Plant and Soil204: 21–34, 1998.© 1998Kluwer Academic Publishers. Printed in the Netherlands.

21

Rapid identification of Rhizobiumstrains by targeted PCR fingerprinting

X. Perret and W.J. BroughtonLaboratoire de Biologie Mol´eculaire des Plantes Sup´erieures, University of Geneva, 1 chemin de l’Imp´eratrice,1292 Chamb´esy, Geneva, Switzerland∗

Key words:genomic fingerprinting, PCR amplification,Rhizobiumstrains

Abstract

Numerouspolymerasechainreaction (PCR) based procedures are routinely used to produce genomic fingerprintsof prokaryotes. Many of them have drawbacks however such as sensitivity to experimental variation, lack ofreproducibility, poor resolution and the inability to distinguish between closely related strains. To overcome thesedifficulties, we developed an alternative procedure,TargetedPCR Fingerprinting (TPF) which is based upon theamplification of few but carefully selected markers, followed by high resolution RFLP analysis of the amplifiedDNA fragments. In contrast to most fingerprinting protocols that use low resolution agarose gels, TPF patternsare produced on denaturing polyacrylamide gels which allow the precise recording of the genomic fingerprints.TPF analysis, which can simultaneously process 96 samples in less than 12 h and remains unaffected by slightexperimental variations, is particularly adapted for the rapid identification of target strains amongst many fieldisolates. Using PCR primers specific for thenifH andrecAgenes, this procedure was also sufficiently sensitive todiscriminate betweenRhizobiumspecies NGR234 andR. fredii USDA257, two closely related bacteria in whichthe symbiotic loci are 98% homologous. Interestingly, comparison of several of their symbiotic genes as well as thepartial DNA sequences of their 16S rDNA andrecAgenes suggest that chromosomes and symbiotic plasmids didnot co-evolve, but that symbiotic functions were acquired by lateral gene transfer long after NGR234 and USDA257diverged from their common ancestors. In this respect, TPF fingerprints produced with distinct chromosomal andplasmid born markers, such as therecAand thenifH genes in NGR234 and USDA257, are probably more likelyto detect lateral transfer of genes in bacterial field-populations than procedures relying on the amplification ofnumerous fragments of unknown genomic position and biological function.

Introduction

Rapid and unambiguous identification of markerstrains among field isolates has greatly benefited fromrecent advances in DNA fingerprinting methods basedon the polymerase chain reaction (PCR). Random am-plified polymorphic DNA PCR (RAPD-PCR, Berg etal., 1994; Dooley and Harrison, 1993; Williams etal., 1990), the interspersed repetitive sequences PCR(rep-PCR, Versalovic et al., 1991, 1994) or the finger-printing of bacterial genomes using ribosomal genesor operons (see Schmidt, 1994) are now routinelyused to index prokaryotes. These techniques possess

∗ FAX No: +41 22 9061741. E-mail: broughtw@sc2a.unige.chPlant and Soilis the original source of publication of this article.It is recommended that this article is cited as:Plant and Soil204:21–34, 1998.

several advantages over more common cell-typingmethods utilising plasmid DNA profiles, nutritionaltraits, resistance to antibiotics or phages, reaction ofmicro-organisms to specific anti-sera, etc. Generally,PCR based typing methods do not require extensiveresearch and development before being implementedon a specific bacterial strain. Many of the publishedoligonucleotide primers, such as those designed forthe amplification of 16S rRNA genes, match mostprokaryotic genomic backgrounds. Moreover, sincePCR amplification requires only minute amounts oftemplate DNA, cell typing can be directly performedon nodule and soil extracts (Pillai et al. 1992) elimi-nating the need to cultivate the isolated bacteria.

Although PCR based techniques are faster andgenerally superior to more classical cell typing meth-ods, many present important disadvantages. For exam-

22

ple, RAPD-PCR relies on amplification of numerousDNA fragments that represent distinct genomic re-gions, presumably dispersed throughout the targetgenome and bordered by inverted sequences homolo-gous to the PCR primers. Because of the short primerlength (generally 10-mer’s), and the need to gener-ate a sufficient number of DNA fragments for reliablecharacterisation of the template genomic DNA, lowstringency annealing temperatures are generally used(Berg et al., 1994). Hence, minute variations in theconcentration and purity of template DNA, as well asthe amount of primers andTaqpolymerase, may affectthe efficiency with which strains can be discriminated(Berg et al., 1994). For this reason, well-optimisedand uniform conditions of amplification are essentialto ensure reproducibility.

In contrast, rep-PCR procedures which use longerand thus more discriminatory primers of 18–24 bases(Versalovic et al., 1994), mostly avoid the problemof non-specific amplification of artifactual DNA frag-ments by using annealing temperatures higher than 40◦C (Ellsworth et al., 1993). According to Versalovicet al. (1994) however, rigorous comparative analy-ses require accurate quantification of template DNAand fingerprint patterns of at least 8–15 bands. Fur-thermore, size fractionation of amplified fragmentsranging in size from several hundred bp to more than3 kb is best carried out on large agarose gels. Al-though agarose matrices are more convenient to usethan thin acrylamide gels, their resolution is lowerand they often fail to discriminate between fragmentsof apparently similar sizes but of different nucleotidesequences.

Unlike RADP- and rep-PCR, the ARDRA andITS-PCR methods which are based upon the analy-sis of ribosomal genes/operons and 16–23S intergenicregions respectively, are probably less susceptible toexperimental variation (Arturo et al., 1995; Laguerreet al., 1994; Schmidt, 1994). The existence of varioussets of primers which guarantee the amplification ofmost prokaryoticrrn loci facilitate the adaptation ofsuch fingerprinting techniques to strains of interest.Unfortunately, the high degree of molecular conser-vation of ribosomal genes impairs the accurate dis-crimination of closely related strains (Fox et al., 1992;Oyaizu et al., 1993), and render these methods prob-ably more appropriate to phylogenetics or molecularevolution studies. Furthermore, genomic fingerprintsof single genetic loci, cannot reflect the genetic andstructural complexity ofRhizobiumgenomes whichare generally partitioned into several replicons. InR.

meliloti andR. etli, large extrachromosomal repliconsrepresent almost half the total genomic DNA (Sobralet al., 1991; Martinez et al., 1990), and carry symbi-otic loci as well as genes necessary for survival in therhizosphere (Mercado-Blanco and Toro, 1996). Sig-nificant phenotypic changes such as altered symbioticproperties, have been associated with major genomicre-arrangements (large deletions and duplications, forreview Martinez et al., 1990) or by the lateral transferof genes (Amábile-Cuevas and Chicure, 1992).

To overcome these limitations, we developed an al-ternative method of genomic fingerprinting. TargetedPCR Fingerprinting (TPF) is based on the amplifi-cation of a few specific DNA targets, selected torepresent distinct replicons, and phenotypically im-portant genes or operons. Analysis of the amplifiedproducts by restriction fragment length polymorphism(RFLP) was carried out on high-resolution denaturingpolyacrylamide gels. Separation of the fingerprint pat-terns, together with a 3 bp reference ladder, enabledprecise recording of the fragment’s position and fa-cilitated the comparison of many different bacterialstrains. This protocol is rapid since the whole pro-cedure, from PCR amplification to development ofthe bacterial fingerprints, took less than 12 h, and asmany as 96 templates could be processed simultane-ously. The efficiency of this protocol was assessedby analysing differentRhizobiumandBradyrhizobiumstrains, using therecAandnifH genes as targets. Thisway, characterization of both a conserved chromoso-mal locus and an essential symbiotic gene providesa way of monitoring possible horizontal transfer ofsymbiotic functions, especially when these are carriedby a self-transmissible Sym-plasmid as inRhizobiumsp. NGR234 (Freiberg et al., 1997). Furthermore,comparison of two closely related strains, such asNGR234 andR. frediiUSDA257 (Jarvis et al., 1992),confirmed that TPF is sensitive enough to discrimi-nate between highly homologous loci. Comparativeanalysis of the partial 16S rDNA andrecAnucleotidesequences together with those of three distinct sym-biotic loci provides new insights in the evolution ofNGR234 and USDA257 genomes.

Materials and Methods

Microbiological techniques

Strains are listed in Table 1.E. coli recombinantswere grown on Luria-Bertani medium or in Terrific

23

Table 1. Bacterial strains used in this work

Bacteria Relevant characteristics References

Escherichia coliDH5α recA1, ϕ80 lacZ1M15 Hanahan, 1983

Rhizobiumsp. NGR234 broad host-range, isolated Stanley et al., 1988

from Lablab purpureus, RifR

R. frediiUSDA257 broad host-range, isolated Heron et al., 1984

from Glycine soja, KmR

B. elkaniiUSDA76 isolated fromGlycine max Kuykendall and Saxena, 1992

R. melilotiRCR2011 = SU47, wild type isolate Rosenberg et al., 1981

Fix+ onM. sativa, SmR , TcR

R. loti NZP4010 NZP2037 derivative cured of

cryptic plasmid, Nod+ onLotus

pedunculatus, RifR , SmR Chua et al., 1985

R. tropiciCIAT899 wild-type isolate from

Phaseolus vulgaris Vargas et al., 1990

Broth (Sambrook et al., 1989). Strains ofRhizo-bium were grown in/on tryptone-yeast (TY) medium(Beringer, 1974) orRhizobium minimal medium(RMM; Broughton et al., 1986). Antibiotic concen-trations were used as follows: rifampicin (Rif) at50µg mL−1 for Rhizobiumsp. NGR234, kanamycin(Km) 50µg mL−1 for R. fredii USDA257 and ampi-cillin (Ap) 100 µg mL−1 for the Bluescript/DH5αrecombinant clones.

DNA isolation

Small scale preparation ofRhizobiumgenomic DNAwas carried out as in Chen and Kuo (1993). CsCl gra-dient grade genomic DNA was prepared as follows:cultures grown in 150 mL of TY or RMM mediumwere centrifuged at 6000g, 5 ◦C for 10–15 min.Pellets were resuspended in 25 mL of TE (10 mMTris-HCl pH 7.6, 1 mM EDTA) containing 100 mgof lysozyme, and incubated for 15 min at 37◦C toprovoke lysis. Bacterial debris was precipitated byadding 9 mL of 5M potassium acetate followed by a10 min incubation on ice. After 15 min centrifugationat 10,000g at 5◦C, nucleic acids were recovered fromthe clear supernatant by adding 70 mL of ethanol, in-cubating 30 min at−20 ◦C and centrifuging 20 min at17,000g. DNA pellets were washed with 70% ethanol,dried briefly and resuspended in 4 ml of TE. Gradientsprepared by adding 4.4 g of CsCl to each ethidiumbromide containing DNA solution, were then cen-trifuged to equilibrium. Bluescript KS+ (Stratagene,La Jolla, CA, USA) recombinants were prepared by

standard alkaline-lysis mini-prep methods (Sambrooket al., 1989).

PCR amplification and Targeted PCR Fingerprinting

PCR amplifications were carried out in a PTC-100programmable thermal controller (MJ Research Inc.,Watertown, MA, USA). Primers and their nucleotidesequences are listed in Table 2. The amplificationconditions used are reported in Table 3. Reaction mix-tures of 100µL contained ca. 0.2–1µg of templategenomic DNA, 10 mM tris-HCl (pH 8.3), 50 mMKCl, 1.5 mM MgCl2, 0.01% (w/v) gelatin, 200µMdNTPs, 0.7µM of each of the required primers(RecA1/RecA2, NifH1/NifH2, Y1/Y3 or P25; Ta-ble 2) and 0.5 U ofTaq DNA polymerase. 10µLaliquots of the PCR products were migrated on 1.2%agarose gels to assess the specificity of the ampli-fication, while the rest of the amplified DNA wasprecipitated with ethanol. DNA pellets were washedwith 70% ethanol, dried briefly and re-suspended in20 µL of TE buffer. Fingerprinting (see diagram inFigure 1) was carried out in heat-resistant V-shaped210 µL 96 well micro-titer plates (Corning CostarCorporation, One Alewife Center, Cambridge, MA,USA): 2 µL DNA aliquots of precipitatednifH andrecA PCR products were mixed with 4µL of finger-print mix containing 100 mM NaCl, 10 mM tris-HCl,10 mM MgCl2, 1 mM dithiothreitol (pH 7.0 at 25◦C),3 U of Sau3AI, 1 U of Klenow DNA polymerase, 0.2µL of 35S-dATP, 1 mM dGTP, 1 mM dTTP and 1 mMdCTP. Reactions were incubated for 45 min at 37◦Con the PTC-100 thermo-cycler, terminated by the addi-

24

Table 2. Nucleotide sequence of PCR primers

Primer Nucleotide sequence Approximate References

TM (in ◦C)

P25 5′__TATTTATTCCGGCCAATCATCCGC__3′ 70 Kay et al., 1994

NifH1 5′__CGTTTTACGGCAAGGGCGGTATCGGCA__3′ 86 This work

NifH2 5′__TCCTCCAGCTCCTCCATGGTGATCGG__3′ 84 This work

RecA1 5′__CATGCRCTGGATCCGGTCTATGC__3′ 73 This work

RecA2 5′__CTTGTTCTTGTCGACCTTGACGCG__3′ 74 This work

Y1 5′__TGGCTCAGAACGAACGCTGGCGGC__3′ 80 Young et al., 1991

Y2 5′__CCCACTGCTGCCTCCCGTAGGAGT__3′ 80 Young et al., 1991

Y3 5′__TACCTTGTTACGACTTCACCCCAGTC__3′ 78 Young et al., 1991

Notes:R in the RecA1 primer corresponds to a nucleotide of either G or A. TheBamHI andSalI restrictionsites internal to the RecA1 and RecA2 primers respectively, are in italics.

Table 3. Conditions of PCR amplification

Type of PCR P25 RAPD-PCR 16S rDNA PCR recAPCR nifH PCR

First denaturationb 30 s at 94◦C 30 s at 94◦C 30 s at 94◦C 30 s at 94◦C

5 cycles Denaturation 30 s at 94◦C 30 s at 94◦C 30 s at 94◦CAnnealing AT1c 45 s at 30–60◦C 30 s at 55◦C 30 s at 55◦CPolymerization 2 min at 72◦C 45 s at 72◦C 1 min at 72◦C

30 cyclesa Denaturation 30 s at 94◦C 30 s at 94◦C 30 s at 94◦C 30 s at 94◦CAnnealing AT2c 45 s at 36–65◦C 45 s at 65◦C 30 s at 62◦C 30 s at 65◦CPolymerization 2 min at 72◦C 100 s at 72◦C 45 s at 72◦C 1 min at 72◦C

Final step 5 min at 72◦C 5 min at 72◦C 5 min at 72◦C 5 min at 72◦Ca35 cycles were used for amplification of 16S rDNA.bIn PCR amplifications from fresh cells or nodule extracts, the initial denaturation step was extended to 3 min.cThe different annealing temperatures AT1 and AT2 used for the P25 RAPD-PCR are also reported in Figure 3.

tion of 4µL of Stop Solution (95% formamide, 20 mMEDTA, 0.05% Bromophenol Blue and 0.05% XyleneCyanol FF) and denatured for 10 min at 80◦C. 1.5µLof the fingerprint reactions was separated for 80 min at80–85 W on 6% acrylamide sequencing gels (ModelS2, Life Technologies Inc., Gaithersburg, MD, USA).Autoradiographs were exposed for 1–5 h dependingon signal intensities.

Determination of partial 16S rDNA and recAsequences of NGR234 and USDA257

16S rDNA PCR products ofRhizobiumsp. NGR234andR. fredii USDA257 (amplified using the Y1 andY3 primers, Table 2) were simultaneously restrictedwith EcoRI andXhoI. The resulting ca. 650 bp DNAfragments were recovered from agarose gels usingthe Nucleotrap extraction kit (Macherey-Nagel GmbH& Co., Düren, Germany) and cloned intoEcoRI-XhoI digested Bluescript KS+ vector. The ca. 300

bp SalI restriction fragments of the PCR amplifiedrecAsequences (RecA1 and RecA2 PCR primers, Ta-ble 2) were cloned using a similar procedure. DNAsequences of inserts were determined by the dideoxymethod of Sanger et al. (1977), using double strandedtemplates and the Sequenase II kit (United StatesBiochemical Corp., Cleveland, OH, USA).

Results

Comparison of the 16S rRNA and recA genes ofRhizobiumsp. NGR234 andR. fredii USDA257

Complete sequencing of pNGR234a added to the listof genes known to be highly homologous betweenNGR234 and USDA257 (Freiberg et al., 1997). Inaddition to those likenodABCandnodSU(Krishnanet al., 1992; Relic et al., 1994), these now includenolXWBTUV. To verify whether the same level of con-

25

Figure 1. Diagram showing the different steps of Targeted PCR Fingerprinting. A, PCR amplification of target sequences. B, restrictiondigest and 5′-end-labelling of the PCR amplified products. C, separation onto acrylamide gels. D, exposure of dried gels and development ofautoradiographs.

servation applied to chromosomal loci, we sequencedparts of the 16S rDNA andrecA loci of NGR234 andUSDA257. DNA fragments (1.5 kb) of the 16S rRNAgenes were amplified by PCR using the Y1 (positions20–43 in the 16S rRNA sequence ofE. coli) and Y3(positions 1482–1502) primers (Table 2; Young et al.,1991). In contrast toB. japonicumstrain USDA110which carries only a singlerrn operon (Künding et al.,1995), three copies of each of the ribosomal genes arepresent in the genome of NGR234 (Perret, 1992). Tocompensate for any experimental bias introduced bythe PCR amplification or by the presence of multipleand divergent copies of rDNA sequences, 6 indepen-dent sub-clones were sequenced for each of the twostrains. The 654 bp long DNA sequence of theEcoRI-XhoI fragments internal to the amplified products wasdetermined and compared to similar sequences ofother rhizobia (Figure 2).

The RecA protein is one of the most highly con-served bacterial proteins and has been shown to bea reliable molecular marker in phylogenetic studies(Lloyd and Sharp, 1993). We used the published DNAsequences of therecA genes ofRhizobium meliloti2011 (EMBL accession number X59957),R. legu-minosarumbiovar viciae VF39 (EMBL # X59956),R. leguminosarum phaseoliCNPAF512 (EMBL #X62479) andAgrobacterium tumefaciensC58 (GEN-BANK # ATURECAX) to design the two RecA1 andRecA2 oligonucleotide primers (Table 2). To facilitate

cloning of the 462 bp amplified PCR products, internalBamHI and SalI restriction sites were included intothe RecA1 and RecA2 primer sequences, respectively(Table 2). Comparison of NGR234 and USDA257(Figure 3A) showed that the partialrecA sequencesof both strains differed by 7 nucleotides over the 299bp of the clonedSalI fragment. At the amino acidlevel, only one change (a cysteine residue in NGR234is replaced by an arginine in USDA257) was foundin the 100 amino acids encoded by the two sequences(Figure 3B).

Characterisation of NGR234 and USDA257 byRAPD-PCR

We assessed the ability of RAPD-PCR to discrimi-nate between NGR234 and USDA257 by producinggenomic fingerprints of the two rhizobia using primerP25 (Table 2) which was previously used to charac-teriseB. japonicumstrains (Kay et al., 1994). RAPDpatterns of the two strains were different and didnot reflect the extremely high degree of conserva-tion found in the various symbiotic loci of NGR234and USDA257 (Table 4). To examine whether dif-ferent conditions of PCR amplification would affectthe fingerprint patterns, we tested the effect of variedamounts of template DNA together with a range ofdifferent annealing temperatures (steps AT1 and AT2of the P25 PCR amplifications, Table 3 and Figure 4).

26

Figure 2. Multiple alignment of partial 16S rDNA sequences corresponding to nucleotide positions 774 to 1325 inE. coli. Sequences ofR.fredii strain LMG6217,R. melilotistrain LMG6133 (R. mel.), R. loti strain LMG4284 (R. loti) andR. leguminosarumstrain LMG9518 (R. leg.)were retrieved from the EMBL database under the respective accession numbers X67231, X67222, X67230 and X67233 (Willems et al., 1993).EcoRI andXhoI restriction sites used to clone part of the amplified PCR products are marked, identical bases are replaced with dashes. Gapsintroduced for best-fit alignments are marked with�.

Aliquots of the PCR reactions were loaded side-by-side on a 0.8% agarose gel and run under standardconditions (Figure 4, top). Only three bands of sim-ilar sizes were found when NGR234 and USDA257fingerprints were compared. It is generally assumedthat co-migrating DNA fragments of related profilesshare homologous to identical nucleotide sequences.To detect such homologous fragments in the NGR234and USDA257 fingerprints, a Southern transfer of thegel was probed with a radioactively labelled RAPDfingerprint reaction ofR. fredii USDA257 (Figure 4,bottom). As expected, strong hybridisation signalswere detected with the USDA257 amplified prod-ucts. In contrast, only a single DNA fragment of theNGR234 profiles hybridised weakly, while the strongband of∼=1 kb found in all the USDA257 and NGR234fingerprints did not cross-hybridise. Several conclu-sions can be drawn from this experiment: (i) NGR234

and USDA257 genomic fingerprints generated usingP25 primer are different irrespective of the amplifi-cation conditions used; (ii) despite the length of P25(24 bp instead of 10 used for most RAPD primers),variations in the amount of template DNA and inthe annealing temperatures tend to modify the pro-files; (iii) more generally, co-migrating amplificationproducts in distinct fingerprints do not necessarily rep-resent homologous genomic regions. Thus, in somecases the indexing of the number of co-migratingDNA fragments between different RAPD profiles doesnot seem to be a sufficient criterion for establishingrelationships between organisms.

Characterisation ofRhizobiumstrains by TargetedPCR Fingerprinting

nifH sequences are more highly conserved than thoseof nod genes, presumably because the nitrogenase

27

Figure 3. Panel A: multiple alignment of partialrecAsequences. DNA sequences ofR. meliloti2011 (R. mel. 2011),R. phaseoliCNPAF512(CNPAF512) andR. leguminosarumbiovarviciaesub-strain VF39 (VF39) were retrieved from the EMBL database under the accession numbersX59957, X62476 and X59956. Identical nucleotides are replaced with dashes. Panel B: comparison of the amino acid sequences derived fromthe partialrecAsequences of NGR234 and USDA257.

Table 4. Comparison of coding DNA sequences of chromosomal and Sym-plasmid origins in NGR234 andUSDA257

Chromosomal loci Symbiotic genes of pNGR234a

16S rDNA recA nodABC nolXWBTUV nodSU

Number of substitutions 4 7 19 57 37

Total coding length (in bp) 684 299 2469 4859 2240

Frequency of nucleotide substitution (in %) 0.6 2.3 0.8 1.2 1.7

iron-protein is more sensitive to mutation (Dobert etal., 1994). Thus, irregardless of whether these lociare plasmid or chromosomal, thenifH sequences seemto be ideal markers for symbiotic regions. Multi-ple alignment of thenifH sequences ofB. japonicum110 (EMBL sequence RJNIFH),R. phaseoliCFN-42 (RPNIFH),R. trifolii strain 329 (RTNIFH)and R.meliloti strain 41 (RMNIFH) allowed the design oftwo primers, NifH1 and NifH2 (see Table 2), whichmatch conserved nucleotide sequences bordering a∼=780 bp segment.recA was selected as the secondmarker to represent that portion of the genome whichcarries non-symbiotic but vital genetic functions.

The first step in the production ofnifH and recAfingerprints was the specific amplification from ge-

nomic DNA template of 781 and 462 bp long PCRproducts respectively. Separation on 1.2% agarosegels of aliquots of the amplified DNA fragments en-sured the overall specificity of the PCR reactions (Fig-ure 5). Generally, the proportion of non-specific am-plified fragments can be significantly reduced with anAT1 of 62 ◦C instead of 55◦C (Figure 5,recApanel,lanes 1 and 1′). When high proportions of spuriousfragments compromise the accuracy of the fingerprintpatterns, the correct target sequences can be recoveredfrom the agarose gel and amplified in a second roundof PCR using high fidelity thermophilic DNA poly-merase. This additional step is often necessary in thecase of amplifications performed directly from noduleextracts, which in our experience yield low amounts

28

Figure 4. Top: RAPD genomic fingerprints of NGR234 and USDA257 obtained using the primer P25 with different conditions of annealing(AT1 and AT2 for the first and second annealing steps respectively), and different concentrations of genomic template DNA. The arrows markbands that disappear in the RAPD fingerprints of NGR234 at annealing temperatures higher than 50◦C for the AT1 step. Bottom: Southern blotprobed with a radioactively labelled RAPD fingerprint of USDA257.

29

Figure 5. nifH(top) andrecA (bottom) PCR amplifications using genomic DNA of: 1 and 1′, Rhizobiumsp. NGR234; 2,R. frediiUSDA257;3, R. meliloti 2011; 4,B. elkanii USDA76; 5,R. loti NZP4010 and 6,R. etli CIAT899. m, marker lane with 123 bp reference ladder. Lanesmarked 1 correspond to PCR amplifications carried out with an AT1 annealing temperature of 55◦C, while the lanes labelled 1′–6 used AT1 at62 or 65◦C for recAandnifH amplifications respectively.

of DNA (data not shown). Primers nifH1/nifH2 andrecA1/recA2 have been tested successfully with ge-nomic DNA of different strains such asB. elkaniiUSDA76, R. meliloti 2011, R. loti NZP4010, R.tropici CIAT899 as well as NGR234 and USDA257(Figure 5).

Depending on the number, size and distribution offragments composing the fingerprint patterns, various

endonucleases or combinations of restriction enzymesproducing 5′-protruding ends can be used to cleavethe amplified targets. Although other methods of la-belling can be envisaged (e.g. using fluorescent dyes),the fingerprints reported in Figure 6 were producedby end-labellingSau3AI restriction fragments with35S-dATP. Separation of fingerprint reactions on 6%denaturing acrylamide gels ensured single base-pair

30

Figure 6. nifHandrecAfingerprints of NGR234 (lanes 1 and 1′), USDA257 (lanes 2),R. meliloti2011 (lanes 3),B. elkaniiUSDA76 (lanes 4),R. loti NZP4010 (lanes 5) andR. etliCIAT899 (lanes 6). As in Figure 5, lanes 1 and 1′ correspond to PCR amplifications carried out with AT1at 55◦C and 62◦C, respectively. m, lanes with 3 bp reference ladder. Differences between the NGR234 and USDA257nifH fingerprints aremarked with black arrows.

31

resolution. Depending on the signal intensities, au-toradiograms were developed after exposures as shortas 60 min.nifH and recA fingerprints ofB. elkaniiUSDA76,R. meliloti2011,R. lotiNZP4010,R. tropiciCIAT899, NGR234 and USDA257 were easily distin-guishable (Figure 6). The rare differences found in thenifH fingerprints of NGR234 and USDA257 (markedwith arrows in lane 1′ and 2 of Figure 6), are consis-tent with the high degree of molecular conservationencountered in the symbiotic loci of both strains. Thelower homology found in theirrecA loci is also re-flected in the fingerprint patterns which differ moremarkedly.

Discussion

Comparative studies have shown that USDA257 nodu-lates an exact subset of those of NGR234 (Pueppkeand Broughton, 1998). At the nucleotide level, thealmost perfect conservation of several symbiotic loci,includingnodABC(Relic et al., 1994),nodS(Krishnanet al., 1992) andnolXWBTUV(Balatti et al., 1995),suggests a very close phylogenetic relationship be-tween the two rhizobia. Results from subtractive DNAhybridization and shot-gun sequencing (Perret et al.,1994) confirmed the presence of a limited number ofDNA sequences specific to NGR234 which are dis-persed over about 30 distinct chromosomal regions.Together, these results indicate that both rhizobiaare indeed closely related. The few genomic differ-ences correspond to short and dispersed DNA regionspresumably inherited since NGR234 and USDA257diverged.

Comparative analysis of chromosomal and symbi-otic loci suggest a more intricate situation (Table 4).Frequencies of base substitution derived from the par-tial sequences of two chromosomal loci have beenestablished at 0.6% and 2.3% for the 16S rRNA andrecA genes, respectively. The higher frequency ofbase substitution observed in therecA gene was ex-pected since nucleotide changes in 16S rRNA arerestricted by the fact that large parts of the primary andsecondary structures of the ribosomal RNA are func-tionally important. Surprisingly, all the non-essentialsymbiotic loci analysed showed a higher degree ofmolecular conservation thanrecA, with base substitu-tion frequencies ranging from 0.8% (nodABC), 1.2%(nolXWBTUV) to 1.7% in thenodSUgenes (Table 4).It is remarkable that despite the inactivation of thenodSUpromoter of USDA257 by a 36 bp deletion

down-stream of thenod-box (Krishnan et al., 1992),the overall base substitution frequency of the twogenes remains much lower than within therecA lo-cus. Together with the observation that pNGR234a isself-transmissible and resembles a patchwork of genesof various origins (Freiberg et al., 1997), our resultssuggest that the chromosome and Sym-plasmid didnot co-evolve. Rather, the symbiotic functions seem tohave been acquired by lateral gene transfer long afterNGR234 and USDA257 diverged from their commonancestor. Horizontal gene transfer is a well establishedphenomenon in the prokaryotic kingdom (for reviewsee Amábile-Cuevas and Chicure, 1992), and severalphylogenetic studies have explained the differences inthe evolution rates and phylogenetic trees derived fromthe 16S rDNA andnodCor nodDgenes (Dobert et al.,1994; Oyiazu et al., 1993; Ueda et al., 1995; Young,1993).

Analysis of 16S rRNA sequences is widely usedin modern bacterial taxonomy, and it has been ex-tensively employed to classify rhizobia (Eardly etal., 1992; Jarvis et al., 1992; Laguerre et al., 1993;Segovia et al., 1993; Willems and Collins, 1993;Yanagi and Yamasato, 1993; Young et al., 1991).Two types of regions have been distinguished in the16S rRNA sequence: highly conserved motifs whichare used to define the relationships among distanttaxa, and variable sequences which can be used todiscriminate between genera and species (Dams etal., 1988; Noller, 1984). Recent phylogenetic stud-ies among psychrophilic strains ofBacillus showedhowever that analysis of 16S rRNA sequences is notnecessarily a sufficient criterion to guarantee speciesidentity, but might be effective for the analysis of gen-era and higher orders (Fox et al., 1992). Moreover,Oyaizu et al. (1993) argued that the partial sequenceof 16S rRNA cannot be used for the identificationof rhizobia to the species level, because of the highdegree of molecular conservation. To overcome thisproblem in phylogenetic studies, it is necessary to useother genetic markers which should: (i) have a highermolecular evolution rate than the 16S rRNA gene, but(ii) nonetheless remain sufficiently conserved to allowtheir specific PCR amplification with a unique set ofprimers, (iii) be distributed universally among bacter-ial species, and (iv) not be transmitted horizontally likeplasmid born genes. In this respect, it has been pro-posed that thegyrB gene coding for the sub-unit B ofthe DNA gyrase (Yamamoto and Harayama, 1995) andtherecAlocus (Lloyd and Sharp, 1993) can adequatelyreplace the 16S rRNA in taxonomic studies.

32

The most discriminatory PCR-based fingerprintingmethods available are based on whole genome analy-sis, however. Surprisingly, RAPD profiles producedusing primer P25 did not reflect the presence of longsegments of highly homologous (over 98%) symbioticDNA, which nonetheless represents a significant frac-tion of both NGR234 and USDA257 genomes. Thisfinding, together with time necessary to develop orfind primers better adapted to NGR234 and USDA257,prompted us to develop an alternative strategy. Toaccount for possible horizontal transfer of symbioticgenes, we designed a system of genomic fingerprintingbased on two distinct markers, therecAlocus from thechromosome and thenifH gene(s) which are linkedto plasmids in mostRhizobiumstrains. Two sets ofprimers (RecA1/RecA2 and NifH1/NifH2) were de-signed for the specific PCR amplification of thesetwo target sequences. Even under stringent anneal-ing conditions, these primers are sufficiently universalto permit specific PCR amplification using differentRhizobiumandBradyrhizobiumgenomic backgrounds(Figure 5), and to produce fingerprints which are notaffected by small variations in the experimental pro-cedure. Duplication of thenifHDK operon in manystrains does not affect the quality of the fingerprintpatterns (e.g. NGR234 has two functional copies),since duplicated copies which are significantly differ-ent contribute to polymorphism.Sau3AI RFLP analy-sis of the amplifiedrecA and nifH partial sequencescarried out on denaturing acrylamide gels allowed dis-crimination of highly homologous sequences such asthenifH genes of NGR234 and USDA257 (Figure 6).Separation of the digested PCR products on denatur-ing acrylamide gels provides single base resolution.In closely related strains, nucleotide replacements inrestriction fragments of identical size often producedetectable shifts in mobility. Separation of labelledRFLP patterns alongside a 3 bp reference ladder per-mits the comparison of individual fingerprints pro-duced on distinct gels. Digitalisation of the genomicfingerprints into a comprehensive database could beperformed by scanning the autoradiographs. Finally,Targeted PCR Fingerprinting is rapid since up to 96different samples can be processed simultaneously inmicro-titer plates. Designed to rapidly identify markerRhizobiumstrains among many isolates, this proce-dure is also versatile. Replacement of the primer pairspermit other types of applications, such as the verifica-tion of insertional mutants, or the comparison of largeDNA segments by using long-range PCR amplifica-tion (Perret, 1997). Although the primers presented in

this work have been designed for typingAzo-, Brady-,Rhizobiumstrains, selection of other genetic markerscould be used to target different bacteria includingplant or animal pathogens.

Acknowledgments

We would like to thank R Fellay and T Bjourson forconstructive discussions, and N Amarger for provid-ing some of theRhizobiumstrains used in this study.Financial support for this work was provided by theFonds National Suisse de la Recherche Scientifique(Grant # 31-45921.95) and the International AtomicEnergy Agency, Food and Agriculture Organization ofthe United Nations.

References

Amábile-Cuevas C F and Chicure M E 1992 Bacterial plasmids andgene flux. Cell 70, 189–199.

Balatti P A, Kovács L G, Krishnan H B and Pueppke S G 1995Rhizobiumsp. NGR234 contains a functional copy of the soy-bean cultivar specificity locus,nolXWBTUV. Mol. Plant-MicrobeInteract. 8, 693–699.

Berg D E, Akopyants N S and Kersulyte D 1994 Fingerprinting mi-crobial genomes using the RAPD or AP-PCR method. MethodsMol. Cellular Biol. 5, 13–24.

Beringer J E 1974 R-factor transfer inRhizobium leguminosarum. J.Gen. Microbiol. 84, 188–198.

Broughton W J, Wong C-H, Lewin A, Samrey U, Myint H, Meyerz A H, Dowling D N and Simon R 1986 Identification ofRhizo-biumplasmid sequences involve in recognition ofPsophocarpus,Vigna, and other legumes. J. Cell Biol. 102, 1173–1182.

Chen W P and Kuo T T 1993 A simple and rapid method forthe preparation of gram-negative bacterial genomic DNA. Nucl.Acids Res. 21, 2260.

Chua K J, Pankhurst C E, MacDonald P E, Hopcroft D H, Jarvis BD W and Scott D B 1985 Isolation and characterization of Tn5-induced symbiotic mutants ofRhizobium loti. J. Bacteriol. 162,335–343.

Dams E L, Hendricks Y, van de Peer Y, Neefs J M, Smits G,Vandenbempt I and de Wachter R 1988 Compilation of smallribosomal subunit RNA sequences. Nucl. Acids Res. 16, r87–r173.

Dobert R C, Breil B T and Triplett E W 1994 DNA sequence of thecommon nodulation genes ofBradyrhizobium elkaniiand theirphylogenetic relationship to those of other nodulating bacteria.Mol. Plant-Microbe Interact. 5, 564–572.

Dooley J J and Harrison S P 1993 Phylogenetic grouping and iden-tification ofRhizobiumisolates on the basis of random amplifiedpolymorphic DNA profiles. Can. J. Microbiol. 39, 665–673.

Eardly B D, Young J P W and Selander R K 1992 Phylogeneticposition ofRhizobiumsp. strain Or 191, a symbiont of bothMed-icago sativaandPhaseolus vulgaris, based on partial sequencesof the 16S rRNA andnifH genes. Appl. Environ. Microbiol. 58,1809–1815.

33

Ellsworth B D, Rittenhouse K D and Honeycutt R L 1993 Artifac-tual variation in randomly amplified polymorphic DNA bandingpattern. Biotechniques 14, 214–217.

Fox G E, Wisotzkey J D and Jurtschuk P J 1992 How close is close:16S rRNA sequence identity may not be sufficient to guaranteespecies identity. Int. J. Syst. Bacteriol. 42, 166–170.

Freiberg C, Fellay R, Bairoch A, Broughton W J, Rosenthal A andPerret X 1997 Molecular basis of symbiosis betweenRhizobiumand legumes. Nature 387, 394–401.

Hanahan D 1983 Studies on transformation ofEscherichia coliwithplasmids. J. Mol. Biol. 166, 557–580.

Heron D S and Pueppke S G 1984 Mode of infection, nodula-tion specificity, and indigenous plasmids of 11 fast-growingRhizobium japonicumstrains. J. Bacteriol. 160, 1061–1066.

Jarvis B D W, Downer H L and Young J P W 1992 Phylogenyof fast-growing soybean-nodulating rhizobia supports synonymyof SinorhizobiumandRhizobiumand assignment toRhizobiumfredii. Int. J. Syst. Bacteriol. 42, 93–96.

Kay H E, Coutinho H L C, Fattori M, Manfio G P, Goodacre R,Nuti M P, Basiglia M and Beringer J E 1994 The identificationof Bradyrhizobium japonicumstrains isolated from Italian soils.Microbiology 140, 2333–2339.

Krishnan H B, Lewin A, Fellay R, Broughton W J and PueppkeS G 1992 Differential expression ofnodSaccounts for the variedabilities ofRhizobium frediiUSDA257 andRhizobiumsp. strainNGR234 to nodulateLeucaenaspp. Mol. Microbiol. 6, 3321–3330.

Kündig C, Beck C, Hennecke H and Göttfert M 1995 A single rRNAgene region inBradyrhizobium japonicum. J. Bact. 177, 5151–5154.

Kuykendall L D and Saxena B 1992 Genetic diversity inBradyrhi-zobium japonicumJordan 1982 and a proposal forBradyrhizo-bium elkaniisp. nov. Can. J. Microbiol. 38, 501–505.

Laguerre G, Fernandez M P, Edel V, Normand P and Amarger N1993 Genomic heterogeneity among FrenchRhizobiumstrainsisolated fromPhaseolus vulgaris. L. Int. J. Syst. Bacteriol. 43,761–767.

Laguerre G, Allard M R, Revoy F and Amarger N 1994 Rapid iden-tification of rhizobia by restriction length polymorphism analysisof PCR-amplified 16S rRNA genes. Appl. Environ. Microbiol.60, 56–63.

Lloyd A T and Sharp P M 1993 Evolution of therecAgene and themolecular phylogeny of bacteria. J. Mol. Evol. 37, 399–407.

Martinez E, Romero D and Palacios R 1990 TheRhizobiumgenome.Crit. Rev. Plant Sci. 9, 59–93.

Massol-Deya A A, Odelson D A, Hickey R F and Tiedje J M 1995Bacterial community fingerprinting of amplified 16S and 16-23Sribosomal DNA gene sequences and restriction endonucleaseanalysis (ARDRA).In Mol. Microbial Ecology Manual 3.3.2. pp1–8.

Mercado-Blanco J and Toro N 1996 Plasmids in rhizobia: the roleof nonsymbiotic plasmids. Mol. Plant-Microbe Interact. 9, 535–545.

Noller H F 1984 Structure of ribosomal RNA. Annu. Rev. Biochem.53, 119–162.

Ochman H and Wilson A C 1987 Evolution in bacteria: evidence fora universal substitution rate in cellular genomes. J. Mol. Evol. 26,74–86.

Oyaizu H S, Matsumoto S, Minamisawa K and Gamov T 1993Distribution of rhizobia in leguminous plants surveyed by phylo-genetic identification. J. Gen. Appl. Microbiol. 39, 339–354.

Perret X, Broughton W J and Brenner S 1991 Canonical orderedcosmid library of the symbiotic plasmid ofRhizobiumspeciesNGR234. Proc. Natl. Acad. Sci. USA 88, 1923–1927.

Perret X 1992 Cartographie physique et génétique du génome deRhizobiumspecies NGR234. Ph.D. Thesis # 2489, University ofGeneva, Geneva, Switzerland.

Perret X, Fellay R, Bjourson A J, Cooper J E, Brenner S andBroughton W J 1994 Subtraction hybridization and shot-gun se-quencing: a new approach to identify symbiotic loci. Nucl. AcidsRes. 22, 1335–1341.

Perret X. 1997 Charactrization of prokaryotic genomes by Tar-geted PCR Fingerprinting: various applications.In BoehringerMannheim PCR-Bibliographie. pp 58–60.

Pillai S D, Josephson K L, Bailey R L and Pepper I 1992 Specific de-tection of rhizobia in root nodules and soil using the polymerasechain reaction. Soil. Biol. Biochem. 24, 885–891.

Relic B, Perret X, Estrada-Garcia M T, Kopcinska J, GolinowskiW, Krishnan H B, Pueppke S G and Broughton W J 1994Nod-factors ofRhizobiumare a key to the legume door. Mol.Microbiol. 13, 171–178.

Rosenberg C, Boistard P, Dénarié J and Casse-Delbart F 1981 Genescontrolling early and late functions in symbiosis are located on amegaplasmid inRhizobium meliloti. Mol. Gen. Genet. 184, 326–333.

Sambrook J, Fritsch E F and Maniatis T 1989 Molecular Cloning:A Laboratory Manual, 2nd edn. Cold Spring Harbor UniversityPress, Cold Spring Harbor.

Sanger F, Nicklen S and Coulson R A 1977 DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,1757–1761.

Segovia L, Young J P W and Martinez-Romero E 1993 Reclassi-fication of AmericanRhizobium leguminosarumbiovarphaseolitype I strains asRhizobium etlisp. nov. Int. J. Syst. Bacteriol. 43,374–377.

Schmidt T M 1994 Fingerprinting bacterial genomes using riboso-mal RNA genes and operons. Methods Mol. Cellular Biol. 5,3–12.

Sobral B W, Honeycutt R J, Atherly A G, McClelland M 1991 Elec-trophoretic separation of the threeRhizobium melilotireplicons.J. Bact. 173, 5173–5180.

Stanley J, Dowling D N and Broughton W J 1988 Cloning ofhemAfrom Rhizobiumsp. NGR234 and symbiotic phenotype of a gene-directed mutant in diverse legume genera. Mol. Gen. Genet 215,32–37.

Ueda T, Suga Y, Yahiro N and Matsugushi T 1995 Phylogeny ofSym plasmids of rhizobia by PCR-based sequencing of anodCsegment. J. Bacteriol. 177, 468–472.

Vargas C, Martinez L J, Megias M and Quinto C 1990 Identificationand cloning of nodulation genes and host-specificity determi-nants of the broad host-rangeRhizobium leguminosarumbiovarphaseolistrain CIAT899. Mol. Microbiol. 4, 1899–1910.

Versalovic J, Koeuth T and Lupski J R 1991 Distribution of repeti-tive DNA sequences in eubacteria and application to fingerprint-ing of bacterial genomes. Nucl. Acids Res. 19, 6823–6831.

Versalovic J, Schneider M, de Bruijn F J and Lupski J R 1994Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods Mol. Cellular Biol.5, 25–40.

Williams J G K, Kubelic A R, Livak K J, Rafalski J A and Tingey SV 1990 DNA polymorphisms amplified by arbitrary primers areuseful as genetic markers. Nucl. Acids Res. 18, 6531–6535.

Willems A and Collins D 1993 Phylogenetic analysis of rhizobiaand agrobacteria based on 16S rRNA gene sequence. Int. J. Syst.Bacteriol. 43, 305–313.

Yamamoto S and Harayama S 1995 PCR amplification and directsequencing ofgyrBgenes with universal primers and their appli-

34

cation to the detection and taxonomic analysis ofPseudomonasputidastrains. Appl. Environ. Microbiol. 61, 1104–1109.

Yanagi M and Yamasato K 1993 Phylogenetic analysis of the familyRhizobiaceae and related bacteria by sequencing of 16S rRNAgene using PCR and DNA sequencer. FEMS Microbiol. Lett.107, 115–120.

Young J P W, Downer H L and Eardly B D 1991 Phylogeny of

the phototropicRhizobiumstrain BTAi1 by polymerase chainreaction-based sequencing of a 16S rRNA gene segment. J.Bacteriol. 173, 2271–2277.

Young J P W 1993 Molecular phylogeny of rhizobia and theirrelatives.In New Horizons in Nitrogen Fixation. Eds. R Pala-cios, J Mora and W E Newton. pp 587–592. Kluwer AcademicPublishers, London.