.

Figure 8 shows a clear increase in the binding to m7-GTP-sepharose beads in spermatocytes of

all the factors that take active part to formation of the translational initiation complex (eIF4G,

PABP and eIF4A), whereas the binding of the initiation inhibitor 4EBP1 was reduced. We

also noticed an increase of the phosphorylation state of 4EBP1.

36

Figure 8 Assay of binding of eIF4F components to m7-GTP-sepharose beads after OA treatment.

37

VII) Analysis of formation of the translational initiation complex in

different germ cell types

To investigate whether the difference in the rate of translational activity observed in

spermatocytes, round spermatids and elongating spermatids by [35S]methionine incorporation

correlates with the formation of the translational initiation complex, we performed an

experiment to assay the assembly of the eIF4F complex to the cap mimicking mRNA

structure. Spermatocytes, round spermatids and elongating spermatids isolated from adult

mouse testis were harvested after 1h of culture in MEM medium and the extracts processed for

binding to m7-GTP-sepharose beads.

Figure 9 shows that there is no substantial difference in the binding of eIF4G, PABP, eIF4A

and eIF4E to m7-GTP-sepharose beads between spermatocytes and round spermatids, whereas

an increase of the binding of these factors occurs in elongating spermatids.

On the contrary, 4EBP1 binding appears to be strongly reduced in elongating spermatids, but

this appears to be due mainly to a strong decrease in the total amount of this protein in these

cells. Also in this experiment the pattern of S6 phosphorylation state during spermatogenetic

differentiation was similar to that described in fig 2 and 3.

38

Figure 9 Assay of the assembly of the eIF4F complex to the m7-GTP-sepharose beads. Spermatocytes, round spermatids and elongating spermatids isolated from adult mouse testis were harvested after 1h of culture in MEM medium and the extracts processed for binding to -GTP-sepharose beads.

39

DISCUSSION

40

Discussion

Translational control is crucial for proper timing of developmental events that take place in the

absence of transcription during spermatogenesis.

As stated in the introduction section, it has been observed that pachytene spermatocytes

incorporate the highest levels of [35S]methionine indicating a major protein syntesis in these

cells. The aim of this project was to understand whether biochemical data of translational

activity correlate with those of [35S]methionine incorporations and to investigate how the

translation activity is regulated at the molecular level, in particular at the level of the initiation

complex formation, in different cell types during spermatogenesis.

First of all we re-evaluated the rate of [35S]methionine incorporation in germ cells at different

developmental stages. We observed that the highest [35S]methionine incorporation is present

in spermatocytes indicating a stronger translational activity in meiotic cells compared to

haploid cells.

Elongating spermatids show a higher rate of [35S]met incorporation compared to that of round

spermatids. In agreement with these data are the finding of high levels of S6 phosphorylation (

a well known marker of active translation ) in spermatocytes, which is reduced in round

spermatids, and which increase again in elongating spermatids, as evaluated by immunoblot

analisys. Immunocytochemical analisys indicate a strong level of S6 phosphorylation in

middle-late pachytene spermatocytes and in spermatocytes undergoing the meiotic divisions

and in elongated spermatids. Immunoreactivity is low in early meiotic cells and in the

cytoplasm of round spermatids and spermatozoa near to the spermiation step.

All these data indicate that during spermatogenesis there are two moments of high

translational activity, one in late pachytene spermatocytes and one during spermatid

elongation.

Thus, after a period of low protein syntesis at the beginning of meiosis, two periods of high

translational activity are separated by a period of reduced protein synthesis corresponding with

the beginning of the haploid stage of spermatogenesis.

41

Active translation in late pachytene spermatocytes, is supported by the increase of

phosphorylation state of Akt, S6 and eIF4E after OA treatment, which is known to push

meiotic progression of spermatocytes and their entry into methaphase I (MI).

Moreover, after OA treatment, we observed an increase in the binding to m7-GTP-sepharose

beads of all the factors that take active part to the formation of the translational initiation

complex (eIF4G, PABP and eIF4A) and a concomitant increase of the phosphorylation state

4EBP1, an inhibitor of the eIF4F complex formation which correlates with its reduced binding

to capped mRNA.

After having evaluated the rate of translational activity in different cell types, we investigated

the presence of some factors involved in the pathway that modulate translational activity, such

as mTor, eIF4E, eIF4G and PABP, and found that they are expressed during all differentiative

stages of spermatogenesis. The most evident difference was a decrease in the expression of

mTor in the haploid stages.

In the [35S]methionine incorporation experiments made on spermatocytes and round

spermatids after pre-incubation with rapamycin or Mnk inhibitor, we observed a reduction of

protein synthesis of 20% in spermatocytes, whereas no apparent effect was evident in round

spermatids.

These data suggest that, while translational activity of spermatocytes is partially regulated by

mTor and Erk pathways, this regulation is not occurring in round spermatids. These results

were confirmed by binding assay of eIF4F components to m7-GTP-sepharose beads

(mimicking the cap mRNA structure) in the presence or absence of rapamycin or Mnk

inhibitor. Treatment with both drugs decreases the binding of eIF4G, PABP, eIF4A and eIF4E

that take part to the translation initiation complex formation in spermatocytes, and increases

the binding of 4EBP1 ( competitive inhibitor of eIF4G).

In round spermatids no effect was observed by treatment with these drugs confirming their

indipendence from mTor and Erk pathways

However these pathways appeared to be active again in elongating spermatids.

These data would suggest that the lower level of translational activity in round spermatids with

respect to spermatocytes and elongating spermatids is mainly due to a decrease in cap

dependent translation.

42

However this conclusion is not supported by the analysis of the binding of initiation factors to

m7-GTP-sepharose beads (mimicking the cap mRNA structure), which shows that there are no

apparent differences between spermatocytes and round spermatids. Thus, a delay in the

elongation step of translation, rather than reduced formation of initiation complexes, might

account for the decrease in the rate of protein synthesis at the beginning of the haploid phase

of spermatogenesis. Indeed, one would expect that, in the absence of active elongation,

preformed initiation complexes are not disassembled, and this could explain the lack of effect

of rapamycin and Mnk inhibitor in round spermatids. Infect mTor and Erk dependent

phosphorylations are dynamically required to reform continuously initiation complexes at

active translation sites (Figure 10).

On the other hand, we found a clear increase in the amount of initiation complex in elongating

spermatids, accompanied by a strong reduction in the levels of the 4EBP1 inhibitor. This

increase in the formation of initiation complexes correlates positively to the new increase in

S6 phosphorylation and protein synthesis in the final steps of spermiogenesis, and might

compensate the reduced efficiency of elongation in the haploid stages of spermatogenesis.

43

Figure 10 Hypothetical mechanism of translation activity of spermatocytes (A) and round spermatids (B): The CAP-dependent translation is active in spermatocytes (A) and inhibited in round spermatids (B) probably due to the absence of active elongation in these cells.

44

MATERIALS AND METHODS

45

Cell isolation, culture and treatment

Testes of adult CD1 mice (Charles River Italia) were used to prepare pachytene

spermatocytes, round spermatids and residual elongated spermatids. After dissection of the

albuginea membrane, testes were digested for 15 min in 0.25% (w/v) collagenase (type IX,

Sigma) at room temperature under constant shaking. Digestion was followed by two washes in

minimum essential medium, hence seminiferous tubules further digested in minimum essential

medium containing 1 mg/ml trypsin for 30 min at 30 °C. Digestion was stopped by adding

10% fetal calf serum and the released germ cells were collected after sedimentation (10 min at

room temperature) of tissue debris. Germ cells were centrifuged for 10 min at 1,500 rpm at 4

°C and the pellet resuspended in 20 ml of elutriation medium (120.1 mM NaCl, 4.8 mM KCl,

25.2 mM NaHCO3, 1.2 mM KH2PO4, 1.2 mM MgSO4(7H2O), 1.3 mM CaCl2, 11 mM

glucose, 1 3 essential amino acid (Life Technologies, Inc.), penicillin, streptomycin, 0.5%

bovine serum albumin). Germ cells at pachytene spermatocyte, round spermatid, and

elongated spermatid steps were obtained by elutriation of the unfractionated single cell

suspension as described previously (25). Homogeneity of cell populations ranged between 80

and 85% (pachytene spermatocytes) and 95% (round spermatids), and was routinely

monitored morphologically (Sette et al., 1999). Spermatogonia were obtained from mice 8-d-

old as described previously (Rossi et al., 1993). After elutriation, pachytene spermatocytes,

round spermatids and residual body were cultured in minimal essential medium, supplemented

with 0.5% bovine serum albumin (BSA), 1 mM sodium pyruvate, 2 mM sodium lactate, at a

density of 106 cells/ml at 32°C in a humidified atmosphere containing 95% air and 5% CO2.

After 30 mitutes, cells were treated with Rapamycin 50nM, or Mnk inhibitor 10 M for 3h.

For the in vivo labelling experiments, 1 x 106 spermatocytes or 4 x 106 per 35 mm well were

incubated in the presence of inhibitors as indicated. In the last 1h [35S] cell labeling mix

(PRO-MIX, Amersham >1000 Ci/mmol) was added to a final concentration of 20 �Ci/ml.

Cells were lysed in PBS-SDS buffer (150 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.4 mm

KH2PO4, 0.1% sodium dodecy lsulfate) and proteins were precipitated in 10% trichloroacetic

acid (TCA). After two washes with 5% cold TCA the insoluble material was collected on GFC

filters (Whatman) and the incorporated radioactivity was measured in scintillation fluid.

46

For okadaic acid (OA) treatment, spermatocytes were treated for 4h with or 0.5 M okadaic

acid (OA; Calbiochem, San Diego, CA) to induce metaphase I entry (Wiltshire et al., 1995) or

equal volumes of the solvent dimethyl sulfoxide (DMSO). At the end of the incubation, cells

were harvested and washed twice with ice-cold phosphate-buffered saline (PBS) and protein

extracted as described below.

Preparation of cell extracts and Western blot analysis.

For proteins extraction, spermatocytes, round spermatids, residual body were lysed by the

addition of lysis buffer containing: 100 mM NaCl, 10 mM MgCl2, 30 mM Tris-HCl, pH 7.5, 1

mM dithiothreitol, 10 mM -glycerophosphate, 0.5 mM Na3VO4, 1 % Triton-X-100, protease

inhibitor cocktail (Sigma-Aldrich). Extracts were homogenised with 15 strokes with a Tight

glass pestle and immediately centrifuged for 10 min at 12,000xg at 4°C. The resulting

supernatants were used as the cell extracts. Protein concentration was determined by using

Bradford reagent (BioRad). Cell extracts were used for Western blot analysis as previously

described with the following primary antibodies (1:1000 dilutions): rabbit anti- eIF4E, rabbit

anti-pSer473-AKT, mouse, rabbit anti-4E-BP1, rabbit, rabbit anti-eIF4G and rabbit anti-rpS6

(Cell Signaling Technology); rabbit anti-pSer240/244 rpS6 and rabbit anti-pSer209 eIF4E

(BioSource International,Inc.USA); mouse anti-tubulin (Sigma-Aldrich). After incubation

with secondary anti-mouse or anti-rabbit IgGs conjugated to horseradish peroxidase

(Amersham), immunostained bands were detected by chemiluminescent method (Santa Cruz

Biotechnology).

7-methyl-GTP-Sepharose chromatography.

For the isolation of eIF4E and associated proteins, spermatocytes, round spermatids and

residual body were lysed in buffer containing 50 mM HEPES, pH 7.4, 75 mM NaCl, 10 mM

MgCl2, 1 mM DTT, 8 mM EGTA, 10 mM -glycerophosphate, 0.5 mM Na3VO4, 0.5 %

Triton-X-100, protease inhibitor cocktail and Rnasi out. Cell extracts were incubated for 10

min on ice and centrifuged at 12,000xg for 10 min at 4°C. The supernatants were pre-cleared

47

for 1h on Sepharose beads (Sigma-Aldrich). After centrifugation for 1 min at 1000xg,

supernatants were recovered and incubated for 1h and 30 minutes at 4°C with 7-methyl-GTP-

Sepharose (Amersham) under constant shaking. Beads were washed three times with lysis

buffer and absorbed proteins were eluted in SDS-PAGE sample buffer.

48

REFERENCES

Albanesi C, Geremia R, Giorgio M, Dolci S, Sette C, Rossi P. (1996). A cell- and developmental stage-specific promoter drives the expression of a truncated c-kit protein during mouse spermatid elongation.Development. 1996 Apr;122(4):1291-302.

Almstrup K, Nielsen JE, Hansen MA, Tanaka M, Skakkebaek NE, Leffers H. (2004). Analysis of cell-type-specific gene expression during mouse spermatogenesis.Biol. Reprod 70, 1751– 1761.

Bellvé AR, Cavicchia JC, Millette CF, O'Brien DA, Bhatnagar YM, Dym M.(1977).Spermatogenic cells of the prepuberal mouse.Isolation and morphological characterization.

J. Cell Biol. 74, 68– 85.

Backer C C. and Fuller T M. (2007) Translational control of meiotic cell cycle progression and spermatid differentiation in male germ cells by a novel eIF4G homologDevelopment 134, 2863-2869

Bellvè A R and O’Brien DA, (1983). The mammalian spermatozoon: structure and temporal assembly. In: Hartmann JF (ed.), Mechanism and Control of Animal Fertilization. New York: Academic Press, pp.55-137

Biggiogera M, Fakan S, Leser G, Martin TE, Gordon J. (1990). Immunoelectron microscopic visualization of ribonucleoprotein in the chromatoid body of mouse spermatids.

Reprod. Dev. 26, 150–158.

Braun RE, Peschon JJ, Behringer RR, Brinster RL, Palmiter RD. (1989). Protamine 3’-untraslated sequences regulate temporal translational control and subcellular localization of growth hormone in spermatids of transgenic mouse.Genes and development, 3, 793-802

Brown, E.J., Albers, M.W., Shin, T.B., Ichikawa, K., Keith, C.T., Lane, W.S., and Schreiber, S.L. 1994. A mammalian protein targeted by G1-arresting rapamycin–receptor complex.Nature 369: 756–758.

Braun R.E. (2000) .Temporal Control of Protein Synthesis during spermatogenesisInternational Journal of Andrology , 23, Suppl.2 : 92-94 (2000).

Cataldo L, Mastrangelo MA, Kleene KC. (1999). A quantitative sucrose gradient analysis of the translational activity of 18 mRNA species in testes from adult mice. Mol Hum Reprod. 1999 Mar;5(3):206-13.

49

Chen, J., Zheng, X.F., Brown, E.J., and Schreiber, S.L. 1995. Identificationof an 11-k Da FKBP12–rapamycin-binding domain within the 289-kDa FKBP12–rapamycin-associated proteinand characterization of a critical serine residue.Proc. Natl. Acad. Sci. 92: 4947–4951.

Choi, J., Chen, J., Schreiber, S.L., and Clardy, J. 1996. Structure of the FKBP12–rapamycin complex interacting with the binding domain of human FRAP.Science 273: 239–242.

Connolly CM, Dearth AT, Braun RE (2005). Disruption of murine Tenr results in teratospermia and male infertility.Dev. Biol. 278, 13–21.

Deng, W. and Lin H. (2002). . miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis Dev. Cell 2, 819–830.

Dolci, S., Pellegrini, M., Di Agostino, S., Geremia, R., Rossi, P., (2001).Signaling through extracellular signal regulated kinase is required for spermatogonial proliferative response to stem cell factor.J. Biol. Chem. 276, 40225–40233.

Wang PJ, Page DC, McCarrey JR. (2005). Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesisin the mouse Human Molecular Genetics, 2005, Vol. 14, No. 19 2911–2918

Gingras, A.-C., Raught, B., and Sonenberg, N. 1999b. eIF4 initiation factors: Effectors of mRNA recruitment to ribosomes and regulators of translation.Annu. Rev. Biochem. 68: 913–963.

Grimes S.R. (2004). Testis-specific transcriptional control Gene 343 11 –22 Review.

Haghighat, A., Mader, S., Pause, A., and Sonenberg, N. 1995.Repression of cap-dependent translation by 4E-binding protein1: Competition with p220 for binding to eukaryotic initiationfactor-4E.EMBO J. 14: 5701–5709.

Hershey, J.W.B. and Merrick, W.C. (2000). Pathway and mechanism of initiation of protein synthesis. In Translational control of gene expression (ed. M.B. Mathews), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y pp. 33–88.

Iguchi N, Tobias JW, Hecht NB. (2006). Expression profiling reveals meiotic male germ cell mRNAs that are translationally up- and down-regulated.Proc Natl Acad Sci U S A. 2006 May 16;103(20):7712-7. Epub 2006 May 8.

50

Kierszenbaum, A.L., Tres, L.L. (1975). Structural and transcriptional features of the mouse spermatid genome.

J. Cell Biol. 65, 258±270.

Kleene, K.C., (1993). Multiple controls over the efÆciency of translation of the mRNAs encoding transition proteins, protamines and the mitochondrial capsule selenoprotein in late spermatids in mice. Dev. Biol. 159, 720±731.

Kleene K.C (1996). Patterns of translational regulation in the mammalian testis.Mol Reprod Dev. 1996 Feb;43(2):268-81. Review.

Kleene K.C (2001). A possible meiotic function of the peculiar patterns of gene expression in mammalian spermatogenic cells Mechanisms of Development 106 (2001) 3±23 Review

Kuersten, S., and Goodwin, E. B. (2003). The power of the 3_ UTR: translational control and development. Nat. Rev. Genet. 4, 626–637.

Kuramochi-Miyagawa S, Kimura T, Ijiri TW, Isobe T, Asada N, Fujita Y, Ikawa M, Iwai N, Okabe M, Deng W, Lin H, Matsuda Y, Nakano T. (2004). Mili, a mammalian member of piwi family gene, is essential for spermatogenesis.

Development 131, 839–849.

Lee K, Haugen HS, Clegg CH, Braun RE. (1995). Premature Traslation of protamine 1 mRNA causes precocious nuclear condensation and arrest spermatide differenciation in mice.Proceedings of the National Academy of Science of the USA 2, 12451–12455.

Lee, M. H., and Schedl, T. (2001). Identification of in vivo mRNA targets of GLD-1, a maxi-KH motif containing protein required for C. elegans germ cell development. Genes Dev. 15, 2408–2420.

Lukong, K. E., and Richard, S. (2003). Sam68, the KH domain-containing superSTAR. Biochim. Biophys. Acta 1653, 73–86.

Mader, S., Lee, H., Pause, A., and Sonenberg, N. 1995. The translation initiation factor eIF-4E binds to a common motifshared by the translation factor eIF-4 _ and the translationalrepressors 4E-binding proteins.Mol. Cell. Biol. 15: 4990–4997.

Marcotrigiano, J., Gingras, A.-C., Sonenberg, N., and Burley,S.K. 1999. Cap-dependenttranslation initiation in eukaryotesis regulated by a molecular mimic of eIF4G. Mol. Cell3: 707–716.

51

Meistrich, M.L. (1989). Histone and basic nuclear transitions in mammalianspermatogenesis.In: Hnilica L.S., Stein, G.S. (Eds.), Histones and Other Basic Nuclear Proteins. CRC Press, Boca Raton, FL, pp. 165±182.

Monesi , V. (1964). RIBONUCLEIC ACID SYNTHESIS DURING MITOSIS AND MEIOSIS IN THE MOUSE TESTIS. J. Cell Biol. 22, 521-532.

Monesi , V. (1965). Synthetic activities during spermatogenesis in the mouse RNA and protein.Exp. Cell. Res. 33, 197-224.

Monesi , V. (1967). Ribonucleic acid and protein synthesis during differentiation of male germ cells in the mouse. Arch Anat Microsc Morphol Exp. 1967;56(3):61-74.

Monesi , V. (1971). Chromosome activities during meiosis and spermiogenesis. J. Reprod. Fert. Suppl. 13, 1-14.

Monesi V, Geremia R, D'Agostino A, Boitani C. (1978).Biochemistry of male germ cell differentiation in Mammals: RNA synthesis in Meiotic and Postmeiotic cells. In: Current Topics in Developmental Biology (A.A.Moscona and A.Monroy eds ). Academic Press, New York and London.

Moussa F, Oko R, Hermo L. (1994) The immunolocalization of small nuclear ribonucleoprotein particles in testicular cells during the cycle of the seminiferous epithelium of the adult rat. Cell Tissue Res 278:363–378

O'Brien DA (1987). Stage-specific protein synthesis by isolated spermatogenic cells throughout meiosis and early spermiogenesis in the mouse.Biol Reprod. 1987 Aug;37(1):147-57.

O'Brien DA, Bellvé AR.(1980) a. Protein constituents of the mouse spermatozoon. II. Temporal synthesis during spermatogenesis. Dev Biol. 1980 Mar 15;75(2):405-18.

O'Brien DA, Bellvé AR.(1980) b. Protein constituents of the mouse spermatozoon. I. An electrophoretic characterization. Dev Biol. 1980 Mar 15;75(2):386-404.

Pellegrini, M., Grimaldi, P., Rossi, P., Geremia, R., Dolci, S., 2003 Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: a potential role of BMP4 in spermatogonia differentiation.J. Cell Sci. 116, 3363–3372.

52

Pyronnet S., Imataka H.,Gingras AC, Rikiro Fukunaga R.1,2,Hunter T.1 and Nahum Sonenberg N.3 (1999)Human eukaryotic translation initiation factor 4G(eIF4G) recruits Mnk1 to phosphorylate eIF4EThe EMBO Journal Vol.18 No.1 pp.270–279, 1999

Paronetto M P, Zalfa F, Botti F, Geremia R,Bagni C, and Sette C(2003). Tr-kit promotes the formation of a multimolecular complex composed by Fyn, PLCgamma1 and Sam68.Oncogene. 2003 Nov 27;22(54):8707-15.

Rossi P, Dolci S, Sette C, Capolunghi F, Pellegrini M, Loiarro M, Di Agostino S, Paronetto MP, Grimaldi P, Merico D, Martegani E, Geremia R. (2004). Analysis of the gene expression profile of mouse male meiotic germ cells Gene Expression Patterns 4 (2004) 267–281

Roeder, G.S., (1997). Meiotic chromosomes: it takes two to tango. Genes Dev. 11, 2600–2621.

Rossi P, Marziali G, Albanesi C, Charlesworth A, Geremia R, Sorrentino V. (1992). A novel c-kit transcript, potentially encoding a truncated receptor, originates within a kit gene intron in mouse spermatids.Dev Biol. 1992 Jul;152(1):203-7.

Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R., Geremia, R., (1993). FSH induction of steel factor (SLF) mRNA in mouse Sertoli cells and stimulation of DNA synthesis in spermatogoný´a by soluble SLF. Dev. Biol. 155, 68–74.

Russell, L.D., Ettlin, R.A., Hikim, A.P.S., Clegg, E.D.(1990) . Histological and Histopathological Evaluation of the Testis. Cache River Press, Clearwater, FL.

Sassone-Corsi, P. (2002). Unique chromatin remodeling and transcriptional regulation in spermatogenesis. Science 296, 2176–2178.

Saunders PT, Turner JM, Ruggiu M, Taggart M, Burgoyne PS, Elliott D, Cooke HJ. (2003).Absence of mDazl produces a final block on germcell development at meiosis.Reproduction 126, 589–597.

Schlecht, U., Demougin, P., Koch, R., Hermida, L., Wiederkehr, C.,Descombes, P., Pineau, C., Jegou, B., Primig, M.,.( 2004). Expression profiling of mammalian male meiosis and gametogenesis identifies novel candidate genes for roles in the regulation of fertility.

Mol. Biol. Cell 15, 1031–1043.

Schmidt EE, Hanson ES, Capecchi MR. (1999). Sequence-independent assembly of spermatid RNAs into messenger ribonucleoprotein particles. Mol. Cell Biol. 19, 3904±3915.

53

Schrans-Stassen, B.H., van de Kant, H.J., de Rooij, D.G., van Pelt, A.M., (1999). Differentialexpression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 140, 5894–5900.

Sette, C., Bevilacqua, A., Geremia, R., and Rossi, P. (1998).Involvement of phospholipase Cgamma1 in mouse egg activation induced by a truncated form of the C-kit tyrosine kinase present in spermatozoa..J Cell Biol. 1998 Aug 24;142(4):1063-74.

Sette, C., Barchi, M., Bianchini, A., Conti, M., Rossi, P., and Geremia, R. (1999). Activation of the mitogen-activated protein kinase ERK1 during meiotic progression of mouse pachytene spermatocytes.J. Biol. Chem. 274, 33571–33579.

Sette C, Paronetto MP, Barchi M, Bevilacqua A, Geremia R, Rossi P. (2002). Tr-kit-induced resumption of the cell cycle in mouse eggs requires activation of a Src-like kinase. EMBO J. 2002 Oct 15;21(20):5386-95.

Shima, J.E.,McLean,D.J.,McCarrey, J.R., Griswold, M.D.,(2004) .Themurine testicular transcriptome: characterizing gene expression in the testisduring the progression of spermatogenesis.Biol. Reprod 71, 319–330.

Shojia M., Chumaa S., Yoshidab K.,Moritab T.,Nakatsujia N. (2005). RNA interference during spermatogenesis in mice.Developmental Biology 282 524 – 534

Söderström KO (1981) Labeling of the chromatoid body by [3H]uridine in the rat pachytene spermatocytes.Exp Cell Res 131: 488–491

Sonenberg N and Hay N (2004) Upstream and downstream of mTORGenes & Dev Review18: 1926-1945

Sorrentino, V., Giorgi, M., Geremia, R., Besmer, P., Rossi, P., 1991. Expression of the c-kit protooncogene in the murine male germ cells.Oncogene 6, 149–151.

Steger K. (1999).Transcriptional and translational regulation of gene expression in haploid spermatids. Anat Embryol (Berl). 1999 Jun;199(6):471-87. Review.

Steger K.(2001) Haploid spermatids exhibit translationally repressed mRNAs Anat Embryol (2001) 203:323–334 Review

54

Venables JP, Eperon IC (1999) The roles of RNA-binding proteins in spermatogenesis and male infertility.Curr Opin Genet Dev9:346–354

Vernet, C., and Artzt, K. (1997). STAR, a gene family involved in signal transduction and activation of RNA. Trends Genet. 13, 479–484.

Wiltshire, T., Park, C., Caldwell, K. A., and Handel, M. A. (1995). Induced premature G2/M transition in pachytene spermatocytes includes eventsunique to meiosis.Dev. Biol. 169, 557–567.

Yang, J., Medvedev, S., Yu, J., Tang, L. C., Agno, J. E., Matzuk, M. M., Schultz,R. M., and Hecht, N. B. (2005). Absence of the DNA-/RNA-binding protein MSY2 results in male and female infertility. Proc. Natl. Acad. Sci. USA 102, 5755–5760.

Yoshinaga, K., Nishikawa, S., Ogawa, M., Hayashi, S., Kunisada, T.,Fujimoto, T., Nishikawa, S.-I., (1991). Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 113, 689–699.

Zhao, G.Q., Garbers, D.L. (2002). Male germ cell specification and differentiation.Dev. Cell 2, 537– 547.

Zirkin, B.R. (1993). Regulation of spermatogenesis in the adult mammal: gonadotrophin and androgens. In: Desjardins, C., Ewing, L.L. (Eds.),Cell and Molecular Biology of the Testis. Oxford Univ. Press, NewYork, pp. 166–188.

55

ONGOING PROJECT

56

Ongoing Project: RNA Interference in Vivo to study the role of Germ cell

specific proteins

The ablation of genes which play essential roles during embryogenesis often generates lethal

phenotypes, thus impeding to establish the functional role played by these genes in specific

tissue environments in the adult animal. This is especially true in the case of genes encoding

molecules involved in pleiotropic signal transduction pathways. Traditional “knock-out”

strategies also show their limitations when studying, e.g., the function of alternative transcript

of the same gene generated through alternative splicing or utilization of alternative

transcriptional promoters. In the case of the c-kit gene, we know since long time that a

truncated form of the receptor (“tr-kit”) is selectively expressed in the haploid stages of

spermatogenesis, and, as described in the introductory section, we have accumulated several

experimental evidences that this protein might play an important role at the beginning of

embryogenesis after its transfer from the sperm into the oocyte at fertilization. We knew that

an intronic promoter drives the expression of the alternative c-kit transcript during

spermiogenesis (Albanesi et al.., 1996).

In my laboratory, this intronic promoter has been inactivated through a classical “knock-out”

strategy, assuming that it would have not affected c-kit expression in other cell types, while

selectively abolishing tr-kit expression in mouse spermatids. However, homozygous mutant

mice showed a lethal phenotype almost identical to the one which is observed in mice with

deletions of the c-kit gene. This could be explained, e.g., by the existence within the knocked-

out intron of enhancer sequences needed both for c-kit expression in several tissues and for tr-

kit expression during spermiogenesis. This problem can be overcome through the use of new

methodologies allowing to target a gene in a conditional fashion, thus permitting the analysis

of specific mutations or deletions in selected organs or in temporally defined moments during

the animal lifespan. Such an advancement in knock-out strategies has been achieved through

the use of exogenous enzymatic systems (CRE recombinase) which are active in the events of

genetic recombination, which have considerably improved the spectrum of possible genetic

manipulations. The insertion of "lox" sequences (a specific target for CRE recombinase)

flanking specific coding regions of the gene to be targeted, and subsequent matings of mice

bearing one or both “loxed” alleles with transgenic mice expressing CRE recombinase only in

specific tissues, under the control of transcriptional promoters that are active in selected cell

57

types, leads to the production of mice in which the gene is altered only in one or few tissues

and/or organs (“conditional knock-out”). However, these are time-consuming and very

expensive strategies.

A new strategy for selective modification of gene expression, which is now emerging, and that

we would prefer to try in order to establish the physiological role played by tr-kit, is the so

called “knock-down”, which is based on the in vivo efficacy of the so called “RNA

interference” (Dykxhoorn et al., 2003). “Knock-down” means the alteration of the expression

of a given gene through the specific destruction of messengers RNAs transcribed by that gene,

without altering the structure of the gene itself. This can be achieved thanks to the efficacy of

small double stranded RNAs (short hairpin RNAs, shRNAs), corresponding to peculiar

sequences within a transcript, to induce specific degradation of the target transcript. Such

double-stranded RNAs can be transcribed in transgenic mice under the control of either

ubiquitous or tissue-specific promoters, thus obtaining in the latter case the so called

“conditional knock-down”. However, several technical problems impair an easy application of

this technology. First, it is difficult to predict which short shRNA sequence within the large

structure of a transcript will be efficient in triggering its degradation. Moreover, in order to

achieve the “knock-down” goal, it is much better if expression of shRNAs is driven by RNA-

polymerase-III-dependent promoters (which are largely ubiquitous), since the generated

transcripts are retained in the nucleus and are not exported to the cytoplasm, in which the

possibility of contact with the target RNA is unlikely. Thus the so-called “conditional knock-

down” cannot be performed, since only RNA-polymerase-II-dependent promoters show

tissue-specificity, but their transcripts are quickly processed and exported to the cytoplasm (in

such a case, transcribed shRNAs will not be effective in inducing the degradation of the target

messenger RNA). The problem of finding out which specific shRNA will be efficient in

inducing RNA silencing could be theoretically solved by expressing, instead of shRNA, much

longer double- stranded RNAs (at least 500 bp), which are attacked in the nucleus by an

ubiquitous type III RNAse (“Dicer”), thus generating a large combination of small double

stranded RNAs (siRNAs) potentially effective in the specific RNA silencing. However, if their

expression is driven by RNA-polymerase-II-dependent promoters, such long double strand

transcripts would be efficiently transferred to the cytoplasm, where they activate the classical

anti-viral-defense system regulated by interferons, which provokes a general non-specific

block of mRNA translation, and, at the same time, RNA degradation, with the consequence of

58

cell death. Furthermore, as mentioned above, the short nuclear permanence of these double

stranded transcripts would avoid their processing by Dicer to siRNAs efficient in triggering

gene-specific RNA silencing (Figure 11)

59

Figure 11 The RNA interference pathway. A) Short interfering (si)RNAs. Molecular hallmarks of an siRNA include 5’phosphorylated, a19-nucleotid (nt) duplexed region and 2-nt unpaired and unphosphorylated 3’ ends that are characteristic of RNase III cleavege products. B)The siRNA pathway. Long double-stranded (ds)RNA is cleaved by the RNAse III family member, Dicer, into siRNAs in an ATP-dependent reaction. These siRNAs are then incorporated into the RNA-inducing silencing complex (RISC). Although the uptake of siRNAs by RISC is indipendent of ATP, the unwinding of the siRNA duplex requires ATP. Once unwound, the single-stranded antisense strand guides RISC to messenger RNA that has a complementary sequence, which results in the endonucleolytic cleavage of the target mRNA.

60

Recently a new vector for the generation of transgenic mice has been developed, called

pDECAP (Figure 12), which is able to drive the expression of long double-stranded RNAs

(ds-RNA) by a RNA-polymerase-II-dependent promoter (CMV), without activating the

interferon-like response and allowing efficient processing of long hairpin RNAs by Dicer

(Shinagawa and Ishii, 2003).

Figure 12. Structure of pDECAP vector. The pDECAP vector contains the CMV promoter, a ribozyme cassette to cut off the m7G cap structure, and a MAZ site for Pol II pausing. The gene specific targeting sequence was cloned between the ribozyme cassette and the MAZ site as an inverted repeat separated by a 12-nt spacer.

This has been achieved through the insertion in the vector plasmid of a DNA fragment

encoding a ribozyme which removes the 5’ cap structure of mRNAs and of a binding site for

MAZ, a nuclear protein that provokes the arrest of transcriptional elongation and block of

polyadenylation. Thus, pDECAP-derived transcripts lack both the 5’ cap structure and a poly-

A tail, avoiding cytoplasmic export of transcribed ds RNA to the cytoplasm and the non-

specific general translational block evoked by the interferon system. It has been shown that ds

61

RNA generated from the pDECAP vector are processed in a Dicer-dependent fashion to

siRNAs which are very effective in triggering specific gene silencing. Transgenic mice, in

which long ds RNA corresponding to the transcript of a specific gene were expressed from the

pDECAP vector under the control of an ubiquitously active promoter, displayed a phenotype

almost identical to the one observed in mice carrying an homozygous null mutation in the

same gene (Shinagawa and Ishii, 2003).

We have modified the pDECAP vector, which was available in our laboratory, by replacing

the ubiquitously active CMV promoter with a promoter selectively active during

spermiogenesis, and inserting a long inverted repeat corresponding to part of tr-kit transcript,

in order to achieve the production of ds RNA against tr-kit in the spermatids of adult animals.

This should cause estinguishment of tr-kit expression in spermatozoa, which should allow to

evaluate the alternative cell-specific function of the c-kit gene in the reproductive system.

We inserted in the pDECAP vector, under the control of the ubiquitously active CMV

promoter, and between the sequences encoding the ribozyme and the MAZ binding site, three

different inverted repeat of about 500 bp, spanning three distinct regions of the tr-kit cDNA

(Figure 13)

62

A

B

Figure 13 A)Structure of pDECAP vector containing the tr-kit specific targeting sequence. B) Three different inverted repeat of about 500 bp, spanning three distinct regions of the tr-kit cDNA.

XbaIEcoRI

NdeI

START CODON STOP CODON

Nde EcoRI/Xba

TR-KIT

A C

B

63

We co-transfected increasing amounts of these constructs in Hek293 cell lines together with a

construct in which the CMV promoter drives the expression of tr-kit cDNA or of a fusion

protein between GFP-and tr-kit. We verified that all the three inverted repeats were efficient in

downregulating expression of both tr-kit and of the GFP-tr-kit fusion protein in transfected

cells, by western blot (Figure 14) and direct fluorescence analysis (Figure 15).

64

0.4ug tr-kit/0.4ug pDecap 0.2ug tr-kit/0.4ug pDecap

0.1ug tr-kit/0.4ug pDecap

Figure 14.Western blot analysis of tr.kit silencing efficiency. Increasing amounts of three constructs (A,B and C) were co-transfected in Hek293 cell lines together with a construct in which the CMV promoter drives the expression of tr-kit cDNA.

65

Tr-kit GFP/pDECAP (0,5ug / 1ug)

Figure 15. Direct fluorescence analysis of tr.kit silencing efficiency. 0,5ug of construct in which the CMV promoter drives the expression of tr-kit fusion protein between GFP-and tr-kit (tr-kit-GFP) was co-transfected with 1ug of three constructs (A,B and C) in Hek293 cell lines

pDecaTr-kitA

pDecap

pDecapTr-kitB

pDecapTr-kitC

66

In particular we have found that the inverted repeat spanning the A segment, corresponding to

the 5’ untranslated terminal region of the tr-kit mRNA is the most efficient in triggering the

RNA interference phenomenon.

After having identified the most efficient construct to perform the specific “RNA

interference”, we have replaced in this construct the CMV promoter with the tr-kit promoter

that we have previously characterized (Albanesi et al., 1996) (.Figure 16 A and B)

A

B

c-kit 16th intron Ribizime Tr-kit tr-kit Maz site

Figure 16. A) Structure of the pDECAP vector containing the tr-kit specific targeting sequence and the tr-kit specific promoter. B) essential fragment used for microinjection in male pronucleus.

67

Our intention is now to generate different lines of transgenic mice harboring this construct.

mice which are homozygous for the transgene. In tr-kit ”knockdown” animals, first we will

verify the effective ablation of tr-kit mRNA and of the target protein during spermiogenesis. If

we will succeed in achieving this goal, independently from the observed phenotype, we could

apply these methodologies that we will have set up to verify in vivo in the mouse model the

function of other molecules expressed in mature human spermatozoa.

68

LAVORI PUBBLICATI

69

Transcriptome analysis of differentiating spermatogonia stimulated with kit ligand

Gene Expression Patterns xxx (2007) xxx–xxx

Abstract

As stated in the introduction section, Kit ligand (KL) is a survival factor and a mitogenic

stimulus for differentiating spermatogonia. However, it is not known whether KL

also plays a role in the differentiative events that lead to meiotic entry of these cells. We

performed a wide genome analysis of difference in gene expression induced by treatment with

KL of spermatogonia from 7-day-old mice, using gene chips spanning the whole mouse

genome.

The analysis revealed that the pattern of RNA expression induced by KL is compatible with

the qualitative changes of the cell cycle that occur during the subsequent cell divisions in type

A and B spermatogonia, i.e. the progressive lengthening of the S phase and the shortening of

the G2/M transition. Moreover, KL up-regulates in di.erentiating spermatogonia the

expression of early meiotic genes (for instance: Lhx8, Nek1, Rnf141, Xrcc3, Tpo1, Tbca,

Xrcc2, Mesp1, Phf7, Rtel1), whereas it down-regulates typical spermatogonial markers (for

instance: Pole, Ptgs2, Zfpm2, Egr2, Egr3, Gsk3b, Hnrpa1, Fst, Ptch2). Since KL modifes the

expression of several genes known to be up-regulated or down-regulated in spermatogonia

during the transition from the mitotic to the meiotic cell cycle, these results are consistent with

a role of the KL/kit interaction in the induction of their meiotic differentiation.

70

Dynamic Regulation of Histone H3 Methylation at Lysine 4 in Mammalian Spermatogenesis

BIOLOGY OF REPRODUCTION 77, 754–764 (2007)

Abstract

Spermatogenesis is a highly complex cell differentiation process that is governed by unique

transcriptional regulation and massive chromatin alterations, which are required for meiosis

and postmeiotic maturation. The underlying mechanisms

involve alterations to the epigenetic layer, including histone modifications and incorporation

of testis-specific nuclear proteins, such as histone variants and protamines. Histones can

undergo methylation, acetylation, and phosphorylation among

other modifications at their N-terminus, and these modifications can signal changes in

chromatin structure. We have identified the temporal and spatial distributions of histone H3

mono-, di-, and trimethylation at lysine 4 (K4), and the lysine-specific histone

demethylase AOF2 (amine oxidase flavin-containing domain 2, previously known as LSD1)

during mammalian spermatogenesis.

Our results reveal tightly regulated distributions of H3-K4 methylation and AOF2, and that

H3-K4 methylation is very similar between the mouse and the marmoset. The AOF2 protein

levels were found to be higher in the testes than in the somatic

tissues. The distribution of AOF2 matched the cell- and stagespecific patterns of H3-K4

methylation. Interaction studies revealed unique epigenetic regulatory complexes associated

with H3-K4 methylation in the testis, including the association of

AOF2 and methyl-CpG-binding domain protein 2 (MBD2a/b) in a complex with histone

deacetylase 1 (HDAC1). These studies enhance our understanding of epigenetic modifications

and their roles in chromatin organization during male germ cell differentiation in both normal

and pathologic states.

Transcriptome analysis of differentiating spermatogoniastimulated with kit ligand

Pellegrino Rossi *, Francesca Lolicato, Paola Grimaldi, Susanna Dolci, Annarita Di Sauro,Doria Filipponi, Raffaele Geremia

Dipartimento di Sanita’ Pubblica e Biologia Cellulare, Universita’ degli Studi di Roma Tor Vergata, via Montpellier 1, 00133 Rome, Italy

Received 10 September 2007; received in revised form 2 October 2007; accepted 17 October 2007

Abstract

Kit ligand (KL) is a survival factor and a mitogenic stimulus for differentiating spermatogonia. However, it is not known whether KLalso plays a role in the differentiative events that lead to meiotic entry of these cells. We performed a wide genome analysis of difference ingene expression induced by treatment with KL of spermatogonia from 7-day-old mice, using gene chips spanning the whole mouse gen-ome. The analysis revealed that the pattern of RNA expression induced by KL is compatible with the qualitative changes of the cell cyclethat occur during the subsequent cell divisions in type A and B spermatogonia, i.e. the progressive lengthening of the S phase and theshortening of the G2/M transition. Moreover, KL up-regulates in differentiating spermatogonia the expression of early meiotic genes (forinstance: Lhx8, Nek1, Rnf141, Xrcc3, Tpo1, Tbca, Xrcc2, Mesp1, Phf7, Rtel1), whereas it down-regulates typical spermatogonial mark-ers (for instance: Pole, Ptgs2, Zfpm2, Egr2, Egr3, Gsk3b, Hnrpa1, Fst, Ptch2). Since KL modifies the expression of several genes knownto be up-regulated or down-regulated in spermatogonia during the transition from the mitotic to the meiotic cell cycle, these results areconsistent with a role of the KL/kit interaction in the induction of their meiotic differentiation.� 2007 Elsevier B.V. All rights reserved.

Keywords: Kit ligand; Kit receptor tyrosine kinase; Retinoic acid; Bone morphogenetic protein 4; Spermatogonia; Spermatocytes; Cell cycle; Meiosis;Differentiation; DNA microarray; Spermatogenesis

1. Results and discussion

The kit tyrosine-kinase receptor and its ligand, (KL) areessential for the maintenance of primordial germ cells(PGCs) in both sexes. However, kit is known to playimportant roles also during post-natal stages of spermato-genesis (Sette et al., 2000). In the adult testis, the kit recep-tor is expressed in differentiating spermatogonia, but not inspermatogonial stem cells, whereas KL is expressed by Ser-toli cells under FSH stimulation in both a soluble and atransmembrane form, which are generated by alternativesplicing (Rossi et al., 1993). The soluble form of KL stim-ulates DNA synthesis in type A spermatogonia cultured

in vitro, and injection of anti-kit antibodies blocks theirproliferation in vivo (Rossi et al., 1993; Packer et al.,1995). A point mutation in the kit gene, which impairsKL-mediated activation of phosphatydilinositol 3-kinase,does not cause any significant reduction in PGCs numberduring embryonic development, nor in spermatogonialstem cell populations. However, males are completely ster-ile due to a block in the initial stages of spermatogenesis,associated to abolishment of DNA-synthesis in differentiat-ing A1–A4 spermatogonia (Blume-Jensen et al., 2000; Kis-sel et al., 2000). With the onset of meiosis kit expressionceases, whereas a truncated kit product, tr-kit, a candidatesperm factor acting in egg activation at fertilization, isspecifically expressed in post-meiotic stages of spermato-genesis (Sorrentino et al., 1991; Sette et al., 1997). OtherSertoli cell-secreted growth factors known to have directeffects on spermatogonia are glial cell line-derived

1567-133X/$ - see front matter � 2007 Elsevier B.V. All rights reserved.

doi:10.1016/j.modgep.2007.10.007

* Corresponding author. Tel.: +39 06 72596272; fax: +39 06 72596268.E-mail address: pellegrino.rossi@med.uniroma2.it (P. Rossi).

www.elsevier.com/locate/gep

Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

neurotrophic factor (Gdnf), which acts on self-renewal ofspermatogonial stem cells and inhibits their differentiation(Meng et al., 2000), and bone morphogenetic protein 4(Bmp4), which has both a proliferative and differentiativeeffect on these cells, in which it stimulates kit expression(Pellegrini et al., 2003).

We have previously shown that in vitro addition of sol-uble KL to kit expressing A1–A4 spermatogonia from pre-puberal mice stimulates their progression into the mitoticcell cycle and significantly reduces apoptosis in these cells(Dolci et al., 2001). However, it is not known whether,besides stimulating cell divisions and survival, KL alsoplays a role in the differentiative events which lead to mei-otic entry, i.e. the transition from type B spermatogonia toprimary spermatocytes, even though it has been reportedthat mouse germ cells cocultured with the 15-P1 cell line,expressing the transmembrane form of KL, can undergotransmeiotic progression in culture, whereas the solubleform of KL was reported to antagonize this effect (Vincentet al., 1998). Up to now, the only agent which has been pos-tulated to have a (direct or indirect) role in the induction ofmeiotic entry is all-trans retinoic acid (ATRA) (van Peltand de Rooij, 1991; Bowles et al., 2006; Koubova et al.,2006). Interestingly, Wang and Culty (2007) have recentlyfound that ATRA stimulates kit expression in prepuberalspermatogonia. In order, to clarify whether kit, besidesstimulating spermatogonial proliferation, also plays adirect role in the differentiative program at the onset ofspermatogenesis, we performed microarray analysis of thevariation in gene expression induced by a 24 h treatmentwith soluble KL of cultured spermatogonia from 7-day-old mice, a cell populations which is highly enriched inkit expressing cells.

The composition of the cell populations used for eachRNA extraction was routinely evaluated by morphologyand immunocytochemistry, as indicated in Section 2. Thespermatogonial population purified from testes of 7-day-old mice consisted mainly of type A1–A4, intermediateand type B spermatogonia together with spermatogonialstem cells, and was contaminated by less than 5% ofsomatic cells, whereas germ cells in the meiotic prophasewere virtually absent, in agreement with previous reports(Pellegrini et al., 2003; Dolci et al., 2001).

Spermatogonia were incubated for 24 h in the presenceor absence of 100 ng/ml soluble KL. At the end of the incu-bation complementary RNAs (cRNAs) were preparedfrom the two different cell populations and hybridized withcommercially available mouse Genome 430 2.0 GeneChipprobe arrays (Affymetrix Inc.), containing 45,500 knownmouse genes or EST sequences, and thus spanning approx-imately the whole mouse genome. The analysis was per-formed on duplicate chip arrays, using cRNAs from twodifferent RNA pools, each obtained from two different cul-ture experiments. Analogous experiments were also per-formed with other two agents known to be active onspermatogonia, i.e. Bmp4 (100 ng/ml) and ATRA(0.3 lM). The entire set of raw and normalized are avail-

able in the Array Express public repository at http://www.ebi.ac.uk/arrayexpress. (Accession No.: E-MEXP-1126).

In statistical analysis, only genes with detection param-eter P in both duplicates for one of the two compared con-ditions (KL-treated and untreated cells) were taken intoconsideration, and in the subsequent comparative analysisonly genes with change parameter I or D in both duplicateexperiments were considered. We established a change ingene expression level between treated and untreated cellsto be significant only if exceeding 1.5-fold up or down inboth experimental duplicates. We chose this relativelylow threshold considering that the cell population in thetestis of 7-day-old mice is heterogeneous, i.e. approxi-mately 50% of the spermatogonial population is expectedto be KL-responsive, based on the percentage of kit-posi-tive cells determined in spermatogonia isolated from8-day-old mice (Prabhu et al., 2006).

We reasoned that the genes found to be up- or down-regulated by KL treatment assume significance especiallywhen considered not as single genes, but as groups of func-tionally related genes, even though showing small quantita-tive changes in their expression level, since small butcoordinated changes in gene expression have been shownto clearly distinguish biological phenotypes (Moothaet al., 2003).

Analysis of the data revealed that the transcripts up-reg-ulated at least 1.5-fold by KL treatment in both experi-ments were 544, while those down-regulated at least 1.5-fold were 504. The complete list of up- and down-regulatedgenes is available in the first two files of the Supplementarydata. The changes in spermatogonial gene expression pat-tern induced by KL appear to be relatively specific for thisgrowth factor, since only 18% of these genes appeared to beregulated in a similar fashion also by treatment with Bmp4,and 12% also by treatment with ATRA (data available athttp://www.ebi.ac.uk/arrayexpress with Accession No.E-MEXP-1126). One hundred and eighty-two of the KL-up-regulated and 128 of the KL-down-regulated transcriptscorresponded to EST sequences for genes with unknownfunctions (unclassified). We grouped the remaining 362KL-up-regulated and 376 KL-down-regulated transcriptsin several functional classes (see the first two files in theSupplementary data for description of the single genes).Validity of the data of microarray analysis was confirmedby performing semi-quantitative (RT-PCR) analysis forrandomly selected transcripts on RNA preparationsobtained from different cell preparations (Fig. 1). Afteranalysis of the encoded genes several interesting featuresemerged. We clustered the genes with similar functionsand/or known developmental pattern of expression in thegerm cell line in four main categories, which are summa-rized in Tables 1–4 (the indicated value of fold change isthe average of the two separate experiments): (1) Cell cyclecontrol; (2) Control of differentiation and meiotic entry; (3)Metabolism; (4) Growth factors, receptors, nucleic acidbinding proteins and signal transducers.

2 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

1.1. Cell cycle control

Genes involved in cell cycle control up- or down-regu-lated by KL stimulation are reported in Table 1. Withinthese genes, three functional groups can be identified, i.e.,G1/S transition inhibitors and G2/M promoters, whichare up-regulated, and G1/S promoters, which are down-regulated. These data indicate that KL induces in kitexpressing spermatogonia variations in their gene expres-sion pattern, which might explain the occurrence of thequalitative changes in their mitotic cell cycle that have beenpreviously described by pioneering autoradiographic stud-ies by Monesi (Monesi, 1962). He showed that the wholeduration of the cell cycle is relatively constant, but the aver-age DNA synthetic time (S phase) becomes progressivelylonger during the subsequent cell divisions from type Ato type B spermatogonia, up to the last premeiotic DNAsynthesis in pre-leptotene spermatocytes (Monesi, 1962).On the contrary, the average post DNA-synthetic time(G2 phase) becomes progressively shorter during the subse-quent cell divisions, and pre-leptotene spermatocytes enterthe prophase of the first meiotic division shortly after thecompletion of the last round of DNA synthesis (Monesi,1962). The present analysis reveals that, in agreement with

the progressive lengthening of the S phase, KL up-regulatesthe expression of several genes which antagonize or delayG1/S progression, and down-regulates expression of geneswhich promote or accelerate G1/S progression. At thesame time, in agreement with the progressive shorteningof the G2/M phase, KL up-regulates the expression of sev-eral genes which stimulate mitotic entry and completion ofmitosis.

1.2. Control of differentiation and meiotic entry

Genes known as spermatogonial or meiotic markers arereported in Table 2. Between these genes, three functionalgroups can be identified i.e., spermatogonial and late mei-otic markers, which are down-regulated, and early meioticmarkers, which are coordinately up-regulated.

These data indicate that stimulation by the soluble formof KL induces in kit expressing spermatogonia changes intheir gene expression pattern compatible with the activa-tion of their differentiative program culminating with entryinto meiosis after the last round of DNA synthesis in pre-leptotene spermatocytes. Indeed, many genes known to bedown-regulated in male germ cells at the onset of meiosis,actually decrease their expression following KL treatment,and, on the contrary, genes which are known markers ofthe early meiotic stages of spermatogenesis, or that startto be expressed from the lepto-zygotene stage onward,increase their expression after KL treatment.

The down-regulation of Gsk3b is interesting, since itshomolog gene in Saccharomyces cerevisiae, Rim11p (regu-lator of inducer of meiosis), is pivotal for the control ofmeiosis entry in response to nutritional signals (Rubin-Bejerano et al., 2004; Kassir et al., 2003). Moreover,in vitro experiments have shown that Gsk3b inhibitors sup-press DNA synthesis selectively in rat preleptotene sper-matocytes, suggesting that Gsk3b might be required forthe last round of DNA synthesis preceding meiosis (Guoet al., 2003).

The up-regulation of Tbca is also interesting. The pre-cise role of Tbca is still unknown, though findings onRbl2p (its yeast homolog) suggest that it might play a rolein meiosis: Rbl2p has been hypothesized to serve as a b-tubulin storage protein, and to intervene specifically alongmeiosis but not mitosis (Archer et al., 1995).

Particularly intriguing is also the KL-mediated induc-tion of the homeobox gene Lhx8, a gene highly expressedin the adult testis, in view of its possible role in regulationof spermatogonial differentiation into spermatocytes,downstream from spermatogenesis and oogenesis basichelix–loop–helix transcription factor 1 (Sohlh1) (Pangaset al., 2006; Ballow et al., 2006).

KL influence also the expression of other genes whosehomologs play a role in meiosis in other species, eventhough details about their expression during mammalianspermatogenesis are not yet available. For instance, twoDSB repair enzymes Xrcc3 and Xrcc2 are up-regulatedby KL treatment. The Arabidopsis and Drosophila homo-

Fig. 1. Representative RT-PCR analysis of RNA from KL-treated anduntreated spermatogonia from 7-day-old mice, using specific oligonucleo-tide primers for 12 of the 115 KL-regulated genes described in the text andin Tables 1–4. RT-PCR analysis was performed at least twice andprovided similar results. The full list of the couples of oligonucleotideprimers used for RT-PCR analysis of each gene transcript is shown inSection 2. Between parentheses, after the gene names, the average foldchanges deduced from the two separate microarray analysis are reported.

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 3

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

logs of Xrcc3 play an essential role in meiosis (Bleuyardand White, 2004), and Xrcc2 is known to be expressed athigh levels in the mammalian testis, so a possible role inmeiosis for this gene has been postulated (Cartwrightet al., 1998). A recent report indicates that Xrcc3 plays arole during meiotic events in the mammalian testis (Liuet al., 2007).

The down-regulation of several genes considered to bemarkers of later stages of the meiotic prophase or ofpost-meiotic germ cells, but which are not expressed inearly meiosis (i.e. in lepto-zygotene spermatocytes), is notconflict with the ‘‘pro-meiotic’’ action of KL in spermato-gonia. Indeed, this might be explained if the main action ofsoluble form of KL is to induce an ‘‘early meiotic’’ pheno-

type, while inhibiting or delaying further progression of themeiotic prophase, which is actually known to be a lengthyprocess. Moreover, this would give a rational explanationto the previously reported inhibitory role exerted by thesoluble form of KL in the relatively rapid transmeiotic pro-gression of mouse germ cells in vitro (detected as expres-sion of postmeiotic genes), which would be insteadstimulated by transmembrane KL (Vincent et al., 1998).

1.3. Metabolism

KL treatment appears to down-regulate in spermatogo-nia several genes which are important in the control ofseveral anabolic pathways and energy production (Table 3)

Table 1Cell cycle control

Functionalgroups of genes

Target ID Fold changevs. control

Genesymbol

Description and functional notes

Inhibitors of G1/Stransition

1426520_at 4.04 Btg4 Negative regulator of progression through mitotic cell cycle, expressed at high levelsin the testis and in oocytes. (Buanne et al., 2000). Also called PC3B

1457356_at 2.85 Igf2r Antagonist of Igf2-stimulated growth, known to be expressed in spermatogenic cells(Tsuruta and O’Brien, 1995)

1426210_x_at 2.67 Parp3 Poly(ADP-ribosyl)transferase. Its overexpression interferes with G1/S transition(Augustin et al., 2003)

1430164_a_at 2.62 Grb10 Potent growth inhibitor which is a specific endogenous suppressor ofIgf-I-stimulated cell signaling and DNA synthesis (Dufresne and Smith, 2005)

1422574_at 2.45 Mxd4 Myc antagonist and inhibitor of cell cycle entry (Hurlin et al., 1995)1431134_at 2.00 Ing5 Its overexpression in cancer cell lines decrease cell population in S phase

(Shiseki et al., 2003)1427708_a_at 1.96 Nf2 (merlin) A tumor suppressor which inhibits cell proliferation and cell cycle progression by

repressing cyclin D1 expression (Xiao et al., 2005)1422477_at 1.82 Cables1 Inhibits cdk2 activity by enhancing phosphorylation of its tyrosine 15 by Wee1

(Wu et al., 2001)1441183_at 1.79 Jmjd2b Member of a family of retinoblastoma-binding proteins which potentiate

pRb-mediated repression of E2F-regulated promoters (Gray et al., 2005)1438938_x_at 1.73 Phb2 Prohibitin 2. An inhibitor of cell proliferation (Tatsuta et al., 2005)1448496_a_at 1.58 Ing1 Negative regulator of cell cycle progression analogous to Ing5 (Garkavtsev et al.,

1996)

Promoters of G1/Stransition

1422535_at 0.53 Ccne2 Cyclin E2. A well known stimulator of entry into the S phase(Payton and Coats, 2002)

1435176_a_at 0.51 Id2 Transcription factor known as a positive regulator of cell proliferation and negativeregulator of cell differentiation, which causes inappropriate DNA synthesis inmeiotic cells when up-regulated in Ovol1-deficient mice (Li et al., 2005)

1433640_at 0.45 Fubp1 Transcription factor required for c-myc expression and cell proliferation(He et al., 2000)

1423635_at 0.37 Bmp2 Reported to stimulate spermatogonial proliferation (Puglisi et al., 2004)1448254_at 0.32 Ptn Pleiotropin. A known stimulator of spermatogonial proliferation essential for

spermatogenesis (Zhang et al., 1999)1451805_at 0.26 Phip Stimulator of insulin and Igf signaling (Farhang-Fallah et al., 2002)1458994_at 0.16 Csnk1g3 Casein kinase isoform whose yeast homologs are essential for cell growth

(Zhai et al., 1995)

Promoters of G2/Mtransition

1450073_at 2.45 Kif3b Kinesin family member important for the proper progression of mitosis(Haraguchi et al., 2006)

1419092_a_at 2.31 Slk Required for progression through G2 upstream of H1 kinase activation(O’Reilly et al., 2005)

1432043_at 2.16 Smu1 Involved directly or indirectly in activation of cdc2 kinase (cdk1), and spindleassembly (Sugaya et al., 2005)

1427679_at 2.15 Lats1 Promoter of mitotic exit (Bothos et al., 2005)1419943_s_at 1.77 Ccnb1 Cyclin B1. A well known inducer of the M phase (Takizawa and Morgan, 2000)1448000_at 1.72 Cdca3

(Tome-1)A cytosolic protein required for proper activation of cdk1/cyclin B and mitotic entry(Ayad et al., 2003)

4 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Table 2Control of differentiation and meiotic entry

Functionalgroups of genes

Target ID Fold changevs. control

Genesymbol

Description and functional notes

Early meioticmarkers

1459672_at 4.25 Top1 DNA topoisomerase 1. Expressed spermatogonia and spermatocytes, with thehighest levels in lepto-zygotene (Cobb et al., 1997). Localized in the nuclei of meioticcells in C. elegans (Lee et al., 2001)

1434588_x_at 3.17 Tbca Tubulin cofactor a. Involved in beta-tubulin folding. Abundant in testis, it isprogressively up-regulated from the onset of meiosis through spermiogenesis(Fanarraga et al., 1999)

1432386_a_at 2.51 Phf7 PHD finger protein 7, also called Nyd-sp6. A transcription factor highly expressedin the human testis, and absent in spermatocytic arrest (Xiao et al., 2002). One ofthe most differentially expressed genes between spermatocytes and spermatogonia inmice (Rossi et al., 2004)

1425641_at 2.48 Aff1 AF4/FMR2 family, member 1, also called AF5q31, Af4, Rob, Mllt2h, Alf4. Atranscriptional regulator essential for male germ cell differentiation and survival(Urano et al., 2005)

1418466_at 2.34 Rnf141 Ring finger protein 141, also called Zfp36 or Znf230. Abundant in the human testisand absent in azoospermic patients (Zhang et al., 2001). First detected at day 6 afterbirth in the mouse testis, it reachs adult levels between day 14 and 21 (Qiu et al.,2003)

1432230_at 2.25 Hip1 Huntingtin interacting protein 1. A protein required for differentiation,proliferation, and/or survival of spermatogenic progenitors (Rao et al., 2001)

1436354_at 2.18 Dzip1l DAZ interacting protein 1-like An homolog of Dzip1, a RNA binding proteinexpressed in pre-meiotic spermatogonia (Curry et al., 2006)

1452748_at 2.11 Xrcc3 X-ray repair complementing defective repair in Chinese hamster cells 3. A double-strand DNA break (DSB) repair enzyme member of the recA/Rad51 family, whichbinds to Rad51C, highly expressed in the mammalian testis (Dosanjh et al., 1998)

1442660_at 2.05 Ypel1 Yippee-like 1. A protein localized to the centrosome, the nucleolus and the mitoticapparatus. Highly expressed within the testis in meiotic cells (Hosono et al., 2004;Maratou et al., 2004)

1429923_x_at 2.02 Spata3 Spermatogenesis associated 3, also called Tsarg1 A testicular member of the DnaJ/HSP40 protein family, cloned by subtraction with cryptorchid testis (Yang et al.,2005)

1449912_at 1.90 Ssxb1 Synovial sarcoma, X member B, breakpoint 1. A X-linked gene showing tissue-restricted mRNA expression to testis (Chen et al., 2003)

1427300_at 1.88 Lhx8 LIM homeobox protein 8. Highly expressed only in the post-natal testis and in fetaloocytes, in which mRNA is detectable after meiotic entry (Ballow et al., 2006;Pangas et al., 2006)

1454263_at 1.86 Gscl Goosecoid-like. A transcription factor expressed in both PGCs and in the adulttestis (Galili et al., 2000)

1457708_at 1.85 Mbd4 Methyl-CpG binding domain protein 4. Possibly involved in DNA mismatch repairor in gene silencing imposed by methylated DNA. Expressed in fetal gonads andadult testis (Fukushige et al., 2006)

1453612_at 1.81 Nek1 NIMA-never in mitosis gene a-related expressed kinase 1. A kinase possiblyinvolved early in the DNA damage response. In the testis is expressed at thebeginning of the meiotic phase (Arama et al., 1998; Letwin et al., 1992). Essential formale fertility (Upadhya et al., 2000)

1426557_at 1.77 Mesp1 Mesoderm posterior 1. A spermatocyte-specific transcription factor absent inspermatogonia (Rossi et al., 2004)

1455335_at 1.75 Xrcc2 X-ray repair complementing defective repair in Chinese hamster cells 2. DSB repairenzyme member of the recA/RAD51 family, highly expressed in the testis(Cartwright et al., 1998)

1456729_x_at 1.73 Rtel1 Regulator of telomere elongation helicase 1. An essential gene that regulatestelomere length and prevents genetic instability. Highly expressed in the testis,mainly in the spermatogonia and spermatocytes, where it could prevent illegitimaterecombination in early meiosis (Ding et al., 2004)

1427498_a_at 1.66 Spag5 Sperm associated antigen 5. A microtubule-binding protein found in the mitoticspindle (also called Deepest, MAP126, Mastrin, Astrin). It starts to be expressed inthe testis when meiosis begins (Shao et al., 2001)

Spermatogonialmarkers

1428639_at 0.58 Lin9 Required for the expression of the spermatogonial marker B-Myb (Latham et al.,1996; Pilkinton et al., 2007)

1422655_at 0.57 Ptch2 Patched homolog 2. A receptor for sonic hedgehog, expressed in spermatogonia,and at lower levels in spermatocytes (Szczepny et al., 2006)

(continued on next page)

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 5

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

[no specific references are given for these genes, sincedescription of their metabolic function can be found inthe free databases at the link http://www.informat-ics.jax.org]. The KL-mediated down-regulation of theexpression of several metabolic genes in spermatogonia isan. apparent paradox for the action of a growth factor,since these genes encode for proteins involved in nutrienttransport (amino acids, oxygen, glucose), nucleotide andprotein biosynthesis and energy production through theKrebs cycle and the respiratory chain. However, it is wor-thy to remind that starvation from nitrogen and carbonnutrient sources is the environmental signal which inducesthe switch from the mitotic to the meiotic cell cycle in yeast.

Indeed, in S. cerevisiae, nutritional signaling pathways con-verge on transcriptional activation of the Ime1 gene, whichencodes a transcription factor that, in turn, triggers initia-tion of meiosis, by turning off the expression of genesrequired for the mitotic cell cycle, while activating theexpression of other genes which are crucial for executionof the meiotic program (Kassir et al., 2003). Thus, it istempting to speculate that one of the effects of KL/kitinteraction in differentiating spermatogonia is to establishprogressively, during their mitotic divisions, a sort ofendogenous state of nutritional stress, which might be theancestrally inherited trigger for transcription of a mastertranscriptional regulator of meiosis.

Table 2 (continued)

Functionalgroups of genes

Target ID Fold changevs. control

Genesymbol

Description and functional notes

1436549_a_at 0.54 Hnrpa1 RNA binding protein expressed in the fetal testis but not in the fetal ovary. Afterbirth it is highly expressed only in early spermatogonia (Kamma et al., 1995)

1434458_at 0.52 Fst Follistatin. An activin-binding protein located in type B spermatogonia, andprimary spermatocytes, with the exception of the late leptotene and early zygotenestages (Meinhardt et al., 1998)

1421700_at 0.50 Tex16 Testis expressed gene 16, an X-linked spermatogonial marker (Wang et al., 2001)1436329_at 0.49 Egr3 Transcription factor specific for early A spermatogonia (Hamra et al., 2004)1448460_at 0.48 Acvr1 Activin A receptor, type 1, also called Alk2 or ActRIA. Expressed in PGCs and in

mouse spermatogonia (Puglisi et al., 2004), in which activin is bound with higherintensity with respect to leptotene or zygotene spermatocytes (Woodruff et al., 1992)

1438921_at 0.45 Atr Ataxia telangiectasia and rad3 related). A DNA damage checkpoint protein.Expressed in all germ cell types with exception of the early meiotic stages(Bellani et al., 2005)

1427682_a_at 0.39 Egr2 Transcription factor highly expressed in type A and B spermatogonia anddownregulated in preleptotene spermatocytes (Guo et al., 2004)

1439949_at 0.34 Gsk3b In mice, it is expressed in type B spermatogonia and pre-leptotene spermatocytesand is down-regulated upon meiotic entry in both mice and rats (Guo et al., 2003)

1419012_at 0.24 Zfpm2 Zinc finger protein, also called Fog-2, which is expressed in the newborn mousetestis in gonocytes and disappears after the first week of testicular development(Ketola et al., 2002)

1457582_at 0.18 Uty Ubiquitously expressed Y-linked gene encoding a histocompatibility antigen, whichis not expressed in differentiating germ cells of the adult testis (Warren et al., 2000)

1417262_at 0.17 Ptgs2 Prostaglandin-endoperoxide synthase 2, also known as Cox-2. Its expression in rattestis has been primarily localized in spermatogonial cells (Neeraja et al., 2003). It isnot expressed in the adult human testis, but strongly up-regulated in testicularcancer (Hase et al., 2003)

1441854_at 0.13 Pole DNA polymerase epsilon. Detectable in mitotically proliferating spermatogonia butnot in the early stages of meiotic prophase (Kamel et al., 1997)

1443831_s_at 0.13 Mtl5(Tesmin)

Testis-specific gene, whose transcription starts to accumulate in 8-day-old mousegerm cells (Sugihara et al., 1999), and is detectable postnatally in all stages ofmeiotic prophase I except preleptonema and leptonema (Olesen et al., 2004)

Late meiotic andpost-meioticmarkers

1434229_a_at 0.62 Polb DNA polymerase beta, a DNA repair enzyme in pachytene spermatocytes and postmeiotic male mouse germ cells (Hirose et al., 1989)

1437693_at 0.62 D1Pas1 Expressed in pachytene spermatocytes and haploid cells, in which it replaces thespermatogonial and early meiotic expression of the homologous Y-linked Dby -Ddzx3 gene (Session et al., 2001)

1437313_x_at 0.58 Hmgb2 Highly expressed in pachytene spermatocytes and early spermatids. Its disruptioncauses sterility in male mice (Ronfani et al., 2001)

1441948_x_at 0.54 Zfand3,Tex27

Also called Tex27. A postmeiotic germ cell marker (de Luis et al., 1999)

1440500_at 0.53 Map3k10 Also called mixed lineage kinase (Mlk2), expressed in late pachytene spermatocytesand spermatids (Phelan et al., 1999)

1419772_at 0.15 Mllt10 Myeloid/lymphoid or mixed lineage-leukemia translocation to 10 homolog), highlyexpressed in the testis in postmeiotic cells ( Linder et al., 1998)

6 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

1.4. Growth factors, receptors, nucleic acid binding proteins

and signal transducers

This wide category of genes is summarized in Table 4[references are given only for genes playing a known orpotential role in the spermatogenic process; in the othercases, references can be found in the free databases at thelink http://www.informatics.jax.org].

An interesting information coming from this set of datais that KL, which is known as a mitogenic and survival fac-tor for differentiating spermatogonia (Rossi et al., 1993;Dolci et al., 2001) up-regulates the expression of ligandsand receptors of the Tnf superfamily that might beinvolved in regulating the number of germ cells enteringthe first wave of spermatogenesis, which is characterizedby an early and massive wave of apoptosis in the spermato-cyte compartment (Rodriguez et al., 1997). The inductionof Plzf, a known marker of spermatogonial stem cells(Buaas et al., 2004; Costoya et al., 2004), is in apparentconflict with the above described pro-differentiative patternof gene expression set up by KL treatment of spermatogo-nia. Indeed, Plzf is expressed in gonocytes, and in undiffer-entiated spermatogonia, but it is thought not to beexpressed in kit positive spermatogonia in the adult testis(Oatley et al., 2006). However, Plzf is co-expressed withkit in a subset of spermatogonial stem cells during the firstwave of spermatogenesis (Naughton et al., 2006). More-over, recent data in our laboratory indicate that one ofthe mechanisms through which Plzf maintains the stem cellphenotype is the suppression of kit expression (Filipponiet al., 2007). Thus, Plzf induction by KL in Plzf/kitco-expressing spermatogonia during the first wave of sper-

matogenesis might contribute to the definitive cessation ofkit expression in these cells, which is required to establishthe pool of spermatogonial stem cells in the adult testis(Naughton et al., 2006). Another possibility is that a tran-sient Plzf induction by KL in differentiating spermatogoniamight contribute to the cessation of kit expression which isknown to occur at the onset of meiosis (Sorrentino et al.,1991). Finally, among the list of KL down-regulated genesencoding nucleic acid binding proteins, we noticed the geneencoding the RNA binding protein Rod1, which might beinvolved in the negative control of meiosis. Indeed, theRod1 homolog gene in the fission yeast Schizosaccharomy-

ces pombe [nrd1(+)] negatively regulates the onset of mei-otic differentiation (its biological role is to blockdifferentiation by repressing a subset of the Ste11-regulatedgenes, essential for conjugation and meiosis until the cellsreach a critical level of nutrient starvation). Interestingly,mammalian Rod1 can complement yeast nrd1 defects(Yamamoto et al., 1999).

1.5. Concluding remarks

One should consider that, in view of the fact that after24 h of culture the difference in the percentage of apoptoticcells between KL-treated and. untreated cells is 17% vs.38% (Dolci et al., 2001), the possibility exists that changesof gene expression levels that we observed could beascribed at least in part to variation of the relative contentof live vs. apoptotic cells in KL-treated and untreated cells.Indeed, we did not perform treatments longer than 24 h,since the high rate of apoptosis in control cells would haveimpaired the significance of the changes in the pattern of

Table 3Metabolism

Functionalgroups of genes

Target ID Fold changevs. control

Genesymbol

Description and functional notes

Nucleotidebiosynthesis

1439012_a_at 0.64 Dck Involved in purine and pyrimidine biosynthesis1416319_at 0.60 Adk Involved in purine and pyrimidine biosynthesis1435277_x_at 0.32 Nme1 Involved in purine and pyrimidine biosynthesis1442353_at 0.30 Itpa Involved in purine and pyrimidine biosynthesis

Metabolitetransport

1434897_a_at 0.62 Slc25a4 Intramitochondrial transporter1437052_s_at 0.62 Slc2a3 Glucose transporter1454622_at 0.57 Slc38a5 Transporter for both oxygen and amino acids1420504_at 0.41 Slc6a14 Amino acid transporter1437069_at 0.41 Osbpl8 Oxysterol binding protein-like 8. Involved in lipid transport and steroid metabolism

Energyproduction

1423159_at 0.60 Dld Part of the of the energy-transfer system of the respiratory chain1451084_at 0.59 Etfdh Part of the of the energy-transfer system of the respiratory chain1422478_a_at 0.58 Acas2 Enzyme which produces acetyl-CoA mainly for the oxidation of acetate1423747_a_at 0.53 Pdk1 A pyruvate dehydrogenase kinase isoform known to be repressed under starvation1456573_x_at 0.46 Nnt Part of the of the energy-transfer system of the respiratory chain1423621_a_at 0.42 Slc33a1 Acetyl-CoA transporter1422500_at 0.42 Idh3a Isocitrate dehydrogenase 3 (NAD+) alpha. A key enzyme which catalyze the allosterically

regulated rate-limiting step of the tricarboxylic acid cycle, required to utilize acetate as acarbon source

1416617_at 0.29 Acas2l Enzyme which produces acetyl-CoA mainly for the oxidation of acetate

Proteinsynthesis

1429317_at 0.41 Qrsl1 Glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1. Involved in proteinbiosynthesis

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 7

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Table 4Growth factors, receptors, nucleic acid binding proteins and signal transducers

Functionalgroups of genes

Target ID Fold changevs. control

Genesymbol

Description and functional notes

Nucleic acidbindingproteins

1457177_at 6.91 Rora RAR-related orphan receptor alpha. A nuclear receptor activated by stress (hypoxia) andbinding cholesterol derivatives (Jakel et al., 2006). Strongly expressed in the mouse testisin cells at the periphery of seminiferous tubules (Steinmayr et al., 1998)

1427638_at 1.64 Zbtb16(Plzf)

Transcription factor co-expressed with Oct4 in gonocytes and undifferentiatedspermatogonia, whose knock-out causes stem cell depletion in the testis (Buaas et al.,2004; Costoya et al., 2004)

1449978_at 1.59 Zfy2 Y-linked zinc finger protein1420759_s_at 0.60 Zfy1 Y-linked zinc finger protein1424084_at 0.35 Rod1 Regulator of differentiation 1. A RNA binding protein, whose homolog in the fission

yeast S. pombe negatively regulates the onset of meiotic differentiation(Yamamoto et al., 1999)

Growth factorsand cytokines

1417936_at 9.19 Ccl9 Chemokine (C–C motif) ligand 9, also called MIP-1 gamma. A cytokine which shares thesame receptors with Ccl3 (MIP 1-alpha), which increases in vitro DNA synthesis of typeA1–A4 spermatogonia and of pre-leptotene spermatocytes but inhibits DNA synthesis inintermediate and type B spermatogonia (Hakovirta et al., 1994)

1459913_at 2.63 Tnfsf10 Tumor necrosis factor (ligand) superfamily, member 10, also called Tl2, or Trail, orApo-2L. Expressed in all human and rat testicular cells (Grataroli et al., 2002), it inducesapoptosis in germ cells, specifically spermatocytes, (McKee et al., 2006)

1459947_at 2.09 Bmp6 An oocyte-secreted growth factor (Hussein et al., 2005)1439959_at 0.62 Fgf11 Growth factor of the FGF family1419123_a_at 0.62 Pdgfc Growth factor of the PDGF family1437270_a_at 0.47 Clcf1 Cardiotrophin-like cytokine factor 1. A gp-130 ligand of the IL-6 family, which have been

proposed as inhibitors of transition into meiosis in the fetal testis trough in vitro studies(Chuma and Nakatsuji, 2001)

Receptors 1446875_at 12.43 Il1rapl2 Interleukin 1 receptor accessory protein-like 2. A X-linked gene also called IL-1R9,IL1R9, TIGIRR-1

1455689_at 3.12 Fzd10 Frizzled homolog 10. A receptor for ligands of the WNT family of signaling proteins1440085_at 2.00 Eda2r Ectodysplasin A2 isoform receptor, also called Xedar (X linked ectodysplasin receptor).

A tumor necrosis factor (Tnf) receptor superfamily member1449149_at 1.94 Traf3 Tnf receptor-associated factor 3, a co-receptor of the Tnf family1448167_at 0.56 Ifngr1 An interferon gamma receptor1429216_at 0.56 Paqr3 Progestin and adipoQ receptor family member III. A membrane progesterone receptor1418723_at 0.53 Edg7 Member of family I of the G protein-coupled receptors functioning as a lysophosphatidic

acid (LPA) receptor and contributing to Ca2+ mobilization1442291_at 0.43 Edg4 Member of family I of the G protein-coupled receptors functioning as a lysophosphatidic

acid (LPA) receptor and contributing to Ca2+ mobilization

Signaltransducers

1424881_at 2.58 Trib1 Tribbles homolog 1. It is the homolog of a cell cycle regulator which affects the number ofgerm cell divisions as well as oocyte determination in Drosophila (Mata et al., 2000)

1417784_at 2.52 Als2 A Rho/Rab/Rac activator which plays an anti-apoptotic role in neuronal cells1420539_a_at 2.50 Chrdl2 Chordin-like 2. A regulator of BMP signaling1439467_at 2.40 Mtap4 Microtubule-associated protein 4. Involved in the changes in microtubule dynamics or

function that are known to accompany differentiation1455297_at 2.32 Spin2 Spindlin family, member 2—spindlin-like. A X-linked gene, cloned through a functional

retroviral cDNA library-based screen to identify genes that prevent growth factorwithdrawal-mediated apoptosis (Fletcher et al., 2002)

1418332_a_at 1.86 Agtpbp1 ATP/GTP binding protein 1, also called Pcd (Purkinje cell degeneration) or Nna1. A geneessential for normal spermatogenesis (Fernandez-Gonzalez et al., 2002)

1435647_at 1.70 Ikbkg Inhibitor of kappaB kinase gamma. An inhibitor of TNF-induced apoptosis1460304_a_at 1.55 Ubtf Upstream binding transcription factor, RNA polymerase I. A transcription factor

downregulaed by Gsk3b in myeloid cells1423389_at 0.58 Smad7 An inhibitor of signaling from TGF-beta family members1423176_at 0.57 Tob1 Transducer of ErbB-2.1. A negative regulator of BMP signaling1423350_at 0.49 Socs5 Negative regulator of kit signaling1450870_at 0.48 Rala V-ral simian leukemia viral oncogene homolog A—ras related. An activator of PLD,

which is activated in response to mitogenic stimulation1425514_at 0.34 Pik3r1 Phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1. Also called Grb1 or p85

alpha, it is the regulatory subunit of PI3 kinase and the mediator of tyrosine-kinase-mediated PI3K signaling

8 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

gene expression. However, if the changes in the pattern ofgene expression after a 24 h incubation depended just onthe variation in the proportion of live cells between KL-treated and untreated samples, one would expect a wide-spread variation in gene expression, whereas we found that80% of expressed genes (i.e. those with a P detectionparameter) did not show quantitative variations after KLtreatment. Moreover, we had previously performed preli-minary duplicate microarray experiments, using different,less representative, Affymetrix gene chips (MG-U74A),after a KL treatment of only 4 h, a time at which no changein the rate of live vs. apoptotic cells in control vs. KL-trea-ted cells is observed (see the third file in the Supplementarydata). As expected, using a 1.5-fold change threshold, wecould not detect significant changes in the rate of geneexpression after such a short incubation time for most ofthe 12,500 genes represented in these arrays. However, ina retrospective analysis, we have compared these data withthe results obtained with the 24 h treatment. When consid-ering the absolute values, we noticed that a 4 h KL treat-ment induces an increase for some of the genes that weclassified as G1/S inhibitors (Btg4, fold change vs.control:3.44), meiotic markers (Top1: 1.37; Phf7: 1.50; Lhx8: 1.47;Nek1: 2.52) and transcription factors (Rora: 3.44), and adecrease for some of the genes that we classified as signaltransducers (Rala: 0.49) and spermatogonial markers(Egr2: 0.72; Lin9: 0.65). Thus, the trend of the changes inthe pattern of gene expression which is observed after24 h of culture is already present after a short-time incuba-tion with KL.

Overall, the present study suggests that the soluble formof KL, beside being a positive regulator of cell divisionsand survival in kit expressing type A spermatogonia, alsomodifies the characteristics of their cell cycle and stimulatestheir entry into the meiotic program. Even though furtherstudies, extended at the post-transcriptional and proteomelevel, are required to fully evaluate the effects of KL stim-ulation in spermatogonia, this transcriptome analysis sug-gest that KL plays an important and direct role in malegerm cell differentiation that leads to the establishment ofspermatogenesis.

2. Experimental procedures

2.1. Isolation and culture of spermatogonia

Germ cell populations highly enriched in mitotic spermatogonia wereobtained as previously described from testes of 7-day-old mice (Rossiet al., 1993; Pellegrini et al., 2003; Dolci et al., 2001; Rossi et al., 2004).Briefly, germ cell suspensions were obtained by sequential collagenase–hyaluronidase–trypsin digestions of freshly withdrawn testes. A 3 h periodof culture in E-MEM additioned with 10% FCS was performed to facili-tate adhesion of contaminating somatic cells to the plastic dishes. At theend of this pre-plating treatment, enriched mitotic germ cell suspensionswere rinsed from FCS and incubated for 24 h in the presence or absenceof 100 ng/ml soluble KL (R&D Systems, Minneapolis, MN), or 100 ng/ml Bmp4 (R&D Systems, Minneapolis, MN), or 0.3 lM ATRA (SigmaAldrich, Milan, Italy). Purity of 7 dpn spermatogonia was about 90% afterthe pre-plating treatment, and 95% after 24 h of culture. The homogeneity

of the cell populations was assessed through both morphological criteriaand by specific immunostaining with antibodies directed against three spe-cific markers of mitotic germ cells, which are not expressed in testicularsomatic cells (Smad5, Alk3 and kit), as described previously (Pellegriniet al., 2003).

2.2. RNA extraction, cDNA and cRNA preparation

Total RNA was extracted using TRIzol Reagent (Gibco), followed byclean up on RNeasy mini/midi columns (RNeasy Mini/Midi Kit, Qiagen).For each cell treatment (control, KL, Bmp4 and ATRA) two separateRNA pools were prepared, each of which was obtained from cell prepara-tions from two separate cultures. Biotin-labelled cRNA targets were syn-thesized starting from 5 lg of total RNA. Double stranded cDNAsynthesis was performed with GIBCO SuperScript Custom cDNA Synthe-sis Kit, and biotin-labelled antisense RNA was transcribed in vitro usingAmbion’s In Vitro Transcription System, including Bio-11-UTP andBio-11-CTP (NEN Life Sciences, PerkinElmer Inc., Boston, Massachu-setts, USA) in the reaction. All steps of the labelling protocol were per-formed as suggested by Affymetrix (http://www.affymetrix.com/support/technical/manual/expression_manual.affx).

The size and the accuracy of quantitation of targets were checked byagarose gel electrophoresis of 2 lg aliquots, prior to and after fragmenta-tion. After fragmentation, targets were diluted in hybridisation buffer at aconcentration of 150 lg/ml.

2.3. DNA microarray hybridization

Hybridization mix for target dilution (100 mM MES, 1 M [Na+],20 mM EDTA, 0.01% Tween 20) was prepared as indicated by Affymetrix,including pre-mixed biotin-labelled control oligo B2 and bioB, bioC, bioDand cre controls (Affymetrix cat #900299) at a final concentration of50 pM, 1.5 pM, 5 pM, 25 pM and 100 pM, respectively. Targets werediluted in hybridization buffer at a concentration of 150 lg/ml and dena-tured at 99 �C prior to introduction into the GeneChip cartridge. A singleGeneChipMOE430 v2.0 was then hybridized with each biotin-labelled tar-get. For each of the four experimental conditions tested (control, KL,Bmp4, ATRA), two GeneChipMOE430 v2.0 were used for a total numberof 8 GeneChip arrays.

Hybridizations were performed for 16 h at 45 �C in a rotisserie oven.GeneChip cartridges were washed and stained in the Affymetrix fluidicsstation following the EukGE-WS2 standard protocol (including AntibodyAmplification), including the following steps: (1) (wash) 10 cycles of 2mixes/cycle with Wash Buffer A (6X SSPE, 0.01% Tween 20) at 25 �C;(2) (wash) 4 cycles of 15 mixes/cycle with Wash Buffer B (100 mMMES, 0.1 M [Na+], 0.01% Tween 20) at 50 �C; (3) staining of the probearray for 10 min in SAPE solution (10 lg/mL SAPE in 100 mM MES,1 M [Na+], 0.05% Tween 20, 2 mg/mL BSA) at 25 �C; (4) (wash) 10 cyclesof 4 mixes/cycle with Wash Buffer A at 25 �C; (5) staining of the probearray for 10 min in antibody solution (Normal Goat IgG 0.1 mg/mL;(6) addition of the biotinylated antibody 3 lg/mL, 100 mM MES, 1 M[Na+], 0.05% Tween 20, 2 mg/mL BSA) at 25 �C; (7) staining of the probearray for 10 min in SAPE solution at 25 �C; (8) (final wash) 15 cycles of 4mixes/cycle with Wash Buffer A at 30 �C.

2.4. Scanning and bioinformatic analysis

Images were scanned using an Affymetrix GeneChip Scanner3000 7G,using default parameters. The resulting images were analysed using Gene-Chip Operating Software v1.2 (GCOS1.2).

‘‘Absolute analysis’’ was performed for each chip with GCOS1.2 soft-ware using default parameters, scaling signal intensity global trimmedmean of all images to a value of 500. Report files were extracted for eachchip, and performance of labelled targets was evaluated on the basis ofseveral values (scaling factor, background and noise values, % presentcalls, average signal value, etc.). Further data analysis was performedusing both GenePicker, a proprietary software developed by Giacomo

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 9

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Finocchiaro and Heiko Muller (http://bioinformatics.oxfordjournals.org/cgi/reprint/bth416v1) and GeneSpring GX v.7.3.1 (Agilent Technologies),a commercial software for analysis of microarrays data, with the followingcriteria.

2.4.1. GenePicker analysis

(1) Samples were compared two by two; signal intensity values fromfirst condition were compared to signal intensity values from second con-dition, for each of the four conditions; (2) in addition signal intensitiesfrom single condition were used for regulated genes selection; (3) startingfrom the complete list of probesets represented on the GeneChip arrays, afold change criteria was used to select probesets regulated; (4) transcriptsshowing both a regulation call from the GCOS algorithm (I or D forincrease and decrease) and a fold change higher that the cutoff value werepositively selected as being regulated. The cutoff value was set to 1.5.These list of regulated probesets, were furtherly refined by applying a sta-tistical parametric test, with p-value cutoff set to 0.05 without multipletesting correction.

2.4.2. GeneSpring analysis

(1) Starting from the list of all the probesets represented on the Gene-ChipMOE430 v2.0, an initial selection was performed based on the ‘‘Flag’’parameter generated by the GCOS software; (2) to avoid the selection offalse positives, a reduction of transcripts included in the starting genelistwas achieved, accordingly to the ‘‘flag’’ parameter associated with eachtranscript; (3) probesets showing a ‘‘Present’’ flag in both replicate of atleast one experimental condition were included in the genelist, thus reduc-ing the number of probesets (P in 2_2 either conditions); (4) starting fromthis genelist, each condition was compared to the others using normalizedexpression values and setting the fold change cutoff to 1.5, providing sev-eral genelists of regulated probesets. These list of regulated probesets, werefurther refined by applying a statistical parametric test, with variances notassumed to be equal (Welch t-test) and p-value cutoff set to 0.05 withoutmultiple testing correction.

2.5. RT-PCR analysis

RT-PCR amplification of selected mRNAs (shown in Fig. 1), was per-formed by using specific oligonucleotide primers designed on the basis ofthe sequence of the corresponding Affymetrix target genes. Specificity ofthe primers was previously controlled through BLAST analysis (http://www.ncbi.nlm.nih.gov/blast/). The full list of the primers used follows:

Ccl9: ATGGCTTGGTGGTTAAGAGCACC (Forward); ACCAGACACATTCCAAAGTCCCA (Reverse). Amplification product 300 bpLhx8: GTCTGGAGATAGTTGGCTCGAGT (Forward); GGATGGTAGGCTTTGTAAACTAG (Reverse). Amplification product 357 bpRnf141: TGCTGTTGTCTGTCATACCTTAG (Forward); TAGGTAAGCACTCTACCAACTGA (Reverse). Amplification product 382 bpTop1: GTAACAGCTATAGCACCGGAGTG (Forward); CTCCTCCAAATAAGTCAAGAGTG (Reverse). Amplification product 284 bpRora: CTGCAATGTTCTCAGAGCTCCAG (Forward); CCACACCCTCACATAACAGTCCT (Reverse). Amplification product 283 bpXrcc3: ATCCAGGCTGGAAGGCACCACAA (Forward); CCTGGTTTAAGGAGTCAGACACT (Reverse). Amplification product 264 bpPlzf: AGTTCAGCCTCAAGCACCAGTTG (Forward); GTAGAGGTACGTCTTCTCTATCC (Reverse). Amplification product 263 bpBtg4: AAGCATTTGGCAGATGGTCGTGG (Forward); TGTGCTCACATTCCTGAAGCAGG (Reverse). Amplification product 252 bpSpin2: GTACATGTATCAGCTTCTGGATG (Forward); ATGAAGTACACAGAAGGCTTGGC (Reverse). Amplification product207 bpDzip1l: GTGAACAATCTAGACAATCCCTC (Forward); AAGAGGCTTCATCCAGATTGCTC (Reverse). Amplification product 222 bpGsk3b: TTCCTGCTGACACACGATGGAGC (Forward); TCCATTCCCACTTGGAAAGTATC (Reverse). Amplification product 284 bpPhip: GTAATTTCCTGATGTTATCTGCA (Forward); TTTCCTTGTTATAAGAGAGATGG (Reverse). Amplification product 190 bp

Acknowledgements

This work has been supported by a Grant from MiURto P.R. (Prin 2005: ‘‘Interazione spermatozoo-ovocito: stu-dio dei meccanismi della chemotassi nemaspermica e dellaattivazione ovocitaria’’), and by a Grant of ‘‘Centro diEccellenza per lo Studio del Rischio Genomico in PatologieComplesse Multifattoriali’’ to R.G.

We thank Simone Paolo Minardi (IFOM, FondazioneIstituto FIRC di Oncologia Molecolare, Milan, Italy) forhis contribution to the description of the methods of micro-array data analysis.

Appendix A. Supplementary data

Supplementary data associated with this article can befound, in the online version, at doi:10.1016/j.modgep.2007.10.007.

References

Arama, E., Yanai, A., Kilfin, G., Bernstein, A., Motro, B., 1998. MurineNIMA-related kinases are expressed in patterns suggesting distinctfunctions in gametogenesis and a role in the nervous system. Oncogene16, 1813–1823.

Archer, J.E., Vega, L.R., Solomon, F., 1995. Rbl2p, a yeast protein thatbinds to beta-tubulin and participates in microtubule function in vivo.Cell 82, 425–434.

Augustin, A., Spenlehauer, C., Dumond, H., Menissier-De Murcia, J.,Piel, M., Schmit, A.C., Apiou, F., Vonesch, J.L., Kock, M., Bornens,M., De Murcia, G., 2003. PARP-3 localizes preferentially to thedaughter centriole and interferes with the G1/S cell cycle progression.J. Cell Sci. 116, 1551–1562.

Ayad, N.G., Rankin, S., Murakami, M., Jebanathirajah, J., Gygi, S.,Kirschner, M.W., 2003. Tome-1, a trigger of mitotic entry, is degradedduring G1 via the APC. Cell 113, 101–113.

Ballow, D., Meistrich, M.L., Matzuk, M., Rajkovic, A., 2006. Sohlh1 isessential for spermatogonial differentiation. Dev. Biol. 294, 161–167.

Bellani, M.A., Romanienko, P.J., Cairatti, D.A., Camerini-Otero, R.D.,2005. SPO11 is required for sex-body formation, and Spo11 hetero-zygosity rescues the prophase arrest of Atm�/� spermatocytes. J. CellSci. 118, 3233–3245.

Bleuyard, J.Y., White, C.I., 2004. The Arabidopsis homologue of Xrcc3plays an essential role in meiosis. EMBO J. 23, 439–449.

Blume-Jensen, P., Jiang, G., Hyman, R., Lee, K.F., O’Gorman, S.,Hunter, T., 2000. Kit/stem cell factor receptor-induced activation ofphosphatidylinositol 3’-kinase is essential for male fertility. Nat.Genet. 24, 157–162.

Bothos, J., Tuttle, R.L., Ottey, M., Luca, F.C., Halazonetis, T.D., 2005.Human LATS1 is a mitotic exit network kinase. Cancer Res. 65, 6568–6575.

Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S.,Yashiro, K., Chawengsaksophak, K., Wilson, M.J., Rossant, J.,Hamada, H., Koopman, P., 2006. Retinoid signaling determines germcell fate in mice. Science 312, 596–600.

Buaas, F.W., Kirsh, A.L., Sharma, M., McLean, D.J., Morris, J.L.,Griswold, M.D., de Rooij, D.G., Braun, R.E., 2004. Plzf is required inadult male germ cells for stem cell self-renewal. Nat. Genet. 36, 647–652.

Buanne, P., Corrente, G., Micheli, L., Palena, A., Lavia, P., Spadafora,C., Lakshmana, M.K., Rinaldi, A., Banfi, S., Quarto, M., Bulfone, A.,Tirone, F., 2000. Cloning of PC3B, a novel member of the PC3/BTG/TOB family of growth inhibitory genes, highly expressed in theolfactory epithelium. Genomics 68, 253–263.

10 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Cartwright, R., Tambini, C.E., Simpson, P.J., Thacker, J., 1998. TheXRCC2 DNA repair gene from human and mouse encodes a novelmember of the recA/RAD51 family. Nucleic Acids Res. 26, 3084–3089.

Chen, Y.T., Alpen, B., Ono, T., Gure, A.O., Scanlan, M.A., Biggs 3rd,W.H., Arden, K., Nakayama, E., Old, L.J., 2003. Identification andcharacterization of mouse SSX genes: a multigene family on the Xchromosome with restricted cancer/testis expression. Genomics 82,628–636.

Chuma, S., Nakatsuji, N., 2001. Autonomous transition into meiosis ofmouse fetal germ cells in vitro and its inhibition by gp130-mediatedsignaling. Dev. Biol. 229, 468–479.

Cobb, J., Reddy, R.K., Park, C., Handel, M.A., 1997. Analysis ofexpression and function of topoisomerase I and II during meiosis inmale mice. Mol. Reprod. Dev. 46, 489–498.

Costoya, J.A., Hobbs, R.M., Barna, M., Cattoretti, G., Manova, K.,Sukhwani, M., Orwig, K.E., Wolgemuth, D.J., Pandolfi, P.P., 2004.Essential role of Plzf in maintenance of spermatogonial stem cells. Nat.Genet. 36, 653–659.

Curry, B.J., Holt, J.E., McLaughlin, E.A., Aitken, R.J., 2006. Character-ization of structure and expression of the Dzip1 gene in the rat andmouse. Genomics 87, 275–285.

de Luis, O., Lopez-Fernandez, L.A., del Mazo, J., 1999. Tex27, a genecontaining a zinc-finger domain, is up-regulated during the haploidstages of spermatogenesis. Exp. Cell Res. 249, 320–326.

Ding, H., Schertzer, M., Wu, X., Gertsenstein, M., Selig, S., Kammori,M., Pourvali, R., Poon, S., Vulto, I., Chavez, E., Tam, P.P., Nagy,A., Lansdorp, P.M., 2004. Regulation of murine telomere length byRtel: an essential gene encoding a helicase-like protein. Cell 117, 873–886.

Dolci, S., Pellegrini, M., Di Agostino, S., Geremia, R., Rossi, P., 2001.Signaling through extracellular signal-regulated kinase is required forspermatogonial proliferative response to stem cell factor. J. Biol.Chem. 276, 40225–40233.

Dosanjh, M.K., Collins, D.W., Fan, W., Lennon, G.G., Albala, J.S.,Shen, Z., Schild, D., 1998. Isolation and characterization of RAD51C,a new human member of the RAD51 family of related genes. NucleicAcids Res. 26, 1179–1184.

Dufresne, A.M., Smith, R.J., 2005. The adapter protein GRB10 is anendogenous negative regulator of insulin-like growth factor signaling.Endocrinology 146, 4399–4409.

Fanarraga, M.L., Parraga, M., Aloria, K., del Mazo, J., Avila, J., Zabala,J.C., 1999. Regulated expression of p14 (cofactor A) during sper-matogenesis. Cell Motil. Cytoskeleton 43, 243–254.

Farhang-Fallah, J., Randhawa, V.K., Nimnual, A., Klip, A., Bar-Sagi,D., Rozakis-Adcock, M., 2002. The pleckstrin homology (PH)domain-interacting protein couples the insulin receptor substrate 1PH domain to insulin signaling pathways leading to mitogenesis andGLUT4 translocation. Mol. Cell. Biol. 22, 7325–7336.

Fernandez-Gonzalez, A., La Spada, A.R., Treadaway, J., Higdon, J.C.,Harris, B.S., Sidman, R.L., Morgan, J.I., Zuo, J., 2002. Purkinje celldegeneration (pcd) phenotypes caused by mutations in the axotomy-induced gene, Nna1. Science 295, 1904–1906.

Filipponi, D., Hobbs, R.M., Ottolenghi, S., Rossi, P., Jannini, E.A.,Pandolfi, P.P., Dolci, S., 2007. Repression of kit expression by Plzf ingerm cells. Mol. Cell. Biol. 30 (Epub ahead of print).

Fletcher, B.S., Dragstedt, C., Notterpek, L., Nolan, G.P., 2002. Func-tional cloning of SPIN-2, a nuclear anti-apoptotic protein with roles incell cycle progression. Leukemia 16, 1507–1518.

Fukushige, S., Kondo, E., Gu, Z., Suzuki, H., Horii, A., 2006. RET fingerprotein enhances MBD2- and MBD4-dependent transcriptionalrepression. Biochem. Biophys. Res. Commun. 351, 85–92.

Galili, N., Nayak, S., Epstein, J.A., Buck, C.A., 2000. Rnf4, a RINGprotein expressed in the developing nervous and reproductive systems,interacts with Gscl, a gene within the DiGeorge critical region. Dev.Dyn. 218, 102–111.

Garkavtsev, I., Kazarov, A., Gudkov, A., Riabowol, K., 1996. Suppres-sion of the novel growth inhibitor p33ING1 promotes neoplastictransformation. Nat. Genet. 14, 415–420.

Grataroli, R., Vindrieux, D., Gougeon, A., Benahmed, M., 2002.Expression of tumor necrosis factor-alpha-related apoptosis-inducingligand and its receptors in rat testis during development. Biol. Reprod.66, 1707–1715.

Gray, S.G., Iglesias, A.H., Lizcano, F., Villanueva, R., Camelo, S., Jingu,H., The, B.T., Koibuchi, N., Chin, W.W., Kokkotou, E., Dangond, F.,2005. Functional characterization of JMJD2A, a histone deacetylase-and retinoblastoma-binding protein. J. Biol. Chem. 280, 28507–28518.

Guo, R., Yu, Z., Guan, J., Ge, Y., Ma, J., Li, S., Wang, S., Xue, S., Han,D., 2004. Stage-specific and tissue-specific expression characteristics ofdifferentially expressed genes during mouse spermatogenesis. Mol.Reprod. Dev. 67, 264–272.

Guo, T.B., Chan, K.C., Hakovirta, H., Xiao, Y., Toppari, J., Mitchell,A.P., Salameh, W.A., 2003. Evidence for a role of glycogen synthasekinase-3 beta in rodent spermatogenesis. J. Androl. 24, 332–342.

Hakovirta, H., Vierula, M., Wolpe, S.D., Parvinen, M., 1994. MIP-1alpha is a regulator of mitotic and meiotic DNA synthesis duringspermatogenesis. Mol. Cell. Endocrinol. 99, 119–124.

Hamra, F.K., Schultz, N., Chapman, K.M., Grellhesl, D.M., Cronkhite,J.T., Hammer, R.E., Garbers, D.L., 2004. Defining the spermatogonialstem cell. Dev. Biol. 269, 393–410.

Haraguchi, K., Hayashi, T., Jimbo, T., Yamamoto, T., Akiyama, T.,2006. Role of the kinesin-2 family protein, KIF3, during mitosis. J.Biol. Chem. 281, 4094–4099.

Hase, T., Yoshimura, R., Matsuyama, M., Kawahito, Y., Wada, S.,Tsuchida, K., Sano, H., Nakatani, T., 2003. Cyclooxygenase-1 and -2in human testicular tumours. Eur. J. Cancer 39, 2043–2049.

He, L., Liu, J., Collins, I., Sanford, S., O’Connell, B., Benham, C.J.,Levens, D., 2000. Loss of FBP function arrests cellular proliferationand extinguishes c-myc expression. EMBO J. 19, 1034–1044.

Hirose, F., Hotta, Y., Yamaguchi, M., Matsukage, A., 1989. Difference inthe expression level of DNA polymerase beta among mouse tissues:high expression in the pachytene spermatocyte. Exp. Cell Res. 181,169–180.

Hosono, K., Sasaki, T., Minoshima, S., Shimizu, N., 2004. Identificationand characterization of a novel gene family YPEL in a wide spectrumof eukaryotic species. Gene 340, 31–43.

Hurlin, P.J., Queva, C., Koskinen, P.J., Steingrimsson, E., Ayer, D.E.,Copeland, N.G., Jenkins, N.A., Eisenman, R.N., 1995. Mad3 andMad4: novel Max-interacting transcriptional repressors that suppressc-myc dependent transformation and are expressed during neural andepidermal differentiation. EMBO J. 14, 5646–5659.

Hussein, T.S., Froiland, D.A., Amato, F., Thompson, J.G., Gilchrist,R.B., 2005. Oocytes prevent cumulus cell apoptosis by maintaining amorphogenic paracrine gradient of bone morphogenetic proteins. J.Cell Sci. 118, 5257–5268.

Jakel, H., Fruchart-Najib, J., Fruchart, J.C., 2006. Retinoic acid receptor-related orphan receptor alpha as a therapeutic target in the treatmentof dyslipidemia and atherosclerosis. Drug News Perspect. 19, 91–97.

Kamel, D., Mackey, Z.B., Sjoblom, T., Walter, C.A., McCarrey, J.R.,Uitto, L., Palosaari, H., Lahdetie, J., Tomkinson, A.E., Syvaoja, J.E.,1997. Role of deoxyribonucleic acid polymerase epsilon in spermato-genesis in mice. Biol. Reprod. 57, 1367–1374.

Kamma, H., Portman, D.S., Dreyfuss, G., 1995. Cell type-specificexpression of hnRNP proteins. Exp. Cell Res. 221, 187–196.

Kassir, Y., Adir, N., Boger-Nadjar, E., Raviv, N.G., Rubin-Bejerano, I.,Sagee, S., Shenhar, G., 2003. Transcriptional regulation of meiosis inbudding yeast. Int. Rev. Cytol. 224, 111–171.

Ketola, I., Anttonen, M., Vaskivuo, T., Tapanainen, J.S., Toppari, J.,Heikinheimo, M., 2002. Developmental expression and spermatogenicstage specificity of transcription factors GATA-1 and GATA-4 andtheir cofactors FOG-1 and FOG-2 in the mouse testis. Eur. J.Endocrinol. 147, 397–406.

Kissel, H., Timokhina, I., Hardy, M.P., Rothschild, G., Tajima, Y.,Soares, V., Angeles, M., Whitlow, S.R., Manova, K., Besmer, P., 2000.Point mutation in kit receptor tyrosine kinase reveals essential roles forkit signaling in spermatogenesis and oogenesis without affecting otherkit responses. EMBO J. 19, 1312–1326.

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 11

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Koubova, J., Menke, D.B., Zhou, Q., Capel, B., Griswold, M.D., Page,D.C., 2006. Retinoic acid regulates sex-specific timing of meioticinitiation in mice. Proc. Natl. Acad. Sci. U SA 103, 2474–2479.

Latham, K.E., Litvin, J., Orth, J.M., Patel, B., Mettus, R., Reddy, E.P.,1996. Temporal patterns of A-myb and B-myb gene expression duringtestis development. Oncogene 13, 1161–1168.

Lee, M.H., Park, H., Shim, G., Lee, J., Koo, H.S., 2001. Regulation ofgene expression, cellular localization, and in vivo function of Caeno-rhabditis elegans DNA topoisomerase I. Genes Cells 6, 303–312.

Letwin, K., Mizzen, L., Motro, B., Ben-David, Y., Bernstein, A., Pawson,T., 1992. A mammalian dual specificity protein kinase, Nek1, is relatedto the NIMA cell cycle regulator and highly expressed in meiotic germcells. EMBO J. 11, 3521–3531.

Li, B., Nair, M., Mackay, D.R., Bilanchone, V., Hu, M., Fallahi, M.,Song, H., Dai, Q., Cohen, P.E., Dai, X., 2005. Ovol1 regulates meioticpachytene progression during spermatogenesis by repressing Id2expression. Development 132, 1463–1473.

Linder, B., Jones, L.K., Chaplin, T., Mohd-Sarip, A., Heinlein, U.A.,Young, B.D., Saha, V., 1998. Expression pattern and cellulardistribution of the murine homologue of AF10. Biochim. Biophys.Acta 1443, 285–296.

Liu, Y., Tarsounas, M., O’regan, P., West, S.C., 2007. Role of RAD51Cand XRCC3 in genetic recombination and DNA repair. J. Biol. Chem.282, 1973–1979.

Maratou, K., Forster, T., Costa, Y., Taggart, M., Speed, R.M., Ireland,J., Teague, P., Roy, D., Cooke, H.J., 2004. Expression profiling of thedeveloping testis in wild-type and Dazl knockout mice. Mol. Reprod.Dev. 67, 26–54.

Mata, J., Curado, S., Ephrussi, A., Rorth, P., 2000. Tribbles coordinatesmitosis and morphogenesis in Drosophila by regulating string/CDC25proteolysis. Cell 101, 511–522.

McKee, C.M., Ye, Y., Richburg, J.H., 2006. Testicular germ cellsensitivity to TRAIL-induced apoptosis is dependent upon p53expression and is synergistically enhanced by DR5 agonistic antibodytreatment. Apoptosis 11, 2237–2250.

Meinhardt, A., O’Bryan, M.K., McFarlane, J.R., Loveland, K.L.,Mallidis, C., Foulds, L.M., Phillips, D.J., de Kretser, D.M., 1998.Localization of follistatin in the rat testis. J. Reprod. Fertil. 112, 233–241.

Meng, X., Lindahl, M., Hyvonen, M.E., Parvinen, M., de Rooij, D.G.,Hess, M.W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H., Lakso,M., Pichel, J.G., Westphal, H., Saarma, M., Sariola, H., 2000.Regulation of cell fate decision of undifferentiated spermatogonia byGDNF. Science 287, 1489–1493.

Monesi, V., 1962. Autoradiographic study of DNA synthesis and the cellcycle in spermatogonia and spermatocytes of mouse testis usingtritiated thymidine. J. Cell Biol. 14, 1–18.

Mootha, V.K., Lindgren, C.M., Eriksson, K.F., Subramanian, A., Sihag,S., Lehar, J., Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E.,Houstis, N., Daly, M.J., Patterson, N., Mesirov, J.P., Golub, T.R.,Tamayo, P., Spiegelman, B., Lander, E.S., Hirschhorn, J.N., Altshuler,D., Groop, L.C., 2003. PGC-1alpha-responsive genes involved inoxidative phosphorylation are coordinately downregulated in humandiabetes. Nat. Genet. 34, 267–273.

Naughton, C.K., Jain, S., Strickland, A.M., Gupta, A., Milbrandt, J.,2006. Glial cell-line derived neurotrophic factor-mediated RETsignaling regulates spermatogonial stem cell fate. Biol. Reprod. 74,314–321.

Neeraja, S., Sreenath, A.S., Reddy, P.R., Reddanna, P., 2003. Expressionof cyclooxygenase-2 in rat testis. Reprod. Biomed. Online 6, 302–309.

Oatley, J.M., Avarbock, M.R., Telaranta, A.I., Fearon, D.T., Brinster,R.L., 2006. Identifying genes important for spermatogonial stem cellself-renewal and survival. Proc. Natl. Acad. Sci. USA 103, 9524–9529.

Olesen, C., Moller, M., Byskov, A.G., 2004. Tesmin transcription isregulated differently during male and female meiosis. Mol. Reprod.Dev. 67, 116–126.

O’Reilly, P.G., Wagner, S., Franks, D.J., Cailliau, K., Browaeys, E.,Dissous, C., Sabourin, L.A., 2005. The Ste20-like kinase SLK is

required for cell cycle progression through G2. J. Biol. Chem. 280,42383–42390.

Packer, A.I., Besmer, P., Bachvarova, R.F., 1995. Kit ligand mediatessurvival of type A spermatogonia and dividing spermatocytes inpostnatal mouse testes. Mol. Reprod. Dev. 42, 303–310.

Pangas, S.A., Choi, Y., Ballow, D.J., Zhao, Y., Westphal, H., Matzuk,M.M., Rajkovic, A., 2006. Oogenesis requires germ cell-specifictranscriptional regulators Sohlh1 and Lhx8. Proc. Natl. Acad. Sci.USA 103, 8090–8095.

Payton, M., Coats, S., 2002. Cyclin E2, the cycle continues. Int. J.Biochem. Cell Biol. 34, 315–320.

Pellegrini, M., Grimaldi, P., Rossi, P., Geremia, R., Dolci, S., 2003.Developmental expression of Bmp4/ALK3/SMAD5 signaling path-way in the mouse testis: a potential role of Bmp4 in spermatogoniadifferentiation. J. Cell Sci. 116, 3363–3372.

Phelan, D.R., Loveland, K.L., Devereux, L., Dorow, D.S., 1999.Expression of mixed lineage kinase 2 in germ cells of the testis. Mol.Reprod. Dev. 52, 135–140.

Pilkinton, M., Sandoval, R., Song, J., Ness, S.A., Colamonici, O.R., 2007.Mip/LIN-9 regulates the expression of B-Myb and the induction ofcyclin A, cyclin B, and CDK1. J. Biol. Chem. 282, 168–175.

Prabhu, S.M., Meistrich, M.L., McLaughlin, E.A., Roman, S.D., Warne,S., Mendis, S., Itman, C., Loveland, K.L., 2006. Expression of c-Kitreceptor mRNA and protein in the developing, adult and irradiatedrodent testis. Reproduction 131, 489–499.

Puglisi, R., Montanari, M., Chiarella, P., Stefanini, M., Boitani, C., 2004.Regulatory role of BMP2 and BMP7 in spermatogonia and Sertoli cellproliferation in the immature mouse. Eur. J. Endocrinol. 151, 511–520.

Qiu, W., Zhang, S., Xiao, C., Xu, W., Ma, Y., Liu, Y., Wu, Q., 2003.Molecular cloning and characterization of a mouse spermatogenesis-related ring finger gene znf230. Biochem. Biophys. Res. Commun. 306,347–353.

Rao, D.S., Chang, J.C., Kumar, P.D., Mizukami, I., Smithson, G.M.,Bradley, S.V., Parlow, A.F., Ross, T.S., 2001. Huntingtin interactingprotein 1 Is a clathrin coat binding protein required for differentiationof late spermatogenic progenitors. Mol. Cell. Biol. 21, 7796–7806.

Rodriguez, I., Ody, C., Araki, K., Garcia, I., Vassalli, P., 1997. An earlyand massive wave of germinal cell apoptosis is required for thedevelopment of functional spermatogenesis. EMBO J. 16, 2262–2270.

Ronfani, L., Ferraguti, M., Croci, L., Ovitt, C.E., Scholer, H.R.,Consalez, G.G., Bianchi, M.E., 2001. Reduced fertility and spermato-genesis defects in mice lacking chromosomal protein Hmgb2. Devel-opment 128, 1265–1273.

Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R., Geremia, R.,1993. Follicle-stimulating hormone induction of steel factor (SLF)mRNA in mouse Sertoli cells and stimulation of DNA synthesis inspermatogonia by soluble SLF. Dev. Biol. 155, 68–74.

Rossi, P., Dolci, S., Sette, C., Capoluoghi, F., Pellegrini, M., Loiarro, M.,Di Agostino, S., Baronetto, M.P., Grimaldi, P., Merico, D., Marte-gani, E., Geremia, R., 2004. Analysis of the gene expression profile ofmouse male meiotic germ cells. Gene Expr. Patterns 4, 267–281.

Rubin-Bejerano, I., Sagee, S., Friedman, O., Pnueli, L., Kassir, Y., 2004.The in vivo activity of Ime1, the key transcriptional activator ofmeiosis-specific genes in Saccharomyces cerevisiae, is inhibited by thecyclic AMP/protein kinase A signal pathway through the glycogensynthase kinase 3-beta homolog Rim11. Mol. Cell. Biol. 24, 6967–6979.

Session, D.R., Lee, G.S., Wolgemuth, D.J., 2001. Characterization ofD1Pas1, a mouse autosomal homologue of the human AZFa regionDBY, as a nuclear protein in spermatogenic cells. Fertil. Steril. 76,804–811.

Sette, C., Bevilacqua, A., Bianchini, A., Mangia, F., Geremia, R., Rossi,P., 1997. Parthenogenetic activation of mouse eggs by microinjectionof a truncated c-kit tyrosine kinase present in spermatozoa. Develop-ment 124, 2267–2274.

Sette, C., Dolci, S., Geremia, R., Rossi, P., 2000. The role of stem cellfactor and of alternative c-kit gene products in the establishment,maintenance and function of germ cells. Int. J. Dev. Biol. 44, 599–608.

12 P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

Shao, X., Xue, J., van der Hoorn, F.A., 2001. Testicular protein Spag5 hassimilarity to mitotic spindle protein Deepest and binds outer densefiber protein Odf1. Mol. Reprod. Dev. 59, 410–416.

Shiseki, M., Nagashima, M., Pedeux, R.M., Kitahama-Shiseki, M.,Miura, K., Okamura, S., Onogi, H., Higashimoto, Y., Appella, E.,Yokota, J., Harris, C.C., 2003. p29ING4 and p28ING5 bind to p53and p300, and enhance p53 activity. Cancer Res. 63, 2373–2378.

Sorrentino, V., Giorgi, M., Geremia, R., Besmer, P., Rossi, P., 1991.Expression of the c-kit proto-oncogene in the murine male germ cells.Oncogene 6, 149–151.

Steinmayr, M., Andre, E., Conquet, F., Rondi-Reig, L., Delhaye-Bouchaud, N., Auclair, N., Daniel, H., Crepel, F., Mariani, J., Sotelo,C., Becker-Andre, M., 1998. staggerer phenotype in retinoid-relatedorphan receptor alpha-deficient mice. Proc. Natl. Acad. Sci. USA 95,3960–3965.

Sugaya, K., Hongo, E., Tsuji, H., 2005. A temperature-sensitive mutationin the WD repeat-containing protein Smu1 is related to maintenance ofchromosome integrity. Exp. Cell Res. 306, 242–251.

Sugihara, T., Wadhwa, R., Kaul, S.C., Mitsui, Y., 1999. A novel testis-specific metallothionein-like protein, tesmin, is an early marker of malegerm cell differentiation. Genomics 57, 130–136.

Szczepny, A., Hime, G.R., Loveland, K.L., 2006. Expression of hedgehogsignalling components in adult mouse testis. Dev. Dyn. 235, 3063–3070.

Takizawa, C.G., Morgan, D.O., 2000. Control of mitosis by changes inthe subcellular location of cyclin-B1-Cdk1 and Cdc25C. Curr. Opin.Cell Biol. 12, 658–665.

Tatsuta, T., Model, K., Langer, T., 2005. Formation of membrane-boundring complexes by prohibitins in mitochondria. Mol. Biol. Cell 16,248–259.

Tsuruta, J.K., O’Brien, D.A., 1995. Sertoli cell-spermatogenic cellinteraction: the insulin-like growth factor-II/cation-independent man-nose 6-phosphate receptor mediates changes in spermatogenic cell geneexpression in mice. Biol. Reprod. 53, 1454–1464.

Upadhya, P., Birkenmeier, E.H., Birkenmeier, C.S., Barker, J.E., 2000.Mutations in a NIMA-related kinase gene, Nek1, cause pleiotropiceffects including a progressive polycystic kidney disease in mice. Proc.Natl. Acad. Sci. USA 97, 217–221.

Urano, A., Endoh, M., Wada, T., Morikawa, Y., Itoh, M., Kataoka, Y.,Taki, T., Akazawa, H., Nakajima, H., Komuro, I., Yoshida, N.,Hayashi, Y., Handa, H., Kitamura, T., Nosaka, T., 2005. Infertilitywith defective spermiogenesis in mice lacking AF5q31, the target ofchromosomal translocation in human infant leukemia. Mol. Cell. Biol.25, 6834–6845.

van Pelt, A.M., de Rooij, D.G., 1991. Retinoic acid is able to reinitiatespermatogenesis in vitamin A-deficient rats and high replicate dosessupport the full development of spermatogenic cells. Endocrinology128, 697–704.

Vincent, S., Segretain, D., Nishikawa, S., Nishikawa, S.I., Sage, J., Cuzin,F., Rassoulzadegan, M., 1998. Stage-specific expression of the Kit

receptor and its ligand (KL) during male gametogenesis in the mouse:a Kit-KL interaction critical for meiosis. Development 125, 4585–4593.

Wang, P.J., McCarrey, J.R., Yang, F., Page, D.C., 2001. An abundanceof X-linked genes expressed in spermatogonia. Nat. Genet. 27, 422–426.

Wang, Y., Culty, M., 2007. Identification and distribution of a novelplatelet-derived growth factor receptor beta variant: effect of retinoicacid and involvement in cell differentiation. Endocrinology 148, 2233–2250.

Warren, E.H., Gavin, M.A., Simpson, E., Chandler, P., Page, D.C.,Disteche, C., Stankey, K.A., Greenberg, P.D., Riddell, S.R., 2000. Thehuman UTY gene encodes a novel HLA-B8-restricted H-Y antigen. J.Immunol. 164, 2807–2814.

Woodruff, T.K., Borree, J., Attie, K.M., Cox, E.T., Rice, G.C., Mather,J.P., 1992. Stage-specific binding of inhibin and activin to subpopu-lations of rat germ cells. Endocrinology 130, 871–881.

Wu, C.L., Kirley, S.D., Xiao, H., Chuang, Y., Chung, D.C., Zukerberg,L.R., 2001. Cables enhances cdk2 tyrosine 15 phosphorylation byWee1, inhibits cell growth, and is lost in many human colon andsquamous cancers. Cancer Res. 61, 7325–7332.

Xiao, G.H., Gallagher, R., Shetler, J., Skele, K., Altomare, D.A., Pestell,R.G., Jhanwar, S., Testa, J.R., 2005. The NF2 tumor suppressor geneproduct, merlin, inhibits cell proliferation and cell cycle progression byrepressing cyclin D1 expression. Mol. Cell. Biol. 25, 2384–2394.

Xiao, J., Xu, M., Li, J., Chang Chan, H., Lin, M., Zhu, H., Zhang, W.,Zhou, Z., Zhao, B., Sha, J., 2002. NYD-SP6, a novel gene potentiallyinvolved in regulating testicular development/spermatogenesis. Bio-chem. Biophys. Res. Commun. 291, 101–110.

Yamamoto, H., Tsukahara, K., Kanaoka, Y., Jinno, S., Okayama, H.,1999. Isolation of a mammalian homologue of a fission yeastdifferentiation regulator. Mol. Cell. Biol. 19, 3641–3829.

Yang, H.M., Liu, G., Nie, Z.Y., Nie, D.S., Deng, Y., Lu, G.X., 2005.Molecular cloning of a novel rat gene Tsarg1, a member of the DnaJ/HSP40 protein family. DNA Seq. 16, 166–172.

Zhai, L., Graves, P.R., Robinson, L.C., Italiano, M., Culbertson, M.R.,Rowles, J., Cobb, M.H., DePaoli-Roach, A.A., Roach, P.J., 1995.Casein kinase I gamma subfamily. Molecular cloning, expression, andcharacterization of three mammalian isoforms and complementationof defects in the Saccharomyces cerevisiae YCK genes. J. Biol. Chem.270, 12717–12724.

Zhang, N., Yeh, H.J., Zhong, R., Li, Y.S., Deuel, T.F., 1999. A dominant-negative pleiotrophin mutant introduced by homologous recombina-tion leads to germ-cell apoptosis in male mice. Proc. Natl. Acad. Sci.USA 96, 6734–6738.

Zhang, S., Qiu, W., Wu, H., Zhang, G., Huang, M., Xiao, C., Yang, J.,Kamp, C., Huang, X., Huellen, K., Yue, Y., Pan, A., Lebo, R.,Milunsky, A., Vogt, P.H., 2001. The shorter zinc finger proteinZNF230 gene message is transcribed in fertile male testes and may berelated to human spermatogenesis. Biochem. J. 359, 721–727.

P. Rossi et al. / Gene Expression Patterns xxx (2007) xxx–xxx 13

ARTICLE IN PRESS

Please cite this article in press as: Rossi, P. et al., Transcriptome analysis of differentiating spermatogonia ..., Gene Expr. Pattern(2007), doi:10.1016/j.modgep.2007.10.007

BIOLOGY OF REPRODUCTION 77, 754–764 (2007)Published online before print 18 July 2007.DOI 10.1095/biolreprod.107.062265

Dynamic Regulation of Histone H3 Methylation at Lysine 4 inMammalian Spermatogenesis1

Maren Godmann,3 Veronik Auger,3 Vivian Ferraroni-Aguiar,3 Annarita Di Sauro,4,5 Claudio Sette,4,5

Ruediger Behr,6 and Sarah Kimmins2,3

Departments of Animal Science and Pharmacology and Therapeutics,3 McGill University, Montreal, Quebec, Canada H9X 3V9Department of Public Health and Cell Biology,4 University of Rome Tor Vergata, 00133 Rome, ItalyLaboratory of Neuroembryology,5 IRCCS Fondazione Santa Lucia, 00133 Rome, ItalyStem Cell Research Group, German Primate Center,6 37077 Goettingen, Germany

ABSTRACT

Spermatogenesis is a highly complex cell differentiationprocess that is governed by unique transcriptional regulationand massive chromatin alterations, which are required formeiosis and postmeiotic maturation. The underlying mechanismsinvolve alterations to the epigenetic layer, including histonemodifications and incorporation of testis-specific nuclear pro-teins, such as histone variants and protamines. Histones canundergo methylation, acetylation, and phosphorylation amongother modifications at their N-terminus, and these modificationscan signal changes in chromatin structure. We have identifiedthe temporal and spatial distributions of histone H3 mono-, di-,and trimethylation at lysine 4 (K4), and the lysine-specific histonedemethylase AOF2 (amine oxidase flavin-containing domain 2,previously known as LSD1) during mammalian spermatogenesis.Our results reveal tightly regulated distributions of H3-K4methylation and AOF2, and that H3-K4 methylation is verysimilar between the mouse and the marmoset. The AOF2 proteinlevels were found to be higher in the testes than in the somatictissues. The distribution of AOF2 matched the cell- and stage-specific patterns of H3-K4 methylation. Interaction studiesrevealed unique epigenetic regulatory complexes associatedwith H3-K4 methylation in the testis, including the association ofAOF2 and methyl-CpG-binding domain protein 2 (MBD2a/b) ina complex with histone deacetylase 1 (HDAC1). These studiesenhance our understanding of epigenetic modifications and theirroles in chromatin organization during male germ cell differen-tiation in both normal and pathologic states.

AOF2/LSD1, epigenetics, gamete biology, histone epigenetics,spermatogenesis, testis

INTRODUCTION

Spermatogenesis is a highly complex cell differentiationprocess that is essential for sexual reproduction. While ourknowledge of the molecular mechanisms that regulate andcoordinate spermatogenesis remains incomplete, it is well

established that pituitary gonadotropins and androgens arecritical effectors [1]. Male germ cell development includesunique processes, such as meiosis, genetic recombination,haploid gene expression, formation of the acrosome andflagellum, and remodeling and condensation of the chromatin.These processes are intricate, highly ordered, and require novelgene products and a precise and stringently co-ordinatedprogram of chromatin reorganization. As with any differenti-ating tissue in the body, the characteristics of the cell types thatcomprise the mammalian testis are dependent upon differentialgene expression. This differential gene expression is achievedby unique chromatin remodeling, transcriptional regulation,posttranscriptional control of mRNAs, and the expression oftestis-specific genes or isoforms [2–4]. Epigenetic events in thetestis have just begun to be studied. New work on the functionof specific histone modifications suggests that they serve a keyrole in the control of development [5–7].

The topic of epigenetics, which refers to heritable changes ingene expression that are not encoded in the DNA, includescovalent modification of histones and methylation of DNA. Theepigenetic layer regulates chromatin higher order and controlsaccess of the transcriptional and repair machinery to the DNA[8]. Importantly, altered male fertility and reproductive healthhave been linked with exposure to chemotherapeutic drugs andpesticides that disrupt the epigenetic program. This has beenshown to be manifested as DNA damage and altered DNAmethylation [9–11], while the role of histone modificationsremains to be elucidated. Histones can undergo epigeneticmodifications at their N-termini, including methylation, acety-lation, and phosphorylation, among others. Indirect immuno-fluorescence studies of cultured cells have been highlyinformative regarding the functions of specific histone modi-fications that modulate cellular events, e.g., histone methylationat H3-K9 directs X-chromosome inactivation in mammals [12–15], and histone phosphorylation of H3-S10 regulates pericen-tric chromatin condensation [16–18]. Despite these advances inmammalian model systems and in development, a comprehen-sive map of the organization of histone modifications duringmale germ cell differentiation has not been established.

Histone methylation is catalyzed by histone methyltransfer-ases (HMTs), which can be grouped into two major classes,those specific for arginine (R) methylation (PMRTs, proteinarginine methyltransferases), and those specific for lysine (K)methylation (HKMTs, histone lysine methyltransferases). Todate, five enzymes have been identified that methylate histoneH3 at lysine 4 (H3-K4) [19]. Genomic analysis has revealed theH3-K4 di- and trimethylation are principally associated withactive transcription [20]. The absolute requirement for histonemethylation in spermatogenesis is demonstrated by the sterilityof mice that bear defects in histone methyltransferases Suv39h1

1Supported by grants from NSERC (to S.K.), the Dr. L.J. JohnsonFoundation (to S.K.), and the Lance Armstrong Foundation (to C.S.).M.G. is supported by a fellowship from the McGill Faculty of Agricultureand Environmental Sciences, McGill University, Montreal, Canada.2Correspondence: Sarah Kimmins, Department of Animal Science,McGill University, 21111 Lakeshore Rd, Ste-Anne-de-Bellevue,Montreal, QC, Canada H9X 3V9. FAX: 514 398 7964;e-mail: sarah.kimmins@mcgill.ca

Received: 13 April 2007.First decision: 30 May 2007.Accepted: 18 July 2007.� 2007 by the Society for the Study of Reproduction, Inc.ISSN: 0006-3363. http://www.biolreprod.org

754

and Suv39h2, which are specific for histone H3-K9 [15].Importantly, at the earliest point in germ cell specification,histone methylation has been shown to be crucial. Disruptionof Prdm1 (previously known as Blimp1), which is a potenttranscriptional repressor of a histone methyltransferase sub-family, results in aberrant primordial germ-like cells withderegulated gene expression [21].

Histone methylation was previously considered to be apermanent marker, until the recent identification of the firsthistone demethylase, the lysine-specific histone demethylaseAOF2 (amine oxidase flavin-containing domain 2, previouslyknown as LSD1) [24]. AOF2 is specific for the removal ofmono- and di-methylation of H3-K4 [22–25], and functionswith histone deacetylases (HDAC1/2), REST corepressor 1(RCOR1), and PHD finger protein 21A (PHF21A) as atranscriptional repressor [25, 26]. AOF2 has also been reportedto participate in the demethylation of H3-K9 [27], by co-operating with the androgen receptor to activate androgenreceptor target genes via H3-K9 demethylation.

This is the first comprehensive study to determine preciselythe stage- and cell-specific distributions of H3-K4 methylationand AOF2 in mammalian male germ cells, and to identify novelchromatin regulatory complexes associated with AOF2.Importantly, our comparison of the temporal and spatialdistributions of H3-K4 methylation in spermatogenesis betweenthe mouse and the common marmoset, Callithrix jacchus,indicates that these epigenetic markers are likely to be involvedin the highly conserved mechanisms of chromatin organizationin male germ cell development. We found high levels of AOF2in the mouse testis, in comparison with the levels in somatictissues, and its directly overlapping distribution pattern withH3-K4 mono-and di-methylation suggests that it is a keyregulator of methylation of histone H3-K4 in spermatogenesis.Our coimmunoprecipitation studies identified interactionsbetween the epigenetic modifiers AOF2, HDAC1, andMBD2a,b in the mouse testis, which suggest that they play arole in chromatin reorganization. Epigenetic events in the testishave just begun to be studied, and this study on the distributionand functional protein partners associated with histone H3-K4methylation indicates a fundamental role for H3-K4 methyla-tion in germ cell development.

MATERIALS AND METHODS

Mice

All tissues and cells were obtained from CD1 mice (Charles River), whichwere housed under normal light/dark conditions with free access to food andwater. Mice were killed and the testes were collected during the first wave ofspermatogenesis at postnatal days corresponding to the appearance of thespermatogenic cell types [28]: postnatal day (PND) 6, type A spermatogonia;PND 8, type A/B spermatogonia; PND 10, preleptotene/leptotene; PND 12,zygotene; PND 14, pachytene; PND 20, late pachytene; and adult, 8 weeks ofage. All animal procedures were approved by the Animal Care and UseCommittee of McGill University, Montreal, Canada.

Primates

All procedures were carried out according to German Animal Experimen-tation Law. Animals were housed according to standard German PrimateCentre practice for the common marmoset (Callithrix jacchus) [29, 30]. Twoadult animals were killed by an overdose of anaesthetic, and the testes weresurgically removed and immediately processed for further analyses.

Histology and Immunohistochemistry

Tissues were fixed in Bouin solution, processed for embedding in paraffin,and sectioned using standard histological protocols. Immunohistochemicalstaining was performed on 5-lm-thick sections. Briefly, tissues were deparaffi-nized with Citrisolve and then rehydrated through three changes of alcohol.

After washing in PBS-Brij (PBS plus 0.03%Brij 35) for 10 min, antigen retrievalwas performed by incubating tissue sections in sodium citrate buffer, heating inthe microwave until boiling, followed by cooling for 30 min at room temperatureand washing with distilled water. The slides were then rinsed in PBS-Brij andendogenous peroxidase activity was blocked by incubation with 0.3% hydrogenperoxide in methanol for 30 min at room temperature. The sections weresubsequently blocked in 5% BSA in PBS-Brij for 1 h, and then incubated withpolyclonal rabbit anti-H3-K4 mono-methyl (ab8895, 1:500 dilution; Abcam),anti-H3-K4 di-methyl (Abcam, ab7766, 1/500), anti-H3-K4 trimethyl (ab8580,1:500; Abcam), anti-AOF2 (otherwise known as LSD1, ab17721, 1:50; Abcam),or control rabbit IgG (Jackson Immunoresearch Laboratories) antibody at thesame concentration as the primary antibody, with rocking overnight at 48C. Afterwashing, the sections were incubated with secondary horseradish peroxidase-conjugated anti-rabbit antibody (1:500; Jackson Immunoresearch Laboratories),for 1 h at room temperature, followed by washing. Immune complexes wererevealed by diaminobenzidine (Sigma) and sections were counterstained withhematoxylin. Spermatogenic stages for mouse histology were determinedaccording to Russell et al. [31], and for marmoset histology according to thecriteria described by Holt and Moore [32] and Millar et al. [33].

Stage-Specific Cell Isolation and Immunofluorescence

For immunofluorescent colocalization of AOF2 and ZBTB16 (previouslyknown as PLZF, spermatogonial marker for As, Apr, and Aal), and forZBTB16 and H3-K4 mono-, di- and trimethylation, stage-specific populationsof mouse germ cells were isolated using transillumination-assisted microdis-section, followed by phase-contrast analysis, as described by Kotaja et al. [34].Briefly, monolayers of stage-specific cell populations were snap-frozen inliquid nitrogen, fixed in 90% ethanol, followed by washing in PBS-T (PBSwith 0.05% Triton-X) and blocking for 30 min at room temperature in 3% BSAand 10% normal goat serum in PBS-T. The cells were then incubated withpolyclonal rabbit anti-AOF2 (1:300; Abcam), anti-H3-K4 mono-methylation(1:2000; Abcam), anti-H3-K4 di-methylation (1:1000; Abcam), anti-H3-K4trimethylation (1:2000; Abcam) or control rabbit IgG (Jackson Immunor-esearch Laboratories) antibody, for 2 h at room temperature. The cells werewashed and incubated with anti-ZBTB16 antibody (anti-PLZF, OP128, 1:100;Calbiochem). Primary antibodies were detected using Alexa Fluor 594-conjugated anti-rabbit and Alexa Fluor 488-conjugated anti-mouse (MolecularProbes) antibodies used at dilutions of 1:1000. Cells were counterstained with4’,6-diamidino-2-phenylindole (DAPI).

Immunoprecipitation Assay

Total testis extracts were prepared in modified RIPA (50 mM Tris-HCl [pH7.5], 300 mM NaCl, 1% NP-40, 50 mM NAF, 1 mM PMSF, 100 lM NaVO

3,

and a proteinase inhibitor cocktail [Sigma]) and kept on ice for 30 min. Solubleextracts were separated by centrifugation at 10 0003g for 30 min. Cell extractsthat contained 200 lg of total protein were precleared for 1 h on Protein A-agarose beads (Roche Diagnostics) and collected as supernatant fluids aftercentrifugation. The supernatants were incubated for 2 h at 48C, with 2 lg ofanti-HDAC1 (clone 2E10, Upstate Cell Signaling), anti-AOF2 (Abcam), anti-MBD2a (ab3754; Abcam) or anti-MBD2ab (kindly provided by Dr. M. Szyf,McGill University, Montreal) antibody, or the appropriate controls, whichincluded nonimmune serum, mouse IgG, and rabbit IgG. Protein A-agarosebeads were preadsorbed with 0.05% BSA prior to capturing the immunecomplex for 1 h at 48C. The beads were then washed three times with lysisbuffer and captured proteins were eluted in SDS-PAGE sample buffer forWestern blot analysis.

Western Blotting

For Western blotting, total testis extracts were prepared in modified RIPA(50 mM Tris-HCl [pH 7.5], 170 mM NaCl, 1% NP-40, 50 mM NAF, 1 mMPMSF, 100 lM NaVO

3, and a proteinase inhibitor cocktail), followed by

quantitation using the Bradford assay. Equal amounts of protein were resolvedby standard SDS-PAGE and electroblotted onto nitrocellulose membranes. Themembranes were incubated overnight at 48C in PBS that contained 5% low-fatmilk, 0.05% Tween-20, and polyclonal rabbit anti-AOF2 (1:500), anti-H3-K4mono-, di- or trimethylation (1:2000), anti-HDAC1 (1:5000), anti-MBD2a/b(1:2000) or anti-MBD2a (1:2000) antibody, or the loading controls, whichincluded monoclonal anti-b-actin (Sigma, 1:10 000) and monoclonal anti-MAPK1 (ERK2 (C-14), 1:1000; Santa Cruz Biotechnology) antibodies.Donkey anti-rabbit horseradish peroxidase-conjugated secondary antibody(1:5000; Jackson Immunoresearch Laboratories) or donkey anti-mouseantibody (1:20 000; Jackson Immunoresearch Laboratories) was diluted in 5%milk in PBS with 0.05% Tween-20 and labeling was detected using enhanced

HISTONE H3 METHYLATION AT LYSINE 4 IN THE TESTIS 755

chemiluminescence (Pierce). Membranes were exposed to Kodak autoradiog-raphy BioMax film. Each experiment was replicated a minimum of three times.

Cell Isolation by Elutriation

Testes from 23- to 28-day-old CD1 mice (Charles River Italia, Calco,Italy) were used to obtain spermatocytes and round spermatids by centrifugalelutriation, as described previously [35]. Spermatogonia were obtained from8-day-old mice, as described previously [36]. After elutriation, cell extractswere immunoblotted using standard techniques.

RESULTS

Dynamic Modulation of H3-K4 Mono-, Di-, andTrimethylation During Mouse Spermatogenesis

Strikingly, H3-K4 mono-, di-, and trimethylation displaytightly controlled temporal and spatial appearances duringspermatogenesis. We used immunohistochemical analysis oftestis sections obtained from adult males and prepubertal males

collected at PNDs corresponding to the appearance ofspermatogenic cell types, to determine the spermatogenic stageand cell distribution of H3-K4 methylation during spermato-genesis. Our analysis indicated that the levels of H3-K4 mono-,di-, and trimethylation were highly dynamic during germ celldevelopment (Fig. 1 and Table 1). These epigenetic modifica-tions were observed at the onset of spermatogenesis, withmoderate to strong signals present in type A and Bspermatogonia (Fig. 1). Positive staining for H3-K4 mono-,di-, and trimethylation was also detected in prepubertal testes atPND 6 and PND 10, corresponding to the appearance of type Aand B spermatogonia (Supplemental Fig. 1, available online atwww.biolreprod.org). At the onset of meiosis, in preleptotenespermatocytes, H3-K4 mono-, di-, and trimethylation werestrongly up-regulated (Fig. 1 and Supplemental Fig. 1). In themid- and late-meiosis stages (zygotene through pachytene),H3-K4 mono- and di-methylation were greatly reduced (Fig. 1,A and B), while H3-K4 trimethylation persisted in zygotene

FIG. 1. Histone H3 methylation at lysine 4 (H3-K4) during murine spermatogenesis. Immunohistochemical analysis of adult mouse testis reveals dynamicmodulation of histone H3-K4 using antibodies specific for (A) mono-methylated H3-K4 (H3-K4-me1), (B) di-methylated H3-K4 (H3-K4-me2), and (C)trimethylated H3-K4 (H3-K4-me3). Brown staining indicates positive reactivity. Roman numerals indicate the stage of spermatogenesis. B, Spermatogoniatype B; ES, elongating spermatids; M, metaphase spermatocyte; L, leptotene spermatocytes; P, pachytene spermatocytes; Pl, preleptotene spermatocytes;RS, round spermatids; SG, spermatogonia; SG

A, spermatogonia type A; Z, zygotene spermatocytes. The sections are counterstained with hematoxylin.

TABLE 1. Spermatogenic cell distribution patterns of H3-K4-me1, H3-K4-me2, H3-K4-me3, and AOF2 in the mouse.

Staining intensityb

Cell typesa H3-K4-me1 H3-K4-me2 H3-K4-me3 AOF2

As, Apr, Aal spermatogonia Intermediate Intermediate Intermediate IntermediateIn and B spermatogonia Strong Intermediate Intermediate StrongPreleptotene spermatozytes Strong Strong Strong StrongLeptotene spermatozytes Strong Strong Intermediate StrongZygotene spermatozytes Weak Weak Strong WeakPachytene spermatozytes Weak Weak Weak Weak

Round spermatids Moderate ModerateIntermediate(stages I–VII)

Moderate

Elongating spermatidsStrong

(stages IX–XI)Strong

(stages IX–XII)Strong

(stages IX–XI)Strong

(steps 10–16)

a In, intermediate spermatogonia.b me1, Mono-methylated; me2, di-methylated; me3, tri-methylated.

756 GODMANN ET AL.

spermatocytes (Fig. 1C). Unlike mono- and di-methylation,which were low in round spermatids (Fig. 1, A and B), H3-K4trimethylation was moderate in round spermatids from stages Ito VIII and persisted in elongating spermatids from stages VIIIto XI (Fig. 1C). At the onset of spermatid elongation, H3-K4mono-, di-, and trimethylation temporarily increased (stages IXto XII) (Fig. 1). These cell-specific patterns of H3-K4methylation observed in adult animals were confirmed byimmunohistochemical analysis of developmentally staged testiscollected at PND 6–20, corresponding to the appearance of thespermatogenic cell types (Supplemental Fig. 1) [28].

Confocal analysis of spermatogenic stage-specific isolatedpopulations of germ cells [34] revealed identical patterns ofH3-K4 methylation to those identified in Bouin-fixed tissuesections (Figs. 1 and 2). Using this technique, we were able tovisualize the chromatin localization patterns. As predicted forH3-K4 methylation based on its previously identified associ-ation with gene transcription [37–39], H3-K4 mono-, di, andtrimethylation appeared to be preferentially associated witheuchromatic regions (Fig. 2). Confocal analysis of immuno-fluorescently stained cells revealed preferential colocalizationof H3-K4 mono-, di-, and trimethylation to the regions of cellswith low levels of DAPI staining, which correspond to regionsof less-condensed DNA (Fig. 2). An intriguing observation wasthe polarization of H3-K4 trimethylation in spermatids (Fig.2D), which occurred just prior to the onset of elongation andpreparation for replacement of the majority of the histones,initially with transition proteins and subsequently withprotamines [4]. Confirming our immunohistochemical obser-vations that H3-K4 mono-, di-, and trimethylation localize to

spermatogonial cells was the observation that these epigeneticmarkers were present in ZBTB16 (PLZF)-positive spermato-gonia (Fig. 2). ZBTB16 is a specific transcriptional repressorthat has been shown to regulate self-renewal and maintenanceof the stem cell pool [40].

Western Blot Analysis of Histone H3-K4 Mono-, Di-, andTrimethylation During the First Wave of Spermatogenesis inPrepubertal, Pubertal, and Adult Testes

As our immunohistochemical results showed distinct increas-es in the levels of H3-K4 methylation in early meiotic cells at thepreleptotene stage, we confirmed these results by Westernblotting of testicular extracts obtained from developmentallystaged testicular extracts corresponding to the appearance ofspermatogenic cell types [28]. The aforementioned approachwaschosen because centrifugal elutriation and the STAPUTmethodsof germ cell separation do not permit the isolation of purepopulations of earlymeiotic cells, such as preleptotene, leptotene,and zygotene cells, from adult mice. There were increases in H3-K4mono- and di-methylation in testicular extracts obtained frommice at PND 10, corresponding to the appearance of preleptotenespermatocytes (Fig. 3, A and B), followed by decreases at PND14 and the appearance of pachytene spermatocytes. Confirmingour immunohistochemical observations, H3-K4 trimethylationincreased at PND 12 to PND 14, at the time of zygotene topachytene development, and then decreased at PND 20, at whichpoint late pachytene spermatocytes appear (Fig. 3C). Thesepatterns of H3-K4 methylation during the first wave ofspermatogenesis were confirmed by immunohistochemical

FIG. 2. Confocal laser scanning analysesof the H3-K4 methylation patterns of stagedspermatogenic cells. Immunofluorescenceusing antibodies specific for (A) H3-K4mono-methylation (H3-K4-me1, red), (B)H3-K4 di-methylation (H3-K4-me2, red),and (C) H3-K4 trimethylation (H3-K4-me3,red) shows preferential colocalization ofmethylated H3-K4 to regions of the cellnucleus with less condensed DNA, whichare indicated by low-level DAPI staining(blue). Zinc finger- and BTB domain-con-taining 16 (ZBTB16, previously known asPLZF; green) is specifically expressed intype A spermatogonia. D) Polarization ofH3-K4-me3 (green) in elongating sperma-tids. ES, Elongating spermatids; L, leptotenespermatocytes; P, pachytene spermatocytes;SG

A, spermatogonia type A. All pictures are

original magnification 363.

HISTONE H3 METHYLATION AT LYSINE 4 IN THE TESTIS 757

analysis of testicular cross-sections that were collected accordingto the appearance of spermatogenic cell types in prepubertal mice(Supplemental Fig. 1).

DynamicModulationofH3-K4Mono-,Di-, andTrimethylationDuring Marmoset (Callithrix jacchus) Spermatogenesis

Immunohistochemistry was used to compare the distribu-tions of histone H3 mono-, di-, and trimethylation betweenmice and the well-established primate reproductive model ofthe common marmoset. H3-K4 mono-, di-, and trimethylationwere detected in spermatogonia, as well as in preleptotene,leptotene, and zygotene spermatocytes (Fig. 4). As in themouse, pachytene spermatocytes at all stages of spermatogen-esis were negative for H3-K4 methylation (Fig. 4). Roundspermatids that were transitioning to elongated spermatids werepositive for di- and trimethylation at H3-K4, while mono-methylation was not detected in the round spermatids (Fig. 4).Similarly, elongated spermatids were positive for H3-K4 di-and trimethylation at stage VII (Fig. 4). These distributionpatterns are summarized in Table 2.

AOF2 Is Preferentially Distributed in the Testis in a Stage-Specific Manner That Directly Corresponds to the H3-K4Mono- and Di-Methylation Patterns

Histone H3-K4 mono- and di-methylation can be reversed invitro by the demethylase activity mediated by AOF2 [24].Strikingly, using Western blot analysis, we detected significant-ly more AOF2 in the testes than in the somatic tissues (P� 0.05)(Fig. 5, A and B), and its distribution was tightly regulatedduring spermatogenesis (Figs. 5C and 6, and Supplemental Figs.2 and 3, available at www.biolreprod.org). Highly purepopulations of spermatogenic cells isolated by elutriation andanalyzed by Western blotting revealed that the AOF2 levelswere highest in spermatocytes, in comparison to the respectivelevels in spermatogonia and spermatids (P � 0.05) (Fig. 7H).These levels detected by Western blot analysis in purified cellpopulations directly matched the levels obtained in ourimmunohistochemical analysis of both adult tissues andprepubertal testes (Fig. 6 and Supplemental Fig. 2). Importantly,immunolocalization revealed that, similar to H3-K4 mono- anddi-methylation, AOF2was strongly expressed in spermatogonia,increased in preleptotene spermatocytes, and then dramaticallydeclined in pachytene spermatocytes. Again, as for H3-K4mono- and di-methylation, AOF2 transiently reappeared inhaploid round spermatids at the onset of elongation and wasrestricted to stage IX and X spermatids (Fig. 6 and Table 1).Immunofluorescence analysis of staged spermatogenic cellsrevealed that AOF2 was found in a punctuate distribution ineuchromatic regions (Supplemental Fig. 3). The overlappingdistribution patterns of AOF2 and H3-K4 mono and di-methylation suggest tight gene-specific regulation governed byH3-K4 methylation and AOF2 interaction at methylateddomains in H3-K4.

AOF2 and HDAC1 Complex with Each Other and withMethyl-CpG-Binding Proteins (MBD) in the Mouse Testis

Epigenetic regulation of histone H3 methylated at K4involves interactions with multiple proteins that act together totarget gene-specific regions and reorganize chromatin. Inprevious studies, HDAC1 has been shown to be functionallyassociated with AOF2, and they act in concert to enhance thedeacetylation of histone H3 and to remove the methyl groupson histone H3 at lysine 4 [22]. In addition, the methyl-CpG-

FIG. 3. Western blot analyses of the methylation status of H3-K4 in totaltestis protein extracts obtained from prepubertal mice. Testes werecollected during the first wave of spermatogenesis at postnatal days(PND) corresponding to the appearance of the spermatogenic cell types(PND 6, spermatogonia type A; PND 8, spermatogonia types A and B; PND10, preleptotene and leptotene spermatocytes; PND 12, zygotenespermatocytes; PND 14, early pachytene spermatocytes; PND 20, latepachytene spermatocytes; ad, adult), and protein extracts were analyzedfor (A) mono-methylated H3-K4 (H3-K4-me1), (B) di-methylated H3-K4(H3-K4-me2), and (C) trimethylated H3-K4 (H3-K4-me3) in the developingmouse testis. The Western blots were reprobed with an anti-b-actinantibody as a loading control. Data are presented as the ratios of H3-K4-meto b-actin. M

rvalues are310�3.

758 GODMANN ET AL.

binding proteins (MBD) have been associated with acorepressor complex comprised of HDAC1 [41]. UsingWestern blot analysis of purified germ cell populations, wedetermined that AOF2, HDAC1, and MBD2 were present inthe same spermatogenic cell types (Fig. 7H). In other cellsystems, HDAC1 has been shown to interact with AOF2 andMBD2. Do HDAC1 and MBD2a/b interact with AOF2 in malegerm cells? We answered this question by in vivo coimmu-noprecipitation experiments to determine which chromatinremodeling complex governs dynamic histone H3 methylationin spermatogenesis. Immunoprecipitated AOF2 was found tocoimmunoprecipitate with HDAC1 (Fig. 7A), MBD2a, andMBD2b (Fig. 7B). In turn, HDAC1 interacted with AOF2 (Fig.7C) and with MBD2b (Fig. 7D). Conversely, MBD2a (Fig. 7E)and MBD2b (Fig. 7F) coimmunoprecipitated with AOF2, andMBD2b coimmunoprecipitated with HDAC1, respectively(Fig. 7G). Immunolocalization of MBD2a or MBD2b in eitherisolated germ cells or in testicular cross-sections was notpossible due to the limited reactivities of the availableantibodies for immunocytochemistry. In order to confirm thatthese proteins have overlapping distributions in germ cells, weproceeded to analyze by Western blotting pure populations ofspermatogonia, spermatocytes, and round spermatids. Indeed,the concomitant presence of these proteins in purifiedpopulations of spermatogonia, spermatocytes, and roundspermatids was detected, confirming their potential to formchromatin-modifying complexes in germ cells (Fig. 7H). It isnoteworthy that the protein level of AOF2 was highest in

spermatocytes, while the HDAC1 level was highest in roundspermatids (Fig. 7H). Protein loading was normalized to thelevels of MAPK1 (Fig. 7H).

DISCUSSION

We have shown that mono-, di-, and trimethylation ofhistone H3 at the fourth lysine is tightly regulated during malegerm cell development. In the mouse, there is striking up-regulation of H3-K4 methylation in preleptotene spermato-cytes, which is followed by down-regulation in pachytenespermatocytes. H3-K4 methylation reappeared transiently in

FIG. 4. Alterations of histone H3-K4 dur-ing spermatogenesis in Callithrix jacchus.Immunohistochemistry of adult Callithrixjacchus testis sections shows dynamicmodulation of histone H3-K4 using anti-bodies specific for mono-methylated H3-K4(H3-K4-me1), di-methylated H3-K4 (H3-K4-me2) and trimethylated H3-K4 (H3-K4-me3). Brown staining indicates positivereactivity. Roman numerals indicate thestage of the spermatogenic cycle. ES,Elongating spermatids; L, leptotene sper-matocytes; P, pachytene spermatocytes; Pl,preleptotene spermatocytes; RS, roundspermatids; SG, spermatogonia; SG

A, sper-

matogonia type A; Z, zygotene spermato-cytes. The sections are counterstainedwith hematoxylin.

TABLE 2. Spermatogenic cell distribution patterns of H3-K4-me1, H3-K4-me2, and H3-K4-me3 in the common marmoset (Callithrix jacchus).

Staining intensitya

Cell types H3-K4-me1 H3-K4-me2 H3-K4-me3

Spermatogonia Strong Strong StrongPreleptotene spermatozytes Strong Strong ModerateLeptotene spermatozytes Strong Strong ModerateZygotene spermatozytes Strong Intermediate StrongPachytene spermatozytes Absent Absent Absent

Round spermatids AbsentIntermediate(step 5,6)

Strong(step 4–6)

Elongating spermatids AbsentIntermediate

(step 7)Strong(step 7)

a me1, Mono-methylated; me2, di-methylated; me3, tri-methylated.

HISTONE H3 METHYLATION AT LYSINE 4 IN THE TESTIS 759

the haploid spermatids. Transcriptional activity has beencorrelated with specific histone modifications of N-terminaltails [42, 43]. Genome-wide data correlate the H3-K4methylation state, gene locations, and corresponding geneexpression levels. For example, trimethylation of histone H3-K4 at the 5’-end of the transcribed region is a hallmark of geneexpression [38, 44, 45], as is H3-K4 di-methylation [39, 46].Mono-methylation of H3-K4 differs from di- and trimethyla-tion, as in yeast it has been localized to the 3’-region and isassociated with genes that are poised for expression [47]. Inother eukaryotes, H3-K4 methylation has been linked totranscriptional activation, so it seems plausible that it has asimilar role in transcriptional control in germ cells. Microarraystudies based on purified germ cell populations have shownincreased gene expression in early meiotic cells and inpostmeiotic cells [48]. These waves of gene expression followthe H3-K4 methylation patterns described herein.

In addition to unique transcriptional regulation, spermato-genesis also involves dramatic chromatin alterations duringmeiosis and through the postmeiotic histone to protamineexchange. Meiosis requires specialized chromatin remodeling tofacilitate transcriptional regulation, homologous chromosomepairing, alignment, and genetic recombination. Little is knownabout the epigenetic mechanisms that regulate these steps, andour data highlight the possibility that H3-K4 methylation isinvolved in the massive chromatin reorganization required forsuccessful completion of meiosis. The strong distribution of H3-K4 methylation in preleptotene spermatocytes coincides withcondensation of the chromatin in preparation for chromosomesynapsis, which occurs in zygonema.

During postmeiotic male germ cell development, precedinghistone replacement, there is massive chromatin remodeling,which is underpinned by alterations to the epigenetic layer.Global histone H4 acetylation coincides with the initial steps ofchromatin restructuring in elongating spermatids [49], and thisprocess is conserved across mammals, fish, and birds as aprerequisite to histone displacement [50, 51]. An interestingtemporal feature of H3-K4 methylation is that it is stronglydetected at the onset of spermatid elongation at stage IX.Importantly, this methylation at H3-K4 is retained during themassive chromatin remodeling process that begins at stage Xwith the replacement of 90% of the histones, initially withtransition proteins and subsequently with protamines [4, 52,53]. At the later stages of spermatid maturation (from steps 13to 16, corresponding to the deposition of protamines), H3-K4methylation is not detected. The timing of H3-K4 methylationin elongating spermatids hints at a possible involvement in thechromatin remodeling process at the histone-to-transitionprotein exchange.

Genomic methylation patterns are established in the germ-line and accurate setting of methylation markers is required forsuccessful passage through meiosis [54]. Importantly, H3-K4di-methylation has recently been implicated in the differentialmarking of imprinting control regions during mouse spermato-genesis, being associated with the unmethylated allele [55].Underscoring the requirement for histone H3-K4 trimethylation

FIG. 5. Protein levels of amine oxidase (flavin-containing) domain 2(AOF2, previously known as LSD1) in mouse tissues. A) AOF2 proteinlevels are high in the mouse testis in comparison to somatic tissues.Western blot analyses of AOF2 protein levels in total protein extractsobtained from different mouse tissues. T, Testis; E, epididymis; U, uterus;St, stomach; C, colon; I, small intestine; B, brain; L, lung; Li, liver; H,heart; S, spleen; K, kidney. The Western blots were reprobed with ananti-b-actin antibody as a loading control. Each experiment was repeatedthree times. M

rvalues are310�3. B) Data in the graph indicate the ratios

of AOF2 to b-actin. The stacked column represents the contribution ofeach experiment. C) Western blot analysis of AOF2 levels in total testisprotein extracts obtained from mice at different postnatal developmentalstages. Testes were collected during the first wave of spermatogenesis atpostnatal days (PND) corresponding to the appearance of the spermato-genic cell types (PND 6, spermatogonia type A; PND 8, spermatogonia

3

types A and B; PND 10, preleptotene and leptotene spermatocytes; PND12, zygotene spermatocytes; PND 14, early pachytene spermatocytes;PND 20, late pachytene spermatocytes; ad, adult) and protein extractswere analyzed for the levels of AOF2 in the developing mouse testis.The Western blots were reprobed with an anti-b-actin antibody as aloading control. Each experiment was repeated three times. The graphsshow the ratios of AOF2 to b-actin. Stacking lines indicate the trend ofchanges in testicular AOF2 protein expression during the first wave ofspermatogenesis. M

rvalues are 310�3. *P , 0.05.

760 GODMANN ET AL.

in spermatogenesis is the observation that mice in which thePrdm9 gene (previously known as Meisetz, which encodes thehistone-lysine methyltransferase with catalytic activity for H3-K4 trimethylation) is disrupted are completely sterile [56].These mice display reduced H3-K4 trimethylation andspermatogenic arrest at the pachytene stage. Extended micro-array analysis of cDNA isolated from PND-14 Prdm9 nullmice revealed reduced transcription of 109 genes in compar-ison to wild-type controls [37]. Based on our in-depth stage-and cell-specific analyses of histone H3 trimethylation, itseffects do not appear to be limited to meiotic events, as thismarker is strongly evident in round spermatids.

The common marmoset, Callithrix jacchus, has been usedintensively for many years as a nonhuman primate model todescribe the physiology of testicular development and function[33, 57–60]. Importantly, the marmoset shows strikingsimilarities to the organization of the human seminiferousepithelium [61]. We wondered if the dynamic histone H3methylation patterns at lysine 4 represented a global epigeneticmechanism that is conserved across species. The temporal- andcell-specific patterns we observed by immunohistochemicalcomparisons of the mouse and marmoset were highly similar. Inboth the marmoset and mouse, at the onset of the meiotic

prophase, preleptotene and leptotene spermatocytes showstrong evidence of mono-, di-, and trimethylated H3-K4.Interestingly, in zygotene spermatocytes, in which alignmentof homologous chromosomes is initiated and the formation ofthe synaptonemal complex commences, strong H3-K4 methyl-ation persists in the marmoset testis but is lost in the mouse. Thisdifference between species may represent chromatin reorgani-zation events that persist slightly longer in marmoset meioticcells. For both species, H3-K4 methylation is lost in pachytenespermatocytes, coinciding with the transcriptional silencing thataccompanies chromatin condensation mediated in part by aurorakinase B phosphorylation of histone H3 at serine 10 [62, 63],full chromosome synapsis, and genetic recombination. As in themouse, in the marmoset there is a transient reappearance of H3-K4 concomitant with the massive chromatin remodelingassociated with spermatid morphological transformation andtransition protein-to-protamine deposition. As further confir-mation of the involvement of global and conserved epigeneticmechanisms in spermatogenesis, Rathke and coauthors [64]have reported dynamic levels of H3-K4 methylation duringspermatogenesis inDrosophila melanogaster, and similar to ourpresent findings, they observed high levels of H3-K4 methyl-ation prior to histone removal.

FIG. 6. Immunolocalization of amine ox-idase (flavin-containing) domain 2 (AOF2,previously known as LSD1) in the mousetestis. Immunohistochemical analysis ofadult mouse testis sections shows AOF2expression in a stage-specific pattern. Ro-man numerals indicate the stage of thespermatogenic cycle. Brown staining indi-cates positive reactivity. B, Spermatogoniatype B; ES, elongating spermatids; In,intermediate spermatogonia; L, leptotenespermatocytes; Pl, preleptotene spermato-cytes; RS, round spermatids; SC, Sertoli cell;(SG

A), spermatogonia type A; Z, zygotene

spermatocytes. The sections are counter-stained with hematoxylin.

HISTONE H3 METHYLATION AT LYSINE 4 IN THE TESTIS 761

Histone-lysine methylation is a reversible epigeneticmodification with important functions in both gene repressionand gene activation [8, 27, 65]. How lysine methylation affectschromatin organization and function is dependent upon severalfactors, including the cellular and gene contexts, the site oflysine methylation, and importantly, the recruitment of proteinsthat recognize and bind the methylated lysine. We report thatAOF2 is preferentially expressed in the mouse testis incomparison to somatic tissues, and that its distribution closelymatches those of H3-K4 mono- and di-methylation. Thecoexistence of AOF2 and H3-K4 methylation in the same cellssuggest that H3-K4 methylation is regulated by AOF2 duringgerm cell development. The preferential expression of AOF2 inthe testis may reflect the massive alterations in the epigeneticlayer that are marked by erasure of epigenetic markers and theirresetting [6, 7, 37, 66]. Notably, regions of DNA methylationhave been shown to exclude H3-K4 di- and trimethylation as ameans of protecting DNA-mediated gene silencing [67].

The translational output and the downstream effects of aparticular histone modification on chromatin status aredetermined by the recruitment of opposing enzyme pairs, suchas histone methyltransferases and histone demethylases. AOF2has been shown to act both as a corepressor, when associatedwith the RCOR1 complex and HDAC1 [22, 24, 26], and as acoactivator in association with androgen receptor target genesand demethylation of H3-K9 [27]. The simultaneous detectionof HDAC1, AOF2, and MBD2 in male germ cells prompted usto investigate whether these proteins could complex to form apotential chromatin-reorganizing complex in the testis. Coim-munoprecipitation experiments revealed strong associationsbetween these proteins, and suggest that this complex isimportant in chromatin organization by promoting the removalof H3-K4 methylation. Methyl-CpG-binding proteins provide alink between DNA methylation and chromatin remodeling andseveral mechanisms have been proposed to couple epigeneticmodifications of histones and DNA to the silencing of geneexpression [68, 69]. Based on the association reported hereinbetween AOF2 and HDAC1, we postulate that these proteinsform a chromatin regulatory complex. Zhang et al. [70] havereported that MBD2 recruits a transcriptional repressorcomplex, termed NuRD, to methylated DNA to promote genesilencing. Similarly, in the mouse testis, MBD2a,b may tetherthese interaction partners (AOF2 and HDAC1) to methylatedDNA. Once in place, the complex may serve to recruit MBDproteins to invoke a heterochromatic state similar to thatreported by Kaji et al. [71]. In embryonic stem cells, MBD3a orMBD3b gene targeting has been proposed to recruit the NuRDtranscriptional repressor complex to invoke gene silencingassociated with differentiation of embryonic stem cells [71]. Asimilar mechanism may operate in male germ cells to removeH3-K4 methylation and to promote the chromatin reorganiza-tion required for meiotic progression. The association weobserved between HDAC1 and AOF2 and the timing ofdisappearance of H3-K4 methylation in elongating spermatidsimply that AOF2 and HDAC1 participate in a co-ordinatedeffort to alter epigenetic marks prior to the histone-to-protamine exchange and the incorporation of histone variants[4]. As previously mentioned, in elongating spermatids there isglobal hyperacetylation of histone H4 [50, 51], whichcoincides with the methylation of H3-K4.

Elucidating the molecular pathways that control male germcell chromatin organization is important in understandingtesticular pathologies, such as cancer and infertility. Thedynamic H3-K4 methylation patterns we have revealed asoccurring during mouse and marmoset spermatogenesis impli-cate these epigenetic modifications in the highly specialized

FIG. 7. Interaction studies and protein analyses of known epigeneticmodifiers in the mouse testis. A) Western blot analysis of amine oxidase(flavin-containing) domain 2 (AOF2, previously known as LSD1)coimmunoprecipitated with histone deacetylase 1 (HDAC1) and viceversa (C). B) Western blot analysis of AOF2, which coimmunoprecipitateswith methyl binding domain proteins 2a and 2b (MBD2a and MBD2b),and in turn, MBD2a (E) and MBD2b (F) coimmunoprecipitate with AOF2.D) Western blot analysis of histone deacetylase 1 (HDAC1) coimmuno-precipitated with MBD2b and vice versa (G). H) Western blot analyses ofHDAC1, AOF2, and MBD2a in protein extracts from isolated murinetesticular germ cells. The Western blots were reprobed with an antibodyagainst mitogen-activated protein kinase 1 (MAPK1) as a loading control.Each experiment was repeated three times. The data in the graph indicatethe ratios of AOF2 or HDAC1 or MBD2a to MAPK1. M

rvalues are310�3.

IP, Immunoprecipitation; MIgG, mouse IgG; NRS, normal rabbit serum;RIgG, rabbit IgG; RS, round spermatids; SG, spermatogonia; Spc,spermatocytes.

762 GODMANN ET AL.

chromatin reorganization that governs spermatogenesis. Furthermethylation of H3-K4 during spermatogenesis seems to be aglobal mechanism that is important for the proper differentiationof germ cells of different species. The sensitivity of methylmarkers to environmental disruption through various factors,such as toxicants [10], and drugs [72, 73], places upon theseepigenetic markers a pivotal role for understanding the effects ofthe environment on the epigenome of developing germ cells andfor future studies on transgenerational inheritance [10, 74, 75].

ACKNOWLEDGMENTSWe are grateful to Bernard Robaire, Jacquetta Trasler, Dan Bernard,

and Barbara Hales for helpful comments and discussions.

REFERENCES

1. Eddy EM. Male germ cell gene expression. Recent Prog Horm Res 2002;57:103–128.

2. Iguchi N, Tobias JW, Hecht NB. Expression profiling reveals meiotic malegerm cell mRNAs that are translationally up- and down-regulated. ProcNatl Acad Sci U S A 2006; 103:7712–7717.

3. Kimmins S, Kotaja N, Davidson I, Sassone-Corsi P. Testis-specifictranscription mechanisms promoting male germ-cell differentiation.Reproduction 2004; 128:5–12.

4. Kimmins S, Sassone-Corsi P. Chromatin remodelling and epigeneticfeatures of germ cells. Nature 2005; 434:583–589.

5. Biron VL, McManus KJ, Hu N, Hendzel MJ, Underhill DA. Distinctdynamics and distribution of histone methyl-lysine derivatives in mousedevelopment. Dev Biol 2004; 276:337–351.

6. Khalil AM, Boyar FZ, Driscoll DJ. Dynamic histone modifications marksex chromosome inactivation and reactivation during mammalianspermatogenesis. Proc Natl Acad Sci U S A 2004; 101:16583–16587.

7. Payne C, Braun RE. Histone lysine trimethylation exhibits a distinctperinuclear distribution in Plzf-expressing spermatogonia. Dev Biol 2006;293:461–472.

8. Bannister AJ, Kouzarides T. Reversing histone methylation. Nature 2005;436:1103–1106.

9. Aguilar-Mahecha A, Hales BF, Robaire B. Effects of acute and chroniccyclophosphamide treatment on meiotic progression and the induction ofDNA double-strand breaks in rat spermatocytes. Biol Reprod 2005; 72:1297–1304.

10. Anway MD, Cupp AS, Uzumcu M, Skinner MK. Epigenetic transgenera-tional actions of endocrine disruptors and male fertility. Science 2005;308:1466–1469.

11. Spermon JR, Ramos L, Wetzels AM, Sweep CG, Braat DD, KiemeneyLA, Witjes JA. Sperm integrity pre- and post-chemotherapy in men withtesticular germ cell cancer. Hum Reprod 2006; 21:1781–1786.

12. Boggs BA, Cheung P, Heard E, Spector DL, Chinault AC, Allis CD.Differentially methylated forms of histone H3 show unique associationpatterns with inactive human X chromosomes. Nat Genet 2002; 30:73–76.

13. Heard E, Rougeulle C, Arnaud D, Avner P, Allis CD, Spector DL.Methylation of histone H3 at Lys-9 is an early mark on the X chromosomeduring X inactivation. Cell 2001; 107:727–738.

14. Khalil AM, Driscoll DJ. Histone H3 lysine 4 dimethylation is enriched onthe inactive sex chromosomes in male meiosis but absent on the inactive Xin female somatic cells. Cytogenet Genome Res 2006; 112:11–15.

15. Peters AH, Mermoud JE, O’Carroll D, Pagani M, Schweizer D, BrockdorffN, Jenuwein T. Histone H3 lysine 9 methylation is an epigenetic imprint offacultative heterochromatin. Nat Genet 2002; 30:77–80.

16. Hendzel MJ, Wei Y, Mancini MA, Van Hooser A, Ranalli T, Brinkley BR,Bazett-Jones DP, Allis CD. Mitosis-specific phosphorylation of histoneH3 initiates primarily within pericentromeric heterochromatin during G2and spreads in an ordered fashion coincident with mitotic chromosomecondensation. Chromosoma 1997; 106:348–360.

17. Maison C, Bailly D, Peters AH, Quivy JP, Roche D, Taddei A, LachnerM, Jenuwein T, Almouzni G. Higher-order structure in pericentricheterochromatin involves a distinct pattern of histone modification andan RNA component. Nat Genet 2002; 30:329–334.

18. Peters AH, O’Carroll D, Scherthan H, Mechtler K, Sauer S, Schofer C,Weipoltshammer K, Pagani M, Lachner M, Kohlmaier A, Opravil S, DoyleM, et al. Loss of the Suv39h histone methyltransferases impairs mammalianheterochromatin and genome stability. Cell 2001; 107:323–337.

19. Ruthenburg AJ, Allis CD, Wysocka J. Methylation of lysine 4 on histoneH3: intricacy of writing and reading a single epigenetic mark. Mol Cell2007; 25:15–30.

20. Sims RJ III, Reinberg D. Histone H3 Lys 4 methylation: caught in a bind?Genes Dev 2006; 20:2779–2786.

21. Saitou M, Payer B, O’Carroll D, Ohinata Y, Surani MA. Blimp1 and theemergence of the germ line during development in the mouse. Cell Cycle2005; 4:1736–1740.

22. Lee MG, Wynder C, Bochar DA, Hakimi MA, Cooch N, Shiekhattar R.Functional interplay between histone demethylase and deacetylaseenzymes. Mol Cell Biol 2006; 26:6395–6402.

23. Lee MG, Wynder C, Norman J, Shiekhattar R. Isolation and character-ization of histone H3 lysine 4 demethylase-containing complexes.Methods 2006; 40:327–330.

24. Shi Y, Lan F, Matson C, Mulligan P, Whetstine JR, Cole PA, Casero RA,Shi Y. Histone demethylation mediated by the nuclear amine oxidasehomolog LSD1. Cell 2004; 119:941–953.

25. Shi YJ, Matson C, Lan F, Iwase S, Baba T, Shi Y. Regulation of LSD1histone demethylase activity by its associated factors. Mol Cell 2005; 19:857–864.

26. Lee MG, Wynder C, Cooch N, Shiekhattar R. An essential role forCoREST in nucleosomal histone 3 lysine 4 demethylation. Nature 2005;437:432–435.

27. Metzger E, Wissmann M, Yin N, Muller JM, Schneider R, Peters AH,Gunther T, Buettner R, Schule R. LSD1 demethylates repressive histonemarks to promote androgen-receptor-dependent transcription. Nature2005; 437:436–439.

28. Bellve AR, Cavicchia JC, Millette CF, O’Brien DA, Bhatnagar YM, DymM. Spermatogenic cells of the prepubertal mouse. Isolation andmorphological characterization. J Cell Biol 1977; 74:68–85.

29. Gilchrist RB, Nayudu PL, Hodges JK. Maturation, fertilization, anddevelopment of marmoset monkey oocytes in vitro. Biol Reprod 1997; 56:238–246.

30. Isachenko EF, Nayudu PL, Isachenko VV, Nawroth F, Michelmann HW.Congenitally caused fused labia in the common marmoset (Callithrixjacchus). J Med Primatol 2002; 31:350–355.

31. Russell LD, Ettlin RA, Hikim AP, Clegg ED. Histological andHistopathological Evaluation of the Testis. Clearwater, Florida: CacheRiver Press; 1990.

32. Holt WV, Moore HD. Ultrastructural aspects of spermatogenesis in thecommon marmoset (Callithrix jacchus). J Anat 1984; 138(Pt 1):175–188.

33. Millar MR, Sharpe RM, Weinbauer GF, Fraser HM, Saunders PT.Marmoset spermatogenesis: organizational similarities to the human. Int JAndrol 2000; 23:266–277.

34. Kotaja N, Kimmins S, Brancorsini S, Hentsch D, Vonesch JL, Davidson I,Parvinen M, Sassone-Corsi P. Preparation, isolation and characterizationof stage-specific spermatogenic cells for cellular and molecular analysis.Nat Methods 2004; 1:249–254.

35. Sette C, Barchi M, Bianchini A, Conti M, Rossi P, Geremia R. Activationof the mitogen-activated protein kinase ERK1 during meiotic progressionof mouse pachytene spermatocytes. J Biol Chem 1999; 274:33571–33579.

36. Rossi P, Dolci S, Albanesi C, Grimaldi P, Ricca R, Geremia R. Follicle-stimulating hormone induction of steel factor (SLF) mRNA in mouseSertoli cells and stimulation of DNA synthesis in spermatogonia bysoluble SLF. Dev Biol 1993; 155:68–74.

37. Hayashi K, Matsui Y. Meisetz, a novel histone tri-methyltransferase,regulates meiosis-specific epigenesis. Cell Cycle 2006; 5:615–620.

38. Santos-Rosa H, Schneider R, Bannister AJ, Sherriff J, Bernstein BE, EmreNC, Schreiber SL, Mellor J, Kouzarides T. Active genes are tri-methylatedat K4 of histone H3. Nature 2002; 419:407–411.

39. Schneider R, Bannister AJ, Myers FA, Thorne AW, Crane-Robinson C,Kouzarides T. Histone H3 lysine 4 methylation patterns in highereukaryotic genes. Nat Cell Biol 2004; 6:73–77.

40. Costoya JA, Hobbs RM, Barna M, Cattoretti G, Manova K, Sukhwani M,Orwig KE, Wolgemuth DJ, Pandolfi PP. Essential role of Plzf inmaintenance of spermatogonial stem cells. Nat Genet 2004; 36:653–659.

41. Ng HH, Zhang Y, Hendrich B, Johnson CA, Turner BM, Erdjument-Bromage H, Tempst P, Reinberg D, Bird A. MBD2 is a transcriptionalrepressor belonging to the MeCP1 histone deacetylase complex. Nat Genet1999; 23:58–61.

42. Iizuka M, Smith MM. Functional consequences of histone modifications.Curr Opin Genet Dev 2003; 13:154–160.

43. Strahl BD, Allis CD. The language of covalent histone modifications.Nature 2000; 403:41–45.

44. Ng HH, Robert F, Young RA, Struhl K. Targeted recruitment of Set1histone methylase by elongating Pol II provides a localized mark andmemory of recent transcriptional activity. Mol Cell 2003; 11:709–719.

45. Sims RJ III, Nishioka K, Reinberg D. Histone lysine methylation: asignature for chromatin function. Trends Genet 2003; 19:629–639.

46. Bernstein BE, Kamal M, Lindblad-Toh K, Bekiranov S, Bailey DK,

HISTONE H3 METHYLATION AT LYSINE 4 IN THE TESTIS 763

Huebert DJ, McMahon S, Karlsson EK, Kulbokas EJ III, Gingeras TR,Schreiber SL, Lander ES. Genomic maps and comparative analysis ofhistone modifications in human and mouse. Cell 2005; 120:169–181.

47. Pokholok DK, Harbison CT, Levine S, Cole M, Hannett NM, Lee TI, BellGW, Walker K, Rolfe PA, Herbolsheimer E, Zeitlinger J, Lewitter F,Gifford DK, Young RA. Genome-wide map of nucleosome acetylationand methylation in yeast. Cell 2005; 122:517–527.

48. Shima JE, McLean DJ, McCarrey JR, Griswold MD. The murine testiculartranscriptome: characterizing gene expression in the testis during theprogression of spermatogenesis. Biol Reprod 2004; 71:319–330.

49. Pivot-Pajot C, Caron C, Govin J, Vion A, Rousseaux S, Khochbin S.Acetylation-dependent chromatin reorganization by BRDT, a testis-specificbromodomain-containing protein. Mol Cell Biol 2003; 23:5354–5365.

50. Braun RE. Packaging paternal chromosomes with protamine. Nat Genet2001; 28:10–12.

51. Meistrich ML, Trostle-Weige PK, Lin R, Bhatnagar YM, Allis CD. Highlyacetylated H4 is associated with histone displacement in rat spermatids.Mol Reprod Dev 1992; 31:170–181.

52. Kourmouli N, Jeppesen P, Mahadevhaiah S, Burgoyne P, Wu R, GilbertDM, Bongiorni S, Prantera G, Fanti L, Pimpinelli S, Shi W, Fundele R, etal. Heterochromatin and tri-methylated lysine 20 of histone H4 in animals.J Cell Sci 2004; 117:2491–2501.

53. Meistrich ML, Mohapatra B, Shirley CR, Zhao M. Roles of transitionnuclear proteins in spermiogenesis. Chromosoma 2003; 111:483–488.

54. Webster KE, O’Bryan MK, Fletcher S, Crewther PE, Aapola U, Craig J,Harrison DK, Aung H, Phutikanit N, Lyle R, Meachem SJ, AntonarakisSE, et al. Meiotic and epigenetic defects in Dnmt3L-knockout mousespermatogenesis. Proc Natl Acad Sci U S A 2005; 102:4068–4073.

55. Delaval K, Govin J, Cerqueira F, Rousseaux S, Khochbin S, Feil R.Differential histone modifications mark mouse imprinting control regionsduring spermatogenesis. EMBO J 2007; 26:720–729.

56. Hayashi K, Yoshida K, Matsui Y. A histone H3 methyltransferase controlsepigenetic events required formeiotic prophase. Nature 2005; 438:374–378.

57. Behr R, Hunt N, Ivell R, Wessels J, Weinbauer GF. Cloning andexpression analysis of testis-specific cyclic 30,50-adenosine monophos-phate-responsive element modulator activators in the nonhuman primate(Macaca fascicularis): comparison with other primate and rodent species.Biol Reprod 2000; 62:1344–1351.

58. Luetjens CM, Weinbauer GF, Wistuba J. Primate spermatogenesis: newinsights into comparative testicular organisation, spermatogenic efficiencyand endocrine control. Biol Rev Camb Philos Soc 2005; 80:475–488.

59. Rune GM, deSouza P, Krowke R, Merker HJ, Neubert D. Morphologicaland histochemical effects of 2,3,7,8-tetrachlorodibenzo-p dioxin (TCDD)on marmoset (Callithrix jacchus) testes. Arch Androl 1991; 26:143–154.

60. Weinbauer GF, AslamH, Krishnamurthy H, BrinkworthMH, Einspanier A,

Hodges JK. Quantitative analysis of spermatogenesis and apoptosis in thecommonmarmoset (Callithrix jacchus) reveals high rates of spermatogonialturnover andhigh spermatogenic efficiency.BiolReprod 2001; 64:120–126.

61. Li LH, Donald JM, Golub MS. Review on testicular development,structure, function, and regulation in common marmoset. Birth DefectsRes B Dev Reprod Toxicol 2005; 74:450–469.

62. Kimmins S, Crosio C, Kotaja N, Hirayama J, Monaco L, Hoog C, vanDuin M, Gossen JA, Sassone-Corsi P. Differential functions of the Aurora-B and Aurora-C kinases in mammalian spermatogenesis. Mol Endocrinol2007; 21:726–739.

63. Cobb J, Handel MA. Dynamics of meiotic prophase I duringspermatogenesis: from pairing to division. Semin Cell Dev Biol 1998;9:445–450.

64. Rathke C, Baarends WM, Jayaramaiah-Raja S, Bartkuhn M, Renkawitz R,Renkawitz-Pohl R. Transition from a nucleosome-based to a protamine-based chromatin configuration during spermiogenesis in Drosophila. J CellSci 2007; 120:1689–1700.

65. Garcia-Bassets I, Kwon YS, Telese F, Prefontaine GG, Hutt KR, ChengCS, Ju BG, Ohgi KA, Wang J, Escoubet-Lozach L, Rose DW, Glass CK,et al. Histone methylation-dependent mechanisms impose ligand depen-dency for gene activation by nuclear receptors. Cell 2007; 128:505–518.

66. Rousseaux S, Caron C, Govin J, Lestrat C, Faure AK, Khochbin S.Establishment of male-specific epigenetic information. Gene 2005; 345:139–153.

67. Okitsu CY, Hsieh CL. DNA methylation dictates histone H3K4nethylation. Mol Cell Biol 2007; 27:2746–2757.

68. Klose RJ, Bird AP. Genomic DNA methylation: the mark and itsmediators. Trends Biochem Sci 2006; 31:89–97.

69. Wade PA. Methyl CpG-binding proteins and transcriptional repression.Bioessays 2001; 23:1131–1137.

70. Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D.Analysis of the NuRD subunits reveals a histone deacetylase core complexand a connection with DNA methylation. Genes Dev 1999; 13:1924–1935.

71. Kaji K, Caballero IM, MacLeod R, Nichols J, Wilson VA, Hendrich B.The NuRD component Mbd3 is required for pluripotency of embryonicstem cells. Nat Cell Biol 2006; 8:285–292.

72. Baker EK, Johnstone RW, Zalcberg JR, El-Osta A. Epigenetic changes tothe MDR1 locus in response to chemotherapeutic drugs. Oncogene 2005;24:8061–8075.

73. Dey P. Chromatin remodeling, cancer and chemotherapy. Curr Med Chem2006; 13:2909–2919.

74. Gluckman PD, Hanson MA, Beedle AS. Non-genomic transgenerationalinheritance of disease risk. Bioessays 2007; 29:145–154.

75. Whitelaw NC, Whitelaw E. How lifetimes shape epigenotype within andacross generations. Hum Mol Genet 2006; 15 Spec No 2:R131–137.

764 GODMANN ET AL.

ABSTRACT TESI In male mammals, development and differentiation of the germline is a dynamic process. Primordial germ cells (PGCs) migrate to the developing testis where they form prospermatogonia that subsequently enter mitotic arrest and remain in this state for the duration of fetal development. After birth in the mouse, these cells resume mitotic activity to form stem spermatogonia. The spermatogonial stem cell population replicates mitotically to both maintain itself and ultimately give rise to differentiating spermatogonia that enter meiosis as primary spermatocytes, proceed through the meiotic divisions and yield postmeiotic spermatids that differentiate via the process of spermiogenesis to form spermatozoa. (Jeremy Wang et al, 2005). Transcriptional and translational control plays a crucial role during the spermatogenesis. Studies of uridine-H3 labelling.in mouse have revealed that RNA synthesis occurs in spermatogonia, is very low in early meiotic prophase: leptotene, zygotene and in the first half of pachytene, rises rapidly to a peak in middle-late pachytene and decreses again in diplotene. After meiosis, RNA synthesis is resumed in early spermiogenesis but stops completely in mid-spermiogenesis after the beginning of nuclear elongation. ( Monesi et al 1978).Protein synthesis occurs at nearly all stages of spermatogenesis in the mouse, in particular during the pachytene stage of meiosis (Monesi, 1965, 1967) and in elongating spermatids. Translational control plays a key role in temporal regulation of development events during spermatogenesis. An important regulatory point for translational control in eukaryotes is initiation, instigated by binding of the translational initiation complex to the 5’ cap of the mRNA, leading to recruitement of the ribosomal subunits. The aim of this project was to understand whether biochemical data of translational activity correlate with those of [35S]methionine incorporations and to investigate how the translation activity is regulated at the molecular level, in particular at the level of the initiation complex formation, in different cell types during spermatogenesis. First of all we re-evaluated the rate of [35S]methionine incorporation in germ cells at different developmental stages. We observed an highest [35S]methionine incorporation in spermatocytes compared to haploid cells, high levels of S6 phosphorylation ( a well known marker of active translation ) in spermatocytes, which is reduced in round spermatids, and which increase again in elongating spermatids, evaluated by immunoblot analisys. Immunocytochemical analisys indicate a strong level of S6 phosphorylation in middle-late pachytene spermatocytes, in spermatocytes undergoing the meiotic divisions and in elongated spermatids. Immunoreactivity is low in early meiotic cells, in the cytoplasm of round spermatids and spermatozoa near to the spermiation step. All these data indicate that during spermatogenesis there are two moments of high translational activity, one in late pachytene spermatocytes and one during spermatid elongation, separated by a period of reduced protein synthesis corresponding with the beginning of the haploid stage of spermatogenesis. Active translation in late pachytene spermatocytes, is supported by the increase of phosphorylation state of Akt, S6 and eIF4E after OA treatment, which is known to push meiotic progression of spermatocytes and their entry into methaphase I (MI), and an increase in the binding to m7-GTP-sepharose beads of all the factors that take active part to the formation of the translational initiation complex (eIF4G, PABP and eIF4A). We observed a reduction of protein synthesis of 20% in spermatocytes, after pre-incubation with rapamycin or Mnk inhibitor but not in round spermatids seen by [35S]methionine incorporation experiments. Morover the binding of eIF4F components to m7-GTP-sepharose beads (mimicking the cap mRNA structure) after treatment of rapamycin or Mnk inhibitor decreases in spermatocytes and in elongating spermatids but not in round spermatids.These data suggest that, while translational activity of spermatocytes is partially regulated by mTor and Erk pathways, this regulation is not occurring in round spermatids. However this conclusion is not supported by the analysis of the binding of initiation factors to m7-GTP-sepharose beads (mimicking the cap mRNA structure), which shows that there are no apparent differences between spermatocytes and round spermatids. Thus, a delay in the elongation step of translation, rather than reduced formation of initiation complexes, might account for the decrease in the rate of protein synthesis at the beginning of the haploid phase of spermatogenesis.

SINTESI TESI Nei mammiferi lo sviluppo e il differenziamento della linea germinale maschile è un processo dinamico. Le cellule germinali primordiali (PGC), migrano nel testicolo in sviluppo dove formano i prospermatogoni che entrano in arresto mitotico per tutta la durata dello sviluppo fetale. Dopo la nascita queste cellule riprendono l’attività mitotica per formare gli spermatogoni. Le cellule staminali spermatogoniali si replicano mititicamente per rigenerare sè stesse e per dare origine a spermatogoni differenzianti che entrano in meiosi per dare spermatociti primari i quali procedono attraverso le divisioni meiotiche fino allo stadio di spermatidi apolidi. Questi ultimi poi differenziano attraverso la spermiogenesi per formare spermatozoi maturi (Jeremy Wang et al, 2005). Il controllo trascrizionale e traduzionale, gioca un ruolo cruciale durante la spermatogenesi. Studi di marcatura di uridina H3, nel topo hanno rivelato che la sintesi di RNA avviene negli spermatogoni, è molto bassa nella profase meiotica precoce:leptotene, zigotene e nella prima metà del pachitene, aumenta rapidamente nel pachitene tardivo e decrementa di nuovo in diplotene. Dopo la meiosi la sintesi di RNA riprende nella spermiogenesi precoce, ma si ferma completamente negli spermatidi in allungamento. La sintesi proteica avviene a quasi tutti gli stadi della spermatogenesi ed in particolare durante il pachitene della meiosi e negli spermatidi in allungamento. Il controllo traduzionale gioca un ruolo chiave nella regolazione temporale degli eventi di sviluppo durante la spermatogenesi. Un meccanismo di regolazione importante per il controllo traduzionale negli eucarioti è la formazione del complesso d’inizio traduzionale al 5’cap dell’mRNA che guida al reclutamento della subunità ribosomale. Lo scopo del progetto è stato di comprendere se i dati biochimici dell’attività traduzionale, correlassero con quelli d’incorporazione della metionina [35S] e di indagare come l’attività traduzionale fosse regolata a livello molecolare ed in particolare al livello della formazione del complesso d’inizio nei diversi tipi cellulari durante la spermatogenesi. Prima di tutto abbiamo valutato il tasso d’incorporazione della metionina marcata nelle cellule germinali a diversi stadi di sviluppo. Abbiamo osservato un’elevata incorporazione di metionina[35S] negli spermatociti paragonata agli spermatidi apolidi, elevati livelli di fosforilazione di S6 (un noto marker d’attività tradizionale), negli sprematociti, ma non negli spermatici rotondi, con un leggero incremento negli spermatidi in allungamento. Analisi di immunoistichimica indicano un forte livello di fosforilazione di S6 negli spermatociti in pachitene tardivo, negli spermatociti che stanno per entrare in divisione meiotica e negli spermatidi in allungamento. L’immunoreattività è bassa nelle cellule meiotiche precoci, negli spermatidi rotondi e negli spermatozoi. Tutti questi dati indicano che durante la spermatogenesi ci sono due momenti di elevata attività traduzionale, uno negli spermatociti in pachitene tardivo ed uno negli spermatidi in allungamento separati da un periodo di ridotta sintesi proteica che corrisponde all’inizio della fase apolide della spermatogenesi. L’attivazione traduzionale negli spermatociti in pachitene è supportata dall’incremento della fosforilazione di Akt, S6 e eIF4E dopo trattamento con OA (che è noto indurre la progressione meiotica degli spermatociti ed il loro ingresso in metafase I) ed un incremento nel legame dei componenti (eIF4G, PABP and eIF4A) del complesso d’inizio tradizionale (eIF4F) alla resina m7-GTP-sepharose che mima la struttura del cap. Abbiamo osservato inoltre una riduzione della sintesi proteica di 20% negli spermatociti dopo preincubazione con rapamicina e l’inibitore di Mnk, ma non negli spermatidi rotondi, mediante incorporazione di metionina marcata. Inoltre il legame dei componenti di eIF4F alla resina m7-GTP-sepharose dopo trattamento con rapamicina o l’inibitore di Mnk decrementa negli spermatociti e negli spermatidi in allungamento, ma non negli spermatidi rotondi. Questi dati suggeriscono che mentre l’attività traduzionale degli spermatociti è parzialmente regolata dal pathway di mTor e Erk, tale regolazione non avviene negli spermatidi rotondi. Tuttavia questa conclusione non è supportata dall’analisi del legame dei fattori d’inizio traduzionale al cap che risulta essere uguale negli spermatociti e negli spermatidi rotondi. Quindi un ritardo nello step di allungamento della traduzione piuttosto che una ridotta formazione del complesso d’inizio potrebbe spiegare il decremento nella sintesi proteica all’inizio della fase apolide della spermatogenesi

Keywords

Spermatogenesis, translation regulation, initiation complex, mRNA, mTor, Mnk1