Application of molecular techniques to studies in Rhizobium ecology: a review

P u b l i s h i n g

Australian Journal of Experimental AgricultureCSIRO PublishingPO Box 1139 (150 Oxford Street)Collingwood, Vic. 3066, Australia

Telephone: +61 3 9662 7614Fax: +61 3 9662 7611Email: [email protected]

Published by CSIRO Publishing for the Standing Committee on Agriculture and Resource Management (SCARM)

w w w. p u b l i s h . c s i r o . a u / j o u r n a l s / a j e a

All enquiries and manuscripts should be directed to:

Volume 41, 2001© CSIRO 2001

Australian Journalof Experimental Agriculture

. . . a journal publishing papers at the cutting edgeof applied agricultural research

© CSIRO 2001 10.1071/EA99171 0816-1089/01/030299

Australian Journal of Experimental Agriculture,

2001,

41

, 299–319

Application of molecular techniques to studies in

Rhizobium

ecology: a review

J. E. Thies

ABC

,

E. M. Holmes

B

and A. Vachot

A

A

Centre for Farming Systems Research, University of Western Sydney-Hawkesbury, Locked Bag No. 1, Richmond, NSW 2753, Australia.

B

Centre for Biostructural and Biomolecular Research, University of Western Sydney-Hawkesbury, Locked Bag No. 1, Richmond, NSW 2753, Australia.

C

Author for correspondence: 722 Bradfield Hall, Department of Crop and Soil Sciences, Cornell University, Ithaca, NY 14853, USA; e-mail: [email protected]

Abstract.

The symbiosis between legumes and their specific root-nodule bacteria, rhizobia, has been employed toimprove agricultural productivity for most of the 20th century. During this time, great advances have been made inour knowledge of both plant and bacterial genomes, the biochemistry of the symbiosis, plant and bacterial signalingand the measurement of nitrogen fixation. However, knowledge of the ecology of the bacterial symbiont has laggedbehind, largely due to a lack of practical techniques that can be used to monitor and assess the performance of thesebacteria in the field. Most techniques developed in the last few decades have relied on somehow ‘marking’individual strains to allow us to follow their fate in the field environment. Such techniques, while providingknowledge of the success or failure of specific strains in a range of environments, have not allowed insight into thenature of the pre-existing rhizobial populations in these sites, nor the interaction between marked strains and thebackground population. The advent of molecular techniques has revolutionised the study of

Rhizobium

ecology byallowing us to follow the flux of a variety of ecotypes within a particular site and to examine how introducedrhizobia interact with a genetically diverse background. In addition, molecular techniques have increased ourunderstanding of how individual strains and populations of root-nodule bacteria respond to changes in theenvironment and how genetic diversity evolves in field sites over time. This review focuses on recently developedmolecular techniques that hold promise for continuing to develop our understanding of

Rhizobium

ecology and howthese can be used to address a range of applied problems to yield new insights into rhizobial life in soil and aslegume symbionts.

Additional keywords:

T-RFLP, genetic diversity, microbial ecology, PCR fingerprinting.

Legume–

Rhizobium

symbiosis in Australian agriculture

300

The varying foci for

Rhizobium

ecological studies

300

Prior techniques employed and their limitations

300

Molecular approaches

301

Extraction of nucleic acids (DNA/RNA)

301

Polymerase chain reaction (PCR)

302

Electrophoresis of nucleic acids

303

DNA sequencing

304

Nucleic acid hybridisation

305

Restriction fragment length polymorphism (RFLP)

306

Amplified fragment length polymorphism (AFLP)

306

Ribotyping

307

Subtractive hybridisation

307

GUS marker gene technology

307

Terminal-restriction fragment length

polymorphism (T-RFLP) analysis

307

Software for similarity analyses

307

Level of resolution

308

Selecting, identifying and monitoring individual strains of rhizobia

309

Strain selection

309

Benchmarking selected strains

309

Quality assurance

310

Monitoring genetic stability

310

Competition for nodule occupancy

310

Molecular approaches to population studies

311

Phylogeny and genetic diversity

311

Environmental interaction and adaptation

313

Genetic exchange

313

Interactions with other microbial populations

313

Conclusions

314

Acknowledgments

314

References

314

300

Abbreviations used:

ARDRA, amplified ribosomal DNArestriction analysis; BOX, interspersed repetitive DNA;CTAB, hexadecyltrimethyl ammonium bromide; DGGE,denaturing gradient gel electrophoresis; ERIC, enterobacterialrepetitive intergenic consensus (sequences); FISH, fluorescent

in situ

hybridisation; HMA, heteroduplex mobility assay; IGS,inter-gene spacer; ITS, internal transcribed spacer; PCR,polymerase chain reaction; RAPD, randomly amplifiedpolymorphic DNA; rDNA, ribosomal DNA; REP, repetitiveextragenic palindromic (sequences); rep-PCR, repetitivesequence based PCR; RFLP, restriction fragment lengthpolymorphism; RP01, a directed (sequence specific) primer of20 nucleotides in length; SSCP, single strand conformationpolymorphism; TBE, Tris–borate EDTA; TGGE, temperaturegradient gel electrophoresis; T-RFLP, terminal-restrictionfragment length polymorphism.

Legume–

Rhizobium

symbiosis in Australian agriculture

The use of rhizobial inoculants in agricultural productionis aimed at ensuring that the most effective microsymbiontoccupies the largest proportion of nodules formed on thetarget host legume in the field. The belief is that if this can beachieved, an increase in legume production will follow. Inclose to 80 years of developments in inoculant technology,we still fall far short of legume production goals (Brockwell

et al.

1995). Although improvements have been made ininoculant formulations and application practices and strainsare now selected on the basis of saprophytic competence aswell as nitrogen fixation capacity, we have yet to exploit fullagronomic value from the symbiosis. This is generallyascribed to several factors: failure of the inoculant strain tosurvive in the soil environment long enough to nodulate thelegume host; failure to compete for nodule occupancy withcompatible rhizobia pre-existing at the site; failure to persistin soil between legume crops; failure to maintain a functionalgenotype; or some combination of these factors.

Commonly, high nodule occupancy by an introducedstrain can be achieved in the first year following application,but falls quite precipitously in subsequent years, particularlywhen site soils already contain a high background ofcompatible rhizobia (e.g. Slattery and Coventry 1993). Thefate of these inoculant rhizobia remains largely unknown. Isthe failure to achieve high nodule occupancy in the yearsfollowing sowing due to poor competitiveness, poorpersistence, genetic instability or is this, in part, simply areflection of our inability to adequately assess what happensto these strains in soil over time?

In order to improve the performance of introduced strains,our knowledge of their fate in the soil environment is critical.

The varying foci for

Rhizobium

ecological studies

Studies in

Rhizobium

ecology have generally focused on(i) the autecology of rhizobia, that is the characteristics andperformance of individual strains or the nature of various

subpopulations of rhizobia in field soils or (ii) the synecologyof rhizobia, where the interaction between the microsymbiontand other microbial populations in soil or the microsymbiontand its legume host are assessed. Only recently has it beenpossible to address these foci simultaneously.

Rhizobial population studies have generally addressedquestions about population diversity, population structure,geographic distribution or ecological adaptation. Whereas,studies on individual strains have largely targeted strainselection for increased nitrogen fixation potential(effectiveness), competitive ability, saprophytic competence,the inoculant technology involved in delivering these strainsto the field and, ultimately, the symbiotic performance ofindividual strains in the field environment. Studies on theinteractions

between rhizobia and their legume hosts havefocused largely on the quantity of nitrogen fixed on differentlegume species in different environments

(see reviews, thisvolume). Studies on interactions between rhizobia and othermicrobial populations in soil have largely focused onincreasing the competitive advantage of rhizobia in fieldsoils (Murphy

et al.

1995; Maier and Triplett 1996; Robleto

et al.

1998

a

, 1998

b

). New studies are beginning to targetrhizobia as potential biocontrol agents (e.g. Simpfendorfer

et al.

1999) and as potential plant growth promotingrhizobacteria in association with non-legumes.

To achieve desired improvements in the agriculturalproductivity of legumes, improved techniques formonitoring strains as individuals, within populations and ininteraction with the host legume and other soil microbes arerequired. This review focuses primarily on molecularapproaches to autecological studies of rhizobia bacteria andthe practical application of these developing technologies.

Prior techniques employed and their limitations

Techniques used before the advent of molecular analysesare generally limited in a variety of ways: (i) by the need toculture rhizobia to perform the analyses; (ii) by the ability tofollow only single strains or, at most, a few strains over timein the field (e.g. antibodies to selected strains or antibioticresistance markers); (iii) by the labour intensity of manytechniques (e.g. protein profiles); and, in many cases, (iv) bylack of the ability to characterise the nature of indigenousrhizobial populations (most marker methods).

Most studies focusing on individual rhizobial strains, andindeed on populations, rely on first isolating the bacteriafrom nodules or soil and maintaining them in culture forfurther study. Almost invariably isolates are made fromnodules. This selection process alone will bias results towardonly those bacteria still capable of forming nodules. Ifintroduced rhizobia have been compromised in this ability,they will not be detected and hence, their survival andpersistence will be underestimated (Hartmann

et al

. 1998).When selecting strains for use as inoculants, nodule

isolates are generally tested for their nitrogen-fixing ability

Molecular tools for

Rhizobium

ecological studies 301

on selected legume hosts. Unless these isolates have been‘marked’ in some way, such as by antibiotic resistancemarkers, multi-locus enzyme electrophoresis profiles,serological markers, biochemical markers or by proteinprofiles, researchers could not reliably tell the differencebetween one strain and another. Most selection protocolsused in the past have not incorporated any strain marking,hence, in initial strain screening, the likelihood of repeatedlytesting the same genotype was high. Once selected, however,strains of interest were generally ‘typed’ for further studyusing at least one of the techniques listed.

Strains of interest in inoculation programs have often hadpolyclonal antibodies prepared specific to them(e.g. programs at the Australian Inoculants Research andControl Service (AIRCS), NSW Agriculture, Gosford, NSW,and the NifTAL Project, University of Hawaii, Paia, Hawaii).While many such antisera may cross-react with closelyrelated strains, techniques such as cross absorption havebeen used to increase their specificity (Hoben

et al.

1994).Regardless, antisera are limited to identification of selectedstrains and tell investigators relatively little about therhizobial community into which introduced strains areplaced. The possibility also exists for bacterial strains to altercell surface markers over time, particularly under highselection pressure (Johnsson

et al.

1998), which may renderspecific antisera of limited value. For some species, such as

Sinorhizobium meliloti

, cross reaction of antisera is socommon that only monoclonal sera have proved useful andeven these have been of limited value.

Antibiotic resistance markers, either intrinsic or induced,have also been used to follow selected strains in the field(Josey

et al.

1979; Bushby 1981; Turco

et al.

1986). Suchmarkers do naturally occur in rhizobial populations, so maybe limited in their discriminatory value or if induced mayrepresent increased ‘genetic load’ which may affect strainfitness in the field, thereby altering the behavior of interestand its observation (Bushby 1981). In addition, as withserology, limited information can be obtained about othermembers of the rhizobial community in soil.

Protein profiles began to provide a window through whichwe could view rhizobial community diversity (Moreira

et al.

1993). However, patterns derived from these analyses arecomplex and fraught with difficulty in their use todiscriminate between closely related isolates. In addition, themethod is simply too labour intensive both in its executionand in its interpretation to use as a routine monitoring tool.

Multi-locus enzyme electrophoresis or allozyme analysisremains the standard for assessing rhizobial diversity,deriving estimates of strain relatedness and unravellingpotential evolutionary pathways (Maynard-Smith

et al.

1993; Martinez-Romero and Caballero-Mellado 1996). Thetechnique is simple in its execution and information derivedfrom it gains robustness with each allozyme analysed(Richardson

et al.

1986). The problems lie in using the

technique as a routine tracking tool. One (or a few)enzyme(s) is generally not adequate for identificationpurposes, nor is it adequate for calculating measures ofpopulation diversity. For these analyses upward of 12–20enzyme loci may need to be examined (Demezas

et al.

1995).This makes it difficult to use this technique for large-scalefield studies. However, for questions on strain relatedness,this remains a highly robust tool (Selander

et al.

1986;Maynard-Smith

et al.

1993; Martinez-Romero andCaballero-Mellado 1996; Jarvis

et al.

1997).

Molecular approaches

Molecular techniques have developed to the point wherethey can now address many of the shortcomings of otherapproaches.

The value of molecular approaches lies in theirrelative ease, their ability to provide information about anddiscriminate between all members of a given community andlack of the need to culture bacteria before analysis. Inaddition, these techniques allow us to track chromosomallylocated genes and p

Sym

plasmid-located genes separately,which should lead to new insights into the mechanisms bywhich strain diversity develops in soils over time.

Molecular methods have revolutionised the study ofmicroorganisms

in situ

, none more so than the polymerasechain reaction (PCR) (Saiki

et al.

1985; Mullis and Faloona1987). The ability to extract DNA from cells containedwithin environmental samples such as soil or water and theuse of this DNA in PCR amplification experiments hasallowed us to detect the presence of very low numbers ofmicroorganisms against a large background microbialpopulation (Pillai

et al.

1992). The application of thistechnology in studying microbial communities

in situ

hasovercome the limitations inherent with traditionalenrichment and isolation techniques, thereby enabling thedetection of organisms yet to be cultivated. As rhizobia areeasily cultured, this is not a critical advantage. However, lackof the need to culture the bacteria allows the presence ofrhizobia to be assessed in soil

between crops and has theadvantage of not relying on the capacity to nodulate for strainassessment — a practice that has recently been shown to biasinterpretation of strain performance (Hartmann

et al.

1998).A variety of molecular methods are currently being

employed in order to specifically monitor the fate ofintroduced rhizobia in soil and to identify rhizobial isolateswithin root nodules. In the sections that follow, we review themost commonly used techniques and their associatedapplications.

Extraction of nucleic acids (DNA/RNA)

A variety of DNA extraction methods may be used whenworking with pure cultures of rhizobia. For use in PCRexperiments, a full hexadecyltrimethyl–ammonium bromide(CTAB) (Murray and Thompson 1980) or phenol–chloroform (Sambrook

et al.

1989) extraction method is

302

not always necessary. Crude lysis (by boiling) of cellsstraight from an agar plate or from a liquid culture is oftensufficient. Our studies at the University of Western Sydney(UWS) have shown that DNA from rhizobia that produce alot of polysaccharide amplifies significantly better in PCRexperiments when extracted by a crude lysis of cells froman agar plate or liquid culture than by the traditionalphenol–chloroform extraction method (A. Vachotunpublished data).

Nucleic acids can be extracted routinely fromenvironmental samples in less than 2 h. The DNA/RNAextracted is of high molecular weight and sufficient qualityto be used in PCR or nucleic acid hybridisation experiments(Porteous

et al.

1997; Yeates and Gillings 1998; Miller

et al.

1999). DNA extracted in this way

has been used in microbialcommunity analyses, e.g. one of the genes involved innitrogen fixation,

nif

H

,

which encodes the iron proteinof dinitrogenase reductase, has been studied in a range ofenvironments including forest soils and leaf litter (Widmer

et al.

1999), termite guts (Kudo

et al.

1998; Noda

et al.

1999)and sediments (Piceno

et al.

1999). Extraction of DNA and subsequent

plasmid profiling ofrhizobia has been used for population analysis (Laguerre

et al.

1992; Moënne-Loccoz

et al.

1994). Eckhardt agarosegels (Eckhardt 1978) are commonly used to separate theplasmids. These plasmids can then be excised from the gel ortransferred onto nylon membranes using Southern blottingtechniques (Sambrook

et al.

1989) and subsequentlyhybridised to specific probes (see below) to examineplasmid-encoded functions. Plasmid-encoded functions canalso be analysed by isolating strain derivatives that are curedof their plasmids. These strain derivatives can be obtainedthrough heat curing procedures (Martinez

et al.

1990) andassociated plasmid-encoded functions studied by usingtechniques that are able to detect loss of function throughpositive selection (Hynes

et al.

1989; Flores

et al.

1993).These methods have allowed

Rhizobium

researchers tosystematically study whole plasmid sets within both

R. etli

and

R. leguminosarum

(Hynes and McGregor 1990; Baldani

et al.

1992; Brom

et al.

1992; Stepkowski

et al. 1993). Thestudy of Rhizobium plasmids based on their size andrestriction fragment length polymorphism (for a descriptionof RFLP see below) has also been used by severalresearchers for assessing strain diversity and for taxonomicevaluation of rhizobial isolates (Demezas et al. 1991;Laguerre et al. 1992).

Polymerase chain reaction (PCR)PCR involves the separation of a double-stranded DNA

template into 2 strands (denaturation), the hybridisation(annealing) of oligonucleotides (primers) to the template andthen the elongation of the primer-template hybrid by apolymerase enzyme (Saiki et al. 1985; Mullis and Faloona1987). The potential target genes for PCR are many and varied,

limited only by available sequence information. The primersmost frequently used in Rhizobium ecological studies aredesigned to target specific DNA fragments, e.g. 16S ribosomalRNA (rRNA) genes, 16S–23S rRNA intergenic spacer regions(Jensen et al. 1993; Gürtler and Stanisich 1996; Laguerre et al.1996; Vinuesa et al. 1998), or genes for nitrogen fixation(Perret and Broughton 1998) and nodulation (Dobert et al.1994; Ueda et al. 1995). Alternatively, primers have beendesigned to target repetitive sequences such as the repetitiveextragenic palindromic (REP) sequence (Higgins et al. 1982;Stern et al. 1984; Versalovic et al. 1991), enterobacterialrepetitive intergenic consensus (ERIC) sequences (Hultonet al. 1991; Versalovic et al. 1991; Niemann et al. 1999) andinterspersed repetitive DNA (BOX) sequences (Martin et al.1992; Versalovic et al. 1994). Rhizobium researchers haveused these primers to obtain ‘PCR-fingerprints’ which areused to characterise rhizobial isolates at the strain level (deBruijn 1992; Laguerre et al. 1996; Schneider and de Bruijn1996; Laguerre et al. 1997; Vinuesa et al. 1998; Niemann etal. 1999; Thies et al. 1999). Arbitrary primers have also beendesigned to generate randomly amplified polymorphic DNA(RAPD) fragments (Harrison et al. 1992; Richardson et al.1995). These are now frequently applied to Rhizobium studiesfor strain discrimination (Harrison et al. 1992; Richardsonet al. 1995; Hebb et al. 1998; Thies et al. 1999). The morecommon oligonucleotides used in PCR-fingerprinting ofrhizobia are listed in Table 1.

Both RAPD primers and repetitive sequence primers canprovide a fingerprint or profile for any particular targetgenome. In general, the annealing temperature at which theprimers (Gonzalez-Andres and Ortiz 1998) are useddetermines whether longer single primers such as RP01(Richardson et al. 1995) or BOXA1R (Versalovic et al.1994) or paired repetitive element (rep) primers such asERIC and REP (Versalovic et al. 1991) actually targetspecific sequences or act as RAPD primers. Gillings andHolley (1997) have shown that standard annealingtemperatures for ERIC primers in PCR experiments allowamplification of products from a variety of bacteria, plants,animals and fungi. Amplification is therefore not necessarilydirected at ERIC elements from enterobacteria. Anotherlimitation of PCR-fingerprinting with RAPD-type primers isthat the fingerprint patterns obtained may vary due to subtlevariations in PCR conditions (Berg et al. 1994; Tommerupet al. 1995; Gillings and Holley 1997). Hence,standardisation of all aspects of PCR both within andbetween laboratories is critical, particularly if resulting dataare to be shared.

The practical applications of PCR-fingerprinting toRhizobium ecological studies are vast. With such a high levelof discrimination, it is possible to identify or ‘benchmark’inoculant strains and thereby confirm unknown rhizobialisolates as inoculant strains (Fig. 1; Hebb et al. 1998). It isalso possible to study strain persistence from 1 year to the

Molecular tools for Rhizobium ecological studies 303

next (Brockwell et al. 1995; Hebb et al. 1998), track thedistribution and spread of rhizobial strains (Frémont et al.1999; Segundo et al. 1999), characterise site populations,monitor genetically modified rhizobia in field soils (Cullenet al. 1998) and assess the outcomes of competition betweenstrains (Niemann et al. 1997a). These applications arediscussed further, later in this review.

Electrophoresis of nucleic acidsAmplified PCR products are most often visualised by

running samples out on an electrophoretic gel and thenstaining the gel with ethidium bromide (e.g. Fig. 1). Analysisof the amplification products is based on the presence andpattern of DNA bands in the gel matrix. Agarose is the mostpopular medium for electrophoretic separation of mediumand large-sized nucleic acids. Agarose has a large workingrange, but poor resolution. Depending on the agaroseconcentration used, nucleic acids between 0.1 and 70 kb insize can be separated. Polyacrylamide gels can also be used.Polyacrylamide is the preferred matrix for the separation ofproteins, single-stranded DNA fragments up to 2000 bases inlength or double-stranded DNA fragments of less than 1 kb.The resolving power of polyacrylamide gels is such that theydistinguish the electrophoretic mobility of macromoleculeson the basis of shape in addition to the more commonlyexploited characteristics of size and charge. This shape-

dependent mobility forms the basis of a suite of techniquesthat exploit inter- and intra-strand nucleotide interactionsand can be used to rapidly screen culture collections for veryfine scale sequence differences that are beyond the capacityof routine hybridisation methods. These techniques includesingle strand conformation polymorphism (SSCP) (intra-strand) (Dewit and Klatser 1994), denaturing gradient gelelectrophoresis (DGGE) (Sheffield et al. 1989), temperaturegradient gel electrophoresis (TGGE) (Wartell et al. 1998)and heteroduplex mobility assays (HMA) (Delwart et al.1993; Espejo and Romero 1998) (all inter-strand). Becausethe electrophoretic mobility of nucleic acids using thesetechniques is highly sequence dependent, these techniquesoffer considerable flexibility to researchers for any screeningprogram aimed at detecting genetic diversity. Indeed, whenproperly optimised, all 4 techniques have been reported to becapable of discriminating single base differences.

Denaturing gradient gel electrophoresis (DGGE). DGGEand TGGE are identical in principle. Both techniques imposea parallel gradient of denaturing conditions alongan acrylamide gel. Double stranded DNA (dsDNA,homoduplex) is loaded and, as the DNA migrates, thedenaturing conditions of the gel gradually increase. InDGGE, the denaturant is generally urea; in TGGE it istemperature. Because native dsDNA is a compact structure,it migrates faster than partially denatured DNA. The

Table 1. List of oligonucleotides frequently used in PCR-fingerprinting of rhizobia

M, A or C; R, G or A; I, inosine

Primer Sequence (5´–3´) Length Reference

RAPD

RP04 GGAAGTCGCC 10 Richardson et al. (1995)

RP05 AGTCGTCCCC 10 Richardson et al. (1995)

Rep

ERIC 1R ATGTAAGCTCCTGGGGATTCAC 22 Versalovic et al. (1991)

ERIC 2 AAGTAAGTGACTGGGGTGAGCG 22 Versalovic et al. (1991)

BOXA1R CTACGGCAAGGCGACGCTGACG 22 Versalovic et al. (1994)

REP1R IIIICGICGICATCIGGC 18 Versalovic et al. (1994)

REP 2 ICGICTTATCIGGCCTAC 18 Versalovic et al. (1994)

rDNA

16S f27 AGAGTTTGATCMTGGCTCAG 20 Lane (1991)

16S r1392 ACGGGCGGTGTGTRC 15 Lane (1991)

16S f1490 TGCGGCTGGATCACCTCCTT 20 Navarro et al. (1992)

23Sr132 CCGGGTTTCCCCATTCGG 18 Ponsonnet and Nesme (1994)

Directed

RP01 AATTTTCAAGCGTCGTGCCA 20 Richardson et al. (1995)

NifH1 CGTTTTACGGCAAGGGCGGTATCGGCA 27 Perret and Broughton (1998)

NifH2 TCCTCCAGCTCCTCCATGGTGATCGG 26 Perret and Broughton (1998)

RecA1 CATGCRCTGGATCCGGTCTATGC 23 Perret and Broughton (1998)

RecA2 CTTGTTCTTGTCGACCTTGACGCGG 25 Perret and Broughton (1998)

304

sequence of a fragment determines the point in the gel atwhich denaturation will start to retard mobility. Sequenceaffects duplex stability by both percentage G + C content andneighboring nucleotide interactions (e.g. GGA is more stablethan GAG).

While the power of DGGE and TGGE to detect diversitywithin a single gel is very high, the sensitivity of thetechnique makes comparisons between gels very difficult.These techniques are therefore of greatest use in apreliminary screening to aid recognition of sample diversity.As with all electrophoretic techniques, the resolving power islimited by the number of bands capable of ‘fitting’ on 1 gel.In practice, no more than 100 distinct sequence types may beresolved despite the single base-pair sensitivity. However,DGGE and TGGE have an advantage over restrictionfragment length polymorphism (RFLP) analyses in offeringgreater sensitivity and requiring less manipulation of thesample. They are also amenable to use with mixed samples.DGGE and TGGE are now frequently being applied inmicrobial ecology to compare the structures of complexmicrobial communities and to study their dynamics (Muyzerand Smalla 1998; el Fantroussi et al. 1999; Heuer et al.1999). Use of DGGE in resolving rhizobial 16S rDNA PCR-products was evaluated by Vallaeys et al. (1997). However,low polymorphism in the 16S rDNA region amplified meantthe technique was unable to resolve PCR products from suchclosely related species. Choice of a different gene to amplify

may lead to better resolution and increase the utility of thistechnique for rhizobial studies.

Pulse field gel electrophoresis. Separation of DNA>100 kb in length cannot be achieved using constant fieldelectrophoresis. Schwartz and Cantor (1984) introduced thefirst pulsed field gel electrophoresis method. Since theadvent of the technique and subsequent variations to it, thesize limit for nucleic acid separations has increased to12 Mb. This technique is most often used in theepidemiological characterisation of bacterial strains thatcause disease as a way of tracking point sources of pollutionor disease outbreaks (Foissaud et al. 1998; Vanderlinde et al.1999). It could potentially be used in Rhizobium studies forcharacterising and identifying symbiotic plasmid (Capelaet al. 1999) types in conjunction with digestion with rarecutting restriction enzymes and/or probes for plasmid-specific genes.

DNA sequencingWe have come a long way since Sanger et al. (1977) first

described the dideoxy chain termination method for DNAsequencing. The advent of fluorescent dyes, improvements ingel matrix technology, cyclic sequencing using a PCRmachine, use of lasers and automated gel analysis now allowup to 800 bases of sequence to be generated or deduced in asingle reaction. Manual sequencing is extremely time-consuming and is very rarely performed in laboratories

Figure 1. PCR-fingerprinting with the directed primer RP01 can be used to identify nodule isolates. Lanes 1, 9 and 14, 100 bp molecularweight marker (Pharmacia). The double intensity band is 800 bp, band immediately below is 792 bp. All other bands are in increments of100 bp. Lane 4, strain WU95; lane 8, strain TA1; lane 13, strain CC286a; lanes 2, 3, 5, 6, 7, 10, 11, 12 are ‘unknown’ nodule isolates. 2.5%agarose gel, run at 90 V for 3 h in 1 × TBE.


nowadays. It is more cost efficient to send your DNA andprimer to a commercial sequencing facility.

The usefulness of DNA sequencing to studies inRhizobium ecology lies in determining gene sequences ofinterest for use in developing more specific primers andgene probes. Gene sequences are submitted to andmaintained within various databases such as the RibosomeDatabase Project or GenBank. Access to these and otherdatabases is available through the Australian NationalGenomic Information Service (ANGIS). The internetaddress for ANGIS and details on subscription can befound at www.angis.org.au. ANGIS also supplies on-linesequence analysis programs. Some databases can beaccessed on an individual basis, e.g. The RibosomeDatabase Project II, Release 8.0, which contains over16 000 aligned prokaryotic sequences with updated on-lineanalyses. This database is maintained by The Center forMicrobial Ecology (CME) at Michigan State Universityand can be accessed either through ANGIS or directlyat: www.cme.msu.edu/RDP/html/index.html. Continueddevelopment of databases through DNA sequencing isessential and is a pre-requisite to good primer design.

Nucleic acid hybridisationNucleic acid hybridisation involves hybridising a discrete

fragment (a probe) of DNA or RNA to a target sequence. Theprobe is generally labelled with a radioisotope or fluorescentmolecule and the target sequence is bound to a nylonmembrane. A positive hybridisation signal is obtained whencomplementary base pairing occurs between the probe and thetarget sequence. This signal is visualised by exposing themembrane to autoradiographic film after removal of anyunbound probe. The type of probe used and how the probe is

labelled determine the applications of nucleic acidhybridisation techniques. For example, oligonucleotide probes(up to 30 nucleotides long) may be used under very stringentconditions which resolve single base-pair mismatches buthave limited sensitivity of detection due to the constraint onthe number of labels that may be attached to the probe. Incontrast, larger DNA fragments may be labelled to highspecific activity but it is difficult to control hybridisationconditions sufficiently to guarantee 100% stringency.

Techniques based upon nucleic acid colony hybridisations(colony blotting) have particular value in rapid screening oflarge numbers of isolates or clone libraries. Such techniquesare used to monitor microbial populations in theenvironment (Sayler and Layton 1990) and have beenapplied to Rhizobium studies to determine nodule occupancy(Hodgson and Roberts 1983), discriminate between strains(Wedlock and Jarvis 1986) and detect symbiotic and non-symbiotic Rhizobium isolates (Laguerre et al. 1993). Probesused in studies on the Rhizobium species either targetplasmid or chromosomally located genes. With the exceptionof most Mesorhizobium species (including the former R. loti)and the bradyrhizobia, nitrogen fixation genes (Pankhurstet al. 1983) and nodulation genes (Chua et al. 1985) areplasmid encoded. There is a large suite of plasmidic andchromosomal probes that have been constructed and used inRhizobium studies (Schofield et al. 1983, 1987; Scott et al.1985; Watson and Schofield 1985; Davis and Johnston 1990;Segundo et al. 1999; Suominen et al. 1999) (Table 2). Theseprobes have been used to study population genetics in thefield (Young and Wexler 1988; Demezas et al. 1991;Hartmann and Amarger 1991; Laguerre et al. 1992, 1993;Demezas et al. 1995; Thies et al. 1999), characterise non-symbiotic rhizobia (Sullivan et al. 1996), characterise alfalfa

Table 2. DNA probes frequently used in Rhizobium studies

Plasmid Insert Reference

pSym

pRt564 4.9 kb EcoRI fragment containing RtRS1 and nifHD genes in pBR328. Schofield et al. (1983)

pRt587 Cloned 14 kb HindIII fragment containing nod genes of R. leguminosarum bv. trifolii in pBR328.

Schofield et al. (1984)

pRt585 Insert contains the entire nifHDK operon. Schofield et al. (1983)

pIJI098 Cosmid containing nodB, C, D1 and nolE gene region (20 kb) from R. leguminosarum bv. phaseoli in pLAFR1.

Davis and Johnston (1990)

pIJI246 Cloned EcoRI fragment (6.6 kb) containing nodE, F, D, A, B, C genes of R. leguminosarum bv. viciae in pSUP202.

Downie et al. (1985)

Chromosomal

pPN101 Insert contains the C4-dicarboxylate transport gene dct. Ronson et al. (1984)

plac12 Cosmid containing chromosomal lac gene region of R. leguminosarum bv. viciae in pLAFR1.

Young and Wexler (1988)

pTY12 ndvB region from R. meliloti 102F34 in pRK290. Dylan et al. (1986)

pGM142R HindIII fragment from RCR2011 chromosome in RP4. Julliot and Boistard (1979)

pPN32 Containing M. loti exopolysaccharide genes. Hotter and Scott (1991)

306

nodulating rhizobia (Segundo et al. 1999) and delineate newbiovars (Wang et al. 1999c).

Nucleic acid probes can be fluorescently labelled andhybridised to identify organisms in situ. These protocols havebeen described extensively in a review by Amann et al. (1995).The advantage of fluorescent in situ hybridisation (FISH) isthe ability to visualise and identify organisms on a microscalein their natural environment (Lee et al. 1999). A modificationof this technique has recently been applied to detectleghemoglobin genes in Phaseolus vulgaris by in situ PCRfluorescent in situ hybridisation (Uchiumi et al. 1998).Such techniques have huge potential for the study ofRhizobium–plant interactions, nodule establishment andnodule occupancy in situ.

Restriction fragment length polymorphism (RFLP)In this technique, DNA purified from rhizobial isolates is

cut with a restriction endonuclease (often EcoR1 or HindIII).The variation (polymorphism) in the length of resulting DNAfragments is visualised by running the DNA fragments on anelectrophoretic gel and staining the gel with ethidium bromidefollowed by illumination under UV light. Thesepolymorphisms are then used to differentiate betweenrhizobial isolates. If chromosomal DNA is cut with restriction

endonucleases then visualisation of fragment polymorphismis difficult because of the large number of fragmentsgenerated. RFLP is rarely used on its own for diversity studies.It is most commonly used in conjunction with Southernblotting followed by nucleic acid hybridisation with anoligonucleotide or gene probe (see Nucleic acid hybridisationsection) or in the restriction digestion of amplified ribosomalgenes (see ARDRA in Ribotyping section).

Amplified fragment length polymorphism (AFLP) This method is based on the PCR amplification of

restriction fragments from a total digest of genomic DNAand is comprised of the following 3 steps: (i) restrictiondigestion of DNA followed by ligation of oligonucleotideadapters, (ii) selective amplification of sets of restrictionfragments (Khan and Maliga 1999), and (iii) gel analysis ofthe amplified fragments (Vos et al. 1995; Mueller andWolfenbarger 1999). Although this technique has not beenused directly in Rhizobium studies it is gaining popularityand has been applied in the analyses of genetic variationbelow the species level, particularly in studies of populationstructure and differentiation, e.g. barley (Ellis et al. 1997),rice (Mackill et al. 1996) and nematodes (Semblat et al.1998) to name a few.

Figure 2. Flow chart demonstrating how the various molecular techniques are interconnected and the type of information thatcan be derived from each (modified from Theron and Chloete 2000).

Fluorescent antibody techniques• Polyclonal• Monoclonal

Culture-dependent techniques• Enrichment and isolation• Viable plate count• Most probable number (MPN)

ENVIRONMENTAL SAMPLE Nucleic acid hybridisationtechniques• DNA reassociation• Reciprocal hybridisationof community DNA

Extracted community nucleic acids

DNA RNA cDNA microarrays

Community rRNA genes

rRNA gene clonesOligonucleotide probes

Community fingerprints• ARDRA• T-RFLP• RAPD• rep-PCR• DGGE• TGGE

rRNA sequences and database

Probe design

Quantitative

dot blot

PCR RT-PCR hybridise

Cloning

Shotgun cloning

Dot/Colony blot

Dot/Southern blot

Southern blot

Sequencing

Excise bands, reamplify & sequence

Screening

Whole cellin situ

hybridisation


RibotypingRibotyping makes use of differences in the chromosomal

positions or structure of rRNA genes to identify or groupisolates of a particular genus or species. Ribotyping has beenshown to be reproducible and hence has gained popularityfor strain fingerprinting (Sivakumaran et al. 1997). The mostfrequently used ribotyping method is to identify RFLPs ofrRNA genes by probing a Southern transfer of restrictedgenomic DNA (Sambrook et al. 1989). Sivakumaran et al.(1997) used the technique to characterise isolates of non-nodulating, Gram-negative soil bacteria that gained thecapacity to nodulate clover once they were crossed withE. coli strain PN200, which contains the cointegrativeplasmid pPN1. Ribotyping combined with DNA-DNAhybridisation and partial 16S rRNA sequencing enabledthem to classify these isolates of soil bacteria into 5 differentspecies of Rhizobium. In this way, Sivakumaran et al. (1997)demonstrated that nod – rhizobia bacteria are an integral partof the soil microbial community regardless of either thepresence of a compatible host legume or the capacity of thebacteria to nodulate it. Similarly, Segovia et al. (1991)described non-symbiotic R. etli isolates that outnumberR. etli symbiotic bacteria in the field.

In contrast to ribotyping, ARDRA (Smit et al. 1997) is usedto look specifically at the fragments produced from therestriction digestion of a ribosomal gene PCR product or inter-gene spacer region (IGS) such as that found between the 16Sand 23S rRNA genes. ARDRA is applicable when targetnucleic acid is scarce and has the advantage over ribotyping ofnot requiring a separate detection step but being visualiseddirectly using gel electrophoresis. ARDRA has been usedextensively in rhizobial ecology studies to characterise isolates(Demezas et al. 1991, 1995; Laguerre et al. 1996; Vinuesa etal. 1998; Guo et al. 1999; Tan et al. 1999).

The relationship between many of the aforementionedtechniques and how each is used in microbial communityanalysis is shown in Figure 2. Amplification of rRNAgenes forms the basis for most of these techniques. Figure2 also includes reference to more traditional approachesused in soil microbiology and indicates how they supportand relate to the new molecular approaches.

Subtractive hybridisationSubtractive hybridisation is an elegant technique that can

be used to generate strain specific DNA probes from highlyhomologous genomes (Bjourson et al. 1992; Cooper et al.1998). This technique is principally based on the removal,from one cell type, of nucleic acid sequences that are sharedwith other cell types, thereby leaving only those sequencesthat are unique to the organism in question. This techniquehas been used to generate strain-specific probes forR. leguminosarum bv. trifolii and R. leguminosarum bv.phaseoli, a group specific probe for R. tropici, and to identifynew symbiotic loci (Cooper et al. 1998).

GUS marker gene technologyIntroduced marker genes are now being used more

frequently in the study of microbial ecology. One such genethat has attracted a lot of attention in rhizobial studies is gusA,which encodes β-glucuronidase (GUS). The reason for this isthat there is no GUS background activity in plants or thebacteria and fungi that interact with them, thereby makinggusA an excellent target gene that can be introduced intoselected bacterial strains and used to study plant–microbeinteractions (Wilson 1995). Basically, gusA is transposed intoeither the chromosome or plasmid of a rhizobial strain whereit is subsequently maintained. Various transposon constructshave been made, which differ in the type of promoters orterminators used and some contain repressor genes such aslacI for control of gusA expression (Wilson 1995; Sessitschet al. 1998). The gusA marker is particularly appropriate forcompetition studies with rhizobia since the detection ofmarked strains is simple to perform. Nodules turn blue whenwashed in a buffer solution containing X-glcA (5-bromo-4-chloro-3-indolyl-β-D-glucuronide), a substrate for gusA.Wilson et al. (1999) have recently evaluated this technique foruse in field-based studies.

Terminal-restriction fragment length polymorphism (T-RFLP) analysis

T-RFLP analysis exploits rapid community DNA extractionmethods, PCR, RFLP, the resolution of polyacrylamide gels andautomated sequencing technology, and 16S rRNA genesequence database information to determine key bacterialgroups present in environmental samples. Liu et al. (1997) usedthis technique to characterise microbial diversity withinbioreactor sludge, aquifer sand and termite guts. This techniqueneed not be restricted to studying the16S rRNA gene. T-RFLPcan be used as a quick screen with any gene to look atdifferences between communities in environmental samples.The real advantage of this technique is that it simplifies data toa manageable number of bands, i.e. reducing an ARDRApattern to one visualised fragment per organism. Current studiesat UWS are applying the T-RFLP technique to characterizemicrobial diversity within rhizospheres of wheat plantssubjected to different tillage regimes in an attempt to elucidatewhy ‘no till’ wheat shows reduced early growth compared withwheat in tilled soils. Other studies at Macquarie University haveapplied T-RFLP to study the internal transcribed spacer region 1(ITS1) in fungal populations in different soils (A. Holmes,Macquarie University pers. comm.).

Software for similarity analysesThe successful application of electrophoresis to

population studies and to systematics relies heavily on thecorrect interpretation of the banding patterns observed onelectrophoretic gels. There are a number of softwarepackages on the market that will compare and score ‘PCR-fingerprint’ banding patterns and produce similarity values

308

for a given set of samples. Such packages includeBioNumerics and GelCompar (Applied Maths, Kortrijk,Belgium), Diversity Database and Molecular Analyst(BioRad, Hercules, CA, USA), RFLP Scan (Scanalytics,Billerica, MA, USA) and Dendron (Solltech Inc., Oakdale,IA, USA). At UWS, we are using Diversity Database inorder to benchmark the mother cultures of all strains usedin the manufacture of Australian rhizobial inoculants(UWS Rhizobium Database). PCR-fingerprints have beengenerated for these strains from 5 different markers,namely RP01, REP, BOXA1R, ERIC and IGS, and theresulting fragment patterns scored alongside a molecularweight marker and stored in the database. This informationwill be used to confirm the validity and genetic stability ofmother culture isolates supplied to the Australianinoculant manufacturers on an annual basis. These datawill also complement the developing database ofRhizobium collections held by the major curators inAustralia (Australian Rhizobium Genebank, J. Howieson,Murdoch University pers. comm.). Fingerprints ofselected strains will appear in the database alongside otherstrain information.

An advantage of using analysis programs such asBionumerics, GelCompar, Molecular Analyst or DiversityDatabase is that fingerprints of individual strains generatedfrom the use of several different markers can be combined(Fig. 3; Vinuesa et al. 1998). Generating a combinedfingerprint in this way increases the robustness of similarityanalyses based on PCR-fingerprints because it reduces theimpact that 1 or 2 minor band differences has on theproduction of similarity matrices.

Level of resolutionGenes change, that is, acquire fixed mutations over time.

The number of differences between 2 homologous sequences

reflects both the evolutionary rate of the sequences and thetime separating them, that is, how long it has been since theyhad a common ancestor. Consequently, different sequencesneed to be selected to resolve variation at differenttaxonomic levels. In general, non-coding DNA evolvesfaster than transcribed DNA, since it is under no selectionpressure to remain unchanged; therefore, intergenic spacerregions evolve more rapidly than other sequences. Next is the‘wobble’ position of protein coding genes and slowest tochange are the structural rRNA genes (Gogarten 1995).

The information that can be obtained from molecularcharacterisation also depends on the analysis technique. 16SrDNA sequencing can aid in assigning species into generaand can be used for determining relationships betweengenera, but the information is frequently unable to resolvedifferences between closely related species (Young andHaukka 1996). To overcome this limitation, one couldadditionally employ the information contained within IGSregions either by sequencing or by RFLP to furtherdiscriminate between closely related species.

Discrimination at the strain level can be achieved usingPCR-fingerprinting with RAPD or rep primers and is alsoreported to be possible using RFLP in conjunction withnucleic acid hybridisation, AFLP and MLEE techniques(Demezas et al. 1991; Mueller and Wolfenbarger 1999).Sequence differences between DNA fragments (notnecessarily genes) can be very quickly assessed usingDGGE, TGGE, SSCP or HMA techniques or by acombination of RFLP, Southern blotting and nucleic acidhybridisation of specific probes. Sequence differencesbetween genes that encode enzymes can be analysed by useof MLEE techniques. The level of resolution required,coupled with study aims, will largely guide the choice oftechnique used for a given study (Table 3).

To add value to the study of Rhizobium ecology atechnique must be specific, that is, yield specific informationabout strains at the level of resolution required; it must berapid and must allow high throughput in order for the largenumber of strains needed for landscape studies to beprocessed with minimum effort. Techniques selected mustallow for the identification of selected isolates, but also giverobust information about the indigenous background andallow for diversity indices to be derived and for strainrelatedness to be estimated. Molecular methods are nowallowing us to pursue these aims in a manner not possiblepreviously. In the next 2 sections of this review, we focus onmethods used to (i) identify and monitor individual strains,and (ii) evaluate population genetic diversity and derive ameaningful phylogeny.

Selecting, identifying and monitoring individual strains of rhizobiaStrain selection

Introducing new legumes into farming systems requiresthat new inoculant strains be continually sought. Standard

Figure 3. Example of how fingerprints generated by the use of ARDRAand 3 different restriction enzymes can be combined to produce a singlepattern that is then analysed by use of cluster analysis (Vinuesa et al. 1998).


techniques for strain selection begin with preparing acollection of nodule isolates from the host of interest andsubsequent testing of isolates for their symbiotic andsaprophytic characteristics. Testing strain effectivenessinvolves inoculating isolates onto test plants under controlledconditions and measuring their performance, typically byassessing plant dry weights after several weeks of growth or bymeasuring plant nitrogen contents (Somasegaran and Hoben1985). Generally, isolates are pre-screened only to ensure thatthey are rhizobia, that is, they are ‘authenticated’ on a suitabletest host. Without a reliable means to characterise isolates, thesame genotype could be authenticated, tested for effectivenessand incorporated into a culture collection in multiple copies. Itis likely that many Rhizobium culture collections containstrain reiteration. Such reiteration is more likely whencollections are made from a single geographic location than itis when collections represent a diverse range of collection sites(Howieson et al. 1995). PCR-fingerprinting can besuccessfully used to pre-select unique isolates beforeglasshouse or field testing (Riffkin 2000) and/or germplasmaccession (UWS Rhizobium Database). In this way,considerable savings in time and resources can be achieved.

Strain selection is now becoming more directed in orderto emphasise either the competitiveness of the strains(Aguilar et al. 1998), some specific genetic pattern betweenthe plant and its symbiont (Kishinevsky et al. 1996; Lafayand Burdon 1998), or some local genetic adaptation of

rhizobia to the soil or to the local cultivars (Paffetti et al.1996; Sessitsch et al. 1997; Hungria et al. 1998; Marsudi etal. 1999; Santos et al. 1999; Segundo et al. 1999; Wang et al.1999a; Zhang et al. 1999).

Benchmarking selected strainsOne of the major successes in molecular tool

development for rhizobial ecology studies has undoubtedlybeen the genetic fingerprinting of rhizobial taxa, whichallows the identification of single strains at a taxonomic levelas specific as the biovar or strain variant. This developmentdates from the beginning of the 1990s with reference topublications on genomic fingerprinting of bacteria in general(Versalovic et al. 1991, 1994) and Rhizobium in particular(de Bruijn 1992; Richardson et al. 1995; Laguerre et al.1996) and has been further developed in our laboratory. Aspreviously mentioned, the ability to fingerprint uniquestrains allows the detection of genotypes displaying superiorcapabilities, such as nitrogen fixation (Niemann et al. 1999),provides rapid screening for specific rhizobial taxa(Santamaria et al. 1999), and constitutes a very powerful toolfor investigating population structure (Niemann et al.1997b). In addition, the success of this technique has alsoprovided a means by which quality assurance of rhizobialstrains used for commercial inoculants can be reliablymonitored (A. Vachot and J. E. Thies unpublished data). Thisis a very economically important application.

Table 3. Molecular markers used at different taxonomic levels of resolution

Level of resolution Target Method Reference

Community DNA 16S rDNA T-RFLP Clement et al. (1998)

16S rDNA DGGE Vallaeys et al. (1997)

16S rDNA TGGE Heuer et al. (1999)

Genus 16S rDNA PCR, sequencing Ludwig et al. (1998)

16S rDNA T-RFLP Clement et al. (1998)

23S rDNA PCR, RFLP Terefework et al. (1998)

Species 16S rDNA PCR, ARDRA, RFLP Vinuesa et al. (1998)

16S-23S rDNA IGS PCR, RFLP Fremont et al. (1999)

Strain Rep elements PCR-fingerprinting Niemann et al. (1999)

RAPDs PCR-fingerprinting Paffetti et al. (1998)

Directed primers PCR-fingerprinting Hebb et al. (1998)

GC-rich arbitrary PCR primers PCR-fingerprinting Gonzalez-Andres and Ortiz (1998)

Gene: plasmid nif or nod genes Nested PCR Widmer et al. (1999)

nifH gene PCR, RFLP Chelius and Lepo (1999)

nfeA gene PCR Hartmann et al. (1998)

Gene: chromosome dct or recA genes Targeted PCR-fingerprinting Perret and Broughton (1998)

leghemoglobin genes FISH Uchiumi et al. (1998)

Gene: plasmid or chromosome

gusA or lacI markers Introduced marker gene technique Wilson et al. (1999)

All levels Specific DNA sequences Subtractive hybridisation Cooper et al. (1998)

310

Quality assuranceIn Australia, mother cultures of strains used in

commercial inoculants are maintained and monitored by theAustralian Inoculants Research and Control Service(AIRCS, NSW Agriculture, Gosford, NSW). Each year,specific strains are tested for their symbiotic capability onthe target legume, performance under field conditions,capacity to fix nitrogen and for selected cultural, biochemicaland serological characteristics (Lupwayi et al. 2000). Oncequality assurance tests have been met, mother cultures aresubcultured and distributed to inoculant manufacturers forthe annual production of rhizobial inoculants. In recentyears, controversy has arisen due to observed variations instrain phenotype over time and variations in straineffectiveness and strain performance in the field. Annually,strain performance against selection criteria is reviewed bythe AIRCS Steering Committee and strains are replaced asbetter microsymbionts pass through rigorous testingprocedures (Hartley et al. 1996).

The AIRCS is responsible for quality assurance of theAustralian mother cultures. Until 1998, no moleculartechniques had been employed to benchmark the mothercultures in terms of their identity, or genetic and phenotypicstability over time. In 1998, controversy over colonydimorphism in the inoculant strain for lucerne, led tomolecular examination and subsequent benchmarking of allmother cultures by PCR-fingerprinting using 5 independentprimers (A. Vachot and J. E. Thies unpublished data). Asignificant outcome of this endeavour was the identificationof 2 strains that yielded identical fingerprint patterns. Thisultimately was determined to have resulted from a culturemix-up that occurred before 1997. Without PCR-fingerprinting, this culture confusion may never have beenuncovered. Annual serological testing by use of antiseraprepared more than 10 years ago failed to identify theproblem as antisera to these strains cross-reacted (E. Hartley,AIRCS pers. comm.). This situation is in agreement withother such reports in the literature (Hebb et al. 1998;Moawad et al. 1998).

Monitoring genetic stabilityAnother concrete application of genetic benchmarking

of rhizobial taxa is the possibility of monitoring inoculantcultures in order to preserve their genetic composition andprevent eventual loss of important symbiotic properties(Mathis et al. 1997). The ability to assess the persistenceand genetic stability of inoculant strains can beparticularly useful in the case of colony morphologyvariants which differ in symbiotic abilities, e.g. nitrogenfixation in Bradyrhizobium (Mathis and McMillin 1996)or where such a pattern is highly suspected (Reeve et al.1997). In conjunction with the annual fingerprinting ofthe Australian inoculant strain mother cultures, we haveestablished a genetic database, the UWS RhizobiumDatabase, against which these strains can be benchmarked

year-to-year and against which field re-isolates can becompared. This developing database can be queried toestablish identity and can also be used to monitor strainvariation over time. The impetus for preparing such adatabase came from controversy over the etiology ofcolony dimorphism in the inoculant strains WSM688 andWSM826, both Sinorhizobium meliloti inoculant strains.Both of these strains exhibit 2 colony types: a very wateryor gummy phenotype and a compact, dry colony type.These phenotypes vary in their symbiotic effectiveness(G. Wingett, I. R. Kennedy and J. E. Thies unpublisheddata). Preliminary PCR-fingerprints, generated from theuse of the RPO1 and REP primers, have yielded similarpatterns between phenotypes, but with repeatable,identifiable differences, indicating the ability of thistechnique to pick up genotypic differences. While it isperhaps ‘lucky’ to detect such a difference with a limitednumber of markers, increasing the number of markersused to track strains of interest will increase the likelihoodof identifying genetic changes in strains over time.

Competition for nodule occupancyAnother very useful application of the genetic

benchmarking of rhizobial taxa involves the post inoculationsurvey where the extent of nodule occupancy by theinoculant strain is assessed (Malek et al. 1998). This isparticularly useful when the inoculant strain is introducedagainst a high background of rhizobia in the soil with all thecompetition, persistence and effectiveness consequencesimplied (Hebb et al. 1998). PCR-fingerprinting can be usedto amplify rhizobial DNA directly from surface-sterilised,squashed nodules, without the need to culture noduleoccupants (Richardson et al. 1995). However, a drawback inthe use of PCR-fingerprinting for identifying noduleoccupants is that nodule occupancy by multiple strainscannot be reliably assessed. Fingerprints derived fromnodules containing multiple strains tend to resemble a singlestrain only (Fig. 4). Selective amplification of a single strain,not necessarily the dominant nodule occupant, may thereforeoccur, hence, dual or multiple occupancy may beunderestimated or overlooked. This may then lead toerroneous conclusions regarding the symbiotic capability ofintroduced strains.

Molecular approaches to population studies Phylogeny and genetic diversity

Phylogenetic studies play an important role in ourknowledge of relationships on both sides of the plant–bacteriasymbiosis. Since the developments in Rhizobium taxonomythat occurred in the early 1990s and the reviews of Young(1996) and Martinez-Romero and Caballero-Mellado (1996),very few studies have been published about the phylogeny ofthe rhizobial group on a large evolutionary scale. Still, highlyconserved ribosomal genes, and in particular the 16S and 23SrRNA genes, appear to be very useful to infer phylogeny


among organisms as distantly related as the different generaincluded in the rhizobial group (Ludwig et al. 1998; Pennisi1998; Terefework et al. 1998). In order to better understand theevolution of the symbiotic partnership, phylogenies based ongenes involved in nodulation (which often belong to multi-gene families) have been recently developed, although theresulting evolutionary pattern remains very complex (Doyle1998). Some authors combine several symbiotic genes or usea combination of symbiotic genes and other markers toinvestigate plant–bacteria co-evolution. Some examples are:the use of nodA and nifH genes (Haukka et al. 1998), the useof nifH, 16S rRNA and ERIC–PCR fingerprinting (Aguilaret al. 1998), and the use of nodDAB, nifH and 16S rRNA (Guoet al. 1999; Tan et al. 1999). However, there are someconflicting results as the factors that appear to have influencedthe evolution of rhizobial symbiotic genes vary in importanceat different taxonomic levels and probably involverecombination events not yet understood (Guo et al. 1999).

Many studies on rhizobial phylogeny and relatednessfocus on the notions of host specificity and/or environmentspecificity. Molecular characterisation of rhizobial isolatesforms the basis for discussion in all of them. These studieshave sought to elucidate the phylogeny of (i) isolatesrecovered from as yet uninvestigated hosts (Delajudie et al.

1998a, 1998b; Nick et al. 1999a; Sterner and Parker 1999),several of these have led to new rhizobial speciesdescriptions, (ii) isolates recovered from well-known hostsgrown in different environments (Young and Cheng 1998;Coutinho et al. 1999; Melchor-Marroquin et al. 1999; Wanget al. 1999b; Zhang et al. 1999), (iii) isolates recovered fromseveral hosts in a given environment (Moreira et al. 1998),and (iv) isolates recovered from several hosts in differentenvironments (Khbaya et al. 1998; Vinuesa et al. 1998; Tanet al. 1999).

The large genetic diversity encountered in rhizobia haschallenged studies intending to either identify the differenttaxa or to enlighten the phylogenetic relationships among thedifferent bacterial groups. Martinez-Romero and Caballero-Mellado (1996 p. 117) acknowledged this recently bypleading for a more critical development of moleculartechniques used for phylogenetic studies: “Yet, for peopleworking with Rhizobium and Bradyrhizobium, it is verydifficult to handle such diversity, and proper and simplermethods to identify and classify Rhizobium bacteria need tobe developed”. The difficulties that need to be overcome forthis task are several: (i) that rhizobia enjoy a very widespreaddistribution, (ii) that very little is known about bacterialevolutionary mechanisms, and (iii) that our generalknowledge of the extent of genetic diversity is limitedbecause we have sampled only a small number of themicrosymbionts associated with the vast diversity oflegumes on the earth (Khan and Maliga 1999). Each of theselimitations is discussed below.

First, an important part of the biodiversity observed inrhizobia may be related to their broad geographical distributionand many questions still remain about the mechanisms by whichthese organisms are distributed across the earth and the factorsthat influence their establishment and survival in a givenenvironment. It is now recognised that there has been extensivenatural radiation with successful diversification of rhizobiaindependent of man’s intervention (Martinez-Romero andCaballero-Mellado 1996). However, the effect of agriculturalpractices, such as selection of strains with a narrow host rangeand wide geographical introductions, have led to an inextricablepuzzle for establishing phylogenetic relationships, making itimpossible to use either geographical location or hostinformation to establish them (Kishinevsky et al. 1996; Lafayand Burdon 1998; Moreira et al. 1998; Frémont et al. 1999; Loiet al. 1999; Melchor-Marroquin et al. 1999). In addition,rhizobia may also be carried on the seed coat, which providesanother mechanism for their broad dispersal (Pérez-Ramirez etal. 1998). Some adaptation of the taxonomy to address thisproblem has been proposed (Sivakumaran et al. 1997). Otherstudies suggest a link between geographical distribution and/orcultivar origin and phylogeny (Segovia et al. 1993; Young andCheng 1998; Zhang et al. 1999). However, these reports remainsomewhat isolated in the literature.

The second important feature of rhizobial geneticdiversity is the fact that, as yet, very little is known about

Figure 4. Illustration of the problem inherent in the use of PCR-fingerprinting to identify a mixed strain infection directly from nodules.DNA was amplified using the directed primer, RP01. Lanes 1 and 7, 100 bpmolecular weight marker (Pharmacia). The double intensity band is 800 bp,secondary band at 792 bp has not been resolved. All bands are 100 bp apart.Lane 2, strain 10B-16; lane 3, strain 0505; lane 4, a mixture of strains 10B-16 and 0505; lane 5, strain WU95 (positive control); lane 6, negativecontrol. Note that the mixture of strains 10B-16 and 0505 resembles onlystrain 0505. 2% agarose gel run at 100 V for 2 h in 1 × TBE.

312

bacterial evolutionary mechanisms, particularly with regardto mechanisms of host plant interaction and chromosomalDNA content of the microsymbiont. Because a large numberof the genes involved in the symbiosis are carried by extra-chromosomal elements, a lot of attention has been given toplasmids, to the detriment of understanding thechromosomal genotype or the interaction between a givenchromosomal background and the symbiotic plasmid (orsymbiotic island) carried. Several rhizobial genomicsprojects are currently in progress, but only one involvessequencing the whole genome of a rhizobial isolate, that ofSinorhizobium meliloti (Laboratoire de BiologieMoléculaire des Relations Plantes–Micro-organismes,INRA, Toulouse, France). Most other studies are interestedexclusively in the chromosomally located symbiotic islandor some specific gene regions on selected plasmids. Thisdiscrepancy between the amount of knowledge accumulatedfor plasmid DNA compared with the bacterial chromosomecontinues, even though evidence suggests that the geneticdiversity of rhizobia populations is indeed distributed onboth the chromosome and the pSym plasmid (Paffetti et al.1996; Wernegreen et al. 1997; Wernegreen and Riley 1999).In some cases, studies have detected little genetic variation inthe symbiotic regions but found higher diversity when usingapproaches targeting the whole genome of the bacteria(Sessitsch et al. 1997; Laeremans et al. 1999). Thus, it is nowrecommended that classification should be based on stable,chromosomally encoded characteristics (Graham et al. 1991;Khbaya et al. 1998; Terefework et al. 1998) and thatphylogenies based exclusively on plasmid-borne genesshould be discouraged, at least until the events ofrecombination and plasmid transfer with other bacteria arebetter understood (Droge et al. 1999). However, a currenttendency is to combine plasmid and chromosomal markersand to compare the agreement between the phylogeniesobtained (Martinez-Romero and Caballero-Mellado 1996;Sterner and Parker 1999; Tan et al. 1999) or to combinemolecular markers and one or more non-molecularapproaches (Jarvis et al. 1997; Frémont et al. 1999; McInroyet al. 1999).

In the same vein and despite the fact that host-basedapproaches are not recommended, some authors look at arange of plant taxa in the same ecological environment in thehope of achieving a better understanding of the large geneticdiversity of their microsymbiont (Moreira et al. 1998;Segundo et al. 1999). Others examine the plant specificityand the host range displayed by rhizobia in order to isolatepatterns linking the plant genotype and the rhizobiapopulation structure (Paffetti et al. 1996, 1998; Gonzalez-Andres and Ortiz 1998; Handley et al. 1998; Loi et al. 1999).Generally, the aim has been to try to establish a biologicallymeaningful taxonomy. This involves a broader genomicscope, with researchers increasing the number of approachesused, or the number of markers looked at, as no ‘miraculous’gene representing the main genetic information from thebacteria has been found yet (and probably never will be).

Developing a biologically meaningful taxonomy alsoinvolves the integration of evolutionary processes that occurin the field, such as gene transfer and exchange mechanisms,and adaptation of rhizobia to the soil conditions (Hungriaet al. 1998; Segundo et al. 1999).

Finally, it is important to keep in mind that, as yet, veryfew legumes have been sampled for their compatiblemicrosymbiont(s) (Phillips 1999), so that the extent of ourknowledge of genetic diversity is limited. In addition, severalstudies have shown that the population obtained from plantnodules, which is the standard sampling method, is unlikelyto be representative of the total population present in soil(Hartmann et al. 1998; Felske et al. 1999; Latour et al. 1999;Wang et al. 1999a). Thus, there is still the hidden part of therhizobia iceberg to explore in terms of taxon diversity andpatterns of symbiotic interaction. Not only do the molecularapproaches need to continue to be developed, but samplingand isolating of new taxa need to be continued as well (Doyle1998; Phillips 1999). The combination of this concertedeffort should, hopefully, lead to a better understandingof rhizobial evolutionary mechanisms and symbioticinteractions in particular.

Not surprisingly, the amount of work that needs to bedone is enormous, but there are reasons to remain optimistic.Recent techniques developed for the study of microbialpopulations, such as T-RFLP (Liu et al. 1997; Clement et al.1998), allow access to the very large proportion of organismsthat are present in the soil and which remain unculturableunder laboratory conditions. Other techniques, such asgenomic subtraction (Cooper et al. 1998), metabolicfingerprinting (Roslev et al. 1998), mini-Tn5 transposonanalysis (Xi et al. 1999) and RFLP analysis of radio-labelledamplified nifH sequences (Chelius and Lepo 1999) willallow us to target, with high specificity, organisms or groupsof organisms at different taxonomic levels. These shouldprove to be useful detection tools in ecological studies. Thesetypes of technical developments open new horizons ofresearch and applications that will allow a far more completeand less biased view of rhizobial biodiversity.

Several of the phylogenetic studies previously cited haveas their focus an assessment of the genetic relatedness of theorganisms considered rather than simply their taxonomy.Studies characterising the genetic diversity of rhizobialisolates recovered from a given host taxon represent a majorpart of the latest publications in the literature. As notedpreviously, very few legumes have been sampled for theirmicrosymbiont(s). Hence, many studies assessing thegenetic diversity of rhizobia populations or taxa for a givenhost (or group of hosts) aim to characterise more effective orbetter adapted strains for particular applications, with sometaxa being described for the first time. Traditional legumehosts are still being examined, such as bean, clover, lentil andsoybean (Aguilar et al. 1998; Moawad et al. 1998; Coutinhoet al. 1999). However, there is increasing interest in woodylegumes, particularly in the tropical species (Delajudie et al.1998b; Moreira et al. 1998; Vinuesa et al. 1998; Frémont et


al. 1999; McInroy et al. 1999; Nick et al. 1999b; Wang et al.1999a).

Environmental interaction and adaptationRecently, and probably related to the new microbial

diversity assessment techniques developed, a new area ofresearch has been focusing on rhizobial genetic diversity indifferent sections of the rhizosphere. It is thus possible to lookat the bacterial community content at different depths in thebulk soil or in different fractions of the rhizosphere(rhizoplane or endorhizosphere). This allows access tosignificant ecological information such as genetic diversity,genus/species/strain distribution patterns, and the isolationand identification of the organisms that are physiologicallyactive for the activity considered, such as nitrogen fixation(Chelius and Lepo 1999; Widmer et al. 1999). These studieshave also shown that plant roots create a selective environmentfor microbial populations (Felske et al. 1999; Latour et al.1999; Marilley and Aragno 1999), including rhizobia(Hartmann et al. 1998). Molecular tools are proving useful formonitoring changes in these bacterial communities that resultfrom changes in external factors (Marilley et al. 1998; Cheliusand Lepo 1999). This capacity to monitor shifts in microbialpopulations has contributed greatly to our understanding ofhow rhizobial selection, adaptation and genetic diversity areinfluenced by external stresses, such as flooding (James andSprent 1999), drought (Mathis et al. 1997), soil acidity(Ibekwe et al. 1997; Segundo et al. 1999; del Papa et al. 1999)or soil pollution by hydrocarbons (Ahmad et al. 1997) orcopper (Smit et al. 1997). Characterisation of the rhizobiaisolates in these genetic diversity studies involves primarilyPCR- and RFLP-based techniques. The DNA hybridisationtechnique is used in the case of well-known organisms such asSinorhizobium meliloti for which specific probes have beendesigned (Niemann et al. 1999). The 16S rRNA gene is themost commonly used molecular marker followed by the rep-PCR primers (REP, ERIC), some RAPDs (e.g. RPO1) and thenifH gene sequences. Other genes are occasionally used suchas the genes involved in nodulation (nod, nfeA genes).

Genetic exchangeWe have come to understand that bacterial chromosomes

and bacterial plasmids have different evolutionary histories(Gogarten 1995). Evidence from medically importantbacteria suggests that plasmid-borne genes encoding specialfunctions, such as antibiotic resistance, enjoy rapidmultiplication in selective environments and are subject towidespread exchange between bacteria of radically differentchromosomal makeup (Cohan 1994). Genetic exchange maybe a major factor contributing to the development ofdiversity in rhizobial populations and may have a stronginfluence on how we monitor and interpret strainperformance in the field (Thies et al. 1999).

Evidence for the role of genetic exchange in generatingdiversity within field populations of rhizobia is mounting(Schofield et al. 1987; Sullivan et al. 1996; Thies et al. 1999).

The most striking evidence that genetic exchange within fieldpopulations hampers our ability to track the fate of introducedstrains is the discovery of the mobile symbiotic island inMezorhizobium loti (Sullivan and Ronson 1998), wheresymbiotic genes are normally integrated into the bacterialchromosome. The relative rapidity with which these geneticshifts can be observed has been surprising. In the NewZealand example (Sullivan et al. 1995), significant lateraltransfer of symbiotic genes occurred within 7 years of strainintroduction. If these researchers had relied on traditionalmethods of strain evaluation, and had a pre-existingbackground of compatible rhizobia at the site, the conclusionmay have been that the inoculant strain did not persist well andwas a poor competitor. However, the complete lack of acompatible background population of lotus rhizobia promptedextensive molecular analysis of the fate of the introducedrhizobia. This led to the landmark discovery of theMezorhizobium loti symbiotic island that clearly enjoyssignificant exchange rates with non-symbiotic rhizobia in thesoil (Sullivan et al. 1995, 1996), despite the chromosomallocation of the symbiotic genes. Hence, substantial geneticexchange is not restricted to genes carried on extra-chromosomal elements (plasmids) and may be playing a moresignificant role as a mechanism of population diversificationin bacterial communities than previously thought (Cohan1994; Sullivan and Ronson 1998).

Interactions with other microbial populationsAn important issue in agronomic production is the

management of pathogens. A recent study has suggested thatrhizobacterial community diversity may be linked to areduction in host plant susceptibility to colonisation bypathogens (Shiomi et al. 1999). This area of research is stillin its infancy, but applications in rhizobial ecology arecurrently under investigation with fingerprinting techniques.Genetic fingerprinting could, of course, allow us to identifyand follow pathogenic strains in epidemiological studies(Niemann et al. 1997b), but it could also aid in identifyingspecific rhizobial strains that might prove useful asbiological control agents. It has been shown recently that thepresence of rhizobia in the rhizosphere could limit thedamage to the host by other organisms such as nematodes(Duponnois et al. 1999) or Phytophthora (Simpfendorferet al. 1999).

ConclusionWe have come a long way in developing our understanding

of rhizobial ecology, but have many milestones yet to meet.Molecular tools offer unparalleled opportunities tocharacterise rhizobia in culture, in nodules and directly fromfield soils. These techniques allow us to simultaneouslyexamine both inoculant strains and the background populationinto which they are introduced. This capability should lead toincreased understanding of the fate of introduced bacteria inthe field. These tools are also allowing us to ask questions atmuch larger geographic scales than have been possible

314

previously. We are now able to examine such issues as: howgenetic diversity develops in field populations of introducedrhizobia and what impact this may have on strainperformance; how lateral gene transfer may be influencing ourability to follow the persistence of introduced rhizobiabetween seasons; and how rapidly rhizobial populationsspread from their point of introduction. Molecular approachesalso provide improved tools for seeking new inoculant strains.Genotypes that enjoy high representation in the soilpopulation are likely to be competent saprophytes, adapted tosite conditions. Pre-adapted strains that are also highlyeffective and genetically stable would then be excellent targetorganisms for future inoculants. Such knowledge should allowus to begin to manage the symbiosis better and designinoculation programs that can achieve the aim of improvedcrop productivity in a range of environments.

AcknowledgmentsWe acknowledge and appreciate the technical assistance

of Judy Gray in all aspects of our laboratory work. This workwas supported by grants from the Grains Research andDevelopment Corporation (UWS20) and the Centre forBiostructural and Biomolecular Research, University ofWestern Sydney-Hawkesbury. We thank Andrew Holmesand John Howieson for review of this manuscript.

ReferencesAguilar OM, López MV, Riccillo PM, Gonzalez RA, Pagano M,

Grasso DH, Pühler A, Favelukes G (1998) Prevalence of theRhizobium etli-like allele in genes coding for rRNA among theindigenous rhizobial populations found associated with wild beansfrom the Southern Andes in Argentina. Applied and EnvironmentalMicrobiology 64, 3520–3524.

Ahmad D, Mehmannavaz R, Damaj M (1997) Isolation andcharacterization of symbiotic N2-fixing Rhizobium meliloti fromsoils contaminated with aromatic and chloroaromatichydrocarbons-paths and PCBS. International Biodeterioration andBiodegradation 39, 33–43.

Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identificationand in situ detection of individual microbial cells withoutcultivation. Microbiological Reviews 59, 143–169.

Baldani JI, Weaver RW, Hynes MF, Eardly BD (1992) Utilization ofcarbon substrates, electrophoretic enzyme patterns and symbioticperformance of plasmid-cured clover rhizobia. Applied andEnvironmental Microbiology 58, 2308–2314.

Berg DE, Akopyants NS, Kersulyte D (1994) Fingerprinting microbialgenomes using the RAPD or AP-PCR methods. Methods inMolecular and Cellular Biology 5, 13–24.

Bjourson AJ, Stone CE, Cooper JE (1992) Combined subtractionhybridization and polymerase chain reaction amplification procedurefor isolation of strain specific Rhizobium DNA sequences. Appliedand Environmental Microbiology 58, 2296–2301.

Brockwell J, Bottomley PJ, Thies JE (1995) Manipulation of rhizobiamicroflora for improving legume productivity and soil fertility:a critical assessment. Plant and Soil 174, 143–180.

Brom S, García de los Santos A, Stepkowski T, Flores M, Dávila G,Romero D, Palacios R (1992) Different plasmids of Rhizobiumleguminosarum bv. phaseoli are required for optimal symbioticperformance. Journal of Bacteriology 174, 5183–5189.

Bushby HV (1981) Quantitative estimation of rhizobia in non-sterilesoil using antibodies and fungicides. Soil Biology and Biochemistry13, 237–239.

Capela D, Barloy-Hubler F, Gatius MT, Gouzy J, Galibert F (1999)A high-density physical map of Sinorhizobium meliloti 1021chromosome derived from bacterial artificial chromosome library.Proceedings of the National Academy of Sciences, USA 96,9357–9362.

Chelius MK, Lepo JE (1999) Restriction fragment lengthpolymorphism analysis of PCR-amplified nifH sequences fromwetland plant rhizosphere communities. Environmental Technology20, 883–889.

Chua KY, Pankhurst CE, MacDonald PE, Hopcroft DH, Jarvis BDW,Scott DB (1985) Isolation and characterization of transposon Tn5-induced symbiotic mutants of Rhizobium loti. Journal ofBacteriology 162, 335–343.

Clement BG, Kehl LE, DeBord L, Kitts CL (1998) Terminal restrictionfragment patterns (TRFPs), a rapid, PCR-based method for thecomparison of complex bacterial communities. Journal ofMicrobiological Methods 31, 135–142.

Cohan FM (1994) Genetic exchange and evolutionary divergence inprokaryotes. Tree 9, 175–180.

Cooper JE, Bjourson AJ, Streit W, Werner D (1998) Isolation of uniquenucleic acid sequences from rhizobia by genomic subtraction:applications in microbial ecology and symbiotic gene analysis.Plant and Soil 204, 47–55.

Coutinho HLC, Oliveira VM, Lovato A, Maia AHN, Manfio GP (1999)Evaluation of the diversity of rhizobia in Brazilian agricultural soilscultivated with soybeans. Applied Soil Ecology 13, 159–167.

Cullen DW, Nicholson PS, Mendum TA, Hirsch PR (1998) Monitoringgenetically modified rhizobia in field soils using the PolymeraseChain Reaction. Journal of Applied Microbiology 84, 1025–1034.

Davis EO, Johnston AWB (1990) Analysis of three nodD genes inRhizobium leguminosarum biovar. phaseoli; nodD1 is preceded bynolE, a gene whose product is secreted from the cytoplasm.Molecular Microbiology 4, 921–932.

de Bruijn FJ (1992) Use of repetitive (repetitive extragenic palindromicand enterobacterial repetitive intergeneric consensus) sequencesand the polymerase chain reaction to fingerprint the genomes ofRhizobium meliloti isolates and other soil bacteria. Applied andEnvironmental Microbiology 58, 2180–2187.

del Papa MF, Balague LJ, Sowinski SC, Wegener C, Segundo E,Abarca FM, Toro N, Niehaus K, Pühler A, Aguilar OM, Martinez-Drets G, Lagares A (1999) Isolation and characterization of alfalfa-nodulating rhizobia present in acidic soils of Central Argentina andUruguay. Applied and Environmental Microbiology 65, 1420–1427.

Delajudie P, Laurentfulele E, Willems A, Torck U, Coopman R,Collins MD, Kersters K, Dreyfus B, Gillis M (1998a) Allorhizobiumundicola gen nov., sp. nov., nitrogen-fixing bacteria that efficientlynodulate Neptunia natans in Senegal. International Journal ofSystematic Bacteriology 48, 1277–1290.

Delajudie P, Willems A, Nick G, Moreira F, Molouba F, Hoste B,Torck U, Neyra M, Collins MD, Lindstrom K, Dreyfus B, Gillis M(1998b) Characterization of tropical tree rhizobia and description ofMesorhizobium plurifarium sp.nov. International Journal ofSystematic Bacteriology 48, 369–382.

Delwart EL, Shpaer EG, Louwagie J, McCutchan FE, Grez M,Rubsamen H, Mullins J (1993) Genetic relationships determined bya heteroduplex mobility assay: analysis of HIV-1 env genes. Science262, 1257–1261.

Demezas DH, Reardon TB, Strain SR, Watson JM, Gibson AH (1995)Diversity and genetic structure of a natural population of Rhizobiumleguminosarum bv. trifolii isolated from Trifolium subterraneum L.Molecular Ecology 4, 209–220.

Demezas DH, Reardon TB, Watson JM, Gibson AH (1991) Geneticdiversity among Rhizobium leguminosarum bv. trifolii strainsrevealed by allozyme and restriction fragment length polymorphismanalyses. Applied and Environmental Microbiology 57, 3489–3495.

Dewit MYL, Klatser PR (1994) Mycobacterium leprae isolates fromdifferent sources have identical sequences of the spacer regionsbetween the 16S and 23S ribosomal RNA genes. Microbiology 140,1983–1987.


Dobert RC, Breil BT, Triplett EW (1994) DNA sequence of thecommon nodulation genes of Bradyrhizobium elkanii and theirphylogenetic relationships to those of other nodulating bacteria.Molecular Plant–Microbe Interactions 7, 564–572.

Downie JA, Knight CD, Johnston AWB, Rossen L (1985) Identificationof genes and gene products involved in the nodulation of peas byRhizobium leguminosarum. Molecular and General Genetics 198,255–262.

Doyle JJ (1998) Phylogenetic perspectives on nodulation: evolvingviews of plants and symbiotic bacteria. Trends in Plant Science 3,473–478.

Droge M, Pühler A, Selbitschka W (1999) Horizontal gene transferamong bacteria in terrestrial and aquatic habitats as assessed bymicrocosm and field studies. Biology and Fertility of Soils 29,221–245.

Duponnois R, Senghor K, Thioulouse J, Ba AM (1999) Susceptibilityof several sahelian Acacia to Meloidogyne javanica (Treub) Chitw.Agroforestry Systems 46, 123–130.

Dylan T, Ielpi L, Stanfield S, Kashyap L, Douglas C, Yanofsky M,Nester E, Helinski DR, Ditta G (1986) Rhizobium meliloti genesrequired for nodule development are related to chromosomalvirulence genes in Agrobacterium tumefaciens. Proceedings of theNational Academy of Sciences, USA 83, 4403–4407.

Eckhardt T (1978) A rapid method for the identification of plasmiddeoxyribonucleic acid in bacteria. Plasmid 1, 584–588.

el Fantroussi S, Verschuere L, Verstraete W, Topp EM (1999) Effect ofphenylurea herbicides on soil microbial communities estimated byanalysis of 16S rRNA gene fingerprints and community-levelphysiological profiles. Applied and Environmental Microbiology 65,982–988.

Ellis RP, McNichol JW, Baird E, Booth A, Lawrence P, Thomas B,Powell W (1997) The use of AFLPs to examine genetic relatednessin barley. Molecular Breeding 3, 359–369.

Espejo RT, Romero J (1998) PAGE analysis of the heteroduplexesformed between PCR-amplified 16S rRNA genes: estimation ofsequence similarity and rDNA complexity. Microbiology 144,1611–1617.

Felske A, Wolterink A, van Lis R, de Vos WM, Akkermans ADL (1999)Searching for predominant soil bacteria: 16S rDNA cloning versusstrain cultivation. FEMS Microbiology Ecology 30, 137–145.

Flores M, Brom S, Stepkowski T, Girard MD, Dávila G, Romero D,Palacios R (1993) Gene amplification in Rhizobium-identificationand in vivo cloning of discrete amplifiable DNA regions(amplicons) from Rhizobium leguminosarum biovar. phaseoli.Proceedings of the National Academy of Sciences, USA 90,4932–4936.

Foissaud V, Perriergrosclaude JD, Rouby Y, Clavier B, Dusseau JY,Thierry J (1998) Is quantitative antibiogram a reliableepidemiologic typing method of Pseudomonas aeruginosaoutbreaks — comparison with pulse field gel electrophoresis.Pathologie et Biologie 46, 452–458.

Frémont M, Prin Y, Chauviére M, Diem HG, Pwee KH, Tan TK (1999)A comparison of Bradyrhizobium strains using molecular, culturaland field studies. Plant Science 141, 81–91.

Gillings MR, Holley M (1997) Repetitive element PCR fingerprinting(rep-PCR) using enterobacterial repetitive intergenic consensus(ERIC) primers is not necessarily directed at ERIC elements.Letters in Applied Microbiology 25, 17–21.

Gogarten JP (1995) The early evolution of cellular life (review). Trendsin Ecology and Evolution 10, 147–151.

Gonzalez-Andres F, Ortiz JM (1998) Biodiversity of rhizobianodulating Genista monspessulana and Genista linifolia in Spain.New Zealand Journal of Agricultural Research 41, 585–594.

Graham PH, Sadowsky MJ, Keyser HH, Barnett YM, Bradley RS,Cooper JE, de Ley DJ, Jarvis BDW, Roslycky EB, Strijdom BW,Young JPW (1991) Proposed minimal standards for the descriptionof new genera and species of root- and stem-nodulating bacteria.International Journal of Systematic Bacteriology 41, 582–597.

Guo XW, Zhang XX, Zhang ZM, Li FD (1999) Characterization ofAstragalus sinicus rhizobia by restriction fragment lengthpolymorphism analysis of chromosomal and nodulation genesregions. Current Microbiology 39, 358–364.

Gürtler V, Stanisich VA (1996) New approaches to typing andidentification of bacteria using the 16S–23S rDNA spacer region.Microbiology 142, 3–16.

Handley BA, Hedges AJ, Beringer JE (1998) Importance of host plantsfor detecting the population diversity of Rhizobium leguminosarumbv. viciae in soil. Soil Biology and Biochemistry 30, 241–249.

Harrison SP, Mytton LR, Skøt L, Dye M, Cresswell A (1992)Characterisation of Rhizobium isolates by amplification of DNApolymorphisms using random primers. Canadian Journal ofMicrobiology 38, 1009–1015.

Hartley, E, Gemell LG, Roughley RJ, Howieson J, Ballard R (1996)Protocol for testing strains for possible inclusion in commerciallegume inoculants. In ‘The Eleventh Australian Nitrogen FixationConference, 22–27 September 1996’. (The Australian Society ForNitrogen Fixation: University of Western Australia, Nedlands, WA)

Hartmann A, Amarger N (1991) Genotypic diversity of an indigenousRhizobium meliloti field population assessed by plasmid profiles,DNA fingerprinting, and insertion sequence typing. CanadianJournal of Microbiology 37, 600–608.

Hartmann A, Giraud JJ, Catroux G (1998) Genotypic diversity ofSinorhizobium (formerly Rhizobium) meliloti strains isolateddirectly from a soil and from nodules of alfalfa (Medicago sativa)grown in the same soil. FEMS Microbiology Ecology 25, 107–116.

Haukka K, Lindstrom K, Young JPW (1998) Three phylogenetic groupsof nodA and nifH genes in Sinorhizobium and Mesorhizobiumisolates from leguminous trees growing in Africa and LatinAmerica. Applied and Environmental Microbiology 64, 419–426.

Hebb DM, Richardson AE, Reid R, Brockwell J (1998) PCR as anecological tool to determine the establishment and persistence ofRhizobium strains introduced into the field as seed inoculant.Australian Journal of Agricultural Research 49, 923–934.

Heuer H, Hartung K, Wieland G, Kramer I, Smalla K (1999)Polynucleotide probes that target a hypervariable region of 16SrRNA genes to identify bacterial isolates corresponding to bands ofcommunity fingerprints. Applied and Environmental Microbiology65, 1045–1049.

Higgins CF, Ames GFL, Barnes WM, Clement JM, Hofnung M (1982)A novel intercistronic regulatory element of prokaryotic operons.Nature 298, 760–762.

Hoben HJ, Somasegaran P, Boonkerd N, Gaur YD (1994) Polyclonalantisera production by immunization with mixed cell antigens ofdifferent rhizobial species. World Journal of Microbiology andBiotechnology 10, 538–542.

Hodgson ALM, Roberts WP (1983) DNA colony hybridization toidentify Rhizobium strains. Journal of General Microbiology 129,207–212.

Hotter GS, Scott DB (1991) Exopolysaccharide mutants of Rhizobiumloti are fully effective on a determinate nodulating host but areineffective on an indeterminate nodulating host. Journal ofBacteriology 173, 851–859.

Howieson JG, Loi A, Carr SJ (1995) Biserrula pelecinus L. —A legume pasture species with potential for acid, duplex soils whichis nodulated by unique root-nodule bacteria. Australian Journal ofAgricultural Research 46, 997–1007.

Hulton CSJ, Higgins CF, Sharp PM (1991) ERIC sequences: a novelfamily of repetitive elements in the genome of Escherichia coli,Salmonella typhimurium and other enterobacteria. MolecularMicrobiology 5, 825–834.

Hungria M, Boddey LH, Santos MA, Vargas MAT (1998) Nitrogenfixation capacity and nodule occupancy by Bradyrhizobiumjaponicum and B. elkanii strains. Biology and Fertility of Soils 27,393–399.

316

Hynes MF, McGregor NF (1990) Two plasmids other than thenodulation plasmid are necessary for formation of nitrogen-fixingnodules by Rhizobium leguminosarum. Molecular Microbiology 4,567–574.

Hynes MF, Quandt J, O'Connell MP, Pühler A (1989) Direct selectionfor curing and deletion of Rhizobium plasmids using transposoncarrying the Bacillus subtilis sacB gene. Gene 78, 111–120.

Ibekwe AM, Angle JS, Chaney RL, van Berkum P (1997)Differentiation of clover Rhizobium isolated from biosolids-amended soils with varying pH. Soil Science Society of AmericaJournal 61, 1679–1685.

James EK, Sprent JI (1999) Development of N2-fixing nodules on thewetland legume Lotus uliginosus exposed to conditions of flooding.New Phytologist 142, 219–231.

Jarvis BDW, van Berkum P, Chen WX, Nour SM, Fernandez MP,Cleyetmarel JC, Gillis M (1997) Transfer of Rhizobium loti,Rhizobium huakuii, Rhizobium ciceri, Rhizobium mediterraneum,and Rhizobium tianshanense to Mesorhizobium gen. nov.International Journal of Systematic Bacteriology 47, 895–898.

Jensen MA, Webster J, Straus N (1993) Rapid identification of bacteriaon the basis of polymerase chain reaction-amplified ribosomal DNAspacer polymorphisms. Applied and Environmental Microbiology59, 945–952.

Johnsson E, Berggard K, Kotarsky H, Hellwage J, Zipfel PF,Sjobring U, Lindahl G (1998) Role of the hypervariable region instreptococcal M proteins-binding of a human complement inhibitor.Journal of Immunology 161, 4894–4901.

Josey DP, Beynon JL, Johnston AWB, Beringer JE (1979) Strainidentification of Rhizobium using intrinsic antibiotic resistance.Journal of Applied Bacteriology 46, 343–350.

Julliot JS, Boistard P (1979) Use of RP4-prime plasmids constructed invitro to promote a polarised transfer of the chromosome inEscherichia coli and Rhizobium meliloti. Molecular and GeneralGenetics 173, 289–298.

Khan MS, Maliga P (1999) Fluorescent antibiotic resistance marker fortracking plastid transformation in higher plants. NatureBiotechnology 17, 910–915.

Khbaya B, Neyra M, Normand P, Zerhari K, Filali-Maltouf A (1998)Genetic diversity and phylogeny of rhizobia that nodulate Acaciaspp. in Morocco assessed by analysis of rRNA genes. Applied andEnvironmental Microbiology 64, 4912–4917.

Kishinevsky BD, Sen D, Yang G (1996) Diversity of rhizobia isolatedfrom various Hedysarum species. Plant and Soil 186, 21–28.

Kudo T, Ohkuma M, Moriya S, Noda S, Ohtoko K (1998) Molecularphylogenetic identification of the intestinal anaerobic microbialcommunity in the hindgut of the termite, Reticulitermes speratus,without cultivation (review). Extremophiles 2, 155–161.

Laeremans T, Snoeck C, Mariën J, Verreth C, Martínez-Romero E,Promé JC, Vanderleyden J (1999) Phaseolus vulgaris recognizesAzorhizobium caulinodans Nod factors with a variety of chemicalsubstituents. Molecular Plant–Microbe Interactions 12, 820–824.

Lafay B, Burdon JJ (1998) Molecular diversity of rhizobia occurring onnative shrubby legumes in Southeastern Australia. Applied andEnvironmental Microbiology 64, 3989–3997.

Laguerre G, Bardin M, Amarger N (1993) Isolation from soil ofsymbiotic and nonsymbiotic Rhizobium leguminosarum by DNAhybridization. Canadian Journal of Microbiology 39, 1142–1149.

Laguerre G, Mavingui P, Allard MR, Charnay MP, Louvrier P,Mazurier SI, Rigottier-Gois L, Amarger N (1996) Typing ofrhizobia by PCR DNA fingerprinting and PCR-restriction fragmentlength polymorphism analysis of chromosomal and symbiotic generegions: Application to Rhizobium leguminosarum and its differentbiovars. Applied and Environmental Microbiology 62, 2029–2036.

Laguerre G, Mazurier SI, Amarger N (1992) Plasmid profiles andrestriction fragment length polymorphism of Rhizobiumleguminosarum bv. viciae in field populations. FEMS MicrobiologyEcology 101, 17–26.

Laguerre G, van Berkum P, Amarger N, Prévost D (1997) Geneticdiversity of rhizobial symbionts isolated from legume specieswithin the genera Astragalus, Oxytropis, and Onobrychis. Appliedand Environmental Microbiology 63, 4748–4758.

Lane DJ (1991) 16S/23S rRNA sequencing. In ‘Nucleic acidtechniques in bacterial systematics’. pp. 115–175. (J Wiley andSons Ltd: Chichester, UK)

Latour X, Philippot L, Corberand T, Lemanceau P (1999) Theestablishment of an introduced community of fluorescentpseudomonads in the soil and in the rhizosphere is affected by thesoil type. FEMS Microbiology Ecology 30, 163–170.

Lee N, Halkjaer N, Andreasen KH, Juretschko S, Nielsen JL, SchleiferKH, Wagner M (1999) Combination of fluorescent in situhybridization and microautoradiography — a new tool for structure-function analyses in microbial ecology. Applied and EnvironmentalMicrobiology 65, 1289–1297.

Liu WT, Marsh TL, Cheng H, Forney L (1997) Characterization ofmicrobial diversity by determining terminal restriction fragmentlength polymorphisms of genes encoding 16S rRNA. Applied andEnvironmental Microbiology 63, 4516–4522.

Loi A, Howieson JG, Cocks PS, Carr SJ (1999) Genetic variation inpopulations of two Mediterranean annual pasture legumes(Biserrula pelecinus L. and Ornithopus compressus L.) andassociated rhizobia. Australian Journal of Agricultural Research 50,303–313.

Ludwig W, Amann R, Martinez-Romero E, Schonhuber W, Bauer S,Neef A, Schleifer KH (1998) rRNA-based identification anddetection systems for rhizobia and other bacteria. Plant and Soil204, 1–19.

Lupwayi NZ, Olsen PE, Sande ES, Keyser HH, Collins MM,Singleton PW, Rice WA (2000) Inoculant quality and its evaluation.Field Crops Research 65, 259–270.

Mackill DJ, Zhang Z, Redona ED, Colowit PM (1996) Level ofpolymorphism and genetic mapping of AFLP markers in rice.Genome 39, 969–977.

Maier RJ, Triplett EW (1996) Toward more productive, efficient, andcompetitive nitrogen-fixing symbiotic bacteria. Applied andEnvironmental Microbiology 15, 191–234.

Malek W, Inaba M, Ono H, Kaneko Y, Murooka Y (1998) Competitionfor Astragalus sinicus root nodule infection between its nativemicrosymbiont Rhizobium huakuii biovar. renge B3 and Rhizobiumsp. ACMP18 strain specific for Astragalus cicer. AppliedMicrobiology and Biotechnology 50, 261-265.

Marilley L, Aragno M (1999) Phylogenetic diversity of bacterialcommunities differing in degree of proximity of Lolium perenneand Trifolium repens roots. Applied Soil Ecology 13, 127–136.

Marilley L, Vogt G, Blanc M, Aragno M (1998) Bacterial diversity inthe bulk soil and rhizosphere fractions of Lolium perenne andTrifolium repens as revealed by PCR restriction analysis of 16SrDNA. Plant and Soil 198, 219–224.

Marsudi NDS, Glenn AR, Dilworth MJ (1999) Identification andcharacterization of fast- and slow-growing root nodule bacteriafrom south-western Australian soils able to nodulate Acacia saligna.Soil Biology and Biochemistry 31, 1229–1238.

Martin B, Humbert O, Camara M, Guenzi E, Walker J, Mitchell T,Andrew P, Prudhomme M, Alloing G, Hakenbeck R, Morrison DA,Boulnois GJ, Claverys JP (1992) A highly conserved repeated DNAelement located in the chromosome of Streptococcus pneumoniae.Nucleic Acids Research 20, 3479–3483.

Martinez E, Romero D, Palacios R (1990) The Rhizobium genome.Critical Reviews in Plant Sciences 9, 59–93.

Martinez-Romero E, Caballero-Mellado J (1996) Rhizobiumphylogenies and bacterial genetic diversity. Critical Reviews inPlant Sciences 15, 113–140.

Mathis JN, McMillin DE (1996) Detection of genetic variation inBradyrhizobium japonicum USDA 110 variants using DNAfingerprints generated with GC rich arbitrary PCR primers. Plantand Soil 186, 81–85.


Mathis JN, McMillin DE, Champion RA, Hunt PG (1997) Geneticvariation in two cultures of Bradyrhizobium japonicum 110differing in their ability to impart drought tolerance to soybean.Current Microbiology 35, 363–366.

Maynard-Smith J, Smith NH, O’Rourke M, Spratt BG (1993) Howclonal are bacteria? Proceedings of the National Academy ofSciences, USA 90, 4384–4388.

McInroy SG, Campbell CD, Haukka KE, Odee D, Sprent JI, Wang WJ,Young JPW, Sutherland JM (1999) Characterisation of rhizobiafrom African acacias and other tropical woody legumes usingBiolog (TM) and partial 16S rRNA sequencing. FEMSMicrobiology Letters 170, 111–117.

Melchor-Marroquin JI, Vargas-Hernandez JJ, Ferrera-Cerrato R,Krishnamurthy L (1999) Screening Rhizobium spp. strainsassociated with Gliricidia sepium along an altitudinal transect inVeracruz, Mexico. Agroforestry Systems 46, 25–38.

Miller DN, Bryant JE, Madsen EL, Ghiorse WC (1999) Evaluation andoptimization of DNA extraction and purification procedures for soiland sediment samples. Applied and Environmental Microbiology65, 4715–4724.

Moawad H, El-Din SMSB, Abdel-Aziz RA (1998) Improvement ofbiological nitrogen fixation in Egyptian winter legumes throughbetter management of Rhizobium. Plant and Soil 204, 95–106.

Moënne-Loccoz Y, Dipankar S, Krause ES, Weaver RW (1994) Plasmidprofiles of rhizobia used in inoculants and isolated from cloverfields. Agronomy Journal 86, 117–121.

Moreira FMS, Gillis M, Pot B, Kersters K, Franco AA (1993)Characterization of rhizobia isolated from different divergencegroups of tropical Leguminosae by comparative polyacrylamide gelelectrophoresis of their total proteins. Systematic and AppliedMicrobiology 16, 135–146.

Moreira FMS, Haukka K, Young JPW (1998) Biodiversity of rhizobiaisolated from a wide range of forest legumes in Brazil. MolecularEcology 7, 889–895.

Mueller UG, Wolfenbarger LL (1999) AFLP genotyping andfingerprinting. Tree 14, 389–394.

Mullis KB, Faloona FA (1987) Specific synthesis of DNA in vitro via apolymerase catalysed chain reaction. Methods in Enzymology 155,335–350.

Murphy PJ, Wexler W, Grzemski W, Rao JP, Gordon D (1995)Rhizopines — their role in symbiosis and competition. Soil Biologyand Biochemistry 27, 525–529.

Murray MG, Thompson WF (1980) Rapid isolation of high molecularweight DNA. Nucleic Acids Research 8, 4321–4325.

Muyzer G, Smalla K (1998) Application of denaturing gradient gelelectrophoresis (DGGE) and temperature gradient gelelectrophoresis (TGGE) in microbial ecology. Antonie vanLeeuwenhoek International Journal of General and MolecularMicrobiology 73, 127–141.

Navarro E, Simonet P, Normand P, Bardin R (1992) Characterization ofnatural populations of Nitrobacter spp. using PCR/RFLP analysisof the ribosomal intergenic spacer. Archives of Microbiology 157,107–115.

Nick G, Delajudie P, Eardly BD, Suomalainen S, Paulin L, Zhang XP,Gillis M, Lindstrom K (1999a) Sinorhizobium arboris sp. nov. andSinorhizobium kostiense sp. nov., isolated from leguminous trees inSudan and Kenya. International Journal of Systematic Bacteriology49, 1359–1368.

Nick G, Jussila M, Hoste B, Niemi RM, Kaijalainen S, de Lajudie P,Gillis M, de Bruijn FJ, Lindstrom K (1999b) Rhizobia isolated fromroot nodules of tropical leguminous trees characterized usingDNA–DNA dot-blot hybridisation and rep-PCR genomicfingerprinting. Systematic and Applied Microbiology 22, 287–299.

Niemann S, Pühler A, Selbitschka W (1997a) Growth and nodulationcompetitiveness of Sinorhizobium meliloti L1 (RecA–) is less thanthat of its isogenetic strain L33 (RecA+) but comparable to that oftwo S. meliloti wild-type isolates. Applied Microbiology andBiotechnology 47, 525–529.

Niemann S, Pühler A, Tichy HV, Simon R, Selbitschka W (1997b)Evaluation of the resolving power of three different DNAfingerprinting methods to discriminate among isolates of a naturalRhizobium meliloti population. Journal of Applied Microbiology 82,477–484.

Niemann S, Dammann-Kalinowski T, Nagel A, Pühler A,Selbitschka W (1999) Genetic basis of enterobacterial repetitiveintergenic consensus (ERIC)–PCR fingerprint pattern inSinorhizobium meliloti and identification of S. meliloti employingPCR primers derived from an ERIC-PCR fragment. Archives ofMicrobiology 172, 22–30.

Noda S, Ohkuma M, Usami R, Horikoshi K, Kudo T (1999) Culture-independent characterization of a gene responsible for nitrogenfixation in the symbiotic microbial community in the gut of thetermite Neotermes koshunensis. Applied and EnvironmentalMicrobiology 65, 4935–4942.

Paffetti D, Daguin F, Fancelli S, Gnocchi S, Lippi F, Scotti C,Bazzicalupo M (1998) Influence of plant genotype on the selectionof nodulating Sinorhizobium meliloti strains by Medicago sativa.Antonie van Leeuwenhoek International Journal of General andMolecular Microbiology 73, 3–8.

Paffetti D, Scotti C, Gnocchi S, Fancelli S, Bazzicalupo M (1996)Genetic diversity of an Italian Rhizobium meliloti population fromdifferent Medicago sativa varieties. Applied and EnvironmentalMicrobiology 62, 2279–2285.

Pankhurst CE, Broughton WJ, Weineke U (1983) Transfer of anindigenous plasmid of Rhizobium loti to other rhizobia andAgrobacterium tumefaciens. Journal of General Microbiology 129,2535–2543.

Pennisi E (1998) Genome data shake tree of life. Science 280, 672–674.Pérez-Ramírez NO, Rogel MA, Wang E, Castellanos JZ, Martínez-

Romero E (1998) Seeds of Phaseolus vulgaris bean carryRhizobium etli. FEMS Microbiology Ecology 26, 289–296.

Perret X, Broughton WJ (1998) Rapid identification of Rhizobiumstrains by targeted PCR fingerprinting. Plant and Soil 204, 21–34.

Phillips DA (1999) Using rhizobia in the 21st century. Symbiosis 27,83–102.

Piceno YM, Noble PA, Lovell CR (1999) Spatial and temporalassessment of diazotroph assemblage composition in vegetated saltmarsh sediments using denaturing gradient gel electrophoresisanalysis. Microbial Ecology 38, 157–167.

Pillai SD, Josephson KL, Bailey RL, Pepper I (1992) Specific detectionof rhizobia in root nodules and soil using the polymerase chainreaction. Soil Biology and Biochemistry 24, 885–891.

Ponsonnet C, Nesme X (1994) Identification of Agrobacterium strainsby PCR–RFLP analysis of pTi and chromosomal regions. Archivesof Microbiology 161, 300–309.

Porteous LA, Seidler RJ, Watrud LS (1997) An improved method forpurifying DNA from soil for polymerase chain reactionamplification and molecular ecology applications. MolecularEcology 6, 787–791.

Reeve WG, Dilworth MJ, Tiwari RP, Glenn AR (1997) Regulation ofexopolysaccharide production in Rhizobium leguminosarum bv.viciae WSM710 involves exoR. Microbiology 143, 1951–1958.

Richardson AE, Viccars LA, Watson JM, Gibson AH (1995)Differentiation of Rhizobium strains using the polymerase chainreaction with random and directed primers. Soil Biology andBiochemistry 27, 515–524.

Richardson BJ, Baverstock PR, Adams M (1986) ‘Allozymeelectrophoresis.’ (Academic Press Australia: North Ryde, NSW)

Riffkin PA (2000) An assessment of white clover nitrogen fixation ingrazed dairy pastures of south-western Victoria. Thesis, Universityof Western Sydney-Hawkesbury.

Robleto EA, Borneman J, Triplett EW (1998a) Effects of bacterialantibiotic production on rhizosphere microbial communities from aculture-independent perspective. Applied and EnvironmentalMicrobiology 64, 5020–5022.

318

Robleto EA, Kmiecik K, Oplinger ES, Nienhuis J, Triplett EW (1998b)Trifolitoxin production increases nodulation competitiveness ofRhizobium etli CE3 under agricultural conditions. Applied andEnvironmental Microbiology 64, 2630–2633.

Ronson CW, Astwood PM, Downie JA (1984) Molecular cloning andgenetic organisation of C4-dicarboxylate transport genes fromRhizobium leguminosarum. Journal of Bacteriology 160, 903–909.

Roslev P, Iversen N, Henriksen K (1998) Direct fingerprinting ofmetabolically active bacteria in environmental samples by substratespecific radiolabelling and lipid analysis. Journal ofMicrobiological Methods 31, 99–111.

Saiki R, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA,Arnheim N (1985) Enzymatic amplification of β-globin genomicsequences and restriction site analysis for diagnosis of sickle cellanaemia. Science 230, 1350–1354.

Sambrook J, Fritsch EF, Maniatis TA (1989) ‘Molecular cloning:a laboratory manual (2nd edn).’ (Cold Spring Harbor Laboratory:Cold Spring Harbor, NY)

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy ofSciences, USA 74, 5463–5467.

Santamaria M, Agius F, Monza J, Gutierrez-Navarro AM, Corzo J(1999) Comparative performance of enterobacterial repetitiveintragenic consensus polymerase chain reaction andlipopolysaccharide electrophoresis for the identification ofBradyrhizobium sp. (Lotus) strains. FEMS Microbiology Ecology28, 163–168.

Santos MA, Vargas MAT, Hungria M (1999) Characterization ofsoybean Bradyrhizobium strains adapted to the Brazilian savannas.FEMS Microbiology Ecology 30, 261–272.

Sayler GS, Layton AC (1990) Environmental application of nucleicacid hybridisation. Annual Review of Microbiology 44, 625–648.

Schneider M, de Bruijn FJ (1996) REP-PCR mediated genomicfingerprinting of rhizobia and computer-assisted phylogeneticpattern analysis. World Journal of Microbiology and Biotechnology12, 163–174.

Schofield PR, Djordjevic MA, Rolfe BG, Shine J, Watson JM (1983) Amolecular linkage map of nitrogenase and nodulation genes inRhizobium trifolii. Molecular and General Genetics 192, 459–465.

Schofield PR, Gibson AH, Dudman WF, Watson JM (1987) Evidencefor genetic exchange and recombination of Rhizobium symbioticplasmids in a soil population. Applied and EnvironmentalMicrobiology 53, 2942–2947.

Schofield PR, Ridge RW, Rolfe BG, Shine J, Watson JM (1984) Hostspecific nodulation is encoded on a 14-kb DNA fragment inRhizobium trifolii. Plant Molecular Biology 3, 3–11.

Schwartz DC, Cantor CR (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37,67.

Scott DB, Chua KY, Jarvis BDW, Pankhurst CE (1985) Molecularcloning of a nodulation gene from fast- and slow-growing strains ofLotus rhizobia. Molecular and General Genetics 201, 43–50.

Segovia L, Piñero D, Palacios R, Martínez-Romero E (1991)Genetic structure of a soil population of nonsymbiotic Rhizobiumlegumino-sarum. Applied and Environmental Microbiology 57, 426–433.

Segovia L, Young JPW, Martínez-Romero E (1993) Reclassification ofAmerican Rhizobium leguminosarum bv. phaseoli type I strains asRhizobium etli sp. nov. International Journal of SystematicBacteriology 43, 374–377.

Segundo E, Martinez-Abarca F, van Dillewijn P, Fernández-López M,Lagares A, Martinez-Drets G, Niehaus K, Pühler A, Toro N (1999)Characterisation of symbiotically efficient alfafa-nodulatingrhizobia isolated from acid soils of Argentina and Uruguay. FEMSMicrobiology Ecology 28, 169–176.

Selander RK, Caugant DA, Ochman H, Musser JM, Gilmour MN,Whittam TS (1986) Methods of multilocus enzyme electrophoresisfor bacterial population genetics and systematics. Applied andEnvironmental Microbiology 51, 873–884.

Semblat JP, Wajnberg E, Dalmasso A, Abad P, Castagnonesereno P(1998) High-resolution DNA fingerprinting of parthenogeneticroot-knot nematodes using AFLP analysis. Molecular Ecology 7,119–125.

Sessitsch A, Hardarson G, Akkermans ADL, Devos WM (1997)Characterization of Rhizobium etli and other Rhizobium spp. thatnodulate Phaseolus vulgaris L. in an Austrian soil. MolecularEcology 6, 601–608.

Sessitsch A, Hardarson G, de Vos WM, Wilson K (1998) Use of markergenes in competition studies of Rhizobium. Plant and Soil 204,35–45.

Sheffield VC, Cox DR, Myers RM (1989) Attachment of a 40-base pairG+C rich sequence (GC clamp) to genomic fragments bypolymerase chain reaction results in improved detection of singlebase changes. Proceedings of the National Academy of Sciences,USA 86, 232–236.

Shiomi Y, Nishiyama M, Onizuka T, Marumoto T (1999) Comparisonof bacterial community structures in the rhizoplane of tomato plantsgrown in soils suppressive and conducive towards bacterial wilt.Applied and Environmental Microbiology 65, 3996–4001.

Simpfendorfer S, Harden TJ, Murray GM (1999) The in vitro inhibitionof Phytophthora clandestina by some rhizobia and the possible roleof Rhizobium trifolii in biological control of Phytophthora root rotof subterranean clover. Australian Journal of Agricultural Research50, 1469–1473.

Sivakumaran S, Lockhart PJ, Jarvis BDW (1997) Identification of soilbacteria expressing a symbiotic plasmid from Rhizobiumleguminosarum bv. trifolii. Canadian Journal of Microbiology 43,164–177.

Slattery JF, Coventry DR (1993) Variation in populations of Rhizobiumleguminosarum bv. trifolii and the occurrence of inoculant rhizobiain nodules of subterranean clover after pasture renovation in north-eastern Victoria, Australia. Soil Biology and Biochemistry 25,1725–1730.

Smit E, Leeflang P, Wernars K (1997) Detection of shifts in microbialcommunity structure and diversity in soil caused by coppercontamination using amplified ribosomal DNA restriction analysis.FEMS Microbiology Ecology 23, 249–261.

Somasegaran P, Hoben H (1985) ‘Methods in legume–Rhizobiumtechnology.’ (University of Hawaii NifTAL Project: Paia, HI, USA)

Stepkowski T, Brom S, García-de los Santos A, Girard L, Dávila G,Palacios R (1993) Plasmid related phenotypes in Rhizobiumleguminosarum bv. trifolii ANU843. In ‘New horizons in nitrogenfixation’. p. 653. (Kluwer Academic: Dordrecht, The Netherlands)

Stern MJ, Ames GFL, Smith NH, Robinson EC, Higgins CF (1984)Repetitive extragenic palindromic sequences: a major component ofthe bacterial genome. Cell 37, 1015–1026.

Sterner JP, Parker MA (1999) Diversity and relationships ofBradyrhizobia from Amphicarpaea bracteata based on partial nodand ribosomal sequences. Systematic and Applied Microbiology 22,387–392.

Sullivan JT, Eardly BD, van Berkum P, Ronson CW (1996) Fourunnamed species of nonsymbiotic rhizobia isolated from therhizosphere of Lotus corniculatus. Applied and EnvironmentalMicrobiology 62, 2818–2825.

Sullivan JT, Patrick HN, Lowther WL, Scott DB, Ronson CW (1995)Nodulating strains of Rhizobium loti arise through chromosomalsymbiotic gene transfer in the environment. Proceedings of theNational Academy of Sciences, USA 92, 8985–8989.

Sullivan J, Ronson C (1998) Evolution of rhizobia by acquisition of a500 kb symbiosis island that integrates into a phe-tRNA gene.Proceedings of the National Academy of Sciences, USA 95,5145–5149.

Suominen L, Paulin L, Saano A, Saren AM, Tas E, Lindstrom K (1999)Identification of nodulation promoter (nod-box) regions ofRhizobium galegae. FEMS Microbiology Letters 177, 217–223.


http://www.publish.csiro.au/journals/ajea

Tan ZY, Wang ET, Peng GX, Zhu ME, Martinez-Romero E, Chen WX(1999) Characterization of bacteria isolated from wild legumes inthe north-western regions of China. International Journal ofSystematic Bacteriology 49, 1457–1469.

Terefework Z, Nick G, Suomalainen S, Paulin L, Lindstrom K (1998)Phylogeny of Rhizobium galegae with respect to other rhizobia andagrobacteria. International Journal of Systematic Bacteriology 48,349–356.

Theron J, Cloete T (2000) Molecular techniques for determining microbialdiversity and community structure in natural environments. CriticalReviews in Microbiology 26, 37–57.

Thies JE, Wijkstra G, Ronson CW (1999) What does strain persistencereally mean? In ‘Highlights of nitrogen fixation research’.(Ed. E Martínez-Romero, F Hernández) pp. 85–90. (KluwerAcademic/Plenum Publishers: New York)

Tommerup IC, Barton JE, O’Brien PA (1995) Reliability of RAPDfingerprinting of three basidiomycete fungi, Laccaria, Hydnangiumand Rhizoctonia. Mycological Research 99, 179–186.

Turco RF, Moorman TB, Bezdicek DF (1986) Effectiveness andcompetitiveness of spontaneous antibiotic-resistant mutants ofRhizobium leguminosarum and Rhizobium japonicum. Soil Biologyand Biochemistry 18, 259–262.

Uchiumi T, Kuwashiro R, Miyamoto J, Abe M, Higashi S (1998)Detection of the leghemoglobin gene on two chromosomes ofPhaseolus vulgaris by in situ PCR-linked fluorescent in situhybridisation. Plant and Cell Physiology 39, 790–794.

Ueda T, Sua Y, Yahiro N, Matsuguchi T (1995) Phylogeny of Symplasmids of rhizobia by PCR-based sequencing of a nodC segment.Journal of Bacteriology 177, 468–472.

Vallaeys T, Topp E, Muyzer G, Macheret V, Laguerre G, Rigaud A,Soulas G (1997) Evaluation of denaturing gradient gelelectrophoresis in the detection of 16S-rDNA sequence variation inrhizobia and methanotrophs. FEMS Microbiology Ecology 24,279–285.

Vanderlinde PB, Fegan N, Mills L, Desmarchelier PM (1999) Use ofpulse field gel elctrophoresis for the epidemiologicalcharacterisation of coagulase positive Staphylococcus isolated frommeat workers and beef carcasses. International Journal of FoodMicrobiology 48, 81–85.

Versalovic J, Koeuth T, Lupski JR (1991) Distribution of repetitiveDNA sequences in eubacteria and application to fingerprinting ofbacterial genomes. Nucleic Acids Research 19, 6823–6831.

Versalovic J, Schneider M, de Bruijn FJ, Lupski JR (1994) Genomicfingerprinting of bacteria using repetitive sequence-basedpolymerase chain reaction. Methods in Molecular and CellularBiology 5, 25–40.

Vinuesa P, Rademaker JLW, de Bruijn FJ, Werner D (1998) Genotypiccharacterisation of Bradyrhizobium strains nodulating endemicwoody legumes of the Canary Islands by PCR–restriction fragmentlength polymorphism analysis of genes encoding 16S-rRNA (16SrDNA) and 16S–23S-rDNA intergenic spacers, repetitiveextragenic palindromic PCR genomic fingerprinting, and partial16S-rDNA sequencing. Applied and Environmental Microbiology64, 2096–2104.

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M,Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M (1995) AFLP:a new technique for DNA fingerprinting. Nucleic Acids Research23, 4407–4414.

Wang ET, Martínez-Romero J, Martínez-Romero E (1999a) Geneticdiversity of rhizobia from Leucaena leucocephala nodules inMexican soils. Molecular Ecology 8, 711–724.

Wang ET, van Berkum P, Sui XH, Beyene D, Chen WX, Martinez-Romero E (1999b) Diversity of rhizobia associated with Amorphafruticosa isolated from Chinese soils and description ofMesorhizobium amorphae sp. nov. International Journal ofSystematic Bacteriology 49, 51–65.

Wang ET, Rogel MA, García-de los Santos A, Martínez-Romero J,Cevallos MA, Martínez-Romero E (1999c) Rhizobium etli bv.mimosae, a novel biovar. isolated from Mimosa affinis.International Journal of Systematic Bacteriology 49, 1479–1491.

Wartell RM, Hosseini S, Powell S, Zhu J (1998) Detecting single basesubstitutions, mismatches and bulges in DNA by temperaturegradient gel electrophoresis and related methods. Journal ofChromatography 806, 169–185.

Watson JM, Schofield PR (1985) Species-specific, symbiotic plasmid-located repeated DNA sequences in Rhizobium trifolii. Molecularand General Genetics 199, 279–289.

Wedlock DN, Jarvis BDW (1986) DNA homologies betweenRhizobium fredii, rhizobia that nodulate Galega sp., and otherRhizobium and Bradyrhizobium species. International Journal ofSystematic Bacteriology 36, 550–558.

Wernegreen JJ, Harding EE, Riley MA (1997) Rhizobium gone native:unexpected plasmid stability of indigenous Rhizobiumleguminosarum. Proceedings of the National Academy of Sciences,USA 94, 5483–5488.

Wernegreen JJ, Riley MA (1999) Comparison of the evolutionarydynamics of symbiotic and housekeeping loci: a case for the geneticcoherence of rhizobial lineages. Molecular Biology and Evolution16, 98–113.

Widmer F, Shaffer BT, Porteous LA, Seidler RJ (1999) Analysis of nifHgene pool complexity in soil and litter at a Douglas fir forest site inthe Oregon Cascade Mountain Range. Applied and EnvironmentalMicrobiology 65, 374–380.

Wilson KJ (1995) Molecular techniques for the study of rhizobialecology in the field. Soil Biology and Biochemistry 27, 501–514.

Wilson KJ, Parra A, Botero L (1999) Application of the GUS markergene technique to high-throughput screening of rhizobialcompetition. Canadian Journal of Microbiology 45, 678–685.

Xi C, Lambrecht M, Vanderleyden J, Michiels J (1999) Bi-functionalgfp-and gusA-containing mini-Tn5 transposon derivatives forcombined gene expression and bacterial localization studies.Journal of Microbiological Methods 35, 85–92.

Yeates C, Gillings MR (1998) Rapid purification of DNA from soil formolecular biodiversity analysis. Letters in Applied Microbiology 27,49–53.

Young CC, Cheng KT (1998) Genetic diversity of fast- and slow-growing soybean rhizobia determined by random amplifiedpolymorphic DNA analysis. Biology and Fertility of Soils 26,254–256.

Young JPW (1996) Phylogeny and taxonomy of rhizobia. Plant and Soil186, 45–52.

Young JPW, Haukka KE (1996) Diversity and phylogeny of rhizobia.New Phytologist 133, 87–94.

Young JPW, Wexler M (1988) Sym plasmid and chromosomalgenotypes are correlated in field populations of Rhizobiumleguminosarum. Journal of General Microbiology 134, 2731–2739.

Zhang XP, Nick G, Kaijalainen S, Terefework Z, Paulin L, Tighe SW,Graham PH, Lindstrom K (1999) Phylogeny and diversity ofBradyrhizobium strains isolated from the root nodules of peanut(Arachis hypogaea) in Sichuan, China. Systematic and AppliedMicrobiology 22, 378–386.

Received 16 December 1999, accepted 18 October 2000

Application of molecular techniques to studies in Rhizobium ecology: a review

Documents

Transcript of Application of molecular techniques to studies in Rhizobium ecology: a review