Proteolytic Cleavage of Protein Tyrosine Phosphatase Regulates Glioblastoma Cell Migration

Proteolytic Cleavage of Protein Tyrosine Phosphatase M

Regulates Glioblastoma Cell Migration

Adam M. Burgoyne,1Polly J. Phillips-Mason,

1Susan M. Burden-Gulley,

1Shenandoah Robinson,

2

Andrew E. Sloan,2Robert H. Miller,

3and Susann M. Brady-Kalnay

1,3

Departments of 1Molecular Biology and Microbiology, 2Neurosurgery, and 3Neurosciences, School of Medicine,Case Western Reserve University, Cleveland, Ohio

Abstract

Glioblastoma multiforme (GBM), the most common malignantprimary brain tumor, represents a significant disease burden.GBM tumor cells disperse extensively throughout the brainparenchyma, and the need for tumor-specific drug targets andpharmacologic agents to inhibit cell migration and dispersalis great. The receptor protein tyrosine phosphatase M (PTPM)is a homophilic cell adhesion molecule. The full-length formof PTPM is down-regulated in human glioblastoma. In thisarticle, overexpression of full-length PTPM is shown tosuppress migration and survival of glioblastoma cells.Additionally, proteolytic cleavage is shown to be the mecha-nism of PTPM down-regulation in glioblastoma cells. Proteol-ysis of PTPM generates a series of proteolytic fragments,including a soluble catalytic intracellular domain fragmentthat translocates to the nucleus. Only proteolyzed PTPMfragments are detected in human glioblastomas. Short hairpinRNA–mediated down-regulation of PTPM fragments decreasesglioblastoma cell migration and survival. A peptide inhibitorof PTPM function blocks fragment-induced glioblastoma cellmigration, which may prove to be of therapeutic value in GBMtreatment. These data suggest that loss of cell surface PTPM byproteolysis generates catalytically active PTPM fragments thatcontribute to migration and survival of glioblastoma cells.[Cancer Res 2009;69(17):6960–8]

Introduction

Gliomas are malignancies of glial supporting cells of the centralnervous system, including astrocytes and oligodendrocytes (1, 2).These neoplasms are categorized by their putative cell of originbased on morphologic similarities to various types of normal glia(2, 3). They are graded histologically between 1 and 4 according tothe WHO classification system of tumor cellularity, proliferation,angiogenesis, and invasiveness (4). Glioblastoma multiforme(GBM), a WHO grade 4 glioma, has a poor prognosis with a meansurvival time of <1 year (5). The lethality of GBM can be attributedto the dispersive phenotype where cells migrate and develop focithroughout the brain (3, 6, 7). We recently showed that the receptor

protein tyrosine phosphatase A (PTPA) negatively regulates GBMcell migration, and full-length PTPA protein is lost in human GBMtumors in comparison with low-grade astrocytomas (8).

PTPA is the prototype of the type IIb subfamily of receptor PTPs(RPTP). PTPA has been shown to participate in homophilicbinding. PTPA on the extracellular surface of one cell binds toPTPA on the surface of an adjacent cell (9–11). As a transmem-brane adhesion receptor, PTPA has the ability to sense anextracellular signal via its extracellular segment and transducethis signal intracellularly via its phosphatase activity (12–14). ThePTPA extracellular domain is composed of a MAM (meprin/A5-protein/PTPA) domain, an immunoglobulin-like (Ig) domain,and four fibronectin type III (FNIII) repeats (12, 15, 16). Theintracellular domain of PTPA contains a juxtamembrane sequencewith homology to cadherins and two phosphatase domains ofwhich only the membrane proximal is catalytically active (17, 18).The juxtamembrane portion contains a helix-loop-helix wedge-shaped motif (14) that was targeted in the design of a peptideinhibitor of PTPA function. This wedge peptide inhibitor specifi-cally blocks PTPA function in migration assays (19, 20).

PTPA is expressed as a 200-kDa protein that is proteolyticallycleaved in the fourth FNIII repeat, resulting in a 100-kDaextracellular fragment (E-subunit) that remains associated withthe 100-kDa transmembrane and intracellular portion (P-subunit)through a noncovalent interaction (11, 21, 22). This cleavage ismediated by a furin-like protease in the endoplasmic reticulumduring intracellular trafficking (21). Another type IIb RPTP, PTPn, isalso cleaved by a furin-like protease and further processed by ana-secretase of the ADAM (a disintegrin and metalloproteinasedomain) family and a g-secretase (23). The extracellular ADAMcleaves the P-subunit adjacent to the membrane to generate PDEand shed the ectodomain (23). This cleavage primes PTPn PDE tobe cleaved by g-secretase, which releases the intracellular portionof PTPn containing the active phosphatase domain from themembrane (23). The intracellular fragment of PTPn translocates tothe nucleus and controls h-catenin transcription (23). Wepreviously observed a similar fragment of PTPA containing thecatalytically active intracellular domain (ICD) in the nucleus of alung cell line (24).

We have previously shown that PTPA protein is down-regulated inglioblastoma (8). Here, we show that overexpression of full-lengthPTPA in glioblastoma cells suppresses cell migration and growthfactor–independent cell survival. In addition, we propose that PTPAdown-regulation in glioblastoma is the result of sequential cleavageof full-length PTPA protein to generate the fragments PDE and ICD.In support of this hypothesis, the intracellular fragments of PTPA arepresent in human glioblastoma samples and glioblastoma xenograftflank tumors. Surprisingly, short hairpin RNA (shRNA)–mediateddown-regulation of PTPA fragments decreases cell migrationand growth factor–independent survival in glioblastoma cells.

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

This article is dedicated to Tabitha Yee-May Lou who recently lost her battle withglioblastoma.Requests for reprints: Susann M. Brady-Kalnay, Department of Molecular Biology

and Microbiology, School of Medicine, Case Western Reserve University, 10900 EuclidAvenue, Cleveland, OH 44106-4960. Phone: 216-368-0330; Fax: 216-368-3055; E-mail:[email protected].

I2009 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-09-0863

Cancer Res 2009; 69: (17). September 1, 2009 6960 www.aacrjournals.org

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Published Online First on August 18, 2009 as 10.1158/0008-5472.CAN-09-0863

Research. on July 1, 2015. © 2009 American Association for Cancercancerres.aacrjournals.org Downloaded from

Published OnlineFirst August 18, 2009; DOI: 10.1158/0008-5472.CAN-09-0863

http://cancerres.aacrjournals.org/

Furthermore, peptide inhibition of the function of PTPA fragmentsinhibits cell migration. These data suggest that proteolytic cleavageof full-length PTPA generates PTPA fragments that regulate cellmigration and growth factor–independent survival in glioblastoma.These PTPA fragments can be targeted to develop novel therapeuticagents for glioblastoma patients.

Materials and Methods

Cell lines. The human GBM cell lines U-87 MG and LN-229 were

obtained from the American Type Culture Collection. Human Gli36D5glioblastoma cells have been described (25).

Lentiviral transduction. A human full-length PTPA cDNA construct in

pMT2 has been described (26). Full-length PTPA was ligated into the

lentiviral expression vector pCDH-MCS2 (System Biosciences). A full-lengthPTPA-green fluorescent protein (GFP) fusion construct has been described

(27). The PTPA-GFP cassette was subcloned into pCDH-MCS2. An

intracellular PTPA-GFP fusion construct corresponding to PTPA ICD has

been described (24). Lentiviral shRNA constructs and the production ofVSV-G–pseudotyped lentiviral particles have been described (8).

Immunoblotting. Cell lysates were prepared and immunoblotted as

described (8) using normalized samples of f20 Ag protein detected with

monoclonal antibodies recognizing the intracellular segment of PTPA (SK-7or SK-18; ref. 28). An antibody against vinculin was from Sigma-Aldrich. The

GFP antibody JL-8 was from Clontech.

Reverse transcription-PCR. Reverse transcription-PCR (RT-PCR) wasperformed as described (8). The PCR primers were as follows: extracellular,

CGCGAATTCTAGAGACGTTCTCAGGTGGC ( forward) and CCCGCAAGCT-

TACTTCTTCTCGCACTTG (reverse); intracellular, CGCGGATCCAAAGA-

GACCATGAGCAGCACCCGA ( forward) and CCGGAATTCTCATCTGTTC-TCATCTTTCTTAGCCGA (reverse).

Scratch wound assay. Scratch wound assays were performed as

described (8). Confluent monolayers of cells were scratched to induce a

wound and analyzed by microscopy for the distance migrated by theleading edge of the wound at 0 and 24 h.

Colony formation assays. Growth factor–independent clonogenic

colony assays were performed as described (29). Crystal violet–stainedcolonies were imaged with the Quantity One imaging software of the Gel

Doc imaging system (Bio-Rad). Images were quantitated using MetaMorph

software (Molecular Devices) by measuring the thresholded area of each

well to include only colonies. For the soft agarose assay, cells were seeded at

a concentration of 75,000/mL in 0.4% agarose and plated on an underlay of

0.8% agarose in a six-well plate. Colonies were analyzed after 4 wk by

imaging Z-stacks of 20 random 10� fields using a Leica DMI6000B

automated inverted microscope (Leica Microsystems GmbH) attached to aRetiga EXi camera (QImaging). The number of colonies in minimized

Z-stacks from each microscope field was recorded.

Biotinylation of cell surface proteins. Cell surface biotinylation wasperformed using a Sulfo-NHS-SS-Biotin kit (Pierce). Biotinylated proteins

were isolated and resolved by SDS-PAGE on 6% gels followed by

immunoblotting with an antibody to PTPA (SK-18) as described (30).

Inhibitors. The furin inhibitor I (Dec-RVKR-CMK; Calbiochem) was usedat 50 Amol/L for 17 to 20 h. The g-secretase inhibitors DAPT (Sigma-

Aldrich) and L685,458 (Sigma-Aldrich) were used at 2 and 5 Amol/L,

respectively, for 17 to 20 h. The proteasome was inhibited with MG132

(Sigma-Aldrich) at 20 Amol/L or epoxomicin (Calbiochem) at 5 Amol/Lfor 4 h. GM6001 (Calbiochem) was used at 50 Amol/L as a matrix

metalloproteinase (MMP)/ADAM inhibitor for 17 to 20 h. Inhibitors were

reconstituted in DMSO, which was used as a vehicle control. An inhibitor

of PTPA function targeting the helix-loop-helix wedge domain hasbeen shown to inhibit PTPA function (19, 20). The PTPA wedge

peptide and a scrambled control peptide were synthesized to include a

membrane-penetrant Tat-derived sequence at the COOH terminus topromote cellular uptake. Peptides synthesized by Genemed Synthesis or

GenScript were reconstituted in water and added to cells at a final

concentration of 5 Amol/L.

Immunoprecipitations. Cells were grown to confluence, treated withinhibitors, and lysed in 20 mmol/L Tris-HCl (pH 7.5), 1% Triton X-100,

150 mmol/L NaCl, 2 mmol/L EDTA, 1 mmol/L benzamidine, 5 Ag/mL

aprotinin, 5 Ag/mL leupeptin, and 1 Ag/mL pepstatin. Samples were

sonicated and centrifuged at 10,000 rpm for 5 min. Immunoprecipitationsfrom f400 Ag total protein were performed as described (27) using a PTPAantibody (SK-18) and resolved by SDS-PAGE on 8% gels followed by

immunoblotting with an antibody to PTPA (SK-7).Immunocytochemistry. Immunofluorescent cell staining was per-

formed as described (24). Fixed cells were probed with SK-7 or SK-18,

which recognize intracellular PTPA, and detected with goat anti-mouse

Alexa Fluor 488 secondary antibody (Molecular Probes, Invitrogen). Slideswere mounted with Citifluor antifadent mounting medium (Electron

Microscopy Sciences) and imaged using the Leica system described above.

Tumor specimens. Fresh human brain and tumor tissues were obtained

from surgical resections in accordance with an approved protocol from theUniversity Hospitals Case Medical Center Institutional Review Board. GBM

Figure 1. PTPA expression is posttranscriptionallyregulated. A, lysates from U-87 MG cells, parentalLN-229 cells, and LN-229 cells overexpressing PTPAwere analyzed by immunoblotting. PTPA wasdetected using an antibody to the intracellulardomain (SK-18) that recognizes both the full-length(FL ; 200 kDa) protein and the furin-cleavedintracellular P-subunit (P ; 100 kDa). U-87 MG cellsexpress PTPA, but LN-229 cells down-regulatedPTPA protein. PTPA was overexpressed inLN-229 cells. Vinculin (117 kDa) was used as aloading control. B, RT-PCR analysis of LN-229 andU-87 MG mRNA indicated that PTPA mRNA isexpressed in both cell lines when compared with thePCR product of a control PTPA-containing plasmidwith primers derived from both the extracellularand intracellular domains. Size is indicated in basepairs. C, PTPA shRNA but not control shRNA down-regulated PTPA transcript; however, there was nochange in GAPDH mRNA.

Proteolysis of PTPm Regulates GBM Cell Migration

www.aacrjournals.org 6961 Cancer Res 2009; 69: (17). September 1, 2009




specimens of f100 mg each were obtained for protein extraction.Noncancerous, noneloquent, cortical brain was also collected.

GBM xenograft tumors were grown in NIH athymic nude female mice in

accordance with an approved protocol from the Case Western Reserve

University Institutional Animal Care and Use Committee. LN-229 or Gli36D5cells (2 � 106) were resuspended in a 1:1 dilution of Matrigel (BD

Biosciences) in PBS and injected s.c. in the right flank region of the mouse.

Tumors were harvested between 9 and 28 d after injection. Lysates of

human and xenograft tumor specimens were prepared as described (8).Tumor samples were homogenized using a tissue tearor homogenizer or a

2 mL Dounce homogenizer. Cleared lysates (f20 Ag from human samples

and f50 Ag from xenograft samples) were analyzed by immunoblot on 8%

gels with an antibody to PTPA (SK-18).Statistics. Data presented represent at least three independent experi-

ments. Replicates were normalized as a percent of the control, and the

means were plotted using Microsoft Excel. Error bars indicate SE. Data wereanalyzed for statistical significance using an unpaired Student’s t test.

Results

PTPM protein is down-regulated in the human glioblastomacell line LN-229. We recently showed that PTPA is endogenouslyexpressed in the human GBM cell line U-87 MG and that shRNA-mediated down-regulation of PTPA in U-87 MG cells promotes cellmigration and dispersal (8). Furthermore, PTPA protein is down-regulated in human GBM tumors and the migratory human GBMcell line LN-229. In the current study, PTPA was overexpressed inLN-229 cells via a lentiviral construct, and both the full-length and

normally produced P-subunit were detected by immunoblottingwith an intracellular antibody to PTPA (Fig. 1A). Lentiviraloverexpression of PTPA generated doublets at molecular weightscorresponding to both full-length and P-subunit PTPA (Fig. 1A).These doublets likely are due to posttranslational modifications.mRNA expression of PTPA was examined by RT-PCR in both U-87MG and LN-229 cells. U-87 MG cells expressed PTPA transcript asexpected. Surprisingly, PTPA transcript was also detected in LN-229cells despite their lack of PTPA protein expression (Fig. 1B). PTPAshRNA down-regulated PTPA transcript but did not affect controlglyceraldehyde-3-phosphate dehydrogenase (GAPDH; Fig. 1C).These data suggest that the down-regulation of PTPA in glioblastomais due to a posttranscriptional mechanism.Overexpression of PTPM suppresses cell migration and

growth factor–independent cell survival. We showed recentlythat shRNA-mediated down-regulation of endogenous PTPA inU-87 MG cells promotes cell migration (8). Based on these data, wehypothesized that overexpression of PTPA in LN-229 cells wouldsuppress cell migration. We evaluated this hypothesis using ascratch wound assay. Confluent monolayers of LN-229 cellsoverexpressing either vector or PTPA were scratched to form awound. After 24 hours, control LN-229 cells at the leading edge ofthe wound migrated an average of 150 Am (Fig. 2A). However, LN-229 cells overexpressing PTPA had impaired migration with a 3-foldreduction in the distance migrated (Fig. 2A). Additionally, over-expression of PTPA induced a morphologic change in LN-229 cellsand made the cells noticeably elongated (Fig. 2A). Because this

Figure 2. Overexpression of PTPAsuppresses glioblastoma cell migrationand growth factor–independent survival.A, confluent monolayers of LN-229 cellsexpressing vector or PTPA were scratchedand imaged at 0 and 24 h. Dashed lines,position of the wounded edge at 0 h. Scalebar, 200 Am. *, statistically significant3-fold reduction in migration (P < 0.0001,n = 4). B, LN-229 cells expressing vectoror PTPA were deprived of growth factorstimulation and allowed to form colonies.*, statistically significant 2-fold reduction incolony formation (P < 0.0001, n = 3).

Cancer Research





assay occurred over 24 hours, it was possible that changes in cellproliferation could account for the difference in wound size. Torule out this possibility, LN-229 cells infected with vector or PTPAwere labeled with propidium iodide and analyzed by flowcytometry. Flow cytometry revealed no significant changes in cellproliferation between the vector- and PTPA-infected cells (data notshown). Therefore, we concluded that the difference in wound sizewas due to a decrease in migration resulting from PTPAoverexpression, indicating that PTPA suppresses migration ofLN-229 glioblastoma cells.

Growth factor–independent survival is a hallmark of tumori-genesis. To assess the effect of PTPA overexpression on growthfactor–independent survival, a colony formation assay was used.After 2 weeks of growth factor deprivation, control LN-229 cells

formed abundant colonies (Fig. 2B). In contrast, overexpression ofPTPA reduced colony formation by 2-fold (Fig. 2B). Therefore,PTPA overexpression suppresses migration in two-dimensionalculture and reduces growth factor–independent survival in three-dimensional culture of glioblastoma cells.Proteolysis of PTPM contributes to its down-regulation in

glioblastoma. Other receptor tyrosine phosphatases are sequen-tially cleaved by a furin-like protease, an ADAM-type MMP, and ag-secretase to release a soluble intracellular fragment (23, 31, 32).Because GBMs are known to have up-regulated proteases (33), wehypothesized that constitutive proteolysis of PTPA may be themechanism of PTPA down-regulation in GBM. We first determinedwhether full-length PTPA could be detected in parental LN-229cells. Because we cannot detect PTPA in a total cell lysate of

Figure 3. PTPA is proteolyticallyprocessed to release a catalyticallyactive intracellular fragment from themembrane. A, lysates from parentalLN-229 cells and LN-229 cellsoverexpressing PTPA were biotinylatedand immunoblotted for PTPA with anantibody against the intracellular segmentof PTPA (SK-18). Trace amounts ofPTPA protein were detected in cellsurface–labeled LN-229 cells. Treatmentwith an inhibitor of furin preventedP-subunit formation. B, LN-229 cellstreated with protease inhibitors wereimmunoprecipitated with SK-18 andimmunoblotted with an antibody againstthe juxtamembrane domain of PTPA (SK-7). Proteolyzed membrane-associated(PDE) and soluble (ICD) fragments of PTPAwere stabilized with g-secretase (DAPT)and proteasome (MG132) inhibitors.C, lysates from LN-229 cells treatedwith specific protease inhibitors andoverexpressing PTPA or PTPA-GFP wereimmunoblotted with SK-7 and GFPantibodies, respectively. PTPA PDE andICD were stabilized with g-secretase(DAPT and L685,458) and proteasome(MG132 and epoxomicin) inhibitors.Vinculin was used as a loading control.D, PTPA is sequentially cleaved by afurin-like protease, an a-secretase(ADAM-type MMP), and a g-secretase togenerate a membrane-free ICD thattranslocates to the nucleus.






parental LN-229 cells, we biotinylated cell surface proteins andused avidin resin to enrich the pool of biotinylated cell surfaceproteins. Despite the lack of PTPA in the total cell lysate, thebiotinylated cell surface fraction contained trace amounts of PTPA(Fig. 3A). PTPA is cleaved by a furin-like protease to generate the E-and P-subunits of PTPA (11, 21, 22). As expected, treatment of cellswith an inhibitor of furin activity resulted in an accumulation offull-length PTPA (200 kDa) at the cell surface. These data imply thatthere is a trace amount of endogenous PTPA in LN-229 cells that isprocessed by proteolysis. Biotinylation of cell surface proteins fromLN-229 cells overexpressing PTPA showed a similar pattern of full-length PTPA accumulation at the cell surface on furin inhibition(Fig. 3A).

After furin cleavage, PTPn, another PTPA subfamily member, issubsequently cleaved by a- and g-secretases (23). We hypothe-sized that PTPA is cleaved similarly. To test this hypothesis, LN-229 cells were treated with inhibitors of a- and g-secretases.Proteasome inhibitors were used for biochemical detection toprevent rapid degradation of these fragments (23). Because wecannot detect PTPA in whole-cell lysates, the PTPA fragmentswere immunoprecipitated from LN-229 cells treated with inhib-itors using antibody to the intracellular domain of PTPA. Theg-secretase inhibitor DAPT stabilized a fragment that correspondsby molecular weight to a membrane-tethered truncated P-subunittermed PDE (Fig. 3B). Treatment with the proteasome inhibitorMG132 led to the accumulation of both PDE and a solublefragment termed PTPA ICD (Fig. 3B). The MMP inhibitor GM6001limited the formation of PTPA PDE and ICD fragments, indicatingthat cleavage by a MMP is required for subsequent processing(Fig. 3B). MG132 has been reported to inhibit g-secretase activity

in addition to proteasome activity, leading to the accumulation ofa- and g-secretase products (23, 34). Subsequent experimentsincluded a more specific proteasome inhibitor, epoxomicin, todistinguish these events. Overall, these data support ourhypothesis that the endogenous PTPA expressed in LN-229 cellsis constitutively cleaved to generate PTPA PDE and ICD.Consequently, little full-length PTPA is present to function at thecell surface in LN-229 cells.

Total cell lysates from LN-229 cells overexpressing PTPA showeda similar pattern of cleavage products on inhibitor treatment (Fig.3C). Stabilization of PTPA ICD with treatment of epoxomicinconfirmed that this fragment is labile and can only be seen whenstabilized by the addition of a proteasome inhibitor. Treatment withMG132 and g-secretase inhibitors (DAPT and L685,458) showedaccumulation of PTPA PDE and ICD (Fig. 3C). To verify if thecleavage products include the COOH terminus of the ICD of PTPA,we overexpressed a PTPA construct with a COOH-terminal GFP-tag(PTPA-GFP) in LN-229 cells. Cells expressing PTPA-GFP weretreated with inhibitors as above, and total cell lysates were immuno-blotted with GFP to detect the PTPA-GFP fragments. A GFPantibody detected a similar pattern of fragments, suggesting thatPTPA PDE and ICD fragments include the COOH terminus of PTPA(Fig. 3C). These data support the model depicted in Fig. 3D . Full-length PTPA is cleaved by a furin-like protease to generate theE- and P-subunits in ‘‘normal’’ proteolytic processing. Cleavage byan ADAM-type MMP (a-secretase) in GBM cells generates PTPAPDE. Subsequently, PDE is cleaved by g-secretase to generate PTPAICD.

PTPA ICD is a soluble fragment that translocates to the nucleusin another cell type (24). To determine the subcellular localization

Figure 4. PTPA ICD localizes to thenucleus, and PDE and ICD are expressedin human glioblastoma tumors andglioblastoma xenografts. A, LN-229 cellsexpressing endogenous ICD wereanalyzed by immunocytochemistry usingintracellular antibodies to PTPA(SK-7 and SK-18). LN-229 cellsoverexpressing GFP-tagged PTPA ICD orfull-length PTPA were also examined.Scale bar, 20 Am. B, PTPA expression inhuman normal brain and glioblastomatissue from four patients was analyzed byimmunoblotting with SK-18. Vinculin wasused as a loading control. C, PTPA PDEand ICD expression was analyzed inLN-229 and Gli36D5 xenografts frommouse flank by immunoblotting withSK-18. A human GBM tumor (T ) wasloaded at the end for comparison. Vinculinwas used as a loading control. The humanGBM tumor specimen was loaded with2-fold less protein, as its PTPA PDE andICD expression is significantly higher thanthat of the xenograft specimens(see vinculin lane).

Cancer Research





of PTPA ICD in glioblastoma cells, we performed immunocyto-chemistry on LN-229 cells. Antibodies recognizing the juxtamem-brane (SK-7) and first phosphatase (SK-18) domains of PTPAdetected an endogenous PTPA species with a nuclear pattern oflocalization similar to DAPI (4¶,6-diamidino-2-phenylindole)–stained nuclei (Fig. 4A). The epitopes of these antibodies suggestthat this species is PTPA ICD. Overexpression of GFP-tagged PTPAICD also localized to the nucleus and confirmed these findings. Incontrast, overexpression of GFP-tagged full-length PTPA resulted ina cell-cell contact and filopodial staining pattern as reportedpreviously (35). Full-length PTPA likely senses extracellularadhesive cues to suppress migration by contact inhibition, whereasPTPA ICD distributes to the cytoplasm and nucleus. These datasuggest that full-length PTPA and PTPA ICD have distinctlocalization patterns, potentially leading to differences in theirdownstream signaling.Intracellular fragments of PTPM are expressed in human

glioblastoma tumors and glioblastoma xenograft tumors. Wepreviously showed that PTPA protein expression is down-regulatedin human GBM tumor samples (8). However, immunoblotting freshGBM tumor tissue lysates on higher percentage gels indicated thatfragments of PTPA corresponding to PTPA PDE and ICD areexpressed in human GBM tumor samples in comparison with

normal brain tissue from the same patient (Fig. 4B). Full-lengthPTPA was undetectable in these GBM tumor samples (Fig. 4B).PTPA PDE and ICD were identified in normal tissue samples thatretain significant expression of full-length PTPA (Fig. 4B ).Therefore, it is the expression of full-length PTPA that differsbetween normal brain and GBM tumor tissue. Normal brain tissueexpresses full-length PTPA, whereas GBM tumor tissue does notexpress full-length PTPA but retains PTPA PDE and ICD.

Neither full-length PTPA nor PTPA PDE and ICD are detectablein LN-229 total cell lysates by immunoblot. We assessed humanGBM cell line tumor xenografts grown in mouse flanks todetermine if the three-dimensional architecture of the tumorwould stabilize PTPA fragments in the GBM cells. Flank tumorlysates from LN-229 xenografts expressed little detectable full-length PTPA but expressed abundant PTPA PDE and ICD (Fig. 4C).Similar results were obtained using xenografts prepared withanother glioma cell line, Gli36D5 (Fig. 4C). These data suggest thatthe three-dimensional human glioblastoma tumors and in vivoglioblastoma tumor models favor PTPA proteolysis and stabilizePTPA ICD and its precursor, PDE, in vivo .PTPM fragments contribute to glioblastoma cell migration

and both growth factor–independent and anchorage-indepen-dent cell survival. PTPA ICD is a soluble fragment generated from

Figure 5. PTPA fragments contribute to glioblastoma cell migration and both growth factor–independent and anchorage-independent cell survival. A, confluentmonolayers of LN-229 cells expressing control or PTPA shRNA constructs were scratched and imaged at 0 and 24 h. Dashed lines, position of the woundededge at 0 h. Scale bar, 200 Am. *, statistically significant reduction in migration (PTPA shRNA #1, n = 4; PTPA shRNA #2, n = 6; P < 0.05). B, LN-229 cells expressingcontrol or PTPA shRNA were deprived of growth factor stimulation and allowed to form colonies. *, statistically significant reduction in colony formation(P < 0.001, n = 2). C, colonies of LN-229 cells expressing control or PTPA shRNA were allowed to form in soft agarose over 4 wk. *, statistically significant reduction incolony formation (P < 0.0001, n = 20).






PDE that translocates to the nucleus (Fig. 4A). PTPA ICD containsthe catalytic domain of PTPA and has the potential to signaldifferently than that of membrane-bound, cell surface–associatedPTPA due to changes in substrate availability in different cellularcompartments. Overexpression of membrane-bound, cell surface–associated PTPA suppressed GBM cell migration and growthfactor–independent survival (Fig. 2). We hypothesized that PTPAICD and its precursor, PDE, may signal differently and affect themigration and growth factor–independent survival of GBM cells.First, the effect of PTPA fragments on cell migration was analyzedusing a scratch wound assay.

PTPA mRNA is expressed in LN-229 cells, but the only detectableproteins are PTPA fragments (Fig. 4). Therefore, we were able touse shRNA to down-regulate PTPA fragments. Confluent mono-layers of LN-229 cells expressing either control or two differentPTPA shRNA constructs were scratched and allowed to migrate(Fig. 5A). Down-regulation of PTPA fragments by both shRNAconstructs suppressed cell migration by 2-fold (Fig. 5A). To rule outchanges in cell proliferation, LN-229 cells infected with control orPTPA shRNA were labeled with propidium iodide and analyzed byflow cytometry. No significant changes in cell proliferation weredetected (data not shown).

Both PTPA PDE and ICD are partially stabilized by theg-secretase inhibitor DAPT and are not formed when ADAMs areinhibited (Fig. 3B). These inhibitors were used in a scratch woundassay to analyze their effects on PTPA fragment–mediated cellmigration. Stabilization of PTPA fragments with DAPT increasedmigration, and prevention of PTPA fragment formation by GM6001decreased migration (Supplementary Fig. S1). These data suggestthat proteolysis of PTPA promotes LN-229 cell migration.

Because PTPA overexpression affected growth factor–indepen-dent cell survival, we hypothesized that PTPA fragments may alsoaffect cell survival. To test this hypothesis, LN-229 cells expressingcontrol or PTPA shRNA were seeded at low density and allowed toform colonies over 2 weeks (Fig. 5B). Down-regulation of PTPA

fragments via shRNA reduced the number of colonies incomparison with control cells by 3-fold (Fig. 5B). These findingswere confirmed in a soft agarose assay for anchorage-independentsurvival. PTPA shRNA reduced the number of colonies in this assayby 5-fold (Fig. 5C). These data suggest that PTPA fragmentspromote both cell migration and growth factor–independentsurvival of glioblastoma cells.Catalytic activity of PTPM fragments is required for

glioblastoma cell migration. Soluble intracellular PTPA has beenshown to retain catalytic activity (24, 28). To examine whether thecatalytic activity of PTPA fragments is important in the regulationof cell migration, PTPA function was inhibited using a PTPA-specific peptide inhibitor (19). Confluent monolayers of LN-229cells were treated with a membrane-penetrant PTPA wedge peptideor a control scrambled peptide before scratching to induce awound (Fig. 6). The PTPA wedge peptide significantly reducedmigration of LN-229 cells (Fig. 6). This suppression is likely due toinhibition of the signaling of the PTPA fragments as they are theonly detectable PTPA protein stabilized in LN-229 cells (Fig. 4).These data suggest that PTPA fragments must be catalyticallyactive to induce GBM cell migration. Therefore, the wedge peptideinhibitor of PTPA may have therapeutic value in the treatment ofhuman glioblastoma.

Discussion

Down-regulation of PTPA in a human glioblastoma cell line thatexpresses PTPA was reported to induce cell migration anddispersal (8). In this study, we show that overexpression of PTPAsuppresses migration and growth factor–independent survival ofglioblastoma cells. Furthermore, down-regulation of PTPA in GBMis due to proteolytic processing into a series of fragments. Humanglioblastoma tumor samples selectively retain PTPA fragments,both ICD and its precursor, PDE, in comparison with patient-matched normal brain tissue. In the absence of full-length PTPA,

Figure 6. PTPA fragment–induced migration of glioblastoma cells is abrogated by a peptide inhibitor of PTPA function. Confluent monolayers of LN-229 cells weretreated with the PTPA wedge inhibitor peptide or a scrambled control, scratched to form a wound, and imaged at 0 and 24 h. Dashed lines, position of thewounded edge at 0 h. Scale bar, 200 Am. *, statistically significant difference in migration (P < 0.02, n = 6).

Cancer Research





this PTPA fragment signal promotes cell migration and growthfactor–independent survival. The balance of full-length PTPA andPTPA fragment signaling is likely important in regulating thecontact inhibition switch between cell adhesion and cellmigration.

The receptor tyrosine phosphatases PTPn, PTP~/h, and LAR areregulated by sequential proteolysis (23, 31, 32). Furthermore, othertransmembrane receptors, such as Notch, are similarly cleaved.Notch signaling is regulated by sequential cleavage by furin,ADAMs, and g-secretase that ultimately generates an intracellularfragment (36). This fragment translocates to the nucleus andregulates the CBF1 transcription complex to control cellularprocesses such as differentiation and tumorigenesis (37). Thisregulation of cell surface receptors by proteolysis during develop-ment might be recapitulated during tumorigenesis as GBM cellshave dedifferentiated, stem cell–like characteristics (3).

Differences in full-length PTPA and PTPA fragment signalinglikely depend on the availability of PTPA binding partners anddownstream effectors. Furthermore, as a homophilic cell adhesionmolecule, it may be that cell surface PTPA and PTPA fragmentsignaling pathways regulate the adhesive versus migratory switchof contact-inhibited or dispersive cells, respectively. Cell surfacePTPA binds and regulates cadherins and catenins (12), keycomponents of classic adherens junctions. Four classic cadherinsubtypes, E-, N-, R-, and VE-cadherin, associate with PTPA (35, 38–40). The cadherin binding partner p120-catenin (p120) has beenimplicated as a PTPA binding partner and substrate (41) andcontributes to tumorigenesis by regulating cell migration (42). p120can translocate to the nucleus and associate with the transcriptionfactor Kaiso (43). Interestingly, a proteolytically cleaved intracellu-lar fragment of E-cadherin requires p120 for its nucleartranslocation (44). The cytoplasmic domain of N-cadherin canalso be proteolytically processed and translocate to the nucleus(45). p120 is involved in the recruitment of g-secretase toN-cadherin for its cleavage (46). It is interesting to speculate thatPTPA fragments generated from the proteolytic cleavage of PTPAmay regulate a nuclear complex of N-cadherin and p120 given thatPTPA interacts with cadherins and p120 via its ICD (35, 41).

Computer-based searches for a canonical nuclear localizationsequence (NLS) in PTPA were unsuccessful. However, both p120and another PTPA-interacting protein, BCCIP (24), contain NLSmotifs (47, 48). The yeast homologue of BCCIP has been shown toregulate nuclear export (49). Therefore, p120 and BCCIP may aid inthe shuttling of PTPA ICD in and out of the nucleus.

Migration and dispersal of glioblastoma cells remains a clinicalproblem due to the lack of effective specific therapies (1–3).Individual glioblastoma cells migrate and disperse throughout thebrain parenchyma to form new foci. These cells must have elevatedgrowth factor–independent survival signaling to evade anoikis-mediated cell death and to clonally expand. Therefore, it isinteresting that both migration and growth factor–independentsurvival pathways are regulated by PTPA fragments. Furthermore, apeptide inhibitor targeting PTPA fragment function reduces cellmigration. A small-molecule inhibitor that mimics this peptide willbe developed to target PTPA fragments and suppress glioblastomacell migration and dispersal in vivo . Such an advance in the field oftargeted therapeutics would fulfill a vast need for specific therapyin glioblastoma treatment.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

Received 3/5/09; revised 6/17/09; accepted 6/23/09; published OnlineFirst 8/18/09.Grant support: NIH grant R01-NS051520 (S.M. Brady-Kalnay, S. Robinson, and R.H.

Miller); National Cancer Institute grants K08-CA101954 and R01-CA116257, Ivy BrainTumor Foundation, and Cancer Genome Atlas Project (A.E. Sloan); and NIH grantsT32-GM007250 (Medical Scientist Training Program) and T32-CA059366 (A.M.Burgoyne). Additional support was obtained from the Visual Sciences ResearchCenter Core Grant P30-EY11373 and the Case Comprehensive Cancer Center CoreGrant P30-CA043703 from the NIH.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Moonkyung Caprara, Carol Luckey, and Theresa Gates for technicalsupport; Sara Lou and Scott Howell for help with figures and graphs; and members ofthe Brady-Kalnay lab for insightful discussions.



References

1. Louis DN. Molecular pathology of malignant gliomas.Annu Rev Pathol 2006;1:97–117.2. Wen PY, Kesari S. Malignant gliomas in adults. N EnglJ Med 2008;359:492–507.3. Furnari FB, Fenton T, Bachoo RM, et al. Malignantastrocytic glioma: genetics, biology, and paths totreatment. Genes Dev 2007;21:2683–710.4. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK. WorldHealth Organization classification of tumours of thenervous system. 4th ed. Lyon: IARC; 2007.5. Ohgaki H, Kleihues P. Genetic pathways to primaryand secondary glioblastoma. Am J Pathol 2007;170:1445–53.6. Nakada M, Nakada S, Demuth T, Tran NL, HoelzingerDB, Berens ME. Molecular targets of glioma invasion.Cell Mol Life Sci 2007;64:458–78.7. Sathornsumetee S, Rich JN. Designer therapies forglioblastoma multiforme. Ann N Y Acad Sci 2008;1142:108–32.8. Burgoyne AM, Palomo JM, Phillips-Mason PJ, et al.PTPA suppresses glioma cell migration and dispersal.Neuro-oncol 2009. Epub ahead of print, March 20, 2009.

9. Gebbink MF, Zondag GC, Wubbolts RW, BeijersbergenRL, van Etten I, Moolenaar WH. Cell-cell adhesionmediated by a receptor-like protein tyrosine phospha-tase. J Biol Chem 1993;268:16101–4.10. Brady-Kalnay SM, Flint AJ, Tonks NK. Homophilicbinding of PTPA, a receptor-type protein tyrosinephosphatase, can mediate cell-cell aggregation. J CellBiol 1993;122:961–72.11. Brady-Kalnay SM, Tonks NK. Identification of thehomophilic binding site of the receptor protein tyrosinephosphatase PTPA. J Biol Chem 1994;269:28472–7.12. Ensslen-Craig SE, Brady-Kalnay SM. Receptor proteintyrosine phosphatases regulate neural development andaxon guidance. Dev Biol 2004;275:12–22.13. Sallee JL, Wittchen ES, Burridge K. Regulation of celladhesion by protein-tyrosine phosphatases. II. Cell-celladhesion. J Biol Chem 2006;281:16189–92.14. Tonks NK. Protein tyrosine phosphatases: fromgenes, to function, to disease. Nat Rev Mol Cell Biol2006;7:833–46.15. Ostman A, Hellberg C, Bohmer FD. Protein-tyrosine phosphatases and cancer. Nat Rev Cancer2006;6:307–20.16. Aricescu AR, Siebold C, Jones EY. Receptor protein

tyrosine phosphatase A: measuring where to stick.Biochem Soc Trans 2008;36:167–72.17. Alonso A, Sasin J, Bottini N, et al. Protein tyrosinephosphatases in the human genome. Cell 2004;117:699–711.18. Tiganis T, Bennett AM. Protein tyrosine phosphatasefunction: the substrate perspective. Biochem J 2007;402:1–15.19. Xie Y, Massa SM, Ensslen-Craig SE, et al. Protein-tyrosine phosphatase (PTP) wedge domain peptides: anovel approach for inhibition of PTP function andaugmentation of protein-tyrosine kinase function. J BiolChem 2006;281:16482–92.20. Oblander SA, Ensslen-Craig SE, Longo FM, Brady-Kalnay SM. E-cadherin promotes retinal ganglion cellneurite outgrowth in a protein tyrosine phosphatase-A-dependent manner. Mol Cell Neurosci 2007;34:481–92.21. Campan M, Yoshizumi M, Seidah NG, Lee ME,Bianchi C, Haber E. Increased proteolytic processingof protein tyrosine phosphatase A in confluent vascularendothelial cells: the role of PC5, a member of thesubtilisin family. Biochemistry 1996;35:3797–802.22. Gebbink MF, Zondag GC, Koningstein GM, Feiken E,




Cancer Research


Wubbolts RW, Moolenaar WH. Cell surface expression ofreceptor protein tyrosine phosphatase RPTPA is regu-lated by cell-cell contact. J Cell Biol 1995;131:251–60.23. Anders L, Mertins P, Lammich S, et al. Furin-, ADAM10-, and g-secretase-mediated cleavage of a receptortyrosine phosphatase and regulation of h-catenin’stranscriptional activity. Mol Cell Biol 2006;26:3917–34.24. Phillips-Mason PJ, Mourton T, Major DL, Brady-Kalnay SM. BCCIP associates with the receptor proteintyrosine phosphatase PTPA. J Cell Biochem 2008;105:1059–72.25. Tyminski E, Leroy S, Terada K, et al. Brain tumoroncolysis with replication-conditional herpes simplexvirus type 1 expressing the prodrug-activating genes,CYP2B1 and secreted human intestinal carboxylester-ase, in combination with cyclophosphamide andirinotecan. Cancer Res 2005;65:6850–7.26. Gebbink MF, van Etten I, Hateboer G, et al. Cloning,expression and chromosomal localization of a newputative receptor-like protein tyrosine phosphatase.FEBS Lett 1991;290:123–30.27. Hellberg CB, Burden-Gulley SM, Pietz GE, Brady-Kalnay SM. Expression of the receptor protein-tyrosinephosphatase, PTPA, restores E-cadherin-dependentadhesion in human prostate carcinoma cells. J BiolChem 2002;277:11165–73.28. Brady-Kalnay SM, Tonks NK. Purification andcharacterization of the human protein tyrosine phos-phatase, PTPA, from a baculovirus expression system.Mol Cell Biochem 1993;127–8:131–41.29. Franken NA, Rodermond HM, Stap J, Haveman J, vanBree C. Clonogenic assay of cells in vitro . Nat Protoc2006;1:2315–9.30. Yu J, Becka S, Zhang P, Zhang X, Brady-Kalnay SM,

Wang Z. Tumor-derived extracellular mutations ofPTPRT/PTPU are defective in cell adhesion. Mol CancerRes 2008;6:1106–13.31. Chow JP, Fujikawa A, Shimizu H, Suzuki R, Noda M.Metalloproteinase- and g-secretase-mediated cleavageof protein-tyrosine phosphatase receptor type Z. J BiolChem 2008;283:30879–89.32. Haapasalo A, Kim DY, Carey BW, Turunen MK,Pettingell WH, Kovacs DM. Presenilin/g-secretase-mediated cleavage regulates association of leukocyte-common antigen-related (LAR) receptor tyrosine phos-phatase with h-catenin. J Biol Chem 2007;282:9063–72.33. Rao JS. Molecular mechanisms of glioma invasive-ness: the role of proteases. Nat Rev Cancer 2003;3:489–501.34. Kopan R, Schroeter EH, Weintraub H, Nye JS. Signaltransduction by activated mNotch: importance ofproteolytic processing and its regulation by the extracel-lular domain. Proc Natl Acad Sci U S A 1996;93:1683–8.35. Brady-Kalnay SM, Rimm DL, Tonks NK. Receptorprotein tyrosine phosphatase PTPA associates withcadherins and catenins in vivo . J Cell Biol 1995;130:977–86.36. Roy M, Pear WS, Aster JC. The multifaceted role ofNotch in cancer. Curr Opin Genet Dev 2007;17:52–9.37. Shih IeM, Wang TL. Notch signaling, g-secretaseinhibitors, and cancer therapy. Cancer Res 2007;67:1879–82.38. Brady-Kalnay SM, Mourton T, Nixon JP, et al.Dynamic interaction of PTPA with multiple cadherinsin vivo . J Cell Biol 1998;141:287–96.39. Sui XF, Kiser TD, Hyun SW, et al. Receptor proteintyrosine phosphatase A regulates the paracellularpathway in human lung microvascular endothelia. AmJ Pathol 2005;166:1247–58.

40. Hiscox S, Jiang WG. Association of PTPA withcatenins in cancer cells: a possible role for E-cadherin.Int J Oncol 1998;13:1077–80.41. Zondag GC, Reynolds AB, Moolenaar WH. Receptorprotein-tyrosine phosphatase RPTPA binds to anddephosphorylates the catenin p120(ctn). J Biol Chem2000;275:11264–9.42. van Hengel J, van Roy F. Diverse functions of p120ctnin tumors. Biochim Biophys Acta 2007;1773:78–88.43. Daniel JM, Reynolds AB. The catenin p120(ctn)interacts with Kaiso, a novel BTB/POZ domain zincfinger transcription factor. Mol Cell Biol 1999;19:3614–23.44. Ferber EC, Kajita M, Wadlow A, et al. A role for thecleaved cytoplasmic domain of E-cadherin in thenucleus. J Biol Chem 2008;283:12691–700.45. Uemura K, Kihara T, Kuzuya A, et al. Characteriza-tion of sequential N-cadherin cleavage by ADAM10 andPS1. Neurosci Lett 2006;402:278–83.46. Kouchi Z, Barthet G, Serban G, Georgakopoulos A,Shioi J, Robakis NK. p120 catenin recruits cadherins tog-secretase and inhibits production of Ah peptide. J BiolChem 2009;284:1954–61.47. Kelly KF, Spring CM, Otchere AA, Daniel JM. NLS-dependent nuclear localization of p120ctn is necessaryto relieve Kaiso-mediated transcriptional repression.J Cell Sci 2004;117:2675–86.48. Ono T, Kitaura H, Ugai H, et al. TOK-1, a novelp21Cip1-binding protein that cooperatively enhancesp21-dependent inhibitory activity toward CDK2 kinase.J Biol Chem 2000;275:31145–54.49. Audhya A, Emr SD. Regulation of PI4,5P2 synthesisby nuclear-cytoplasmic shuttling of the Mss4 lipidkinase. EMBO J 2003;22:4223–36.




Published OnlineFirst August 18, 2009.Cancer Res Adam M. Burgoyne, Polly J. Phillips-Mason, Susan M. Burden-Gulley, et al. Regulates Glioblastoma Cell MigrationProteolytic Cleavage of Protein Tyrosine Phosphatase µ

Updated version

10.1158/0008-5472.CAN-09-0863doi:

Access the most recent version of this article at:

Material

Supplementary

ml

http://cancerres.aacrjournals.org/content/suppl/2009/08/17/0008-5472.CAN-09-0863.DC1.htAccess the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-09-0863

http://cancerres.aacrjournals.org/content/suppl/2009/08/17/0008-5472.CAN-09-0863.DC1.html

http://cancerres.aacrjournals.org/content/suppl/2009/08/17/0008-5472.CAN-09-0863.DC1.html

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


Proteolytic Cleavage of Protein Tyrosine Phosphatase Regulates Glioblastoma Cell Migration

Documents

Transcript of Proteolytic Cleavage of Protein Tyrosine Phosphatase Regulates Glioblastoma Cell Migration