RESEARCH ARTICLE

Recapitulation of Werner syndrome sensitivityto camptothecin by limited knockdown of the WRNhelicase/exonuclease

Joseph L. E. Bird • Katrin C. B. Jennert-Burston • Marcus A. Bachler •

Penelope A. Mason • Jill E. Lowe • Seok-Jin Heo • Judith Campisi •

Richard G. A. Faragher • Lynne S. Cox

Received: 31 December 2010 / Accepted: 10 May 2011 / Published online: 24 July 2011

� Springer Science+Business Media B.V. 2011

Abstract WRN is a RecQ helicase with an associ-

ated exonuclease activity important in DNA metab-

olism, including DNA replication, repair and

recombination. In humans, deficiencies in WRN

function cause the segmental progeroid Werner

syndrome (WS), in which patients show premature

onset of many hallmarks of normal human ageing. At

the cellular level, WRN loss results in rapid

replicative senescence, chromosomal instability and

sensitivity to various DNA damaging agents includ-

ing the topoisomerase inhibitor, camptothecin (CPT).

Here, we investigate the potential of using either

transient or stable WRN knockdown as a means of

sensitising cells to CPT. We show that targeting

WRN mRNA for degradation by either RNAi or

hammerhead ribozyme catalysis renders human

fibroblasts as sensitive to CPT as fibroblasts derived

from WS patients, and furthermore, we find altered

cell cycle transit and nucleolar destabilisation in these

cells following CPT treatment. Such WS-like pheno-

types are observed despite very limited decreases in

total WRN protein, suggesting that levels of WRN

protein are rate-limiting for the cellular response to

camptothecin. These findings have major implica-

tions for development of anti-WRN agents that may

be useful in sensitising tumour cells to clinically

relevant topoisomerase inhibitors.

Keywords Werner syndrome � WRN � RecQ �Camptothecin � Topoisomerase � RNAi � Ribozyme �Aging � Cancer

Introduction

Werner syndrome (WS) is an autosomal recessive

disorder in which many features of normal human

ageing are accelerated (Rossi et al. 2010; Cox and

Faragher 2007; Kipling et al. 2004). WS patient

Joseph L. E. Bird and Katrin C. B. Jennert-Burston contributed

equally to this study.

J. L. E. Bird � K. C. B. Jennert-Burston �J. E. Lowe � R. G. A. Faragher

School of Pharmacy and Biomolecular Sciences,

University of Brighton, Brighton, UK

Present Address:J. L. E. Bird

Wolfson Brain Imaging Centre, Department of Medicine,

University of Cambridge, Addenbrooke’s Hospital, Hills

Road, Cambridge CB2 2QQ, UK

M. A. Bachler � P. A. Mason � L. S. Cox (&)

Department of Biochemistry, University of Oxford,

South Parks Road, Oxford OX13QU, UK

e-mail: lynne.cox@bioch.ox.ac.uk

S.-J. Heo

Lawrence Berkeley National Laboratory, 1 Cyclotron

Road, Berkeley, CA, USA

J. Campisi

Buck Institute for Research on Aging, 8001 Redwood

Blvd, Novato, CA, USA

123

Biogerontology (2012) 13:49–62

DOI 10.1007/s10522-011-9341-8

fibroblasts show rapid replicative senescence, a

mutator phenotype and hypersensitivity to certain

DNA-damaging agents including the topoisomerase

poison camptothecin (CPT) (Christmann et al. 2008;

Lebel and Leder 1998; Ogburn et al. 1997; Okada

et al. 1998; Pichierri et al. 2000; Poot et al. 1999).

WS results from loss of function mutations in the

WRN gene (Yu et al., 1996), which encodes a RecQ-

like helicase with a unique 30–50 exonuclease domain

(Gray et al. 1997; Huang et al. 1998; Shen et al. 1998;

Suzuki et al. 1997). WRN acts in multiple DNA

transactions (reviewed in Cheng et al. 2007; Cox and

Faragher 2007; Kudlow et al. 2007), including the

suppression of recombination at stalled replication

forks during S phase (Franchitto and Pichierri 2004;

Rodriguez-Lopez et al. 2002; Sidorova et al. 2008).

Holliday junctions (HJ) are thought to result from

replication fork collapse, for example following

attempts to replicate a template containing campto-

thecin-blocked topoisomerase, and WRN exonucle-

ase activity is implicated in their resolution (Machwe

et al. 2007). The importance of HJ resolution in

overcoming the effects of camptothecin-mediated

arrest has been demonstrated using a Holliday

junction endonuclease RusA, that reduces the hyper-

sensitivity of WS cells to CPT (Rodriguez-Lopez

et al. 2007). The hypersensitivity of WS patient cells

to CPT thus presumably occurs because WS cells are

defective in processing and/or restarting stalled or

collapsed replication forks (Franchitto and Pichierri

2004; Machwe et al. 2007; Rodriguez-Lopez et al.

2002; Sidorova et al. 2008), since WRN usually

prevents conversion of single strand to double strand

DNA breaks (Christmann et al. 2008).

Whilst first identified as an important factor in

preventing premature ageing, WRN has also more

recently been recognised as a significant tumour

suppressor. WS patients show high tumour incidence,

especially sarcomas (Goto et al. 1996). Epigenetic

inactivation by methylation of CpG islands in the

WRN promoter is associated with tumorigenesis in

many common tumour types of both epithelial and

mesenchymal origin (Agrelo et al. 2006), while

reactivation of WRN expression leads to reduction

of tumour growth in a mouse xenograft model

(Agrelo et al. 2006). Since loss of WRN predisposes

to CPT sensitivity, it is an interesting proposition to

exploit WRN inactivation in cancer chemotherapy

(Futami et al. 2007, 2008), as many different tumour

cell types require WRN for survival (Opresko et al.

2007) and CPT analogues are currently in use in the

cancer clinic. Furthermore, treatments that induce

transient WRN loss should not kill normal cells—at

worst, those cells most affected by treatment may

become senescent, a recognised tumour suppressive

mechanism (Campisi 2005), resulting in selective

killing of cancer cells. In order to pursue this goal of

exploiting the ageing-associated WRN as a therapeu-

tic target in cancer, it is necessary to characterise

different possible methods of ablating WRN expres-

sion and determining the degree to which WRN loss

is required in order to obtain the required phenotype

of CPT sensitivity.

Here we test two different strategies (short hairpin

interfering RNAs and hammerhead ribozymes,

(Brummelkamp et al. 2002; Citti et al. 1999; Citti

and Rainaldi 2005; Paddison et al. 2002)) designed to

permit either transient or stable WRN knockdown, and

measure both degree of WRN protein loss and CPT

sensitivity. The transfected human cell lines we report

here in which WRN is targeted for degradation possess

isogenic partner controls, allowing precise analysis of

the contribution of WRN to any phenotype observed,

and so present a useful research resource. We demon-

strate that targeting WRN by these approaches gives

levels of sensitivity to camptothecin equivalent to

those observed in WS patient-derived fibroblasts, even

when very minor decreases in WRN protein levels are

detected, suggesting that WRN levels are rate-limiting

for the cellular response to camptothecin. Moreover,

marked changes in nucleolar integrity were observed

following camptothecin treatment of the ‘knockdown’

cells. These findings are discussed in the context of

recent developments in cancer chemotherapy based on

WRN status.

Materials and methods

shRNA & ribozyme design and plasmid

constructs

Two different anti-WRN shRNA retroviral vectors

were constructed: MSCV-WRN shRNA KJ1 and

MSCV siWRN4, which target nucleotides (nt)

121–150 and 3724–3742 relative to the ATG start

codon, respectively. An anti-WRN hammerhead

ribozyme expression vector, MSCV-WRN Rib3 was

50 Biogerontology (2012) 13:49–62

123

also created, targeting nt 3297–3327. All targets had

at least 8 nt differences from any other human gene as

determined by BLAST searches. An anti-firefly

luciferase shRNA (pSHAG-Ff1) (Paddison et al.

2002) and an ineffective hairpin targeting nt -3 to

?16 of the special AT-rich sequence binding protein

1 (SATB1) were used as negative shRNAi controls,

whilst the insertless pMSCV-puromycin retroviral

vector (Clontech) served as a further control.

The KJ1 hairpin sequence (Table 1) encodes

inverted repeats of 29 base pairs (bp) separated by a

4-nt spacer. A U6 promoter expression cassette was

generated by PCR (Hemann et al. 2003) and cloned

into pENTR/TOPO-D (Invitrogen). siWRN4 and

siSATB1 hairpins contain 19 bp inverted repeats

separated by a 9 bp spacer. These were synthesised

as complementary 64-mer oligonucleotides, annealed

and initially cloned into pSuper (Brummelkamp et al.

2002).

The anti-WRN hammerhead ribozymes were cre-

ated using two complementary 54-mer oligonucleo-

tides containing a 24 bp consensus hammerhead core

sandwiched between 14 nt of complementary

sequence 50 of the target and 15 nt of complementary

sequence 3’ of the target (Table 1). These were

annealed and cloned into pCR2.1-TOPO (Invitrogen)

and subcloned into pU1-ribozyme (Montgomery and

Dietz 1997) to create a U1 expression cassette for a

U1/ribozyme hybrid where the ribozymes are stabi-

lised by U1 stem loop structures. All expression

cassettes were subcloned into the pMSCV-puromycin

retroviral vector and high titre virus was produced in

CRIP amphotropic retroviral packaging cells.

Cell culture and generation of stable recombinant

cell lines

1BR.3neo and WV1 are SV40 T antigen-immorta-

lised fibroblasts from wt or WS donors, respectively,

and were cultured in DMEM (Invitrogen) containing

10% heat-inactivated foetal calf serum (Biowest),

2 mM L-glutamine, 100 U/ml penicillin and 100 lg/ml

streptomycin (Invitrogen) in a humidified incubator

(37�C, 5% CO2).

All RNA-mediated WRN knock-down and con-

trol cells were generated from 1BR.3neo by retro-

viral infection with the appropriate vector. Clones or

bulk cultures were selected using puromycin at

5 lg/ml, and cultures were maintained in 2.5 lg/ml

puromycin.

Table 1 Oligonucleotides use in this study

Construct name Oligonucleotide sequence

Rib1 Ribozyme: 3’AtcgtcgcctttaCACAAAGCAGGAGTGCCTGAGTAGTCgacttacctacttag 5’

Antisense: 5’agcagcggaaatGTGTTTCGTCCTCACGGACTCATCAGctgaatggatgaatcA 3’

Rib2 Ribozyme: 3’AaacgagaaaggaCACAAAGCAGGAGTGCCTGAGTAGTCtcttctataatcgta 5’

Antisense: 5’ttgctctttcctGTGTTTCGTCCTCACGGACTCATCAGagaagatattagcatA 3’

Rib3 Ribozyme: 3’AatgtctcttcttCACAAAGCAGGAGTGCCTGAGTAGTCattgaacctcttcaa 5’

Antisense: 5’tacagagaagaaGTGTTTCGTCCTCACGGACTCATCAGtaacttggagaagttA 3’

WRN4 Forward primer:5’gatccccCAGATGACGAGTCAGGTAGAGttcaagagaCTACCTGACTCGTCATCTGtttttggaaa 3’(linker/anti-sense/loop/sense/linker)

Reverse primer:5’ agcttttccaaaaaCAGATGACGAGTCAGGTAGtctcttgaaCTACCTGACTCGTCATCTGggg 3’ (linker/sense/loop/anti-sense/linker)

KJ1 5’ggaattcAAAAAGTGAATTCTAAGAAGAGGAGGCCACCTCCccaaGAAGATGACCTCCCCTTCTTAGAATTCACTagtatatgtgctgccgaagc 3’

(HindIII site/U6 terminator/sense/loop/anti-sense/3’ end of U6 promoter)

KJ2 5’ggaattcAAAAAGTACTTAATCCAACTAGTACTCGATTACAccaaTATAATCAAGTACCAGTTGAATTAAGTACTagtatatgtgctgccgaagc 3’

(HindIII site/U6 terminator/sense/loop/anti-sense/3’ end of U6 promoter)

U6 forward 5’ caccaaggtcgggcaggaaga 3’

U1 forward 5’ atacttacctggcaggggagat 3’

U1 reverse 5’ tccactgtaggattaacaactaag 3’

Biogerontology (2012) 13:49–62 51

123

RT-PCR

Reverse-transcription PCR to detect expression of the

U1 cassette was conducted using One-step RT-PCR

(Qiagen) according to the manufacturer’s instructions.

Briefly 0.5 lg total RNA extracted from transfected

cells using RNeasy (Qiagen) was incubated with U1

primers as listed in Table 1, and under the following

conditions: 50�C 30 min, 95�C 15 min, followed by 40

cycles of 94�C 30 s, 50�C 30 s, 72�C 60 s, and one

final extension step 72�C for 10 min in a Thermo PX2

PCR block. Products were analysed on 1% agarose gels

in 19 TBE with 1 lg/ml ethidium bromide and

visualised under UV illumination at 280 nm.

Single-cell gel electrophoresis (COMET) assay

Single-cell gel electrophoresis assay was performed as

described (Clingen et al. 2000; Lowe et al. 2004).

Following treatment of proliferating cells with 10 lM

camptothecin for 1 h, COMET tail lengths were

quantified using CASys software (Comet Analysis

Synoptics) from microscopic images taken using a

Nikon microscope UVP videocapture system. 50 nuclei

were scored from two slides for each experiment, and

each experiment was repeated at least 5 times.

Flow cytometry analysis

Cells from a 10 cm tissue culture dish were washed in

PBS, harvested by incubating with trypsin, collected,

trypsin neutralised by addition of foetal calf serum

then cells collected by centrifugation, washed in PBS,

repelleted and fixed by gradual addition of 1 ml

methanol with mixing. Fixed cells were treated with

RNase then DNA was stained with propidium iodide

and processed for flow cytometry using a Becton–

Dickinson FACS machine with Facscalibur software.

SDS-PAGE and western blotting

Cellular proteins were extracted in 50 mM Tris–HCl

pH 7.5, 150 mM NaCl, 1% (v/v) NP40, EDTA-free

protease inhibitors (Roche) with or without 25 U/ml

benzonase (Merck). Equal protein quantities were

solubilised in 62.5 mM Tris–HCl pH 6.8, 10% (v/v)

glycerol, 2% (w/v) SDS, 0.00125% (w/v) bromophe-

nol blue, 200 mM DTT, separated by SDS-PAGE, and

transferred to PVDF or nitrocellulose membranes

(Sigma). The membranes were blocked in 5% (w/v)

non-fat milk powder (NFMP), 0.4% (v/v) Tween 20,

PBS pH 7.5 overnight at 4�C, then incubated with anti-

WRN antibodies (monoclonal, BD Biosciences, 1:250

or polyclonal Ab200, AbCam, at 1:1000), mouse anti-

GAPDH monoclonal antibody (Biogenesis), anti-

tubulin, anti-actin or anti-MRE11, diluted in 0.1%

(w/v) NFMP in PBS. After washing, membranes were

incubated with HRP-conjugated goat anti-mouse or

swine anti-rabbit immunoglobulins (Dako) (1:2000) in

1% (w/v) NFMP. After further washing, immune

complexes were visualised using enhanced chemilu-

minescence (Amersham Pharmacia Biotech) and

X-ray film detection. Signals were measured using a

MultiImageTM transilluminator (Alpha Innotech) and

IOD values quantified using dedicated software.

Statistical analysis

All data are given as mean ± SD. The Student t-test

was used to determine statistical significance.

Immunofluorescence

Transfected cell lines were cultured on coverslips

until approximately 50% confluent. After washing in

PBS, the cells were fixed in buffer containing 4%

(w/v) paraformaldehyde (Sigma-Aldrich), permeabilised

with 0.1% Triton X-100 in PBS then incubated with

mouse anti-WRN monoclonal antibody (BD Biosci-

ences) or rabbit anti-WRN (Ab200, Abcam) in 0.1%

Tween 20 in PBS. Where relevant, anti-nucleolin

antibody (AbCam) was also used. Non-specific

binding was prevented by incubation with 5% (w/v)

non-fat milk powder in PBS or 10% donkey serum in

PBS. After further washing in PBS, the cells were

incubated with FITC horse anti-mouse (Vector Labs)

in 5% non-fat milk powder in PBS or FITC donkey

anti-rabbit IgG conjugated with fluorescein iso-

thiocyanate (Jackson Laboratories). For double

staining, WRN was visualized with a FITC-conju-

gated secondary antibody and nucleolin with a

rhodamine-conjugated secondary antibody (Jackson

Laboratories). Finally, after washing in PBS, cover-

slips were mounted in Vectorshield mounting med-

ium containing DAPI (Vector Labs). Mounted cells

were viewed using a Zeiss Axioskop 2 microscope

and images were captured with a CCD camera using

Axiovision software.

52 Biogerontology (2012) 13:49–62

123

Results

WRN knockdown on transient transfection

with shRNAi and ribozyme constructs

To achieve transient knockdown of WRN, we

generated various short hairpin interfering RNAs

(shRNAi) or ribozymes designed against the

sequence of WRN mRNA (Fig. 1; Table 1), and

transfected these constructs and appropriate controls

(see ‘‘Materials and Methods’’ section) into SV40-

transformed fibroblasts 1Br.3neo.

The degree of WRN knockdown achieved with the

shRNA or ribozyme constructs was assessed by

western blotting at 48 or 72 h following transfection

(Fig. 2a, b, respectively), normalising the intensity of

the WRN protein band against GAPDH, an internal

loading control. We observed no appreciable differ-

ence in WRN protein levels between cells transfected

with anti-WRN shRNA constructs KJ1 and KJ2, or

the ribozyme Rib2, and the negative controls (lipo-

fectamine alone [lipo], insertless vector pMSCV,

firefly luciferase shRNAi [FF1] or SATB1 shRNAi).

By contrast, the ribozyme targeted towards the 30 end

of WRN mRNA (Rib3) did appear to lead to limited

decrease in WRN protein levels at 48 h (Fig. 2a) and

greater reduction at 72 h (Fig. 2b).

WRN4 shRNA and Rib3 ribozyme expression

induces camptothecin hypersensitivity

and aberrant cell cycle response to CPT

Cells lacking functional WRN are hypersensitive to

the topoisomerase inhibitor camptothecin (CPT)

(Lebel and Leder 1998; Ogburn et al. 1997; Okada

et al. 1998; Pichierri et al. 2000; Poot et al. 1999), so

we next tested CPT sensitivity of stable transfectants

expressing either WRN4 shRNA, Rib3 ribozyme or

various control constructs, using a modified COMET

assay to allow the quantification of DNA strand

breaks in individual cells (Clingen et al. 2000). We

have previously shown this to be a sensitive but

robust differentiator between cells expressing wild-

type or mutant WRN following treatment with

camptothecin (Lowe et al. 2004). The increase in

COMET tail length due to CPT treatment (deter-

mined by subtracting the mean tail length without

drug exposure from the mean tail length after CPT

exposure) was plotted (Fig. 3).

Interestingly, whilst the KJ1 construct designed

against WRN resulted in little protein knockdown

even on transient transfection (e.g. see Fig. 2), this

construct gave significantly elevated CPT-dependent

COMET tail lengths equivalent to those observed for

WV1 cells on CPT treatment (Fig. 3a), that were

*2.5 fold longer than those detected for the control

1Br.3neo parental cells or 1Br.3neo stably transfected

with the vector backbone (pMSCV), or shRNAi

targeted against firefly luciferase (FF). This effect

was not dependent on a particular clone of cells

expressing the KJ1 construct as 2 separate samples

from 3 independent clones (numbered 4, 8 and 16) of

the KJ1-transfected cells all showed marked increases

in CPT-induced COMET tail length (Fig. 3a).

Furthermore, stable expression of WRN4 shRNA

in 1BR.3neo cells also resulted in hypersensitivity to

camptothecin (Fig. 3b), with an increase in CPT-

dependent COMET tail length equivalent to that

observed for WS-patient derived cell line WV1

lacking functional WRN protein (P \ 0.05), and

Fig. 1 WRN-directed shRNA and ribozyme constructs.

shRNA retroviral vectors were constructed containing WRN-

targeting KJ1 or WRN4 inserts (see Table 1 for sequence)

under the control of the U6 promoter. Alternatively, WRN-

directed ribozyme constructs were generated for expression

from the U1 promoter (see ‘‘Materials and Methods’’ section

for details)

Biogerontology (2012) 13:49–62 53

123

significantly longer (P \ 0.01) than COMET tails

observed on CPT treatment of the 1Br.3neo parental

cell line (Fig. 3b; Table 2). No significant campto-

thecin sensitivity was observed in 1BR.3neo fibro-

blasts transfected with an shRNA targeting the human

SATB1 mRNA (Fig. 3b; Table 2), suggesting that

enhanced CPT sensitivity is due to expression of

WRN4 shRNAi specifically, rather than a general

effect of shRNAi expression on cells.

As an alternative to WRN inactivation by RNAi,

we tested the impact of stable expression of the

hammerhead ribozyme Rib3 targeted against WRN,

which in transient transfection experiments led to a

drop in WRN protein levels (see Fig. 2). 1BR.3neo

fibroblasts transduced with the Rib3 ribozyme

showed levels of camptothecin sensitivity that were

statistically indistinguishable from those seen in

WV1 fibroblasts lacking functional WRN (Fig. 3c;

Table 2).

Box plots with quartiles marked show the COMET

tail length measured in both untreated and CPT-

related cell lines (Fig. 3d, e), further confirming that

the CPT-dependent increase in tail length in cells

with full or partial knockdown of WRN is genuine

and not due to aberrant outliers impacting dispropor-

tionately on the mean tail length measured.

Expression of the U1 backbone cassette containing

the Rib3 ribozyme was verified by RT-PCR (Fig. 3f),

which demonstrated expression of U1-containing

RNA species in all cells, as expected for expression

of endogenous U1 RNA (asterisk in Fig. 3f), but also

showing production of a slightly larger U1-containing

RNA in Rib3-transfected cells, consistent with the

size of the Rib3 construct (arrow in Fig. 3f). (The

absence of a band representing endogenous U1 RNA

in the Rib3-cells is suggestive of very high levels of

Rib3 RNA expression, out-competing endogenous

U1 for primers in RT-PCR). We also verified that U1-

containing RNA species were not diminished in the

transfected cells following CPT treatment (data not

shown).

COMET tails result from breakage of DNA. Given

that WRN is implicated in resolving or restarting

stalled replication forks (Rodriguez-Lopez et al.

2002, 2007; Sidorova et al. 2008), the increased

COMET tail lengths we observe using the WRN

knockdown constructs may reflect cells that have

been unable to repair DSBs arising from DNA

replication over a CPT-blocked topoisomerase

(which transforms a ss DNA break to a DSB). To

test for this, and to further analyse the response of the

transfected cell lines to CPT, we conducted cell cycle

Fig. 2 Rib3 ribozyme reduces WRN protein levels in tran-

siently transfected 1Br.3neo cells. 1Br.3neo cells were

transiently transfected with various constructs designed to

express shRNA against WRN (KJ1), firefly luciferase (FF1),

special AT-rich sequence binding protein 1 (SATB), or vector

without insert (pMSCV), and protein levels compared with

patient-derived WV-1 fibroblasts and parental cell line

1Br.3neo at 48 h (a) or 72 h (b) following transfection, on

western blots probed for WRN (upper panel) or loading control

GAPDH (middle panel). Band intensity for WRN was

normalised against GAPDH (bottom panel)

54 Biogerontology (2012) 13:49–62

123

analysis of the cell lines with and without CPT

treatment by flow cytometry. WV1 cells showed a

higher S phase fraction than 1Br3neo cells that are

wild type for WRN, and this increased S phase

fraction, which was also observed for Rib3-express-

ing cells (data not shown), did not alter on CPT

Fig. 3 Sensitivity to CPT in stably transfected cell lines

assayed by COMET. Stable clones of cells transfected with

constructs designed to knock down WRN (KJ1, WRN4 or

Rib3) or negative controls (special AT-rich sequence binding

protein 1 (SATB), firefly luciferase (FF1) or insertless vector

(pMSCV) were incubated with or without 10 lM CPT for 1 h

then COMET tail length measured. The increase in tail length

dependent on CPT treatment was determined by subtracting the

mean ‘untreated’ tail length for a given cell line from the tail

length obtained for that cell line after CPT exposure and is

plotted as CPT-dependent COMET tail length (in lm),

compared with the effect of CPT on COMET tail lengths in

patient-derived WV-1 cells and 1Br.3neo parental line. a KJ1-

expressing cell lines (3 different clones, two populations of

each) (b) shRNA WRN4, (c) ribozyme Rib3. d, e Box and

whisker plots of the COMET tail lengths plus and minus CPT

treatment to show the distribution. q1 1st quartile, q3 3rd

quartile, min minimum tail length measured, max maximum

tail length measured. Median is shown by the black bar. N = 5

for each cell line (with 100 nuclei analysed in each replicate)

(f) Reverse-transcription PCR to verify expression of U1-

driven Rib3: total RNA extracted from stable clones was

subjected to RT-PCR using primers specific to U1 to amplify

endogenous U1 RNA (asterisk) or Rib3 expressed from the

U1 hairpin construct (arrow)

Biogerontology (2012) 13:49–62 55

123

treatment. WRN4 cells showed a profile intermediate

between the wt 1Br3neo and the patient-derived WV1

cells lacking WRN. An increase in the S phase

fraction may reflect a failure to complete S phase and

suggests an inability to respond appropriately to DNA

damage when WRN protein is limiting. Note that

there was no marked increase in a sub-G1 population

on CPT treatment of any of the cell lines (data not

shown) suggesting that the CPT treatment was not

sufficiently severe to invoke an apoptotic response.

Thus the long COMET tails observed in WV1 and in

cells expressing the WRN knockdown constructs are

more consistent with DNA breakage during DNA

replication over an unrepaired template rather than

apoptotic cell death.

WRN protein levels by western blotting

are not significantly decreased in stably

transfected ‘knock-down’ cells

Since expression of the WRN-directed ribozyme

Rib3 and shRNA WRN4 resulted in significant CPT

sensitivity (Fig. 3) and alterations in cell cycle

profiles, it was reasonable to assume that these

phenotypes resulted from decreases in WRN protein

levels in the stably transfected clones compared with

the negative controls. This was tested by western

blotting for WRN protein against an extensive range

of loading controls and using several different protein

extraction conditions.

As expected, WRN protein was undetectable in

WV1 patient-derived cells (Fig. 4a–c), but a band at

*162 kDa was observed using an anti-WRN mono-

clonal antibody in cell lysates of the control cell lines

(pMSCV, FF1 and SATB). Unexpectedly, given the

CPT sensitivity and cell cycle phenotypes observed

(Fig. 3), WRN protein levels (normalised against a

tubulin internal loading control) did not appear

significantly diminished in cells stably transfected

with the WRN knockdown constructs Rib3 and

WRN4, compared with the negative controls

(Fig. 4a).

WRN has been reported to be present in different

pools in the cell with at least one fraction associated

with chromatin, so in order to extract both soluble

and chromatin-associated WRN, the potent nuclease

benzonase was used during protein preparation from

cells. While more WRN was extracted on nuclease

treatment, the ratio of WRN to a further loading

control GAPDH was not significantly decreased in

the WRN ‘knockdown’ lines (WRN4, Rib 3 or KJ1)

compared with controls (Fig. 4b).

As this lack of WRN protein reduction in the

‘knockdown’ cell lines was unexpected, the analysis

was repeated several times in our three separate

laboratories using the same cells lines but different

antibodies and different extraction procedures to

extract either soluble protein, chromatin-bound pro-

tein, or total protein using boiling SDS-dyes. Addi-

tional loading controls including Ponceau S staining

of blots and Coomassie blue quantification of protein

levels were also conducted. In all cases, very little

decrease in WRN protein levels was observed in the

WRN4 or Rib3-expressing cells (data not shown)

even though these cell lines showed a highly

significant CPT hypersensitivity phenotype.

Because WRN is a DNA repair protein and hence

its levels and/or activity may alter on DNA damage

(such as treatment with 10 lM CPT for 1 h), we also

compared WRN protein levels with another chroma-

tin-associated DNA repair protein, MRE11, with and

without CPT treatment (Fig. 4c). Note that WRN

physically associates with the MRN complex which

contains MRE11 (Franchitto and Pichierri 2004).

MRE11 protein levels (normalised against actin, a

further loading control) remained stable across all

cell lines analysed with and without CPT treatment.

By contrast, WRN:actin ratios appeared to rise

slightly following 1 h treatment with 10 lM CPT in

Table 2 Statistical comparison of CPT-dependent COMET

tail length

1Br3neo WV1 SATB WRN4

1Br3neo – 0.002 0.193 0.011

WV1 0.002 – 0.025 0.975

SATB 0.193 0.025 – 0.011

WRN4 0.011 0.975 0.011 –

1Br3neo WV1 Rib3

1Br3neo – 0.005 0.0004

WV1 0.005 – 0.516

Rib3 0.0004 0.516 –

Pairwise comparisons between CPT-dependent mean COMET

tail length of 5 independent experiments (100 nuclei for each

cell line in each replicate) for each cell line, assuming a two-

tailed distribution of paired samples, using the Student t-test.

P values are shown

56 Biogerontology (2012) 13:49–62

123

the parental 1Br3.neo cells but decreased in cells

bearing the WRN ‘knockdown’ constructs Rib3 and

WRN4. This resulted in a decrease in WRN:MRE11

ratios in ‘knockdown’ cells (Fig. 4c, graph).

WRN knockdown is observed

by immunofluorescence

The low level of reduction in WRN protein observed

on western blots of lysates of Rib3 and WRN4-

expressing cells was highly unexpected given their

marked sensitivity to CPT. To test whether the small

reduction was due to a mild knockdown in all or most

cells, or a marked knockdown in a few cells with

little or no knockdown in others (i.e. clonal effects),

we studied WRN levels in the transfected cells by

immunofluorescence microscopy. As can be seen in

Fig. 5, WRN protein was not detectable in patient-

derived WV-1 cells while a nuclear WRN signal was

detected in 1Br3.neo cells with a strong nucleolar

signal (Fig. 5), as expected. Compared with controls

(1Br3.neo parental line or cells transfected with

vector alone (pMSCV), shRNA against firefly lucif-

erase (FF1) or special AT-rich sequence binding

protein 1 (SATB1)), the majority of cells bearing the

WRN4 and Rib3 constructs showed slight but con-

sistent reductions in levels of WRN protein as

detected by immunofluorescence (Fig. 5), though

we never observed total loss of signal. Thus the low

levels of WRN protein reduction observed by western

blotting probably represents the case for the majority

of cells in culture, rather than being due to clonal

variation in which only some cells show marked

levels of knockdown while others do not display

protein loss.

Interestingly, we noted a slight but consistent

increase in nuclear size in the cells stably transfected

with the WRN knockdown constructs, and a decrease

in the WRN nucleolar signal (Fig. 5, Rib3 and

WRN4). To investigate this further, we employed

an antibody against the nucleolar protein, nucleolin,

as an additional marker for nucleolar integrity. In

1Br3.neo cells, WRN is observed with the usual

nuclear/nucleolar distribution that alters to nucleo-

plasmic following exposure of cells to 10 lM CPT

for 1 h (Fig. 6a), consistent with WRN responding to

DNA damage and its role in resolving stalled

replication forks e.g. at CPT-induced lesions (Rodri-

guez-Lopez et al. 2002, 2007; Sidorova et al. 2008).

As expected, there was no detectable WRN signal in

Fig. 4 Anti-WRN

ribozyme and shRNAs do

not significantly reduce

total WRN protein levels.

a Protein extracts of stable

cell clones were analysed

by immunoblotting, probing

for WRN, using tubulin as

an internal loading control.

b Cell extracts were

prepared with (?) or

without (-) benzonase

nuclease treatment and

immunoblotted for WRN

and GAPDH (loading

control). c Protein samples

from cell lines exposed for

1 h to 10 lM CPT or

DMSO control were probed

for WRN, MRE11 and actin

(loading control). The

following protein ratios

were determined under both

conditions for each cell

line—MRE11:actin;

WRN:actin; WRN:MRE11

(graph)

Biogerontology (2012) 13:49–62 57

123

WV1 cells, but we also observed that the nucleolin

signal was diminished, and that this decreased further

on CPT treatment (Fig. 6b), suggesting that WRN

may be important for stabilising the nucleolus on

DNA damage. (Note that the nucleolus contains

highly repetitive rDNA in tandem arrays, with DNA

replication fork barriers to promote unidirectional

DNA synthesis, and that yeast cells lacking the WRN

homologue Rqh1, show marked rDNA array insta-

bility (Ahn et al. 2005)). Interestingly, a low nucle-

olin signal that decreased further on CPT treatment

was also detected in cells expressing WRN4 shRNAi

(Fig. 6d), though cells transfected with the Rib3

ribozyme had a robust nucleolin signal with or

without CPT treatment (Fig. 6c). Notably, WV1 (no

functional WRN protein) and Rib3 and WRN4 cells

(slight knockdown of WRN) consistently showed

increased nuclear size compared with the wild type

1Br3.neo parental line.

Discussion

Progeroid Werner syndrome patient cells show

hypersensitivity to camptothecin, a drug that inhibits

topoisomerase activity, and derivatives of which are

widely used in the cancer clinic. Exploiting loss of

the WRN protein, which normally acts to stabilise the

genome particularly in response to genotoxic insults

that impact on DNA replication, may be a powerful

route to improve cancer treatments, and here we have

created molecular tools (shRNA and ribozymes)

designed to deplete WRN in cells. We demonstrate

using the COMET assay (a robust screening tool for

lack of functional WRN protein in cells (Lowe et al.

2004)) that fibroblasts carrying these constructs are as

sensitive to camptothecin as fibroblasts from WS

patients, and that this sensitivity is dependent upon

the anti-WRN component of the constructs since no

abnormal camptothecin sensitivity was apparent in

Fig. 5 Immunofluorescence analysis of WRN levels in knock-

down cells. Transfected 1Br.3neo cells were fixed and stained

for WRN and DNA (DAPI). 1Br3.neo represents the parental

cell line, WV-1 are patient-derived WRN-null cells, FF1 firefly

luciferase shRNAi, siSATB1 special AT-rich sequence binding

protein 1 shRNAi, pMSCV insert-less vector control, WRN4anti-WRN shRNAi, Rib3 anti-WRN ribozyme

58 Biogerontology (2012) 13:49–62

123

fibroblasts transduced with control constructs (hair-

pins that target firefly luciferase or SATB1, or insert-

less vector controls).

Since RNAi can produce off-target effects (Sledz

and Williams 2004), we also created a unique

hammerhead ribozyme, Rib3, which acts indepen-

dently of the endogenous RISC silencing machinery.

This anti-WRN ribozyme produced camptothecin

sensitivity equivalent to that seen in WS-derived

fibroblasts and indistinguishable from that observed

with two different shRNAs, KJ1 and WRN4. Con-

structs designed to knock down WRN expression by

different biochemical pathways therefore resulted in

a WS-like phenotype of CPT hypersensitivity, but

puzzlingly, without much decrease in WRN protein

levels. Although we cannot at this stage completely

rule out the possibility that production of the dsRNA

from our various shRNA or ribozyme constructs is

triggering a DNA damage response (for example

activation of apoptosis through an interferon response

to dsRNA), we believe this to be unlikely since

expression of dsRNA from the control shRNAi

constructs (SATB and FF) did not result in increased

COMET tail length (Fig. 3) nor in increased sub-G1

cell fractions in flow cytometry (data not shown). We

therefore believe that the phenotype of CPT sensi-

tivity observed is due to the impact of the WRN-

directed constructs on WRN, and not via off-target

effects. It would be somewhat surprising if three

different constructs using two different silencing

approaches all resulted in the same off-target effect of

inducing CPT sensitivity without acting through their

intended target WRN, the loss of which does indeed

induce CPT sensitivity.

Our observations of limited WRN knockdown

cannot be explained by simple negative selection

against clones with high levels of transgene expres-

sion. Although primary fibroblasts from WS individ-

uals tend to proliferate more slowly and with very

limited replicative potential compared with those

from normal individuals, these differences are

almost completely removed by SV40-immortalisation

(Huschtscha et al. 1986). Since we have used SV40

immortalised cell lines, any negative selection for

loss of WRN in terms of loss of proliferative capacity

would be negligible. WRN loss has been shown to

result in apoptosis of a range of different transformed

cell lines (Opresko et al. 2007). However, it is highly

Fig. 6 Increased nuclear size and loss of nucleolar integrity in

cells lacking WRN. Cells were treated with 10 lM CPT for

1 h, or DMSO vehicle control, then fixed and stained for WRN

(FITC), DNA (DAPI) and nucleolin (rhodamine). 1Br

represents the parental cell line 1Br3.neo, WV-1 are patient-

derived WRN-null cells, WRN4 anti-WRN shRNAi, Rib3 anti-

WRN ribozyme

Biogerontology (2012) 13:49–62 59

123

improbable that the DNA damage we measure as

increased COMET tail lengths is indicative of

apoptosis in cells actively expressing the constructs,

since our microscopy (Figs. 5, 6) and FACS obser-

vations do not support the idea of mass apoptosis.

Moreover, RT-PCR detection of the U1-Rib3 RNA

product (Fig. 3) does not support the possibility that

the bulk of cells have avoided knockdown and hence

apoptosis by deleting or otherwise silencing the

‘knockdown’ constructs. Instead, we suggest that our

data indicate that phenotypic assays such as COMET

analysis of CPT-induced DNA damage can be

considerably more sensitive than the simple analysis

of total protein levels.

It is known that WRN exists in cells in different

pools with different solubility and that this can alter

on DNA damage (Karmakar and Bohr 2005); since

RNAi and ribozyme treatments lead to destruction of

cognate mRNA transcripts, it is possible that the

camptothecin sensitivity we observe reflects a need

for newly synthesised WRN to respond to acute DNA

damage. While we see little or no loss of WRN in

western blotting, a small but consistent decrease in

WRN signal is detected by immunofluorescence.

Detection of WRN in microscopy can be affected by

epitope masking, for example when WRN is phys-

ically associated with a protein partner or tightly

associated with chromatin (such associations should

be disrupted in western blotting hence all WRN

protein should be detected). Our results are consistent

with the hypothesis that a specific subset of WRN

(e.g. newly synthesised WRN that has not yet been

recruited into multiprotein complexes and thus in

which epitopes are still available for immunological

detection) might be necessary for the cellular

response to CPT, perhaps because this WRN fraction

can be readily mobilised to sites where it is required.

Loss of this subset of WRN (by RNAi or ribozyme

routes) may have as severe an impact as total loss of

WRN for the cellular response to transient DNA

damage such as that induced by CPT treatment.

It is thus probable that WRN is a rate-limiting

enzyme in the damage response to camptothecin and

would be a good target for chemical inhibition.

Furthermore, by generating WRN knockdown con-

structs suitable for stable expression, it should be

possible to assess the long-term phenotypic effects of

low levels of WRN knockdown in any cell type

desired, of significant value since only fibroblastic

and lymphoblastoid lines are currently available from

WS patients.

Recent reports of dose-dependent effects of short

interfering RNAs against WRN following transient

transfection (Futami et al. 2007) are compatible with

our findings. While long-term loss of WRN results in

significant genomic instability which predisposes to

cancer development, tumours in which WRN is

inactive can be more readily killed using low dose

CPT (Agrelo et al. 2006) or clinically relevant

analogues such as etoposide. Transient low-level

reductions in WRN in surrounding normal cells

would not be expected to have significant detrimental

effects. If the requirement for only minor decreases in

WRN protein levels in order to induce profound CPT

sensitivity are borne out by further experimental

studies, this bodes well for the use of WRN

knockdown or inhibition in combination with topo-

isomerase inhibitors as an anti-cancer strategy.

Acknowledgments We thank Mrs Christine Borer for

technical support to LSC and MAB. This work was funded

by the BBSRC grants [107/EGH16152 and 107/ERA16270] to

RGAF, JLEB, KJ-B and JL, BBSRC grants [BB/E000924/1]

and [43/ERA16310] and ESRC programme grant [ES/

G037086/1] (under the cross-council New Dynamics of

Ageing initiative) to LSC, and NIH grant AG024399 to JC.

Conflicts of interest The authors state no conflicts of

interest.

References

Agrelo R, Cheng WH, Setien F, Ropero S, Espada J, Fraga MF,

Herranz M, Paz MF, Sanchez-Cespedes M, Artiga MJ,

Guerrero D, Castells A, von Kobbe C, Bohr VA et al

(2006) Epigenetic inactivation of the premature aging

Werner syndrome gene in human cancer. Proc Natl Acad

Sci USA 103(23):8822–8827

Ahn JS, Osman F, Whitby MC (2005) Replication fork

blockage by RTS1 at an ectopic site promotes recombi-

nation in fission yeast. EMBO J 24(11):2011–2023

Brummelkamp TR, Bernards R, Agami R (2002) Stable sup-

pression of tumorigenicity by virus-mediated RNA inter-

ference. Cancer Cell 2(3):243–247

Campisi J (2005) Suppressing cancer: the importance of being

senescent. Science 309(5736):886–887

Cheng WH, Muftuoglu M, Bohr VA (2007) Werner syndrome

protein: functions in the response to DNA damage and

replication stress in S-phase. Exp Gerontol 42(9):871–878

Christmann M, Tomicic MT, Gestrich C, Roos WP, Bohr VA,

Kaina B (2008) WRN protects against topo I but not topo

II inhibitors by preventing DNA break formation. DNA

Repair (Amst) 7(12):1999–2009

60 Biogerontology (2012) 13:49–62

123

Citti L, Rainaldi G (2005) Synthetic hammerhead ribozymes as

therapeutic tools to control disease genes. Curr Gene Ther

5(1):11–24

Citti L, Eckstein F, Capecchi B, Mariani L, Nevischi S, Poggi

A, Rainaldi G (1999) Transient transfection of a synthetic

hammerhead ribozyme targeted against human MGMT

gene to cells in culture potentiates the genotoxicity of the

alkylation damage induced by mitozolomide. Antisense

Nucleic Acid Drug Dev 9(2):125–133

Clingen PH, Lowe JE, Green MHL (2000) Measurement of

DNA damage and repair capacity as a function of age

using the Comet assay. In: Barnett YA, Barnett CR (eds)

Methods in molecular medicine, vol 38: ageing methods

and protocols. Human Press, Totowa, NJ, pp 143–157

Cox LS, Faragher RG (2007) From old organisms to new

molecules: integrative biology and therapeutic targets in

accelerated human ageing. Cell Mol Life Sci 64(19–20):

2620–2641

Franchitto A, Pichierri P (2004) Werner syndrome protein and

the MRE11 complex are involved in a common pathway

of replication fork recovery. Cell Cycle 3(10):1331–1339

Futami K, Takagi M, Shimamoto A, Sugimoto M, Furuichi Y

(2007) Increased chemotherapeutic activity of campto-

thecin in cancer cells by siRNA-induced silencing of

WRN helicase. Biol Pharm Bull 30(10):1958–1961

Futami K, Ishikawa Y, Goto M, Furuichi Y, Sugimoto M

(2008) Role of Werner syndrome gene product helicase in

carcinogenesis and in resistance to genotoxins by cancer

cells. Cancer Sci 99(5):843–848

Goto M, Miller RW, Ishikawa Y, Sugano H (1996) Excess of

rare cancers in Werner syndrome (adult progeria). Cancer

Epidemiol Biomarkers Prev 5(4):239–246

Gray MD, Shen JC, Kamath-Loeb AS, Blank A, Sopher BL,

Martin GM, Oshima J, Loeb LA (1997) The Werner

syndrome protein is a DNA helicase. Nat Genet 17(1):

100–103

Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ,

Cordon-Cardo C, Hannon GJ, Lowe SW (2003) An epi-

allelic series of p53 hypomorphs created by stable RNAi

produces distinct tumor phenotypes in vivo. Nat Genet

33(3):396–400

Huang S, Li B, Gray MD, Oshima J, Mian IS, Campisi J (1998)

The premature ageing syndrome protein, WRN, is a

30 ? 50 exonuclease. Nat Genet 20(2):114–116

Huschtscha LI, Thompson KV, Holliday R (1986) The sus-

ceptibility of Werner’s syndrome and other human skin

fibroblasts to SV40-induced transformation and immor-

talization. Proc R Soc Lond B Biol Sci 229(1254):1–12

Karmakar P, Bohr VA (2005) Cellular dynamics and modu-

lation of WRN protein is DNA damage specific. Mech

Ageing Dev 126(11):1146–1158

Kipling D, Davis T, Ostler EL, Faragher RG (2004) What can

progeroid syndromes tell us about human aging? Science

305(5689):1426–1431

Kudlow BA, Kennedy BK, Monnat RJ Jr (2007) Werner and

Hutchinson-Gilford progeria syndromes: mechanistic

basis of human progeroid diseases. Nat Rev Mol Cell Biol

8(5):394–404

Lebel M, Leder P (1998) A deletion within the murine Werner

syndrome helicase induces sensitivity to inhibitors of

topoisomerase and loss of cellular replicative capacity.

Proc Natl Acad Sci USA 95:13097–13102

Lowe J, Sheerin A, Jennert-Burston K, Burton D, Ostler EL,

Bird J, Green MH, Faragher RG (2004) Camptothecin

sensitivity in Werner syndrome fibroblasts as assessed by

the COMET technique. Ann N Y Acad Sci 1019:256–259

Machwe A, Xiao L, Lloyd RG, Bolt E, Orren DK (2007)

Replication fork regression in vitro by the Werner syn-

drome protein (WRN): Holliday junction formation, the

effect of leading arm structure and a potential role for

WRN exonuclease activity. Nucleic Acids Res

35(17):5729–5747

Montgomery RA, Dietz HC (1997) Inhibition of fibrillin 1

expression using U1 snRNA as a vehicle for the presen-

tation of antisense targeting sequence. Hum Mol Genet

6(4):519–525

Ogburn CE, Oshima J, Poot M, Chen R, Hunt KE, Gollahon

KA, Rabinovitch PS, Martin GM (1997) An apoptosis-

inducing genotoxin differentiates heterozygotic carriers

for Werner helicase mutations from wild-type and

homozygous mutants. Hum Genet 101(2):121–125

Okada M, Goto M, Furuichi Y, Sugimoto M (1998) Differen-

tial effects of cytotoxic drugs on mortal and immortalized

B-lymphoblastoid cell lines from normal and Werner’s

syndrome patients. Biol Pharm Bull 21(3):235–239

Opresko PL, Calvo JP, von Kobbe C (2007) Role for the

Werner syndrome protein in the promotion of tumor cell

growth. Mech Ageing Dev 128(7–8):423–436

Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, Conklin DS

(2002) Short hairpin RNAs (shRNAs) induce sequence-

specific silencing in mammalian cells. Genes Dev

16(8):948–958

Pichierri P, Franchitto A, Mosesso P, Palitti F (2000) Werner’s

syndrome cell lines are hypersensitive to camptothecin-

induced chromosomal damage. Mutat Res 456(1–2):45–57

Poot M, Gollahon KA, Rabinovitch PS (1999) Werner syn-

drome lymphoblastoid cells are sensitive to camptothecin-

induced apoptosis in S-phase. Hum-Genet 104(1):10–14

Rodriguez-Lopez AM, Jackson DA, Iborra F, Cox LS (2002)

Asymmetry of DNA replication fork progression in

Werner’s syndrome. Aging Cell 1(1):30–39

Rodriguez-Lopez AM, Whitby MC, Borer CM, Bachler MA,

Cox LS (2007) Correction of proliferation and drug sen-

sitivity defects in the progeroid Werner’s Syndrome by

Holliday junction resolution. Rejuvenation Res

10(1):27–40

Rossi ML, Ghosh AK, Bohr VA (2010) Roles of Werner

syndrome protein in protection of genome integrity. DNA

repair 9(3):331–344

Shen JC, Gray MD, Oshima J, Kamath Loeb AS, Fry M, Loeb

LA (1998) Werner syndrome protein. I. DNA helicase and

DNA exonuclease reside on the same polypeptide. J Biol

Chem 273(51):34139–34144

Sidorova JM, Li N, Folch A, Monnat RJ, Jr (2008) The RecQ

helicase WRN is required for normal replication fork

progression after DNA damage or replication fork arrest.

Cell Cycle 7(6):796–807

Sledz CA, Williams BR (2004) RNA interference and double-

stranded-RNA-activated pathways. Biochem Soc Trans

32(Pt 6):952–956

Biogerontology (2012) 13:49–62 61

123

Suzuki N, Shimamoto A, Imamura O, Kuromitsu J, Kitao S,

Goto M, Furuichi Y (1997) DNA helicase activity in

Werner’s syndrome gene product synthesized in a bacu-

lovirus system. Nucleic Acids Res 25(15):2973–2978

Yu CE, Oshima J, Fu YH, Wijsman EM, Hisama F, Alisch R,

Matthews S, Nakura J, Miki T, Ouais S, Martin GM,

Mulligan J, Schellenberg GD (1996) Positional cloning of

the Werner’s syndrome gene. Science 272(5259):258–262

62 Biogerontology (2012) 13:49–62

123