Phenotypic characterization and nuclear microsatelliteanalysis reveal genomic changes and rearrangementsunderlying androgenesis in tetraploid potatoes(Solanum tuberosum L.)

Sushruti Sharma Æ Debabrata Sarkar ÆSuman Kumar Pandey

Received: 10 October 2008 / Accepted: 17 June 2009 / Published online: 1 July 2009

� Springer Science+Business Media B.V. 2009

Abstract Two (di)haploids (2n = 2x = 24) and

nine tetraploids (2n = 4x = 48) obtained from Sola-

num tuberosum through anther culture were character-

ized for nDNA variation, phenotypic variation and

nuclear microsatellite polymorphism. Androgenic

(di)haploids were also characterized for late blight

resistance. The (di)haploid C-13 was derived from

Indian tetraploid potato cv. Kufri Chipsona-2, while

D4 from TPS (true potato seed) parental line JTH/C-

107, which is an interspecific hybrid between Indian

tetraploid cv. Kufri Jyoti and diploid (2n = 2x = 24)

cultivated species S. phureja Juz. & Buk. IVP-35. C-13

and D4 (both male-fertile) could be distinguished from

their corresponding tetraploid anther donors based on

plant height, shoot number, terminal leaflet length and

width, leaf ratio, anther length, pollen diameter and

corolla width and radius. A complete reversal of flower

color occurred in D4, and C-13 was highly resistant to

late blight. Most interestingly, about 3–7% increase in

nDNA content occurred in most of the anther-derived

tetraploids. Both the androgenic (di)haploids and their

anther donors had unique genotypes at the microsat-

ellite loci POTM1-2, STM0015 and STM0019b. How-

ever, the nine anther-derived tetraploids shared the

same allelic profiles with their anther donor JTH/C-107

at all the microsatellite loci, except at STM0019a

where they were characterized by the absence of a

standard donor allele (186-bp). A typical (di)haploid-

specific allele was detected for the locus STWAX-2

where the standard donor alleles were replaced by a

230-bp allele in both C-13 and D4. The over-expres-

sion of microsatellite variation in D4 that also shows

triallelic profiles at the microsatellite loci POTM1-2

and STM0015 can perhaps be attributed to its chimeric

structure, which might have been formed through

incomplete fusion of two different pro-embryos during

the first steps of microspore division.

Keywords Androgenesis � Anther culture �(Di)haploid � Microsatellite � Nuclear DNA content �Phenotyping � Potato � Simple sequence repeats �Solanum tuberosum L.

Abbreviations

AFLP Amplified fragment length polymorphism

AUDPC Area under the disease progress curve

CRBC Chicken red blood cell

CTAB Cetyltrimethylammonium bromide

Sushruti Sharma passed away on November 10, 2008.

S. Sharma � D. Sarkar � S. K. Pandey

Cell and Molecular Biology Laboratory, Division of Crop

Improvement, Central Potato Research Institute (CPRI),

Shimla, Himachal Pradesh 171 001, India

D. Sarkar (&)

Biotechnology Unit, Division of Crop Improvement,

Central Research Institute for Jute & Allied Fibres

(CRIJAF), Barrackpore, Kolkata, West Bengal 700 120,

India

e-mail: d.sarkar@excite.com; debabrata_s@yahoo.com;

dsarkar@crijaf.org.in

123

Euphytica (2010) 171:313–326

DOI 10.1007/s10681-009-9983-7

DAPI 40,6-Diamidino-2-phenylindole

EPU Eyepiece unit

nDNA Nuclear DNA

KI Potassium iodide

RAPD Random amplified polymorphic DNA

RCBD Randomized complete block design

RFLP Restriction fragment length

polymorphism

SSR Simple sequence repeat

TPS True potato seed

Introduction

Tetraploid potatoes (Solanum tuberosum L.; 2n =

4x = 48) are highly heterozygous, with complicated

genetic segregation due to tetrasomic mode of inher-

itance. Since (di)haploids (2n = 2x = 24) are thought

to be genetically pure S. tuberosum, they can be

regarded as gametic samples of their tetraploid parents

(Wilkinson et al. 1995). (Di)haploid potato can be

obtained either paternally through androgenesis or

maternally through gynogenesis. The gynogenic

method relies on the development of (di)haploids from

unfertilized ovules by parthenogenesis (Samitsu and

Hosaka 2002), or from fertilized triploid zygotes by

chromosome elimination (Clulow et al. 1991), or

through somatic translocations (Wilkinson et al. 1995).

However, gynogenic (di)haploids are not always

completely parthenogenetic in origin (Clulow et al.

1991; Waugh et al. 1992; Wilkinson et al. 1995). The

haploid-inducing S. phureja pollinator, which is

essentially used for the production of gynogenic

(di)haploids in potato, frequently produces not only

aneusomatic (di)haploids with variable chromosome

numbers (Clulow et al. 1991; Samitsu and Hosaka

2002), but also (di)haploids with substantial amount of

inducer’s nuclear genome (Waugh et al. 1992;

Wilkinson et al. 1995).

Androgenesis through anther culture is, therefore,

the most reliable method of (di)haploid-derivation in

tetraploid potatoes (Wenzel 1994). It is also consid-

ered more efficient than gynogenesis because there

are greater numbers of microspores among which

superior recombinants can occur than ovules in a

flower (Jacobsen and Ramanna 1994). However,

androgenic (di)haploidization via anther culture has

been proved to be frustratingly difficult in potato

(Wenzel 1994; Cappadocia and Ramulu 1998). There

are only few reports on the induction of androgenesis

in tetraploid S. tuberosum (Rokka et al. 1996 and

references therein) and in disomic tetraploid potato

species S. acaule ssp. acaule (Rokka et al. 1998),

leading to successful regeneration of (di)haploid

plants. Although flowering has been reported in

androgenic (di)haploids of S. tuberosum (Meyer et al.

1993; Calleberg 1996; Song et al. 2005), they

generally show low levels of male fertility similar

to their gynogenic counterparts. In androgenic

(di)haploids of S. acaule ssp. acaule, flowers could

develop, but they were infertile (Rokka et al. 1998).

Phenotypic characterization of anther-derived

plants represents a major means for distinguishing

the haploids from their parental lines according to

ploidy level. This approach was successfully

employed in diploid (2n = 2x = 24) S. phureja not

only to group anther-derived plants (Pehu et al.

1987), but also to compare the performance of

monoploid potatoes developed through androgenesis

versus gynogenesis (Lough et al. 2001). Potato

(di)haploids derived from specific cultivars of tetra-

ploid S. tuberosum exhibited varying levels of

phenotypic and genetic variation in comparison to

their donor cultivars (Matsubayashi 1979; De Maine

1984; Kotch et al. 1992). However, in S. acaule ssp.

acaule, the anther-derived plants were normal look-

ing and as a group morphologically similar to each

other and to the tetraploid anther donor (Rokka et al.

1998). There were no differences in growth, color,

number and size of leaflets and color and size of floral

corollas and anthers between anther-derived (di)hap-

loids or tetraploids and their tetraploid anther donor

S. acaule. This may be because S. acaule is largely

self-pollinating (Watanabe et al. 1994), which results

in a high degree of homozygosity and thus a low level

of variation in its (di)haploid population. In the

present study, we obtained androgenic (di)haploids of

tetraploid S. tuberosum, which not only flower but

also are male fertile. These androgenic (di)haploids

were characterized in relation to their corresponding

tetraploid anther donors for a large number of

phenotypic traits and late blight resistance. In this

study, the androgenic competence of tetraploid

potatoes was also assessed, and the anther-derived

plants obtained were characterized for ploidy level,

chromosome number and nuclear DNA variation.

314 Euphytica (2010) 171:313–326

123

DNA markers have been extensively used for

assessing the genetic variation and for determining

the genetic composition of anther-derived plants in

potato (Birhman et al. 1994; Rivard et al. 1994;

Veilleux et al. 1995; Chani et al. 2000, 2002). All

these studies were, however, confined to the genetic

analyses of monoploid and/or diploid anther-derived

plants, which originated from diploid S. chacoense or

S. phureja anther donors, or their interspecific

hybrids. Rokka et al. (1995) analyzed the androgenic

triploids of hexaploid somatic hybrids (S. brevi-

dens 9 S. tuberosum) by RAPD markers. The utility

of androgenic (di)haploids for genetic marker devel-

opment in potato was demonstrated using AFLP and

SSR markers (Song et al. 2005). However, DNA

markers were never used to characterize androgenic

(di)haploids in relation to their tetraploid anther

donors for assessing the genomic changes and

rearrangements underlying androgenesis in tetraploid

potatoes.

Microsatellites, also termed as simple sequence

repeats (SSRs), have been used to distinguish homo-

zygous doubled monoploids from heterozygous dip-

loid plants in a monoploid anther-derived population

originated from an interspecific diploid hybrid

between S. chacoense and S. phureja (Veilleux

et al. 1995; Chani et al. 2000, 2002). They offer the

same discriminatory potential as RFLPs because both

alleles of a heterozygote can be detected (Veilleux

et al. 1995). Nuclear microsatellite analysis has

proved to be very useful for genotyping tetraploid

potato cultivars and for assessing the comparative

diversity among the potato Groups (McGregor et al.

2000; Ashkenazi et al. 2001; Ghislain et al. 2006).

However, the effectiveness of microsatellites for

characterizing the genetic variation and for determin-

ing the genetic composition of androgenic (di)hap-

loids has not been assessed so far. Since meiotic

processes and the modes of gamete formation in

tetraploid potatoes differ greatly from those in diploid

potatoes, there is no one-to-one relationship between

the phenotype and the genotype of DNA markers

scored in tetraploid individuals (Luo et al. 2004).

Hence, genotyping and characterization of the segre-

gation pattern in androgenic (di)haploids using more

informative genetic markers, such as DNA microsat-

ellites, are not as simple and straightforward as in an

androgenic monoploid population that originated

from a diploid potato species or hybrid.

It is thus of potential interest to resolve the

discriminatory ability of SSRs for assessing the

androgenic origin of anther-derived (di)haploids and

for determining the genetic composition of sporo-

phytic gamete genotypes of tetraploid potatoes. The

present study assessed the potential of nuclear

microsatellite markers for characterizing the andro-

genic (di)haploids in relation to their tetraploid

anther-derived sibs and anther donors. This study

also goes in some way towards determining whether

differential sporophytic pattern of microspore

embryogenesis is reflected in nSSR polymorphism

scored in the regenerated sporophytes of the resulting

gamete genotypes.

Materials and methods

Plant material

For the induction of androgenesis, 14 agronomically

superior tetraploid (2n = 4x = 48) potato (Solanum

tuberosum L. ssp. tuberosum) cultivars were used:

FL-1533, Kufri Badshah, Kufri Chandramukhi, Kufri

Chipsona-1, Kufri Chipsona-2, Kufri Giriraj, Kufri

Jyoti, Kufri Kanchan, Kufri Lalima, Kufri Megha,

Kufri Sindhuri, Kufri Sutlej, MF-II and TPS-13.

Besides, a tetraploid interspecific hybrid JTH/C-107

(S. tuberosum ssp. tuberosum cv. Kufri Jyoti 9 S.

phureja IVP-35; TPS parental line) was also used.

They were raised from tubers in the experimental

field of the Central Potato Research Institute (CPRI),

Shimla (31.06�N, 77.10�E; 2202 m above msl)

during the summer (May–August) following the

recommended cultural practices. The flower buds

were harvested and used for initiating the anther

culture during June–July (mean day/night tempera-

ture: 24.4/16.1�C; RH: 80–90%).

Anther culture

The harvested flower buds (4–6 mm in length) were

processed as described earlier (Sarkar et al. 2004a).

Anthers were isolated aseptically and cultured on MS

(Murashige and Skoog 1962) medium supplemented

with 60 g l-1 sucrose, 1.0 mM ascorbic acid, 2.0 mg l-1

D-calcium pantothenate, 0.5 mM L-cysteine, 60 g l-1

potato starch, 5.0 g l-1 activated charcoal, 17.74 lM

BA and 2.0 g l-1 gelrite (modified from Rokka et al.

Euphytica (2010) 171:313–326 315

123

1996). The pH was adjusted to 5.8 before autoclaving at

121�C for 20 min. The cultures were incubated under a

16 h photoperiod (20 lmol m-2 s-1 PFD) at 28�C.

After 8 weeks’ culture, the androgenic response was

assessed by scoring the frequency of androgenesis. The

embryoids that did not develop into shoots were cultured

on � MS medium supplemented with 2.89 lM GA3,

5.69 lM zeatin riboside, 20 g l-1 sucrose and 2.0 g l-1

gelrite. The regeneration cultures were incubated under

a 16 h photoperiod (60 lmol m-2 s-1 PFD) at 20�C.

Anther-derived regenerants were maintained and mul-

tiplied through single-node cuttings (SNCs) as

described earlier (Sarkar et al. 2004b).

Ploidy diagnosis

For L1-ploidy estimation, the chloroplast density per

stomatal guard cell pair was examined in subterminal

leaflet of the fourth-leaf from the top of 2-month-old

greenhouse-grown plants with a solution of 0.5%

iodine in 5% aqueous KI solution for 2 min. The

length and width of stomatal guard cells were

measured using an eyepiece graticule at 9400 mag-

nification, and all measurements were recorded to the

nearest whole eyepiece unit (1 EPU = 2.0 lm). For

L2- and L3-ploidy estimation, young flower buds and

healthy root tips, respectively were fixed in Carnoy’s

fluid for 24 h. The roots were hydrolyzed in 1 N HCl

for 10 min at 60�C, stained in 2% aceto-orcein, and

squash preparations were made in 45% acetic acid.

The chromosomes in pollen mother cells were stained

with the fluorescent dye DAPI (1.0 ml of 0.35 mg ml-1

DAPI stock was used to prepare a 100 ml working

solution in 0.4 M Na2HPO4). Counts were obtained

from a minimum of 15 cells and from at least five

separate flower buds or roots.

Flow cytometry

Leaf tissues (*50 mg), collected from 4-week-old

microplants, were macerated to prepare nuclei sus-

pensions (Arumuganathan and Earle 1991). Relative

fluorescence of the propidium iodide-stained leaf

nuclei was measured in a FACSCalibur flow cytom-

eter (Becton Dickinson, San Jose, USA) using CRBC

as an internal standard. The objects were analysed

for forward (FSC) versus side (SSC) scatter signals

for at least 5,000 nuclei in each sample. The peak

corresponding to the CRBC nuclei was adjusted to

around channel 200 set on a linear scale of fluores-

cence intensity. The nuclear DNA amount (2C value

in pg) was calculated by direct comparison of the

mean position of plant nuclear peak to the mean

position of CRBC nuclear peak (2.33 pg). For each

sample, there were three independent replicated

measurements.

Field studies

Field studies were conducted on the two androgenic

dihaploids (C-13 and D4) and their corresponding

tetraploid parents (Kufri Chipsona-2 and JTH/C-107).

As potato plants flower only under long-day condi-

tions of Shimla hills (mid Himalayas) in northern

India, this experiment was conducted in the summer

(May–August). The tubers were planted in a ran-

domized complete block design (RCBD) with five

replications. Each clone was represented by three

rows of five plants each at a spacing of 20 cm in rows

60 cm apart per replication. Fertilizer schedules and

cultural practices were as described earlier (Naik

et al. 1998). At 60 days after planting, the following

data were collected: plant height, number of shoots,

terminal leaflet length and width, leaf ratio (average

terminal leaflet length divided by average terminal

leaflet width), leaflet number, leaflet length and

width, internode length, stem width, specific leaf

area, number of inflorescences, number of flower

buds, anther length at dehiscence, corolla radius to

petal tip and corolla width at widest diameter. The

data on internode length, number of tubers, average

tuber weight, harvest index and tuber dry matter were

collected at harvest (120 days after planting). Total

soluble sugars, reducing sugars and starch content of

freshly harvested tubers were estimated as described

earlier (Sharma et al. 2004). Pollen stainability and

quality were assessed by carmino acetic acid and

fluorochromatic tests (2.0 mg ml-1 fluorescein diac-

etate in acetone and few drops of this stock solution

were added to 2.0 ml of a 0.5 M sucrose solution),

respectively.

Foliar assessment of late blight disease

Assessments of the percentage of foliage affected

with late blight were made on the two middle rows of

each plot at an interval of 7 days based on the British

316 Euphytica (2010) 171:313–326

123

Mycological Society scale, starting on 16 July and

continuing for a total of six observations up to 20

August. Late blight susceptible cv. Kufri Jyoti was

used as a spreader. The area under the disease

progress curve (AUDPC) was calculated in percent-

age-day according to the midpoint rule method

(Campbell and Madden 1990). The relative area

under the disease progress curve (RAUDPC = AU-

DPC/(tn-t1) 9 100 where (tn-t1) is the duration of

the epidemic) was calculated to quantify the disease

level that ranged from 0.0 to 1.0 without any unit.

Nuclear microsatellite analysis

Total genomic DNA was extracted from 0.2 to 0.3 g

leaf tissues of 3-week-old microplants, according to a

modified CTAB-dichloromethane protocol (Saghai-

Maroof et al. 1984). Ten nuclear microsatellite loci

were characterized in the study (Table 1). The

reaction mixture (25 ll) was as follows: 19 assay

buffer, 2.5 mM MgCl2, 200 lM of each dNTP, 1.0 U

Taq polymerase (Qiagen GmbH, Hilden, Germany),

0.2 lM of each primer and 50 ng of template DNA.

A PCR protocol consisting of 30 cycles at 93�C for

30 s, Ta�C for 1 min and 72�C for 1 min was used

(Mastercycler� gradient; Eppendorf AG, Hamburg,

Germany). Negative controls were run with each

amplification. Samples were separated on a 18.0 cm

long 9 16.0 cm wide, 1.5 mm thick 8% non-dena-

turing polyacrylamide (29:1) gel, which were pre-run

at 180 V constant voltage for 10 min in 0.59 TBE

buffer using a Hoefer SE 600 (Amersham Biosci-

ences AB, Uppsala, Sweden) vertical electrophoresis

system; samples were loaded and separated under the

same conditions. The amplified products were

exposed with a modified silver staining protocol

(Sanguinetti et al. 1994). For each clone, the SSR

assay was performed at least five times using

five independent DNA extracts. For nSSR allele

detection and scoring, Gene Profiler Version 4.05

(Scanalytics, Fairfax, Virginia, USA), which allowed

single base differences to be detected, was used. Only

Table 1 Oligonucleotide sequences and other associated information for primer pairs used for the amplification from nuclear microsatellite

sequences for the characterization of an anther-derived population in potato

Locus

name

Accession

number

nSSR motif Primer sequence 50–30 Gene function

(LG)

Expected

allele size (bp)

Ta (�C)

POTM 1-2 U237558 (AT)20 AATAATACTGTGATGCCACAATGG

GTGGCATGTCTTCGAAGGTAC

POTM 1-2 (ND)a 221 55

STM0015 NAa (AC)13 (AT)10 GATTGTGAGAAGGCACTGA

CACTTGATATACTAGTGTGTTTGG

PAC26 (ND) 193 53

STM0019ab NA (AT)7 (GT)10 (AT)4

(GT)5 (GC)4 (GT)4

AATAGGTGTACTGACTCTCAATG

TTGAAGTAAAAGTCCTAGTATGTG

PAC33 (VI) 204 (161–239) 47

STM0019bb NA (AT)7 (GT)10 (AT)4

(GT)5 (GC)4 (GT)4

AATAGGTGTACTGACTCTCAATG

TTGAAGTAAAAGTCCTAGTATGTG

ND (83–119) 47

STM1043 U24088 (T)14.....(TAA)5 ATTTGAATTGAAGAACTTAATAGAA

CACAAACAAAATACTGTTAACTCA

STSUSY2 (X) 226 47

STM1069 X78271 (TCC)4 ATGCTAACTTGGACACTTA

AGTCTCTCAGGAGGATTAC

LEPDSGEN (III) 393 td 64–57

STM3003 NA (CT)4, (CA) CATAAATCACTAAAACTAGATAACC

TATTTCATATCAATGTCGAATCCC

ND 317 55

STWAX-1 X58453 (CTT)4 TGATTCTCTTGCCTACTGTAATCG

AGTCAGAGTATGGTTCCTGAGTCC

Waxy gene;

STGBSS (ND)

246 55

STWAX-2 X52417 (ACTC)5 CCCATAATACTGTCGATGAGCA

GAATGTAGGGAAACATGCATGA

G28WXST waxy

gene (VIII)

223 (224–243) 55

STWIN12G X13497 (AAT)6 AAATCGACACAGACGGAAATG

CGAGGGACTTTAATTTGTTGGA

STWIN12G (ND) 231–249 55

a NA not available; ND not determinedb Because using the same primer pairs STM0019 shows two distinct loci, they have been labeled as STM0019a and STM0019b

Euphytica (2010) 171:313–326 317

123

reproducible fragments were selected for data anal-

ysis. The alleles were generated using the Gene

Profiler linkage analysis database module.

Statistical analysis

Prior to univariate analysis, normality and equal

variance assumptions were tested, and accordingly,

the data on pollen stainability/quality (%) and tuber

dry matter (%) were transformed into arc sine square

roots and square roots, respectively. The data were

analyzed by ANOVA followed by all pairwise

multiple comparisons of mean values using the

post-hoc Tukey’s honestly significant difference test

(MSTAT-C; Michigan State University, Michigan,

USA). The term significant has been used to indicate

differences for which P B 0.05.

Results

Androgenic competence

A total of 27,715 anthers of the 15 genotypes gave

rise to three types of androgenic responses, viz.,

embryogenesis, callus induction, or a combination of

the both. Except for Kufri Chandramukhi, all

genotypes were responsive to anther culture; Kufri

Badshah, Kufri Chipsona-1, Kufri Megha and

TPS-13 were characterized by only callus induction,

whereas embryogenesis occurred in the other geno-

types (data not shown). However, complete plants

were obtained only in Kufri Chipsona-2 (henceforth

KCS-2) and JTH/C-107 (henceforth JTH). The

regenerated androgenic plantlets of K. Lalima did

not survive in cultures because they gradually turned

brown and degenerated. Distinct embryogenesis

patterns were observed in KCS-2 and JTH (Fig. 1A,

C). The embryogenesis was exclusively direct

(primary microspore embryogenesis without any

intermediary callus phase) in KCS-2, while both

direct and indirect (somatic embryogenesis from

anther walls via intermediary callus dedifferentia-

tion) embryogenesis occurred in JTH. The progres-

sion of callus dedifferentiation from anther walls

was visualized by sterio-microscopic observations;

however, the somatic origin of the calluses could

only be ascertained by ploidy diagnosis, nDNA

content and nuclear microsatellite analysis of the

regenerants (see below). Most microspore-embryoid-

derived regenerants degenerated during various

stages of cultures in vitro. In contrast, the regener-

ation potential of somatic embryoids was higher in

JTH. Altogether 11 plants were obtained: one in

KCS-2 (C-13 from a microspore embryoid) and 10

in JTH (D4 from a microspore embryoid; D1-1 to

D1-3, D2-1 to D2-5 and D2-7 from somatic

embryoids).

Fig. 1 Androgenesis in

tetraploid Solanumtuberosum L. A The

androgenic (di)haploid C-

13 of tetraploid cv. Kufri

Chipsona-2 (KCS-2)

developing through primary

microspore embryogenesis.

B Five-lobed corollas of

KCS-2 (left) in comparison

to four-lobed corollas of C-

13 (right). C Primary

microspore embryogenesis

in tetraploid interspecific

hybrid JTH/C-107. D A

complete reversal of flower

color in androgenic

(di)haploid D4 (right) in

comparison to its anther

donor JTH/C-107 (left)

318 Euphytica (2010) 171:313–326

123

Ploidy diagnosis and nuclear DNA variation

Based on mean chloroplast density per guard cell

pair, C-13 (13.1) and D4 (12.6) were L1-(di)haploids,

with a (di)haploid-tetraploid density ratio of 1.6–1.8

(Table 2). The other JTH anther-derived clones were

L1-tetraploids. The data on guard cell length and

width confirmed the L1-(di)haploidy status of both

C-13 (12.9/9.9) and D4 (13.1/9.6). Root tip chromo-

some counts showed that C-13 and D4 were typical

L3-(di)haploids with 24 chromosomes, while the

other JTH anther-derived clones were L3-tetraploids

with 48 chromosomes. The nDNA 2C values of C-13

and D4 were 1.72 and 1.76 pg, respectively in

comparison to 3.62 and 3.59 pg of KCS-2 and JTH,

respectively (Table 2). Except for D2-2 and D2-3,

3–7% higher 2C values (3.69–3.86 pg) were observed

in the other JTH anther-derived clones. The L2-ploidy

status was further confirmed by direct PMC chromo-

some counts, and no meiotic abnormalities were

observed.

Phenotypic variation

The most important vegetative characteristics distin-

guishing the two androgenic (di)haploids from their

corresponding tetraploid anther donors were plant

height, number of shoots per plant, terminal leaflet

length and width, leaf ratio, leaflet length and width,

and internode length (Table 3). In contrast to KCS-2,

C-13 was a dwarf, with a semi-compact bushy

appearance, short internodes and small lighter green

leaves. D4 had an open canopy structure, with short

internodes and small dark green leaves, compared to

compact canopy structure of JTH. The most impor-

tant distinguishing floral and tuber characteristics

were number of floral buds per inflorescence, anther

length, corolla width and radius, pollen diameter,

average tuber weight and tuber starch content. Most

of the white semi-stellate corollas of C-13 were four-

lobed, as compared to standard semi-stellate five-

lobed corollas of KCS-2 (Fig. 1B). Other marked

changes in floral attributes of C-13 were pale yellow

Table 2 Mean stomatal guard cell chloroplast density, guard

cell length and width, flow-cytometric nuclear DNA content

(2C) and chromosome counts of the two androgenic

(di)haploids, nine anther-derived tetraploids and their two

corresponding tetraploid parents in potato

Clone Chloroplast density/

guard cell pairaRatioa Guard cell

length (EPU)bGuard cell

width (EPU)bnDNA

content (pg)cChromosome

number

Ploidy

level (x)

C-13 13.1 dd 1.6 a 12.9 b 9.9 c 1.72 g 24 2x

KCS-2 21.4 a 1.0 d 18.0 a 12.3 ab 3.62 e 48 4x

D1-1 17.7 bc 1.2 bc 17.9 a 11.5 b 3.80 bc 48 4x

D1-2 16.8 bc 1.3 bc 19.1 a 12.5 ab 3.80 ab 48 4x

D1-3 17.2 bc 1.3 bc 19.8 a 12.6 ab 3.80 bc 48 4x

D2-1 18.0 bc 1.2 bc 18.8 a 12.3 ab 3.72 d 48 4x

D2-2 18.0 bc 1.2 bc 19.9 a 12.8 a 3.56 f 48 4x

D2-3 18.4 b 1.2 c 18.6 a 12.3 ab 3.54 f 48 4x

D2-4 16.0 c 1.4 b 19.4 a 12.2 ab 3.74 cd 48 4x

D2-5 17.7 bc 1.3 bc 18.7 a 11.8 ab 3.86 a 48 4x

D2-7 18.2 b 1.2 bc 19.3 a 12.0 ab 3.69 d 48 4x

D4 12.6 d 1.8 a 13.1 b 9.6 c 1.76 g 24 2x

JTH/C-107 22.0 a 1.0 d 18.1 a 12.4 ab 3.59 ef 48 4x

a Averaged over three replications, with 300 guard cell pairs counted per replication; the ratio between the mean guard cell

chloroplast density of a tetraploid and its corresponding androgenic/anther-derived cloneb Averaged over three replications, with 20 stomatal guard cells measured at 4009 magnification in eyepiece units (EPU) per

replication (1 EPU = 2.0 lm)c The DNA contents (2C values) of leaf nuclei as determined by laser flow cytometry using CRBC (2C = 2.33 pg) as an internal

standardd Means with common letters are not significantly different at P B 0.05, according to Tukey’s honestly significant difference (HSD)

test

Euphytica (2010) 171:313–326 319

123

anther color, shorter anther length and bilobed

stigma. In addition to other changes in floral

attributes, a complete reversal of corolla color from

intense purple to white occurred in D4 (Fig. 1D).

Both (di)haploids exhibited characteristic morpho-

logical variation in tuber characteristics in relation to

their corresponding tetraploid anther donors. Tubers

of C-13 were cylindrical with white flesh color, as

compared to round tubers with cream flesh color of

KCS-2. In D4, tubers were kidney-shaped with

shallow eye depth, white flesh color (vascular ring-

type secondary flesh color) and white-cream skin

color, as compared to those of JTH/C-107, which

were round with medium-deep eye depth, white flesh

color (no secondary flesh color) and yellow skin

color.

The male fertility of C-13 was comparable to

KCS-2 because more than 80% pollen stainability

Table 3 Means for various phenotypic traits of the two androgenic (di)haploids and their corresponding tetraploid parents in potato

Phenotypic trait C-13 KCS-2 D4 JTH/C-107

Plant height (cm) 29.6 ca 84.2 a 40.1 c 54.8 b

Number of shoots 4.4 a 5.6 a 2.0 b 4.8 a

Number of leaflets 7.0 ab 7.0 a 5.9 bc 5.2 c

Terminal leaflet length (cm) 3.4 c 5.1 b 4.4 b 7.1 a

Terminal leaflet width (cm) 1.6 c 3.0 b 2.0 c 5.3 a

Leaf ratio 2.1 a 1.7 b 2.2 a 1.3 c

Leaflet length (cm) 3.6 b 4.8 a 3.5 b 5.2 a

Leaflet width (cm) 1.9 c 2.9 b 1.6 c 3.4 a

Specific leaf area (cm2 g-1) 211.9 b 272.8 a 265.3 ab 265.0 ab

Stem width (mm) 3.0 b 3.8 b 1.9 c 5.2 a

Internode length (cm)b 1.6 c (2.6 c) 3.6 b (4.4 a) 1.1 c (3.3 bc) 5.7 a (3.6 b)

Number of inflorescencesa 5.2 4.0 4.8 9.0

Number of floral buds 5.0 b 8.8 a 3.7 b 9.3 a

Anther length (mm) 5.4 b 6.4 a 4.8 c 6.5 a

Corolla width (cm) 2.3 b 3.6 a 2.2 b 3.6 a

Corolla radius (cm) 1.1 b 1.8 a 1.1 b 1.8 a

Pollen stainability-CAA (%)c 82.6 a 79.6 a 32.6 b 38.3 b

Pollen quality-FCR (%)c 74.4 a 83.3 a 23.3 b 8.5 c

Pollen diameter (EPU)c 3.1 c 3.6 b 3.1 c 4.0 a

RAUDPCd 0.00 d 0.12 c 0.32 b 0.50 a

Harvest indexa 0.363 0.470 0.319 0.329

Number of tubers 7.8 a 9.8 a 3.4 b 6.4 ab

Average tuber weight (g) 7.6 b 19.5 ab 7.1 b 31.7 a

Tuber dry matter (%) 21.1 a 23.0 a 14.2 b 14.1 b

Tuber reducing sugars (mg g-1 FM) 0.9 b 1.4 b 7.0 a 1.8 b

Tuber total sugars (mg g-1 FM) 3.6 b 3.9 b 12.4 a 3.9 b

Tuber starch (mg g-1 FM) 193.9 ab 241.6 a 108.2 c 151.0 bc

a Means with common letters within a row are not significantly different at P B 0.05, according to Tukey’s honestly significant

difference (HSD) test; for inflorescence number per plant and harvest index, univariate F tests were not significantb Figures within parenthesis represent the average length of the third, fourth and fifth internodes from the base of the plants at

120 days after plantingc Averaged over five replications, with 20 pollen grains measured at 1009 magnification in eyepiece units (EPU) per replication (1

EPU = 8.0 lm); CAA carmino acetic acid; FCR fluorochromatic testd RAUDPC (relative area under the disease progress curve) is AUDPC divided by the duration of the epidemic (tn-t1) 9 100%; the

mean RAUDPC value of cv. Kufri Jyoti, a local late blight susceptible check, was 0.50

320 Euphytica (2010) 171:313–326

123

was recorded (Table 3). The FCR assay substantiated

the pollen stainability results. There was no signif-

icant difference in pollen stainability (\40%)

between JTH and its androgenic (di)haploid D4.

However, the FCR test showed that the per cent

pollen quality was significantly higher in D4 (23.3%)

than in JTH (8.5%). No berries were produced in C-

13. In addition to a moderate degree of premature

floral bud abscission in C-13, the stigma started

degenerating even before pollination, and subse-

quently the style-stigma combine was found to

degenerate completely within a couple of days after

pollination. In D-4, selfed berries could set, but they

prematurely abscised and degenerated subsequently

in storage.

Field resistance to late blight

In comparison to cv. Kufri Jyoti, a highly susceptible

local check, JTH had no field resistance to late blight

(Table 3). Nevertheless, its androgenic (di)haploid

D4 exhibited moderate field resistance. It is known

that KCS-2 is resistant to late blight, as also became

apparent in the present study, with an RAUDPC score

of 0.12. Interestingly, however, its androgenic

(di)haploid C-13 was found to be highly resistant,

and no visible symptoms of Phytophthora infestans

developed in the leaves even when late blight was

severe in the experimental plot. The mean sum of

squares for RAUDPC due to replications was non-

significant, indicating that the infection was uniform

throughout the experimental plot.

Nuclear microsatellite analysis

Of the nine sets of nSSR primers, eight amplified

single locus microsatellites, but STM0019 revealed

two distinct loci (Table 4). They were all polymor-

phic and informative. Altogether they produced 35

alleles, with their sizes ranging from 88 to 462 bp.

True to tetraploid nature of most of the clones typed

in this study, one to four different alleles were

detected for each clone. Of the four nSSR genotypes

produced at POTM1-2, STM0015 and STM0019b,

two androgenic (di)haploids and their corresponding

anther donors had unique genetic profiles, while nine

anther-derived tetraploids had a common allelic

profile true-to-type to JTH (Table 5). The nine

anther-derived tetraploids shared the same allelic

profiles with JTH at all the microsatellite loci, except

at STM0019a where they were characterized by the

absence of a standard JTH allele (STM0019a-186).

Except for the (di)haploid C-13 that was heterozy-

gous for 40% of the loci tested, all the other clones

were with 60% of heterozygous loci.

Table 4 Allelic profiles at ten polymorphic microsatellite loci characterized in two androgenic (di)haploids, nine anther-derived

tetraploids and their two corresponding tetraploid anther donors of potato

Locus Number

of alleles

Number of clones with specified number of alleles Number of

genetic profiles

generated

Genotype

index (GI)aHeterozygote

frequency (HF)aPICa

1 2 3 4

POTM1-2 6 0 11 2 0 4 0.308 1.00 0.679

STM0015 5 0 10 2 1 4 0.308 1.00 0.662

STM0019ab 4 3 9 1 0 4 0.308 0.77 0.597

STM0019bb 3 1 11 1 0 4 0.308 0.92 0.566

STM1043 3 12 1 0 0 3 0.231 0.08 0.417

STM1069 2 1 12 0 0 2 0.154 0.92 0.373

STM3003 3 13 0 0 0 3 0.231 0.00 0.314

STWAX-1 3 11 2 0 0 3 0.231 0.15 0.314

STWAX-2 4 0 13 0 0 3 0.231 1.00 0.595

STWIN12G 2 13 0 0 0 2 0.154 0.00 0.152

Average 3.5 5.4 6.9 0.6 0.1 3.2 0.246 0.58 0.467

a GI number of genetic profiles generated/the total number of clones typed (13); HF number of clones with two or more alleles/the

total number of clones typed (13); PIC polymorphism information contentb Same as in Table 1

Euphytica (2010) 171:313–326 321

123

True to its gametic origin from KCS-2, C-13 was

characterized by single-allele deletions at microsat-

ellite loci POTM1-2, STM0015 and STM1069 and a

double-allele deletion at STM0019b (Table 5). C-13

received the same allelic profiles from its parent

KCS-2 at 40% microsatellite loci. In contrast, D4

could be differentiated from its parent JTH at 90%

microsatellite loci. Interestingly, however, for the loci

POTM1-2 and STM0015, D4 had unique triallelic

profiles, with additional 222- and 185-bp alleles,

respectively; C-13 also had a triallelic profile at the

locus STM0015 (Fig. 2). These triallelic profiles were

consistently amplified over several PCR assays, using

not only fresh DNA extracts, but also a different

polymerase kit. Of all the microsatellite loci tested,

only a typical androgenic (di)haploid-specific allele

was detected for the locus STWAX-2 where the

standard 234- (KCS-2) and 238-bp (JTH) alleles were

replaced by a 230-bp allele in both C-13 and D4.

Discussion

In the present study, the presence of 24 chromosomes

in all the three shoot layers, viz., L1 (epidermis), L2

(hypodermis) and L3 (internal tissues) of both the

androgenic (di)haploids precluded the occurrence of

ploidy chimeras during the process of androgenesis.

Table 5 Genotypes of the two androgenic (di)haploids, nine anther-derived tetraploids and two tetraploid anther donors at ten

polymorphic nuclear microsatellite loci in potato

Locus nSSR genotype (alleles in bp)

KCS-2 C-13 JTH/C-107 D4 D1 seriesa D2 seriesa

POTM1-2 250:230:214 230:214 276:246 276:246:222 276:246 276:246

STM0015 199:179:169:161 179:169:161 199:161 185:179:161 199:161 199:161

STM0019ab 198 198 228:198:186 172 228:198 228:198

STM0019bb 124:110:88 88 110:88 124:88 110:88 110:88

STM1043 229 229 232 250:229 232 232

STM1069 462:441 462 462:441 462:441 462:441 462:441

STM3003 352 348 352 344 352 352

STWAX-1 264:249 264:249 249 258 249 249

STWAX-2 250:234 250:230 250:238 250:230 250:238 250:238

STWIN12G 252 252 252 246 252 252

a D1 series represent anther-derived tetraploid clones D1-1, D1-2 and D1-3, while D2 series represent D2-1, D2-2, D2-3, D2-4, D2-5

and D2-7b Same as in Table 1

Fig. 2 Non-denaturing polyacrylamide gel showing polymor-

phism at the nuclear microsatellite locus STM0015 in potato.

Lanes from left to right: M 100 bp DNA ladder; C negative

control with no DNA; 1 KCS-2; 2 C-13; 3 JTH/C-107; 4 D-4; 5D1-1; 6 D1-2; 7 D1-3; 8 D2-1; 9 D2-2; 10 D2-3; 11 D2-4; 12

D2-5; 13 D2-7. Arrows indicate alleles STM0015-179 and -169

in KCS-2 and C-13, and allele STM0015-185 in D4,

representing triallelic profiles at this locus for both the

androgenic (di)haploids

322 Euphytica (2010) 171:313–326

123

The involvement of primary microspore embryogen-

esis in (di)haploid-derivation mechanism may be

responsible for this ploidy stability, which has been

otherwise shown to progress through varying degrees

of instabilities in potato anther cultures (Birhman

et al. 1994; Wenzel 1994; Calleberg 1996). The 2C

nDNA contents of both the androgenic (di)haploids

were about half the amounts of their corresponding

tetraploid anther donors. These values not only are in

good agreement with the estimates obtained in

tetraploid potatoes (Valkonen 1994), but also exactly

reflect the same variation between (di)haploids and

their corresponding tetraploids (Valkonen 1994;

Rokka et al. 1995, 1998). As we could not find any

cytological basis for a significant increase in nDNA

content in most of the anther-derived tetraploid

clones of JTH, these changes are perhaps associated

with somaclonal variation induced by somatic

embryogenesis via an intermediary callus phase.

Studies on various plant species have shown that

changes in nDNA content are related to growth

environmental stress and even somaclonal variation

(Cullis 1990).

In a cross-pollinated crop such as potato, genetic

variation among (di)haploids is expected because of

the high level of heterozygosity in the parental

cultivars (Ross 1986). The variation between the

(di)haploids and their corresponding tetraploid par-

ents is also common in potato. In the present study, in

the comparison between androgenic (di)haploids and

their tetraploid anther donors, the phenotypic varia-

tion was expressed at all the stages of plant growth.

This might have accrued from genomic changes

inherent in (di)haploid-derivation process, although

differential selection pressures during anther culture

(Rivard et al. 1994) cannot be ignored. A greater

selection pressure during monoploid-derivation pro-

cess through androgenesis than through gynogenesis

has been shown to occur in diploid potatoes (Lough

et al. 2001). The extent of phenotypic variation was

greater in D4 than in C-13. As JTH is an interspecific

hybrid, it is quite expected that the androgenic

process would result in yielding more variability in

its androgenic (di)haploid D4. Though both the

androgenic (di)haploids exhibited improved field

resistance to late blight, of particular interest is the

high level of field resistance expressed by C-13. This

points to extensive genomic rearrangements resulting

in the accumulation of favourable alleles in a gametic

phase under the sporophytic influence. The transmis-

sion and maintenance of virus resistance in potato

during haploidization via anther culture have been

reported (Rokka et al. 1995; Grammatikaki et al.

2007). The restoration of male fertility in androgenic

(di)haploids can be attributed to the mode of

(di)haploid-derivation mechanism through primary

microspore embryogenesis, perhaps coincident with

sporophytic determinants carried over and expressed

in the form of a high degree of meiotic stability

(Heberle-Bors 1985). Indeed, we could not detect any

apparent meiotic abnormalities in both the (di)hap-

loids. However, the inability to set berries in C-13

indicates that some sorts of (self) incompatibilities

might be operating at some levels. It is well known

that potato (di)haploids have an extremely low

capacity to produce berries (Uijtewaal et al. 1987;

Singh et al. 1988; Paz and Veilleux 1999; Phumichai

et al. 2005).

The microsatellite results are indicative of exten-

sive changes and rearrangements underlying andro-

genic (di)haploid-derivation process. The high

polymorphism averaged over ten microsatellite loci

is comparable with the results obtained from nSSR-

based cultivar discrimination for tetraploid potatoes

(Ashkenazi et al. 2001 and references therein). An

average genotype index of 0.246 is also comparable

with that reported for the four single-locus SSRs

(0.360) over 39 potato cultivars (McGregor et al.

2000). Since both the androgenic (di)haploids repre-

sent the gametes directly and SSR is a codominant

marker, it is possible to explain the reasons for such

high polymorphism based on recombination vis-a-vis

crossover events. The microsatellite locus POTM1-2

representing a dinucleotide repeat (AT) has been

mapped at the farthest (42.65 cM) from the centro-

mere (Chani et al. 2002) amongst the other loci

characterized in this study, for which gene-centro-

mere map positions are available. This provides a

strong basis for high polymorphism detected at this

locus because the probability of a crossover in

meiosis increases with distance from the centromere

(Chani et al. 2000), accepting the hypothesis of a

single crossover per chromosome arm in potato

microspores (Bastiaanssen et al. 1996). This also

explains the lowest level of polymorphism at the

locus STWIN12G representing a trinucleotide (AAT)

repeat, which has been mapped \33 cM from the

centromere (at 24.24 cM; Chani et al. 2002). The

Euphytica (2010) 171:313–326 323

123

similar frequency of heterozygous loci in D4 and its

parent JTH may be due to the fact that the later

represents an interspecific hybrid between two repro-

ductively isolated parental species (Veilleux et al.

1995). Incidentally, the frequency of heterozygous

loci was lower in C-13 than in KCS-2, an intraspe-

cific hybrid.

For the locus STWAX-2 representing a tetranucle-

otide (ACTC) repeat that has been mapped at

40.58 cM from the centromere (Chani et al. 2002)

on chromosome VIII, a 230-bp allele was favored in

both the androgenic (di)haploids. Since tetranucleo-

tide repeats are in general least susceptible to

polymerase template slippage (Valdes et al. 1993),

this mutant allele might have been generated due to

unequal crossing-over between sister chromatids. Its

presence in both the (di)haploids can be attributed to

the selection of alleles that influence regeneration

during androgenesis (Rivard et al. 1996). The fact

that all the JTH anther-derived tetraploids have the

common microsatellite allelic profiles that are true-

to-type to their tetraploid anther donor unambigu-

ously indicates their origin from somatic anther

tissues. If these anther-derived tetraploid clones

would have originated from reduced microspores

followed by spontaneous chromosome doubling

either during culture or subsequently, they would

have been expected to display microsatellite variation

not only between themselves, but also in relation to

their tetraploid anther donor JTH due to meiotic

recombination and segregation. In diploid potato

species, anther-derived diploids that originated from

somatic anther tissues were found to be genetically

identical to the diploid anther donor, except for

possible somaclonal variation (Veilleux et al. 1995;

Chani et al. 2000). Indeed, in the present study, the

deletion of a standard 186-bp allele at the locus

STM0019a in all the JTH anther-derived tetraploid

clones suggests the occurrence of somaclonal varia-

tion during the process of somatic embryogenesis

from anther walls. Somatic embryogenesis from

grapevine anthers was also associated with somacl-

onal variation as revealed by microsatellite analysis

(Bertsch et al. 2005).

In the present study, inordinately high allele

numbers for the loci POTM1-2 and STM0015 were

observed in androgenic (di)haploids. The presence of

more alleles than expected for a diploid species has

been related to higher ploidy levels (Ghislain et al.

2006). However, both C-13 and D4 are (di)haploids

in all the three shoot layers. A more probable

hypothesis explaining this phenomenon in D4 that

shows triallelic profiles at both the loci can be based

upon its chimeric structure, which might have been

formed through incomplete fusion of two different

pro-embryos during the first steps of microspore

division (Murigneux et al. 1993). It may perhaps

explains the basis for enormous phenotypic as well as

genetic variation observed in D4 as compared to its

tetraploid anther donor JTH/C-107. However, the

triallelic profile in C-13 for the locus STM0015 is

difficult to explain, even if one considers that its

tetraploid parent KCS-2 is a periclinal chimera

consisting of two different allelic profiles in L1 and

L2 cell layers, and this chimeric genotype has been

dissociated during floral bud formation (from the L2

cell layer). The separation of a periclinal chimera by

passage through anther-derived somatic embryogenic

calli has been detected in grapevine using microsat-

ellite markers (Bertsch et al. 2005). A detailed

microsatellite analysis of both C-13 and D4 in

relation to their parents using DNA from different

plant parts that represent distinct cell layers will be

carried out in our laboratory in the future.

Acknowledgments We thank Poonam Chandel for her

assistance in stomatal guard cell characterization, and Sheesh

Ram Thakur and Ram Dayal for greenhouse and field

management. We also thank Dr. P.H. Singh for his guidance

on the evaluation of field resistance to late blight disease and

Dr. P.S. Ahuja, Director, IHBT, Palampur, Himachal Pradesh

for allowing us to use the flow cytometry facility. The financial

assistance received from the Indian Council of Agricultural

Research (ICAR), New Delhi in the form of an ad-hoc research

project (F. No. 8-45/2004-Hort. II) is also acknowledged.

Comments and suggestions on the manuscript from an

anonymous reviewer are gratefully acknowledged.

References

Arumuganathan K, Earle ED (1991) Estimation of nuclear

DNA content of plants by flow cytometry. Plant Mol Biol

Rep 9:229–241

Ashkenazi V, Chani E, Lavi U, Levy D, Hillel J, Veilleux RE

(2001) Development of microsatellite markers in potato

and their use in phylogenetic and fingerprinting analyses.

Genome 44:50–62

Bastiaanssen HJM, Ramanna MS, Sawor Z, Mincione A, Steen

AVD, Jacobsen E (1996) Pollen markers for gene cen-

tromere mapping in diploid potato. Theor Appl Genet

93:1040–1047

324 Euphytica (2010) 171:313–326

123

Bertsch C, Kieffer F, Maillot P, Farine S, Butterlin G, Merdinoglu

D, Walter B (2005) Genetic chimerism of Vitis vinifera cv.

Chardonnay 96 is maintained through organogenesis but not

somatic embryogenesis. BMC Plant Biol 5:20

Birhman RK, Rivard SR, Cappadocia M (1994) Restriction

fragment length polymorphism analysis of anther-culture-

derived Solanum chacoense. HortScience 29:206–208

Calleberg E (1996) Anther culture of potato. Dissertation,

Swedish University of Agricultural Sciences

Campbell CL, Madden LV (1990) Introduction to plant disease

epidemiology. Wiley, New York

Cappadocia M, Ramulu KS (1998) Anther culture in potato

improvement. In: Paul Khurana SM, Chandra R, Upadhya

MD (eds) Comprehensive potato biotechnology. Malhotra

Publishing House, New Delhi, pp 1–30

Chani E, Veilleux RE, Boluarte-Medina T (2000) Improved

androgenesis of interspecific potato and efficiency of SSR

markers to identify homozygous regenerants. Plant Cell

Tissue Organ Cult 60:101–112

Chani E, Ashkenazi V, Hillel J, Veilleux RE (2002) Micro-

satellite marker analysis of an anther-derived potato

family: skewed segregation and gene-centromere map-

ping. Genome 45:236–242

Clulow SA, Wilkinson MJ, Waugh R, Baird E, DeMaine MJ,

Powell W (1991) Cytological and molecular observations

on Solanum phureja-induced dihaploid potatoes. Theor

Appl Genet 82:545–551

Cullis CA (1990) DNA rearrangements in response to envi-

ronmental stress. Adv Genet 28:73–97

De Maine MJ (1984) Patterns of variation in potato dihaploid

families. Potato Res 27:1–11

Ghislain M, Andrade D, RodrAguez F, Hijmans RJ, Spooner

DM (2006) Genetic analysis of the cultivated potato

Solanum tuberosum L. Phureja group using RAPDs and

nuclear SSRs. Theor Appl Genet 113:1515–1527

Grammatikaki G, Avgelis A, Sonnino A (2007) Behavior of

potato gametoclonal plants against the necrotic strain of

potato Y potyvirus. Russian J Plant Physiol 54:507–512

Heberle-Bors E (1985) In vitro haploid formation from pollen:

a critical review. Theor Appl Genet 71:361–374

Jacobsen E, Ramanna MS (1994) Production of monohaploids

of Solanum tuberosum L. and their use in genetics,

molecular biology and breeding. In: Bradshaw JE, Mac-

kay GR (eds) Potato genetics. CAB International, Wal-

lingford, pp 155–170

Kotch GP, Ortiz R, Peloquin SJ (1992) Genetic analysis by use

of potato haploid populations. Genome 35:103–108

Lough RC, Varrieur JM, Veilleux RE (2001) Selection inherent

in monoploid derivation mechanisms for potato. Theor

Appl Genet 103:178–184

Luo ZW, Zhang RM, Kearsey MJ (2004) Theoretical basis for

genetic linkage analysis in autotetraploid species. Proc

Natl Acad Sci USA 101:7040–7045

Matsubayashi M (1979) Genetic variation in dihaploid potato

clones, with special reference to phenotypic segregations

in some characters (preliminary report). Sci Rep Fac Agr

Kobe Univ 13:185–192

McGregor CE, Lambert CA, Greyling MM, Louw JH, Warnich

L (2000) A comparative assessment of DNA finger-

printing techniques (RAPD, ISSR, AFLP and SSR) in

tetraploid potato (Solanum tuberosum L.) germplasm.

Euphytica 113:135–144

Meyer R, Salamini F, Uhring H (1993) Isolation and character-

ization of potato diploid clones generating a high frequency

of monohaploid or homozygous diploid androgenic plants.

Theor Appl Genet 85:905–912

Murashige T, Skoog F (1962) A revised medium for rapid

growth and bioassays with tobacco tissue cultures. Physiol

Plant 15:473–497

Murigneux A, Barloy D, Leroy P, Beckert M (1993) Molecular

and morphological evaluation of doubled haploid lines in

maize. 1. Homogeneity within DH lines. Theor Appl

Genet 86:837–842

Naik PS, Sarkar D, Gaur PC (1998) Yield components of

potato microtubers: in vitro production and field perfor-

mance. Ann Appl Biol 133:91–99

Paz MM, Veilleux RE (1999) Influence of culture medium and

in vitro conditions on shoot regeneration in Solanumphureja monoploids and fertility of regenerated doubled

monoploids. Plant Breed 118:53–57

Pehu E, Veilleux RE, Hilu KW (1987) Cluster analysis of anther-

derived plants of Solanum phureja (Solanaceae) based on

morphological characteristics. Am J Bot 74:47–52

Phumichai C, Mori M, Kobayashi A, Kamijima O, Hosaka K

(2005) Toward the development of highly homozygous

diploid potato lines using the self-compatibility control-

ling Sli gene. Genome 48:977–984

Rivard SR, Saba-El-Leil MK, Landry BS, Cappadocia M

(1994) RFLP analyses and segregation of molecular

markers in plants produced by in vitro anther culture,

selfing, and reciprocal crosses of two lines of self-

incompatible Solanum chacoense. Genome 37:775–783

Rivard SR, Cappadocia M, Landry BS (1996) A comparison of

RFLP maps based on anther culture derived, selfed, and hybrid

progenies of Solanum chacoense. Genome 39:611–621

Rokka V-M, Valkonen JPT, Pehu E (1995) Production and

characterization of haploids derived from somatic hybrids

between Solanum brevidens and S. tuberosum through

anther culture. Plant Sci 112:85–95

Rokka V-M, Pietila L, Pehu E (1996) Enhanced production of

dihaploid lines via anther culture of tetraploid potato (Solanumtuberosum L. ssp. tuberosum) clones. Am Potato J 73:1–12

Rokka V-M, Ishimaru CA, Lapitan NLV, Pehu E (1998) Pro-

duction of androgenic dihaploid lines of the disomic tet-

raploid potato species Solanum acaule ssp. acaule. Plant

Cell Rep 18:89–93

Ross H (1986) Potato breeding-problems and perspectives.

Verlag Paul Parey, Berlin

Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW

(1984) Ribosomal DNA spacer-length polymorphisms in

barley: mendelian inheritance, chromosomal locations,

and population dynamics. Proc Natl Acad Sci USA 81:

8014–8018

Samitsu Y, Hosaka K (2002) Molecular marker analysis of 24-

and 25-chromosome plants obtained from Solanum tu-berosum L. ssp. andigena (2n = 4x = 48) pollinated with

a Solanum phureja haploid inducer. Genome 45:577–583

Sanguinetti CJ, Dias Neto E, Simpson AJG (1994) Rapid silver

staining and recovery of PCR products separated on

polyacrylamide gels. Biotechniques 17:915–919

Euphytica (2010) 171:313–326 325

123

Sarkar D, Maity S, Das PK (2004a) Induction of androgenic

embryoids from anther culture of Madhuca indica. J Trop

For Sci 16:429–436

Sarkar D, Pandey SK, Sud KC, Chanemougasoundharam A

(2004b) In vitro characterization of manganese toxicity in

relation to phosphorus nutrition in potato (Solanum tuberosumL.). Plant Sci 167:977–986

Sharma S, Chanemougasoundharam A, Sarkar D, Pandey SK

(2004) Carboxylic acids affect induction, development

and quality of potato (Solanum tuberosum L.) microtubers

grown in vitro from single-node explants. Plant Growth

Regul 44:219–229

Singh AK, Uhrig H, Salamini F (1988) Implications of chro-

mosome pairing in a monoploid and its colchidiploid of

Solanum tuberosum (x = 12). Genome 30:347–351

Song Y-S, Hepting L, Schweizer G, Hartl L, Wenzel G,

Schwarzfischer A (2005) Mapping of extreme resistance

to PVY (Rysto) on chromosome XII using anther-culture-

derived primary dihaploid potato lines. Theor Appl Genet

111:879–887

Uijtewaal BA, Jacobsen E, Hermsen JGTh (1987) Morphology

and vigour of monohaploids potato clones, their corre-

sponding homozygous diploids and tetraploids and their

heterozygous diploid parent. Euphytica 36:745–753

Valdes M, Slatkin M, Freimer NB (1993) Allele frequencies at

microsatellite loci: the stepwise mutation model revisited.

Genetics 133:737–749

Valkonen JPT (1994) Nuclear DNA content of the Solanumspp. in the series etuberosa as determined by laser flow

cytometry. Ann Appl Biol 125:589–600

Veilleux RE, Shen LY, Paz MM (1995) Analysis of the genetic

composition of anther-derived potato by randomly

amplified polymorphic DNA and simple sequence repeats.

Genome 38:1153–1162

Watanabe K, Orrillo M, Vega S, Masuelli R, Ishiki K (1994)

Potato germplasm enhancement with disomic tetraploid

Solanum acaule. II. Assessment to breeding value of tet-

raploid F1 hybrids between S. acaule and tetrasomic tet-

raploid potatoes. Theor Appl Genet 88:135–140

Waugh R, Baird E, Powell W (1992) The use of RAPD

markers for the detection of gene introgression in potato.

Plant Cell Rep 11:466–469

Wenzel G (1994) Tissue culture. In: Bradshaw E, Mackay GR

(eds) Potato genetics. CAB International, Wallingford, pp

173–195

Wilkinson MJ, Bennett ST, Clulow SA, Allainguillaume J,

Harding K, Bennett MD (1995) Evidence for somatic

translocation during potato dihaploid induction. Heredity

74:146–151

326 Euphytica (2010) 171:313–326

123