Planktothrix populations in subalpine lakes: selection for strains with strong gas vesicles as a...

Planktothrix populations in subalpine lakes: selectionfor strains with strong gas vesicles as a function of lakedepth, morphometry and circulation

DOMENICO D’ALELIO, ANDREA GANDOLFI , ADRIANO BOSCAINI, GIOVANNA FLAIM,

MONICA TOLOTTI AND NICO SALMASO

IASMA Research and Innovation Centre, Fondazione Edmund Mach, S. Michele a ⁄ Adige, Trento, Italy

SUMMARY

1. The genus Planktothrix (Cyanobacteria) usually produces concentrated populations of

filaments in the summer metalimnion of thermally stratifying lakes. This has been

associated with the action of gas vesicles, cellular structures providing positive buoyancy.

At the end of the summer, filaments are carried by convective mixing deeper into the water

column where some gas vesicles collapse as a result of high hydrostatic pressure. They

then lose their buoyancy, sink and are lost from the euphotic zone.

2. The resistance of gas vesicles to hydrostatic pressures is critical for the survival of

Planktothrix in deep lakes. However, comparative observations on populations from lakes

of a range of depths and hydrodynamic regimes are still needed to examine the

relationships between the adaptive trait (i.e. the ‘critical’ pressure at which each gas vesicle

collapses) with the environmental factor (i.e. the maximum hydrostatic pressure).

3. To explore the adaptation of Planktothrix populations to the depth of winter circulation

in different systems, we collected 276 strains of P. cf. rubescens from eight lakes (zmax = 24–

410 m) in Northern Italy during summer 2009 and we analysed the multicopy gene gvpC

coding for a protein that crucially influences the critical pressure.

4. The strains analysed clustered into two main groups having gas vesicles with a mean

critical pressure of 1.1 and 0.9 MPa, respectively. The proportion of the stronger strains

was generally positively related to lake depth, although the overall pattern was

complicated by individual lake morphology and hydrology. The relative frequency of

stronger filaments was (i) greatest in deep basins with concave slopes and (ii) least in one

deep, but permanently stratified lake.

5. The simultaneous presence of ‘weaker’ and ‘stronger’ filaments could allow for a rapid

adaptive response to changes in hydrostatic pressures, related to changes in the amplitude

of vertical circulation characterising deep lakes.

Keywords: adaptation, cyanobacteria, gas vesicles, Planktothrix, selective processes

Introduction

The microcystin-producing Planktothrix Anagnostidis

& Komarek, 1988 (Christiansen et al., 2003; Komarek

& Anagnostidis, 2005) is a widespread planktonic

filamentous cyanobacterium adapted to deep oligo-

mesotrophic and thermally stratified lakes, where

it produces concentrated metalimnetic populations

during summer and autumn (e.g. Halstvedt et al.,

2007; Kaiblinger et al., 2007; Salmaso, 2010).

The ecological success of Planktothrix species

depends largely on gas vesicles, which provide the

cells with buoyancy (Walsby, Avery & Schanz, 1998;

Correspondence: Domenico D’Alelio, IASMA Research and

Innovation Centre, Fondazione Edmund Mach, Via E. Mach, 1,

I-38010, S. Michele a ⁄ Adige, Trento, Italy

E-mail: [email protected]

Freshwater Biology (2011) 56, 1481–1493 doi:10.1111/j.1365-2427.2011.02584.x

� 2011 Blackwell Publishing Ltd 1481

Walsby & Schanz, 2002; Walsby, Schanz & Schmid,

2006). By regulating their buoyancy in response to the

vertical light field, Planktothrix filaments are able to

dwell in the metalimnion of lakes that are thermally

stratified in summer. The gas vesicles, which are

hollow cylindrical structures, can withstand moderate

pressure but collapse flat at a certain ‘critical pressure’

(pc) and no longer provide buoyancy. The main sources

of pressure that together cause gas vesicles to collapse

are cell turgor pressure, usually 0.2–0.4 MPa (during

winter and summer, respectively), and hydrostatic

pressure of the water column, which approximately

increases by 0.01 MPa per metre. The critical pressure

of individual gas vesicles within any cell varies around

a well-defined mean value, the ‘mean critical pressure’

(mean pc), which varies in different cyanobacteria from

0.3 MPa to more than 1.1 MPa (Walsby, 1994). Strains

with gas vesicles of the highest critical pressure are

found in the deepest lakes (e.g. Walsby et al., 1998).

The critical pressure of a gas vesicle varies inversely

with its cylindrical diameter, and hence, narrow gas

vesicles withstand higher pressures though provide

less buoyancy (Hayes, Buchholz & Walsby, 1992;

Bright & Walsby, 1999). It has been suggested that

differences in the width, and hence the critical

pressure, of gas vesicles are explained by differences

in the amino acid sequence of the structural proteins

forming the gas vesicle (Walsby, 1994; Kinsman,

Walsby & Hayes, 1995; Oliver & Ganf, 2000). GvpA

proteins (encoded by the gvpA gene) form the ribs

sustaining the main cylinder and show little variation.

GvpC proteins (encoded by gvpC) form an outer layer;

they show several variants that are correlated with

variations in gas vesicle width and strength. In

Planktothrix species, there are three principal variants

of gvpC – gvpC16, gvpC20 and gvpC28 – encoding GvpC

proteins of molar mass 16, 20 and 28 kDa, respectively

(Beard et al., 1999, 2000). The gene variants gvpC16 and

gvpC28 (the shorter and the longer, respectively)

originate from gvpC20 by the deletion of a 99 bp

section and by the insertion of a 219 bp section,

respectively (Beard et al., 1999, 2000). The gas vesicles

constructed from the three different GvpC variants of

increasing molar mass have been shown to be of

different widths and have decreasing pc – in the region

of approximately 1.1, 0.9 and 0.7 MPa (cf. Bright &

Walsby, 1999). Moreover, the contemporary presence

of multiple gvpC variants in Planktothrix has an effect

on the relative strength of the gas vesicles: for

instance, strains having both the gvpC16 and gvpC20

variants and those having only gvpC28 ones were

demonstrated to be able to produce gas vesicles of 1.1

and 0.7 mean pc, respectively. Strains of the first type

are dominant in deep Lake Zurich (zmax = 136 m),

while those having the sole gvpC28 variant have been

detected only in shallower lakes of Northern Europe

(zmax = 8–67 m) (Beard et al., 2000). The correlation

between genotype and mean pc is so high that the

genotype can be used as diagnostic of critical pressure

(Beard et al., 1999, 2000).

We have investigated the relationship between

Planktothrix strains of different gas vesicle critical

pressure and mixing depth in a set of lakes in Northern

Italy. Although the correlation between genotype

(gvpC sequence) and phenotype (mean pc) has been

demonstrated only for the Planktothrix population in

Lake Zurich, we assumed that it also holds for

populations in Italian lakes. In order to test the

hypothesis that the strength of gas vesicles and mixing

depth in winter are related, we (i) isolated 276 strains of

Planktothrix from the summer phytoplankton commu-

nity of eight Italian subalpine lakes differing in

maximum depth, morphometry and dynamics of

vertical water circulation; (ii) amplified portions of

the gvpC gene variants by means of diagnostic PCRs

and used the amplicons as markers of gas vesicle

phenotype and (iii) related the relative abundance of

strains belonging to different genotypes ⁄phenotypes to

lake characteristics. We also considered the role of lake

morphometry in gas vesicle selection: for instance, a

concave shape to the lake basin yields a relatively high

volume of water (along with the entrained plankton)

that can be circulated towards the lake bottom, while

the reverse is true of conical lakes. This aspect could be

crucial to the dynamics of gas vesicles selection in

Planktothrix populations. Furthermore, we hypothe-

sised that filaments with weaker gas vesicles would be

more abundant in lakes where the littoral zone is

sufficient for a large portion of the Planktothrix popu-

lation to remain above the critical pressure depth and

thus avoid a loss of buoyancy during annual mixing.

Methods

Study sites

We investigated eight natural lakes in Northern Italy

(Fig. 1). Lakes Como, Garda, Iseo, Maggiore and the

1482 D. D’Alelio et al.

� 2011 Blackwell Publishing Ltd, Freshwater Biology, 56, 1481–1493

https://www.researchgate.net/publication/12763850_The_diversity_of_gas_vesicle_genes_in_Planktothrix_rubescens_from_Lake_Zurich?el=1_x_8&enrichId=rgreq-370c01a9-f553-4ebc-a1eb-0ce889f4b9f7&enrichSource=Y292ZXJQYWdlOzIyOTk3NjU1MDtBUzoxMDIzMTA3ODUwNjA4NjhAMTQwMTQwNDIwMDM3MQ==



https://www.researchgate.net/publication/242604577_The_critical_pressures_of_gas_vesicles_in_Planktothrix_rubescens_relation_to_the_depth_of_winter_mixing_in_Lake_Zurich_Switzerland?el=1_x_8&enrichId=rgreq-370c01a9-f553-4ebc-a1eb-0ce889f4b9f7&enrichSource=Y292ZXJQYWdlOzIyOTk3NjU1MDtBUzoxMDIzMTA3ODUwNjA4NjhAMTQwMTQwNDIwMDM3MQ==

northern basin of Lake Lugano are large and deep;

Idro, Levico and Pusiano are smaller and shallower.

The large Lakes Como, Maggiore and Garda are

oligomictic, with spring mixing involving an epilim-

nion never <100 m and complete circulation occurring

irregularly during exceptionally cold winters (Buzzi,

2002; Ambrosetti, Barbanti & Carrara, 2010; Salmaso,

2010). The other two large and deep lakes, Iseo and

Lugano (northern basin), tend to be meromictic

because of very strong chemical gradients through

the water column favouring permanent stratification.

Nonetheless, they underwent complete winter mixing

in 2005 and 2006 (Salmaso et al., 2007; Holzner et al.,

2009), and the mixed depth was never <80 m in the

following years (for Iseo: Letizia Garibaldi pers.

comm.; for Lugano: Marco Simona pers comm., see

also http://www.cipais.org/html/lago-lugano-stato.

asp). The mean depth of the mixed layer in these

five deep lakes during the period 2005–09 ranged

from 120 to 211 m (Table 1). Lake Idro is smaller but

nevertheless deep and has not undergone a complete

overturn since the 1960s (Garibaldi et al., 1996, 1997;

Garibaldi personal comm.). The mixed layer depth is

always around 50 m in Lake Idro (Table 1). The

shallow Lakes Levico and Pusiano are dimictic and

monomictic, respectively (Copetti et al., 2006; Perini

et al., 2009). The study lakes have different morpho-

metrics and steepness, which are reflected in their

‘volume development’, Vd (Hakanson, 1981), a para-

meter estimating the departure of the shape of a lake

basin from a cone (Vd = 1). Lake volume development

was calculated as three times the ratio between mean

depth (zmean) and maximum depth (zmax) (Hakanson,

1981). The volume of the littoral zone at a specific

depth was calculated by the formula: ðh=3ÞðA1þ A2þffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi

A1 � A2p

Þ � A2h, where ‘h’ is the vertical depth of a

stratum, A1 the area of the upper surface and A2 the

area of the lower surface of the stratum whose volume

is to be determined (Wetzel, 2001).

Sampling and culturing

All samples were taken in summer 2009. For each

lake, temperature and oxygen profiles were taken at

Fig. 1 Location of the study sites in Northern Italy.

Table 1 Geographic, morphometric and hydrological characteristics of the lakes studied

Lake

Latitude

N

Longitude

E

Altitude

h

(m)

Area

A

(km2)

Maximum

depth

zmax

(m)

Mean

depth

zmean

(m)

Volume

V

(km3)

Relative

depth

zr

(%)

Volume

development

Vd

Renewal

time s(year)

Mixed

depth†

(m)

Como 46�00¢ 09�15¢ 198 146 410 154 22.05 3 1.13 4.5(1) 190(6,13)

Maggiore 45�58¢ 08�39¢ 193 213 370 178 37.50 2 1.44 4.1(1) 120(6,7)

Garda 45�42¢ 10�43¢ 65 368 350 133 49.00 1 1.14 26.6(2) 211(6,8)

Lugano* 45�58¢ 08�59¢ 271 28 288 171 4.07 4 1.78 12.4(3) 163(9,10)

Iseo 45�44¢ 10�04¢ 186 62 251 123 7.06 2 1.47 4.1(1) 148(11,12)

Idro 45�46¢ 10�32¢ 368 11 120 65 0.09 3 1.62 1.2(4) 50(12)

Levico 46�00¢ 11�17¢ 440 1 38 11 0.01 3 0.88 1.1(5) 38

Pusiano 45�48¢ 09�16¢ 259 4 24 14 0.07 1 1.75 0.7(4) 24

*Refers to the Northern basin of Lake Lugano. †Average of the maximum depth of the mixed layer over the period 2005–09. (1)Ambrosetti,

Barbanti & Sala (2003). (2)Ambrosetti & Barbanti (1997). (3)Barbieri & Polli (1992). (4)Ambrosetti & Barbanti (1992). (5)Perini et al. (2009).(6)Salmaso & Mosello (2010 and references therein). (7)Ambrosetti et al. (2010). (8)Salmaso (unpublished) (9)Holzner et al. (2009). (10)Marco

Simona (pers. comm.) and website (in Italian): http://www.cipais.org/html/lago-lugano-stato.asp. (11)Salmaso et al. (2007). (12)Letizia

Garibaldi (pers. comm.) (13)Working Group Lake Como (2006). The mixed layer depths in shallow Lakes Levico and Pusiano were

considered equivalent to the respective lake depth according to Perini et al. (2009) and Copetti et al. (2006), respectively.

Differential selection in Planktothrix 1483


1 m intervals with an Ocean Seven 316 multiparameter

probe (Idronaut, Milan, Italy) or a SD4a probe

(Hydrolab, Austin, TX, U.S.A.) in order to identify

the metalimnion. The phytoplankton community was

than sampled: (i) at discrete depths (every 10 m from

0 to 60 m in deep lakes; every 5 m from 0 to 20 m in

shallow lakes) with a Niskin bottle; (ii) along an

integrated water column (from the base of the meta-

limnion up to the surface of the water column) with a

Schroder sampler and a 40-lm plankton net. The use

of multiple devices was intended to maximise the

number of Planktothrix filaments collected. Single

Planktothrix filaments were isolated by Pasteur micro-

pipette and washed at least three times with sterile

lake water; monoclonal cultures were incubated in

standard BG-11 medium (Stanier et al., 1971) at 20 �C,

30 lmol photon m)2 s)1 and 12 : 12 h = L : D photo-

cycle. Filaments were identified by morphological

criteria according to Komarek & Anagnostidis (2005).

For molecular analyses, a 1 mL aliquot of a dense

culture of each strain was mixed with proteinase K

(0.2 mg mL)1), incubated for 15 min at 55 �C and

subsequently for 15 min at 80 �C; the supernatant was

collected after brief centrifugation, as described by

Beard et al. (2000).

PCR amplification and sequencing

The gvpC region of each strain was characterised by a

single PCR containing three Planktothrix-specific oli-

gonucleotides, as described in Beard et al. (2000): a

forward primer, GVPC9 (ACGCCAACAGGGAGT

TCAAGAACG) and two alternative reverse primers,

GVPC1B (TGGGAACTCCCCCAAACTGTCTG) and

GVPC11 (GGCTACCCACAAACGCTCGGTG), with

the latter specific for the gvpC28 variant (Fig. 2a). Each

amplification was performed in a total volume of

25 lL, containing 5 lL of the cell lysate as a template,

1.5 mMM MgCl2, 200 lMM of dNTP, 1 lMM of each primer,

1· Gold Buffer (Applied Biosystems, Foster City, CA,

U.S.A.) and 1 U of AmpliTaq Gold (Applied Biosys-

tems). PCRs were subjected to an initial denaturation

step at 94 �C for 4 min, followed by 30 amplification

cycles at 94 �C for 45 s, 65 �C for 1 min and 72 �C for

1 min, and by a final elongation step of 72 �C for

5 min, in a Master Cycler Gradient (Eppendorf AG,

Hamburg, Germany). Amplicons were separated by

electrophoresis on a 2% w/v agarose gel prepared in

Tris ⁄Borate ⁄EDTA buffer, stained with ethidium

bromide, and their size was estimated under UV

light by comparison with a known DNA standard

(MassRuler� DNA Ladder Mix and MassRuler� Low

Range DNA, Fermentas International Inc., Burlington,

ON, Canada).

To check for correspondence between observed and

expected size for different amplicons, selected bands

were cut from the gel, purified with the MinElute Gel

Extraction kit (Qiagen, Hilden, Germany) and

sequenced in both directions; the same primers as in

the PCR (with either GVPC1B or GVPC11 depending

on the observed band size) were used with the BigDye

Terminator Cycle Sequencing technology (Applied

Biosystems), according to the manufacturers’ proto-

cols and recommendations. After purification in

A C20 A

A C16 A

A AC28

303 bp

402 bp

181 bp

C9 C1B

C9 C1B

C9 C11

181 bp

402 bp303 bp

1 2 3 4(b)(a)

Fig. 2 Gas vesicle gene gvpC in Planktothrix rubescens. (a) Portion of the gas vesicle gene cluster with alternating gvpA and gvpC genes

(modified from Beard et al., 2000); boxed regions indicate open reading frames, lines below boxes indicate the length of the fragment

amplified by the primers GVPC9, GVPC1B and GVPC11 specific for gvpC (Beard et al., 2000). (b) Electrophoresis gel (2%, w ⁄ v) of PCR

products for the amplification of gvpC in Planktothrix strains from Lake Como: lane 1, strain FEM_DD219, single amplicon of size

402 bp representing the variant gvpC20; lane 2, strain FEM_DD220, two amplicons of size 402 and 303 bp representing the variants

gvpC20 and gvpC16, respectively; lane 3, FEM_DD221, two amplicons of size 402 and 181 bp representing the whole variant gvpC20 and

a portion of gvpC28; lane 4, size standard.



automation using the Millipore Montage SEQ96

Sequencing Reaction Cleanup kit (Millipore Corporate,

Billerica, MA, U.S.A.), products were run on an

Automated Capillary Electrophoresis Sequencer

3730XL DNA Analyser (Applied Biosystems). Forward

and reverse chromatograms were assembled using

ChromasPro (Version 1.49 Beta 2) (Technelysium Pty

Ltd, Tewantin, QLD, Australia).

Data analysis

Text format sequences were first automatically

aligned using the application CLUSTALLUSTALW (Thompson,

Higgins & Gibbson, 1994) included in the program

BioEdit 7.01 (Hall, 1999); the final alignment was then

improved by hand. Regression analysis (Sokal &

Rohlf, 1995) was used to relate different lake morpho-

metrics characteristics to the frequency of different gas

vesicles types. All procedures were run in Statistica 9.1

for Windows (Statsoft Inc., Tulsa, OK, U.S.A.).

Results

Vertical temperature and oxygen profiles were con-

sidered as markers for the localisation of the meta-

limnion and the associated phytoplankton community

(Fig. 3). The survival rate of the different isolates in

laboratory conditions was not identical. For instance,

Fig. 3 Vertical profiles of temperature and dissolved oxygen concentration of the lakes studied. Profiles to 100 m or to the bottom

(for shallow lakes) are presented. The name of the lake and the sampling date are indicated on each graph. For Lake Maggiore, only

the first 50 m of the water column was sampled.



for lakes Como, Idro, Lugano and Pusiano, only

strains isolated from integrated samples were brought

successfully into culture (Table S1). Ultimately, cul-

tures of 276 monoclonal strains of Planktothrix yielded

a biomass sufficiently dense for genetic analyses. All

these strains were identified as Planktothrix cf. rubes-

cens according to standard taxonomic keys (included

in Komarek & Anagnostidis, 2005) – e.g. the arrange-

ment of trichomes (long and straight filaments of cells

showing dense aggregates of gas vesicles), the shape

of apical cells (rounded and sometimes bearing

calyptra), colour (absence of green pigmentation and

tendency to red water discoloration in dense cultures)

and morphometrics (cell width ‡ 6 lm) (Fig. 4).

Fingerprinting analysis of gvpC

Three nucleotide fragments, accounting for about 130,

300 and 400 base pairs (bp), were amplified by PCRs

in the cultures. Nucleotide sequences were derived

from amplicons detected in selected cultures from

Lake Como (Fig. 2b). The �130 bp amplicon corre-

sponded to a 128 bp portion of gvpC28 of the

P. rubescens strain PCC7821 (GenBank accession num-

ber AJ253128; Beard et al., 2000) coding for the gas

vesicle protein GvpC28, the � 300 bp fragment corre-

sponded to a 303 bp portion of gvpC16 in the strains

BC-Pla 9401, BC-Pla 9401 ⁄a and BC-Pla 9736

(GenBank accession numbers AJ132354, AJ494990

and AJ238352, respectively; Beard et al., 1999) and

the � 400 bp amplicon corresponded to a 402 bp

portion of gvpC20 in the P. rubescens strain BC-Pla 9303

(GenBank acc. n. AJ132357; Beard et al., 1999).

Based on the combinations of the gvpC variants

detected by gel electrophoresis, the isolates clustered

into four groups. For simplicity, here we indicate the

genotype showing the sole gene variant gvpC20 as

‘C20’, the one showing solely the gene variant gvpC16

as ‘C16’, the one showing gvpC16 and gvpC20 as

‘C16 + C20’ and the one showing gvpC20 and gvpC28

as ‘C20 + C28’. The vast majority of strains belonged to

the genotypes C20 and C16 + C20, two strains to the

type C16 (FEM_DD265 and )281, Lake Pusiano) and

only one strain to the type C20 + C28 (strain

FEM_DD221, Lake Como) (Table S1; Fig. 5). The type

C20 was dominant in lakes Idro (38 of 40 strains) and

Levico (38 of 51), while C16 + C20 was dominant in

Lakes Iseo (40 of 43), Lugano (23 of 24), Maggiore

(13 of 14) and Pusiano (28 of 41) (Fig. 5). In Lakes

Garda and Como, strains were almost evenly divided

between the genotypes C20 and C16 + C20 (Fig. 5).

No significant correlation was found between the

frequency distribution of the gas vesicles genotypes

and the depth at which strains were sampled.

Nucleotide diversity in selected strains (Table S1)

was investigated in the amplicons referring to gvpC16

and gvpC20, the most frequent variants in our cultures.

Besides an insertion ⁄deletion between positions 183

and 281 in our alignment (available upon request),

differentiating the variant gvpC20 from gvpC16, three

single-nucleotide polymorphisms (SNPs) were found

in the gvpC20 variant. Similar to the strain BC-Pla 9303

(GenBank acc. n. AJ132357), all our sequences showed

a guanine instead of the cytosine present in other

P. rubescens strains (e.g. BC-Pla 9736, AJ238352) at

position 155. The other two SNPs were derived from a

point mutation in one sequence each: a transition in

the gvpC20 of strain FEM_DD389 (GenBank acc. n.

HM595037) (C versus T at positions 168) and a

transversion in the gvpC20 of strain FEM_DD212

(T versus A at position 401) (GenBank acc. n.

HM595039). Non-synonymous substitutions in the

referring amino acid sequence were induced by SNPs

at positions 155 (G instead of C fi Arg instead of

Thr) and 401 (T instead of A fi Phe instead of Tyr).

An ambiguity as an incompletely specified base

(Y = thymine or cytosine, at position 184) was also

(a)

(b)

(c)

Fig. 4 Light microscopy microphotographs of Planktothrix cf.

rubescens from North Italy lakes. Cluster of living filaments (a)

Extremities of a single filament with a (b) caliptra end and a (c)

round end.



found in strains FEM_DD129 and FEM_DD137

(GenBank acc. n. HM595038), probably because of

the simultaneous presence of mutated and unmutated

copies of gvpC20 within the same genome. This

nucleotide ambiguity resulted in the contemporary

presence of two potential amino acid sequences

having either Arg or Cys in the same position.

Gas vesicle genotype frequencies versus lake

characteristics

Gas vesicle genotype frequencies were compared to

hydrodynamic and morphometric characteristics of

the lake basins (Table 1). A weak correlation between

the relative frequency of the two most frequent

genotypes (the ratio [C20] ⁄ [C16 + C20]) and the mixed

depth (averaged over the period 2005–09) was

observed (r = 0.65, P = 0.06, n = 7; Fig. 6a). Lake

Pusiano, an outlier in our data set, was excluded in

this correlation. The portion of C20 strains (i.e. the

weaker ones; Table 2) was higher in lakes in which the

mixed depth during winter (over the period 2005–09)

was within 50 m (namely, Levico and Idro). On the

other hand, the fraction of strains C16 + C20 (i.e. the

relatively stronger ones, Table 2) was higher in those

lakes in which, over the same time period, the average

mixed depth during winter exceeded 100 m (Como,

Garda, Iseo, Lugano, Maggiore). Since, in these deep

lakes, the mixed depth was higher than the critical

depths of both genotypes under examination

(Table 2), every change in [C20] ⁄ [C16 + C20] should

have been caused by factors other than the maximum

depth of the mixed layer (e.g. lake volume develop-

ment, proportion of the littoral zone within the gas

vesicles critical depth). In fact, the higher the Vd, the

more concave is the lake basin and the greater is the

volume of the pelagic compared to the littoral at

distinct depths, calculated in this study for mono-

basin lakes (i.e. Garda, Lugano, Maggiore and Zurich)

(Fig. 7). Thus, for these lakes, we correlated the ratio

[C20] ⁄ [C16 + C20] to volume development Vd (an inte-

grated index for lake morphometry), also including

data from Beard et al. (1999) for a population of

Planktothrix from Lake Zurich (zmax = 136 m). The

correlation was statistically well supported (r = 0.95,

P = 0.002, n = 6) (Fig. 6b): strains of genotype C20

were almost absent in lakes with a Vd approaching 2

(i.e. with a more concave basin), while they were

almost in the same proportion as strains of type

C16 + C20 in lakes with a Vd approaching 1 (with a

conical basin). Finally, we correlated [C20] ⁄ [C16 + C20]

with the proportion of the lake volume accounted for

by the littoral zone within 70 m of the surface (the

critical depth for strains of type C20) and we found a

strong correlation (r = 0.89, P = 0.06, n = 4), although

there are few data because reliable volumetric indices

were available for mono-basin lakes only (Fig. 6c).

20406080

100A

bund

ance

(%)

20406080

20406080

20406080

20406080

20406080

20406080

20406080

0

Maggiore zmax = 370 m

V d = 1.44n = 14

Luganozmax = 288 m

V d = 1.78n = 24

Iseozmax = 251 m

V d = 1.47n = 43

Como zmax = 410 m

V d = 1.13n = 47

Gardazmax = 350 m

V d = 1.14n = 16

Idrozmax = 120 m

V d = 1.62n = 40

Levicozmax = 38 m

V d = 0.88n = 51

Pusianozmax = 24 m

V d = 1.75n = 41

C16 C20 C16 +C 20 C20 + C28

Gas vesicle genotypes

Fig. 5 Planktothrix cf. rubescens strains belonging to different gas

vesicle genotypes from lakes in Northern Italy. Grey and black

boxes represent the percentage (%) of strains in the groups C20

and C16 + C20, which are able to produce weaker and stronger

gas vesicles, respectively; white boxes represent the percentage

of strains in the groups C16 and C20 + C28; ‘zmax’ and ‘Vd’ are,

respectively, the maximum depth and the volume development

of each lake; ‘n’ is the number of strains analysed in the corre-

sponding lake.



The frequency of C20 strains was greater in lakes with

a higher proportion of littoral zone within the top

70 m (the absolute critical depth of these strains).

Discussion

Natural populations of Planktothrix cf. rubescens living

in lakes of the Italian subalpine district were repre-

sented by two main genotypes producing gas vesicles

with different resistance to the hydrostatic pressure.

The filaments with stronger gas vesicles were more

frequent in those lakes where the mixed layer depth

during winter–spring is higher than the maximum

depth at which each of the two kinds of gas vesicles

can resist. The filaments with stronger gas vesicles

were even more frequent in lakes with highly concave

basins – i.e. in which vertical mixing involves a larger

volume of water. Although we isolated a limited

number of strains per lake (n £ 50), we are confident

that our sampling was representative of Planktothrix

populations actually present at that time. In each lake,

Planktothrix dominated the phytoplankton in the

metalimnion at the time of our sampling. Each

population could be considered (i) concentrated in a

narrow water layer and (ii) homogeneously distri-

buted horizontally within this layer.

We explain the higher frequency of Planktothrix

strains with stronger gas vesicles (higher critical

pressure, or pc) in deep lakes undergoing annual

circulation (Fig. 6a) as an effect of the strong positive

selection brought about by vertical mixing in these

basins. Strong natural selection for strains with higher

pc is expected in deeper lakes because the higher

hydrostatic pressure at greater depths will collapse

more of the gas vesicles with lower pc; therefore,

filaments lose their buoyancy and ability to remain

and grow in the metalimnion. The selection of gas

vesicle pc is not constant over the entire annual cycle

(Walsby et al., 1998). During summer, Planktothrix is

restricted to the metalimnion. This settling is explained

by buoyancy regulation in relation to irradiance

(Walsby et al., 2004). For a population living in a

metalimnion spanning, during summer, 5–15 m

depth, the combination of hydrostatic pressure

(<0.15 MPa) and turgor pressure (<0.4 MPa) would

produce a total pressure (�0.55 MPa) that is less than

the lowest pc (>0.6 MPa) (Table 2) and, therefore, not

sufficient to cause gas vesicle collapse and cell death.

Filaments become entrained in the surface mixed layer

1 1.2 1.4 1.6 1.8 20.01

0.1

1

LuIsMa

Ga

Co(b)

[C20

]/[C16

+ C

20]

Vd

Zü

50 100 150 200 250

0.1

1

10

[C20

]/[C

16+

C20]

Mixed depth (m)

Le

Id

Co

Ga

Ma

Is

Lu

(a)

10 20 30 40 50

0.1

1(c)

ZüGa

Lu

[C20

] /[C

16 +

C20

]

Littoral zone within 70 m (%)

Ma

Fig. 6 Gas vesicle selection versus lake characteristics (note

Log ⁄ Log scales). Correlation between the relative frequency of

the two gas vesicle genotypes as the ratio ‘[C20 strains] ⁄ [C16 +

C20 strains]’ and (a) the depth of the mixed layer during

winter (average over the time period 2005–09; see also Table 1),

(b) the volume development (Vd) and (c) the portion of the

littoral zone within 70 m (expressed as % of volume). Open

circles are data points in all graphs, dashed lines represent the

power functions y = 11 000x)2 (r = 0.65, P = 0.06), y = 1.3x)6.5

(r = 0.95, P = 0.002) and y = 0.0006x2 (r = 0.89, P = 0.06)

approximating the relationships in (a), (b) and (c), respectively.

In the three graphs, ‘Co’ refers Lake Como, ‘Ga’ to L. Garda,

‘Id’ to L. Idro, ‘Is’ to L. Iseo, ‘Le’ to L. Levico, ‘Lu’ to L. Lugano,

‘Ma’ to L. Maggiore, ‘Pu’ to L. Pusiano, ‘Zu’ to L. Zurich.



during the autumn and are then mixed progressively

deeper as the lake cools. After exposure to deep

mixing during winter, selection occurs during spring.

In fact, filaments that retain their gas vesicles, and

thereby their buoyancy, will float to the newly

reformed metalimnion and will form the inoculum

for the next season’s growth. Clearly, in very shallow

lakes, all of the gas vesicles can survive, even those

with the lowest critical pressure. Some of these will

survive even in the deepest lakes, because they happen

to remain in the top few metres at the shallow fringes

of the lake. Three factors (maximum depth, depth of

mixing and the proportion of surface water mixed to

various depths) determine whether or not a filament

retains sufficient gas vesicles to provide buoyancy (i.e.

gas vesicles selection). In general, the deeper the lake

and the greater the degree of circulation, the more

likely only gas vesicles of high pc will survive.

Functional genetics of gas vesicles

The strength of the gas vesicles in the genus Plankto-

thrix, estimated by measuring the pressure necessary

to collapse them, has been related to the peculiar

configuration of composite gene clusters including

numerous copies of the main genes, gvpA and gvpC

(Beard et al., 1999, 2000). Because of insertions and

deletions in sequence repeats, gvpC shows different

and sometimes co-occurring variants (namely, gvpC16,

gvpC20, gvpC28) coding for proteins with fairly differ-

ent molecular weights. These variants are effectively

transcribed in single filaments (Becker, Hayes &

Walsby, 2005), even though no study on potential

post-transcriptional regulations of these genes at

different pressures has been carried out. However,

owing to the congruence between genetic and pheno-

typic data collected to date, the pattern of the gas

vesicle gene is a marker for the strength of gas vesicles

in Planktothrix. In the strains we sampled, the gene

Vd > 1

Vd < 1

Vd = 1

(a)

(b)

Vd

Litto

ral z

one

(%)

45

5

25

1.81.0 1.4

(c)

Zü

Ga

Ma Lu

55

35

15

1.1 1.3 1.5 1.6 1.71.2

Fig. 7 Schematic lake morphometry parameters. (a) The shape

of a basin in relation to the volume development (Vd): the solid,

dotted and dashed line drawings represent conical, convex and

concave basins for which Vd is 1, <1 or >1, respectively. (b) The

extent of the littoral zone in three basins with different shape but

the same maximum depth: the unbroken and the dashed grey

areas represent, respectively, the portion of littoral and pelagic

zones within a total depth. The ratio between littoral and pelagic

zones is higher or lower in lake with convex or concave basins,

respectively. (c) The relationship between the portion of littoral

zone (expressed as % of volume at a generic depth) and the

volume development: open triangles and circles indicate data

points for the littoral zones within the depths of 70 and 100 m.

‘Ga’ refers to Lake Garda, ‘Lu’ to L. Lugano, ‘Ma’ to L. Maggiore

and ‘Zu’ to Lake Zurich.

Table 2 Correspondence between Planktothrix gas vesicles genotypes, phenotypes and critical depth in summer (cell turgor pres-

sure = 0.4 MPa) and winter (cell turgor pressure = 0.2 MPa). Modified from Bright & Walsby (1999) and Beard et al. (2000)

gvpC

variants

Gas vesicles

genotype*

Mean pc of

genotype class (MPa)

Min–max pc

(MPa)

Summer critical

depth (m)

Winter critical

depth (m)

C20 GV1 or -2 0.9 0.8–0.9 40–50 60–70

C16 + C20 GV3 1.1 1.0–1.2 60–80 80–100

C20 + C28 GV4 0.9 0.8–1.0 40–60 60–80

C28 GV5 or -6 0.7 0.6–0.7 20–30 40–50

*sensu Beard et al. (2000).



gvpC was present in all the three variants mentioned

previously. The vast majority of monoclonal strains

had either only gvpC20 or both gvpC16 and gvpC20.

Following the nomenclature used by previous

authors, the former strains should belong to geno-

types GV1 and GV2 sensu Beard et al. (1999, 2000), in

which the ratio gvpA : gvpC20 was 1 : 1 and 4 : 3,

respectively, as detected by PCR (Beard et al., 2000)

and quantitative PCR (Becker et al., 2005). This gene

configuration was suggested to be at the basis of the

production of gas vesicles with mean pc of 0.9 MPa

(critical depth £ 70 m) detected in both genotypes.

Moreover, the few GV1 strains (n = 3), detected only

in Lake Zurich, showed a resistance to pressure

comparable to GV2s (Table 2; Bright & Walsby,

1999). For this reason, we considered all strains

showing the sole variant gvpC20 as belonging to the

same genetic ⁄phenotypic unit, without distinguishing

between GV1 and GV2. On the other hand, strains

showing both gvpC16 and gvpC20 should belong to the

genotype GV3 sensu Beard et al. (1999, 2000). Here, the

ratio gvpA : gvpC16 : gvpC20 was about 6 : 3 : 1, and

the high frequency of the short variant gvpC16 was

thought to promote narrow gas vesicles with mean pc

of 1.1 MPa, therefore resisting depths £ 100 m

(Table 2) (Beard et al., 2000; Becker et al., 2005). Only

one of our 276 strains had both gvpC20 and gvpC28,

which should belong to the genotype GV4 sensu Beard

et al. (2000), also producing gas vesicles with mean pc

of 0.9 MPa (critical depth £ 80 m). We found no

strains having the sole long allele gvpC28, whose

presence in the genotypes GV5 and GV6 sensu Beard

et al. (2000) was related to the production of wide gas

vesicles with mean pc of 0.7 MPa (critical depth £ 50 m).

However, this gene arrangement seems to be present

most frequently in green strains of Planktothrix

(namely, P. cf. agardhii; see also Beard et al., 2000),

while we isolated only reddish Planktothrix strains

(namely, P.cf. rubescens). Finally, we found two strains

showing only gvpC16, which cannot be associated with

any known genotype but, following the criteria

mentioned previously, they would be characterised

by very narrow and strong gas vesicles.

Gas vesicle selection versus circulation

Lakes Iseo, Lugano and the shallower Idro represent

interesting case studies that provide clues to the effect

of circulation on gas vesicle selection in Planktothrix.

Lake Idro shows a permanent chemolimnion at 50 m

(Garibaldi et al., 1996, 1997; Letizia Garibaldi pers.

comm.). A survey conducted during winter 2010

confirmed this vertical stratification, with convective

mixing limited to the first 50 m of the water column

(unpublished data from our group). In this lake,

filaments with a maximum critical depth of 70 m

(genotype C20) are more frequent than those with a

maximum critical depth of 100 m (genotype

C16 + C20). However, the depth of this lake

(zmax = 120 m) would suggest natural selection in

favour of the C16 + C20 genotype. We explain this

apparent contradiction by the limited winter mixing

that could have entrapped most Planktothrix filaments

for many years within a shallow layer. This layer

(0–50 m depth) was always less than the critical depth

at which the weaker filaments usually lose their

buoyancy (70 m). The consequent relaxed selection

(i.e. persistent absence of selective pressure to resist

collapse) could have favoured the dominance of the

weaker filaments rather than the stronger ones

(Fig. 6a). Conversely, a long-lasting stratification

persisted until winter 2005 in Lakes Iseo and Lugano

N-Basin, but it collapsed because of the deep overturn

events occurring in 2005 and 2006 (Salmaso et al.,

2007; Holzner et al., 2009): these bottleneck events

could have promoted the selection of stronger fila-

ments (max critical depth = 100 m) and the removal

of weaker filaments (max critical depth = 70 m)

(Fig. 6a). On the other hand, in the years following

the 2005–06 overturns, the mixed depth was never less

than 80 m (for Iseo: Letizia Garibaldi pers. comm.; for

Lugano: Marco Simona pers. comm.; see also http://

www.cipais.org/html/lago-lugano-stato.asp), and

thus, higher than the critical pressure for weaker

filaments. This condition should have reduced recruit-

ment of weaker filaments. Unfortunately, we have no

information about the frequency of gas vesicle geno-

types before the 2005 winter mixing to compare with

the situation we depict.

Differential selection in large and deep lakes

Como, Garda, Iseo, Lugano and Maggiore are among

the deepest European lakes, and the depth of the

mixed layer averaged over the 5 years preceding our

study was never <120 m in these basins (Table 1).

In all these lakes, while the depth of mixing is strongly

influenced by climatic features and water-column



stability, the proportion of surface water mixed to

various depths depends on lake morphometry. The

most important features are the shape of the basin

(slope steepness) and concavity of the lake bed, both

of which are reflected in ‘volume development (Vd)’.

In this study, we found a significant correlation

between Vd and the abundance of gas vesicle geno-

types in Planktothrix populations living in large and

deep lakes (Fig. 6b). In Lakes Como and Garda

(Vd < 1.20), the abundance of genotypes C20 and

C16 + C20 was approximately equal, as in deep Lake

Zurich (zmax = 136 m; Vd = 1.03) (Beard et al., 1999;

Bright & Walsby, 1999). The congruency between

physical and biological data in these three systems

suggests the existence of similar environmental

stressor versus adaptive response mechanisms. Con-

versely, in Lakes Maggiore, Iseo and Lugano

(Vd > 1.4), the genotype C16 + C20 was dominant with

respect to C20. The trade-off between the two geno-

types seems to lay in the range 1.2 < Vd < 1.4 and it

could be explained mechanistically. For instance, the

genotype C20 loses buoyancy at depths > 70 m

(Table 2). The survival rate of C20 filaments should

be proportional to the probability that they are not

transported below that depth. Theoretically, this

probability increases with an increase in the propor-

tion of littoral domain within 70 m from the surface.

This condition could be maximal in the very conical

Lake Zurich (Vd = 1.03), where the volume of fringes

within 70 m accounts for 44% of the lake volume

above that depth (Fig. 7). This percentage decreases to

22% in Lake Garda (Vd = 1.14) and 11% in Lake

Maggiore (Vd = 1.44). Remarkably, the decrease in C20

strains with an increase in Vd appears to accord with a

decline in the proportion of the lake volume

accounted for by the littoral zone (at depths below

70 m) with an increase in the same Vd (compare

Figs 6c and 7). Conversely, an increase in C16 + C20

strains seems to be directly related to higher Vd. Our

results suggest that lake morphometry, by determin-

ing the proportion of surface water mixed to different

depths, is likely to influence gas vesicle selection in

those lakes where the depth of the mixed layer

exceeds the critical depth of the strongest gas vesicles.

Differential selection in shallow lakes

Finally, the two shallower lakes (Levico and Pusiano)

showed contrasting patterns in the frequencies of

Planktothrix gas vesicle genotypes. The clear domi-

nance of C20 filaments (max critical depth = 70 m) in

Lake Levico agrees with the weak selective pressure

determined by its relatively restricted depth

(zmax = 38 m). On the other hand, the high abundance

of filaments of genotype C16 + C20 (max critical

depth = 100 m) in Lake Pusiano cannot be similarly

explained. The first bloom of Planktothrix in this lake

occurred in 2001 (Legnani et al., 2005), probably after a

colonisation of strains from nearby Lake Como. Thus,

it is probable that a ‘founder effect’ still characterises

the present population of Planktothrix in Lake Pusiano

(zmax = 24 m). If the founder population was richer in

stronger (genotype C16 + C20) than in weaker fila-

ments (genotype C20), then, without selection, there

would probably be a shift towards weaker genotypes

if there is a cost of being ‘unnecessary strong’. If so, it

would be interesting to follow the future development

of Planktothrix in Lake Pusiano in order to track the

frequency of different genotypes.

In conclusion, our data support the hypothesis that

the strength of gas vesicles is an adaptive trait under

strong and weak selection in lakes with deep and

shallow winter circulation, respectively. Moreover,

lake morphometry further influences these selective

processes. In addition, multiannual fluctuations of

phases of deep circulation and permanent stratifica-

tion could drive cycles of ‘stronger’ and ‘weaker’

filaments of Planktothrix. We conclude that the simul-

taneous presence of ‘weaker’ and ‘stronger’ filaments

could allow adaptive responses to changes in hydro-

static pressures related to changes in the regime of

vertical circulation.

Acknowledgments

This work was funded by the Autonomous Province

of Trento (Italy), project ACE-SAP (Alpine Ecosystems

in a Changing Environment: Biodiversity Sensitivity

and Adaptive Potential) (regulation number 23,

12th June 2008, of the University and Scientific

Research Service). The authors thank A.E. Walsby

and A. Hildrew for their positive criticism and

fundamental suggestions that improved the quality

of this work and one anonymous reviewer for useful

comments and corrections. The authors also thank

Marco Simona (Scuola Universitaria Professionale

della Svizzera Italiana, Switzerland), Fabio Buzzi

(Environmental Protection Agency, Lombardia),



Letizia Garibaldi (University of Milano-Bicocca, Mi-

lan), Rosario Mosello (Institute of Ecosystem Study,

CNR-ISE, Verbania-Pallanza) and the Fire Depart-

ment of Riva del Garda (Trento) for providing logistic

support. We are grateful to Nicola Merlo and Andrea

Zampedri (IASMA Research and Innovation Centre,

San Michele all’Adige) and to Mario Contesini (CNR-

ISE) for their support in the field activities. Massimo

Pindo and the technical staff of FEM (IASMA

Research and Innovation Centre) Sequencing Platform

are also acknowledged.

References

Ambrosetti W. & Barbanti L. (1992) Physical limnology in

Italy: an historical review. Memorie Istituto Italiano

di Idrobiologia, 50, 37–59.

Ambrosetti W. & Barbanti L. (1997) Problems related to

physical limnology of deep southern Alpine lakes.

Documenta Istituto Italiano di Idrobiologia, 61, 3–18.

(in Italian).

Ambrosetti W., Barbanti L. & Sala N. (2003) Residence

time and physical processes in lakes. Journal of

Limnology, 62, 1–15.

Ambrosetti W., Barbanti L. & Carrara E.A. (2010) Mech-

anisms of hypolimnion erosion in a deep lake (Lago

Maggiore, N. Italy). Journal of Limnology, 69, 3–14.

Anagnostidis K. & Komarek J. (1988) Modern approach

to the classification system of cyanophytes 3 –

Oscillatoriales. Algological Studies, 50–53, 327–472.

Barbieri A. & Polli B. (1992) Description of Lake Lugano.

Aquatic Sciences, 54, 181–183.

Beard S.J., Handley B.A., Hayes P.K. & Walsby A.E.

(1999) The diversity of gas vesicle genes in Planktothrix

rubescens from Lake Zurich. Microbiology, 145, 2757–

2768.

Beard S.J., Davis P.A., Iglesias-Rodriguez D., Skulberg

O.M. & Walsby A.E. (2000) Gas vesicle genes in

Planktothrix spp. from Nordic lakes: strains with weak

gas vesicles possess a longer variant of gvpC. Microbi-

ology, 146, 2009–2018.

Becker S., Hayes P.K. & Walsby A.E. (2005) Different

gvpC length variants are transcribed within single

filaments of the cyanobacterium Planktothrix rubescens.

Microbiology, 151, 59–67.

Bright D.I. & Walsby A.E. (1999) The relationship

between critical pressure and width of gas vesicles in

isolates of Planktothrix rubescens from Lake Zurich.

Microbiology, 145, 2769–2775.

Buzzi F. (2002) Phytoplankton assemblages in two sub-

basins of Lake Como. Journal of Limnology, 61, 117–128.

Christiansen G., Fastner J., Erhard M., Borner T. &

Dittmann E. (2003) Microcystin biosynthesis in Plank-

tothrix: Genes, evolution, and manipulation. Journal of

Bacteriology, 185, 564–572.

Copetti D., Tartari G., Morabito G., Oggioni A., Legnani

E. & Imberger J. (2006) A biogeochemical model of

Lake Pusiano (North Italy) and its use in the predict-

ability of phytoplankton blooms: first preliminary

results. Journal of Limnology, 65, 59–64.

Garibaldi L., Brizzio M.C., Varallo A. & Mosello R. (1996)

Water chemistry of the meromictic Lake Idro (North-

ern Italy). Memorie Istituto Italiano di Idrobiologia, 54, 77–

95.

Garibaldi L., Brizzio M.C., Galanti G., Varallo A. &

Mosello R. (1997) Hydrochemistry and phytoplankton

of Lake Idro. Documenta Istituto Italiano di Idrobiologia,

61, 153–172. (in Italian).

Hakanson L. (1981) A Manual of Lake Morphometry.

Springer-Verlag, Berlin–Heidelberg–New York: ix 78

pp.

Hall T.A. (1999) BioEdit: a user-friendly biological

sequence alignment editor and analysis program for

Windows 95 ⁄ 98 ⁄NT. Nucleic Acids Symposium Series, 41,

95–98.

Halstvedt C.B., Rohrlack T., Andersen T., Skulgberg O. &

Edvardsen B. (2007) Seasonal dynamics and depth

distribution of Planktothrix spp. in Lake Steinsfjorden

(Norway) related to environmental factors. Journal of

Plankton Research, 29, 471–482.

Hayes P.K., Buchholz B. & Walsby A.E. (1992) Gas

vesicles are strengthened by the outer-surface protein

GvpC. Archives of Microbiology, 157, 229–234.

Holzner C.P., Aeschbach-Hertig W., Simona M., Veronesi

M., Imboden D.M. & Kipfer R. (2009) Exceptional

mixing events in meromictic Lake Lugano (Switzerland ⁄Italy), studied using environmental tracers. Limnology

and Oceanography, 54, 1113–1124.

Kaiblinger C., Greisberger S., Teubner K. & Dokulil M.T.

(2007) Photosynthetic efficiency as a function of ther-

mal stratification and phytoplankton size structure in

an oligotrophic alpine lake. Hydrobiologia, 578, 29–36.

Kinsman R., Walsby A.E. & Hayes P.K. (1995) GvpCs

with reduced numbers of repeating sequence elements

bind to and strengthen cyanobacterial gas vesicles.

Molecular Microbiology, 17, 147–154.

Komarek J. & Anagnostidis K. (2005) Susswasserflora von

Mitteleuropa, Bd 19 ⁄2: Cyanoprokaryota-2. Teil: Oscill-

atoriales, pp. 354–363. Elsevier GmbH, Heifelberg.

Legnani E., Copetti D., Oggioni A., Tartari G., Palumbo

M.T. & Morabito G. (2005) Planktothrix rubescens’

seasonal dynamics and vertical distribution in Lake

Pusiano (North Italy). Journal of Limnology, 64, 61–73.



Oliver R.L. & Ganf G.G. (2000) Freshwater blooms. In:

The Ecology of Cyanobacteria: their Diversity in Time and

Space (Eds B.A. Whitton & M. Potts), pp. 149–194.

Kluwer Academics Publishers, The Netherlands.

Perini M., Camin F., Corradini F., Obertegger U. & Flaim

G. (2009) Use of d18O in the interpretation of hydro-

logical dynamics in lakes. Journal of Limnology, 68, 174–

182.

Salmaso N. (2010) Long-term phytoplankton community

changes in a deep subalpine lake: responses to nutrient

availability and climatic fluctuations. Freshwater Biol-

ogy, 55, 825–846.

Salmaso N. & Mosello R. (2010) Limnological research in

the deep southern subalpine lakes: synthesis, direc-

tions and perspectives. Advances in Oceanography and

Limnology, 1, 29–66.

Salmaso N., Morabito G., Garibaldi L. & Mosello R.

(2007) Trophic development of the deep lakes south of

the Alps: a comparative analysis. Fundamental and

Applied Limnology, 170, 177–196.

Sokal R.R. & Rohlf F.J. (1995) Biometry: The Principles and

Practice of Statistics in Biological Research. W. H. Free-

man and Co, New York.

Stanier R.Y., Kunisawa R., Mandel M. & CohenBazire G.

(1971) Purification and properties of unicellular blue-

green algae (Order Chroococcales). Bacteriological

Reviews, 35, 171–205.

Thompson J.D., Higgins D.G. & Gibbson T.J. (1994)

Clustal W: improving the sensitivity of progressive

multiple sequence alignment through sequence

weighting, position-specific gap penalities and weight

matrix choice. Nucleic Acids Research, 22, 4673–4680.

Walsby A.E. (1994) Gas vesicles. Microbiological Reviews,

58, 94–144.

Walsby A.E. & Schanz F. (2002) Light-dependent growth

rate determines changes in the population of Plankto-

thrix rubescens over the annual cycle in Lake Zurich,

Switzerland. New Phytologist, 154, 671–687.

Walsby A.E., Avery A. & Schanz F. (1998) The critical

pressures of gas vesicles in Planktothrix rubescens in

relation to the depth of winter mixing in Lake Zurich,

Switzerland. Journal of Plankton Research, 20, 1357–1375.

Walsby A.E., Ng G., Dunn C. & Davis P.A. (2004)

Comparison of the depth where Planktothrix rubescens

stratifies and the depth where the daily insolation

supports its neutral buoyancy. New Phytologist, 162,

133–145.

Walsby A.E., Schanz F. & Schmid M. (2006) The

Burgundy-blood phenomenon: a model of buoyancy

change explains autumnal water blooms by Plankto-

thrix rubescens in Lake Zurich. New Phytologist, 169,

109–122.

Wetzel R.G. 2001. Limnology: Lake and River Ecosystems,

3rd edn. Academic Press, San Diego, CA, U.S.A., 1006

pp.

Working Group Lake Como (2006) PLINIUS Project.

Critical situations and actions for water quality restoration

in Lake Lario (Como). Centro Volta, Como, 216 pp.

(in Italian).

Supporting Information

Additional Supporting Information may be found in

the online version of this article:

Table S1. Strains of Planktothrix rubescens isolated

from lakes in North Italy and analysed in this paper

As a service to our authors and readers, this journal

provides supporting information supplied by the

authors. Such materials are peer-reviewed and may

be re-organised for online delivery, but are not

copyedited or typeset. Technical support issues aris-

ing from supporting information (other than missing

files) should be addressed to the authors.

(Manuscript accepted 19 January 2011)



Planktothrix populations in subalpine lakes: selection for strains with strong gas vesicles as a...

Documents

Transcript of Planktothrix populations in subalpine lakes: selection for strains with strong gas vesicles as a...