PARP1-driven apoptosis in chronic lymphocytic leukemia

Research ArticlePARP1-Driven Apoptosis in Chronic Lymphocytic Leukemia

Panagiotis T Diamantopoulos Maria Sofotasiou Vasiliki PapadopoulouKaterina Polonyfi Theodoros Iliakis and Nora-Athina Viniou

Department of Internal Medicine Hematology Unit Laikon General Hospital National and Kapodistrian University of Athens11527 Athens Greece

Correspondence should be addressed to Panagiotis T Diamantopoulos pandiamantopoulosgmailcom

Received 30 March 2014 Accepted 19 July 2014 Published 3 August 2014

Academic Editor Marie-Christine Kyrtsonis

Copyright copy 2014 Panagiotis T Diamantopoulos et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

Chronic lymphocytic leukemia (CLL) is considered a malignancy resulting from defects in apoptosis For this reason targetingapoptotic pathways in CLL may be valuable for its management Poly [ADP-ribose] polymerase 1 (PARP1) is the main memberof a family of nuclear enzymes that act as DNA damage sensors Through binding on DNA damaged structures PARP1 recruitsrepair enzymes and serves as a survival factor but if the damage is severe enough its action may lead the cell to apoptosis throughcaspase activation or necrosis We measured the PARP1 mRNA and protein pretreatment levels in 26 patients with CLL and thecorresponding posttreatment levels in 15 patients after 3 cycles of immunochemotherapy as well as in 15 healthy blood donors Nodifference was found between the pre- and posttreatment levels of PARP1 but we found a statistically significant relative increaseof the 89 kDa fragment of PARP1 that is cleaved by caspases in the posttreatment samples indicating PARP1-related apoptosis inCLL patients after treatment Our findings constitute an important step in the field especially in the era of PARP1 inhibitors andmay serve as a base for future clinical trials with these agents in CLL

1 Introduction

The poly [ADP-ribose] polymerases (PARPs) are a family ofnuclear enzymes comprising 17 members Their main func-tion is to bind to DNA breaks serving as a signal to otherDNA-repairing enzymes in order to fix the damage Bindingof PARPs to DNA leads to their polymerization and by poly[ADP-ribosylation] a posttranslational modification of pro-teins playing a crucial role in many cell processes theyparticipate in DNA repair and gene transcription [1 2]

Among the members of the PARP family PARP1 is themost abundant and plays a role in the repair of single-strandDNA (ssDNA) and double-strand DNA (dsDNA) breaksInhibition of PARP1 activity leads to reduced ssDNA breakrepair eventually leading to cell death The molecular struc-ture of PARP1 consists of 4 domains an N-terminal doublezinc finger DNA-binding domain a nuclear localization sig-nal a central automodification domain and aC-terminal cat-alytic domain [3] PARP1 has a low enzymatic activity whichis stimulated by allosteric activators such as damaged DNA(single- and double-strand breaks crossovers cruciform andsupercoils) undamaged DNA structures nucleosomes and

some protein-binding partners Binding of PARP1 with suchmolecules boosts its enzymatic activity that targets corehistones histone H1 and transcription-related factors [4ndash8]Upon binding to these allosteric activators PARP1 recruitsvarious proteins involved in the DNAdamage response to thesites of DNA damage [3] and this means that PARP1 actsessentially as a DNAdamage sensor [4] Low level DNAdam-age seems to trigger detection and repair of the DNAdamageIn that case PARP1 acts as a survival factor On the otherhand high levels of DNA damage may lead to cell death byeither apoptosis or necrosis through PARP1 overactivation[9]

PARP1may induce apoptosis through apoptosis inducingfactor (AIF) activation as well as necrosis The cell type andthe type strength and duration of the stimuli are presumed tobe factors determining the cell death pathway It has beenshown that actively proliferating cells (such as malignantcells) aremore sensitive to PARP1 activation and die by necro-sis while nonproliferating cells are resistant to cell deathunder the same conditions [10] a fact that is mainly deter-mined by the availability ofATP in the cell [11] Strong stimulisuch as severe DNA damage may lead to necrosis through

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 106713 6 pageshttpdxdoiorg1011552014106713

2 BioMed Research International

overactivation of PARP1 which causes depletion of theNAD+and ATP pool of the cell [12 13]

During the execution phase of apoptosis caspases cleaveseveral proteins that are necessary for the cell function andsurvival Among them PARP1 is cleaved by caspases 3 and7 into a sim25 kDa N-terminal fragment containing the DNA-binding domain (DBD) and a sim85 kDa C-terminal fragmentthat retains basal enzymatic activity but cannot be stimulatedby DNA damage [14] This cleavage is necessary to eliminatePARP1 activation in response to DNA fragmentation pro-tecting the cells fromATP depletion and subsequent necroticdeath and preventing futile attempts of DNA repairThroughthese processes PARP1 cleavage may help to commit cells tothe apoptotic pathway [15] Thus PARP1 plays a central rolein apoptosis determining the cell fate [16]

CLL is a highly heterogeneous disease in terms of biologyand hence clinical presentation The clinical course of CLLcan vary from asymptomatic and indolent for several years toseverely symptomatic since diagnosis requiring treatmentClinical staging age and performance status remain themajor factors defining prognosis and need for treatmentNewprognostic factors include cytogenetic analysis immun-oglobulin mutation analysis and expression of 70 kDa zetaassociated protein (ZAP-70) and CD38 [17 18] Severalstudies have identified the signal transduction pathways thatcontribute to antiapoptotic signaling in CLL cells and CLL isconsidered a malignancy resulting from defects in apoptosis[19]

Among other genetic defects defects in the ds-DNAbreak response have been implicated in the pathogenesis ofCLL Impairment of the DNA damage response has beencorrelated to aggressive CLL [20] unresponsiveness to stan-dard therapy and adverse clinical outcomes of patients withCLL [21]

A recent study showed that reduced expression of PARP1is associated with an impairment of CLL responsiveness tocell death [22] This is to our knowledge the only study onPARP1 expression in CLL

As PARP1 inhibitors are currently under study in thecontext of phase II [23 24] and phase III clinical trials [25]mostly for advanced or relapsed breast and ovarian cancerthe need to further understand the role of PARP1 in hema-tological malignancies is mandatory This study tries to shedlight on the possible role of PARP1 in the pathways that driveapoptosis in CLL The aim of our study is to determine thelevels of PARP1 expression in patients with CLL before andafter immunochemotherapy as well as to compare them withthose of healthy individuals

2 Patients and Methods

21 Patients Twenty-six patients with B-cell chronic lym-phocytic leukemia (CLL) were included in the studyInformed consent was obtained from all patients The diag-nosis of CLL was established in each case using morpholog-ical histopathological and immunophenotypic criteria Allpatients had immunophenotypically confirmed disease byperipheral blood at the time of first sample collection Fifteen

patients among them received treatment with rituximabbased immunochemotherapy according to common clinicalpractice after the first sample collection and a second samplewas obtained after 3 treatment cyclesWe also obtained bloodsamples from 15 healthy blood donors to be used as a controlgroup

We obtained from all patients and healthy controlsperipheral whole blood samples that were collected inethylenediaminetetraacetic acid (EDTA) All samples wereprocessed within 6 hours from collection Following RNAextraction and cDNA synthesis the samples were kept atminus80∘C A quantitative real-time polymerase chain reaction(qRT-PCR) was performed in order to measure PARP1mRNA levels Moreover PARP1 protein was detected by animmunoblotting assay following protein extraction asdescribed below

22 Methods

221 RNA Extraction and Reverse Transcription The Trizolprotocol (Invitrogen Carlsbad CA USA) was used to extractand purify total RNA from peripheral whole blood sam-ples Reverse transcription was performed using MMLV-derived reverse transcriptase enzyme (M-MLV RT Invitro-gen) according to standard protocols

222 Primer Design for Real-Time PCR Primers for PARP1and 120573-actin were designed with the help of the Primer3software (University of Massachusetts USA) using therelevant annotated cDNA sequences from NCBI BLAST(NM 0016183 for PARP1 and NM 0011013 for 120573-actin)mdashprimer sequences for PARP1 forward CCTGATCCCCCAC-GACTTT reverse GCAGGTTGTCAAGCATTTC and for120573-actin forward AGGATGCAGAAGGAGATCACT reverseGGGTGTAACGCAACTAAGTCATAG

223 Real-Time PCR Real-time PCR was performed withthe use of 2X iTaq Universal SYBR GREEN Supermix (Bio-Rad California USA) on a CFX96 Real-Time PCR system(Bio-Rad California USA) using the following cycling con-ditions for both PARP1 and 120573-actin 510158401015840 at 95∘C 1510158401015840 at 59∘Cand 510158401015840 at 72∘C all steps repeated for 40 cycles Relativequantitation of PARP1 and 120573-actin transcripts was performedwith the standard curve method PARP1 expression was infact compared between samples as a ratio of PARP1actintranscript levels

224 Immunoblotting Total cellular protein was obtainedfrom about 107 cells from each sample using RIPA bufferLysates were incubated on ice for 15 minutes and then cen-trifuged for 10 minutes at 14000 rpm Protein extracts werethen separated by SDS-PAGE electrophoresis on acrylamide5 stacking and 75 separating gels using the Mini-Protean electrophoresis cell (BioRad) according to standardprocedures Molecular weight values were estimated usingprestained protein markers (Full Range RainbowMarker GEHealthcare) Proteins were transferred from the gel to PVDF

BioMed Research International 3

Table 1 Patient characteristics epidemiology disease characteristics treatment and response

Characteristic All patients Subset of patients that received treatmentNumber of patients119873 () 26 (100) 15 (100)Median age years (range) 74 (51ndash87) 73 (51ndash82)Male to female ratio 15 14Peripheral blood lymphocytes times109L (range) 294 (39ndash810) 267 (39ndash810)LDHULN at presentation mean (range) 12 (09ndash31) 11 (09ndash27)Previous treatment119873 () 2 (77) 2 (133)Disease stage (Binet) (1524)119873 ()

A 10 (385) 0 (0)B 9 (346) 8 (533)C 7 (269) 7 (467)

Immunochemotherapeutic regimen119873 () NAR 8 (533)R Ch 3 (200)FCR 4 (267)

Response to treatment119873 () NAComplete response 3 (200)Partial response 10 (667)Stable disease 2 (133)Disease progression 0 (0)

ULN upper limit of normal R rituximab Ch chlorambucil F fludarabine C cyclophosphamide

membrane (Immun-blot Biorad) according to the manu-facturerrsquos instructions Membranes were then incubated inblocking solution (5 wv BSA in ΤBS-T ie Tris-bufferedsaline01 Tween 20) for 1 hour at room temperatureand the primary antibody was added at a dilution 11000(PARP rabbit mAb Cat number 9542 Cell Signal or 120573-actinrabbit polyclonal Ab Cat number 4967 Cell Signal whenmembranes were reprobed for loading control) Afterovernight incubation at 4∘C themembrane was washed 3x inTBS-T and incubated with secondary antibody at a dilution14000 in blocking buffer for 1 h at room temperature (anti-rabbit IgG HRP conjugated Cat number 7074 Cell Signal)After 3x washes in TBS-T signal was detected with ECLBlotting reagent (GE Healthcare) and X-OMAT LS-1 film(Kodak)

23 Statistical Analysis For the statistical analysis of theresults we used IBM SPSS statistics version 190 The RelatedSamples Wilcoxon Signed Rank test was used for compar-isons involving pre- and posttreatment values while the Inde-pendent Samples Mann-Whitney119880 test was used to comparethe levels of PARP1mRNA and protein between patients andhealthy controls

3 Results

Whole blood samples were obtained from 26 patients withCLL before treatment and from 1526 following 3 cyclesof immunochemotherapy Whole blood samples were alsoobtained from 15 healthy volunteers The patientsrsquo charac-teristics are shown in Table 1 Data is presented for the totalpopulation (26 patients) as well as for the subset of 15 patients

from whom samples were obtained both before and aftertreatment The vast majority (1315 866) of this subsetof patients were treatment naıve at the time of first samplecollection while the rest (215 133) had not received anytreatment for at least 6 months None of the above patientshad been treatedwith rituximab in the pastThe programmedand eventually administered treatment schemes are shown inTable 1

The pretreatment levels of PARP1mRNA (ratio of PARP1toACTBmRNA levels) were found to be 0088 (0001ndash3490)while the posttreatment value was 0055 (0003ndash0535) Thetwo values did not differ in a statistically significant level (119875 =051) Moreover the pretreatment levels of PARP1mRNA didnot differ significantly from those of the control group (119875 =0364) although the control group levels were slightly higher(0241 range 0024ndash1762)

The used PARP1 antibody detects the endogenous levelsof full length PARP1 (116 kDa) as well as the large fragment(89 kDa) of PARP1 resulting from caspase cleavage Wedetected the pre- and posttreatment levels of both molecules(full length and large fragment) and we calculated the ratio oftheir expression (ie 11689)This ratio was used as an indica-tor of caspase activation Specifically a decrease of this ratiowould imply a relative increase of the 89 kDa fragment thatresults from caspase activation in comparison to the fulllength molecule On the contrary an increase of this ratiowould mean a relative reduction of the caspase derivedfragment

The89 kDa fragmentwas detected in all samples (pre- andposttreatment) while the 116 kDa molecule was detected in2226 pretreatment samples and in 1215 posttreatment sam-ples For these patients the 11689 ratio was not calculated


Table 2 PCR and immunoblotting results

All patients 15 patients (pretreatment) 15 patients (posttreatment) 119875

lowast

PARP1-mRNA median (range)1 0094 (0001ndash3490) 0088 (0001ndash3490) 0055 (0003ndash0535) 0507116 kDa fragment median (range)2 0532 (0ndash1808) 0528 (0263ndash0673) 0551 (0311ndash0864) 030889 kDa fragment median (range)2 0665 (0202ndash2097) 0647 (0202ndash1002) 0607 (0162ndash0992) 087511689 ratio median (range)dagger 1182 (0754ndash1589) 1245 (0754ndash1589) 1095 (0444ndash1554) 0026

All patients Healthy donorsPARP1-mRNA median (range)1 0094 (0001ndash3490) 024 (0024ndash1762) 03641PARP1ACTB ratio 2PARP1ACTB expression ratiolowastCorrelation between pre- and posttreatment levels was performed using the related samples Wilcoxon Signed Rank testdaggerFour (426) patients did not have a measurable 116 kDa molecule One of them was in the 15-patient group that was given treatment Following treatment315 patients did not have a measurable 116 kDa molecule For these patients the calculation of 11689 ratio was not performed and they were excluded fromthe relevant statistical analysis

and they were excluded from the statistical analysis The pre-and posttreatment levels of both the full length molecule andthe large fragment of PARP1 did not differ significantly Onthe contrary the pretreatment 11689 ratio was higher than itsposttreatment value (1245 (0754ndash1589) versus 1095 (0444ndash1554)) and this difference was statistically significant (119875 =0026) The results are presented in detail in Table 2 Figure 1shows the immunoblotting results of two patients before andafter immunochemotherapy

The full length molecule of 116 kDa was detected in onlyone (115) of the healthy subjects while the caspase derived89 kDa fragment was detected in all of them The medianlevel of the 89 kDa fragment in the control group was 0494(0172ndash0985) and was lower than the pretreatment levels ofthe patients (119875 = 0036) Due to the absence of the 116 kDamolecule in the vast majority (1415) of the healthy controlsthe 11689 ratio was not calculated thus further correlationswere not possible between the control and the patient groups

Multivariate analysis did not reveal statistically significantdifferences in the mRNA and protein levels in correlationto the stage of disease the peripheral blood lymphocytecount the LDH levels and the response to treatment Morespecifically there was no statistically significant correlation ofthe difference of the pre- and posttreatment 11689 ratios withthe response to treatment (119875 = 0378)

4 Discussion

Physiological apoptosis is a process that controls cell num-bers as well as tissue and organ morphology and removesinjured and mutated cells [26] Dysregulation of apoptoticpathways may result in cancer or other hyperproliferativedisorders [27 28] The caspases are highly specialized pro-teases that when activated incite one of the more commonapoptosis pathways Upon caspase activation cell death isinitiated through cleavage of several key proteins requiredfor cellular function and survival [29] Cleavage of PARP1 isconsidered to be a hallmark of apoptosis [14] All members ofthe caspase family may modify PARP1 but caspases 3 and 7tend to cleave PARP1 in a way that results in the formation oftwo fragments with specific functions an 89 kDa catalyticfragment and a 24 kDa DNA binding domain [30] The89 kDa fragment has a greatly reducedDNA binding capacity

SamplesA B

Pre PrePost Post

(kD

a)

95

72

55

43

34

Full length PARP1PARP1 (89kDa)

120573-Actin

Figure 1 Pre- and posttreatment immunobloting results for 2patients (A and B) Patient A expresses different levels of the fulllength (116 kDa) and the 89 kDa fragment of PARP1 Patient Bexpresses both the full length and the 89 kDa fragment of PARP1before treatment but loses the full length molecule after immuno-chemotherapy

and is released from the nucleus into the cytosol [31] The24 kDa fragment binds irreversibly to the DNA strand breaksand inhibits DNA repair enzymes (including PARP1) leadingto attenuation of DNA repair [32] Although the main role ofPARP1 is to detect and repair DNA damage a severe DNAdamage could result in high NAD+ and ATP consumptionthrough PARP1 overactivation leading to depletion of the cellATP pool This activity would inevitably lead to necrotic celldeath a process that is blocked by the rapid cleavage andinactivation of PARP1 by the caspases [33 34]Thus when thedamage is ldquotoo severe to handlerdquo the action of caspases mayshift the cell through enhanced PARP1 cleavage from necro-sis to apoptosis

We detected in our samples the PARP1 mRNA using aPCR and the corresponding protein (the full length moleculeas well as the cleaved by caspases 89 kDa fragment of PARP1)using an immunoblotting technique By measuring the levelsof PARP1 in both RNA and protein levels we managed tocrosscheck our results andmost importantly to measure boththe ldquoproductionrdquo and the ldquousagerdquo of PARP1

We did not detect any differences in the level of PARP1mRNA yield before and after treatment but we found a sta-tistically significant difference in the ratio of the full lengthmolecule to the 89 kDa fragment before and after immuno-chemotherapy indicating caspase activation as reflected bythe relatively higher levels of the 89 kDa fragment in the


posttreatment samples Moreover we found that PARP1driven apoptosis is probably lower in healthy persons asindicated by the lower levels of the 89 kDa fragment incomparison to patients with CLL a fact that is compatiblewith the basic speculation that PARP1 driven apoptosis is anindicator of DNA damage which is fundamental in thepathogenesis of CLL and neoplasia in general

Our results suggest a possible role of PARP1 inducedapoptosis in patients with CLL that are treatedwith rituximabbased immunochemotherapy This preliminary result couldserve as a clinical basis for further research in this field andfor the use of PARP1 inhibitors in patients with CLL in thecontext of clinical trials

Our finding is of significant value for two major reasonsFirstly it confirms the results of other investigators whomeasured the levels of PARP1 before and after irradiationtreatment of CLL cells [22]The results of their study indicatethat PARP1 is downregulated in nonresponder versus respon-der samples and that its basal expression is positively cor-related with PARP1 cleavage after irradiation Secondly ourstudy is the firstmdashto our knowledgemdashtomeasure the levels ofPARP1 in patient samples before and after ldquoin vivordquo treatmentadministration and this fact increases the importance of thefinding and correlates it more directly to the possible resultsof the administration of PARP1 inhibitors in CLL

A drawback of this study is that due to the rather smallstudy population no further analysis could be made forthe several prognostic factors such as p53 mutation andthe immunoglobulin variable (IgVH) regionmutation statusMoreover due to the small number of patients (415) treatedwith fludarabine containing regimens no correlations ofPARP1 expression could be made between patients treatedwith more or less aggressive regimens

The molecular mechanisms involved in balancing sur-vival and death of B lymphocytes in CLL triggered by PARP1activation are highly complex and incompletely understoodAccording to our results the regulative action of caspases onPARP1 seems to be important in CLL We consider thisfinding of significant value because it helps to further under-stand the pathophysiology of the disease and to define theapoptotic pathways that are defective in CLL Because CLL isconsidered a malignancy resulting from defects in apoptosistargeting apoptotic pathways in CLL is a valuable weapon inthe treatment of the disease and our preliminary resultscould guide future research on whether PARP1 serves as atreatment target in CLL The extension of this study can pro-vide more detailed information about the role of PARP1 andcaspases in several subsets of patients based on their geneticprofile and could help formulate a plan about the possible useof PARP1 inhibitors in CLL

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

References

[1] R Krishnakumar and W L Kraus ldquoThe PARP side of thenucleusmolecular actions physiological outcomes and clinicaltargetsrdquoMolecular Cell vol 39 no 1 pp 8ndash24 2010

[2] L A Carey andN E Sharpless ldquoPARP and cancermdashif itrsquos brokedonrsquot fix itrdquoThe New England Journal of Medicine vol 364 no3 pp 277ndash279 2011

[3] M Y Kim T Zhang andW L Kraus ldquoPoly(ADP-ribosyl)ationby PARP-1 lsquoPAR-layingrsquo NAD+ into a nuclear signalrdquoGenes andDevelopment vol 19 no 17 pp 1951ndash1967 2005

[4] D DrsquoAmours S Desnoyers I DrsquoSilva and G G PoirierldquoPoly(ADP-ribosyl)ation reactions in the regulation of nuclearfunctionsrdquo Biochemical Journal vol 342 no 2 pp 249ndash2681999

[5] S L Oei and Y Shi ldquoTranscription factor Yin Yang 1 stimulatespoly(ADP-ribosyl)ation and DNA repairrdquo Biochemical andBiophysical Research Communications vol 284 no 2 pp 450ndash454 2001

[6] E Kun E Kirsten and C P Ordahl ldquoCoenzymatic activityof randomly broken or intact double-stranded DNAs in autoand histone H1 trans-poly(ADP-ribosylation) catalyzed bypoly(ADP-ribose) polymerase (PARP I)rdquoThe Journal of Biolog-ical Chemistry vol 277 no 42 pp 39066ndash39069 2002

[7] N Ogata K Ueda M Kawaichi and O Hayaishi ldquoPoly(ADP-ribose) synthetase a main acceptor of poly(ADP-ribose) inisolated nucleirdquoThe Journal of Biological Chemistry vol 256 no9 pp 4135ndash4137 1981

[8] W L Kraus and J T Lis ldquoPARP goes transcriptionrdquo Cell vol113 no 6 pp 677ndash683 2003

[9] A Burkle ldquoPARP-1 a regulator of genomic stability linked withmammalian longevityrdquo ChemBioChem vol 2 no 10 pp 725ndash728 2001

[10] W X Zong D Ditsworth D E Bauer Z Q Wang and C BThompson ldquoAlkylating DNA damage stimulates a regulatedform of necrotic cell deathrdquo Genes amp Development vol 18 no11 pp 1272ndash1282 2004

[11] W Ying C C Alano P Garnier and R A Swanson ldquoNAD+ asa metabolic link between DNA damage and cell deathrdquo Journalof Neuroscience Research vol 79 no 1-2 pp 216ndash223 2005

[12] P Decker and S Muller ldquoModulating poly (ADP-ribose) poly-merase activity potential for the prevention and therapy ofpathogenic situations involving DNA damage and oxidativestressrdquo Current Pharmaceutical Biotechnology vol 3 no 3 pp275ndash283 2002

[13] V J Bouchard M Rouleau and G G Poirier ldquoPARP-1 a det-erminant of cell survival in response to DNA damagerdquo Experi-mental Hematology vol 31 no 6 pp 446ndash454 2003

[14] S H Kaufmann S Desnoyers Y Ottaviano N E Davidsonand G G Poirier ldquoSpecific proteolytic cleavage of poly(ADP-ribose) polymerase an early marker of chemotherapy-inducedapoptosisrdquo Cancer Research vol 53 no 17 pp 3976ndash3985 1993

[15] C Soldani and A I Scovassi ldquoPoly(ADP-ribose) polymerase-1cleavage during apoptosis an updaterdquo Apoptosis vol 7 no 4pp 321ndash328 2002

[16] A L Edinger and C BThompson ldquoDeath by design apoptosisnecrosis and autophagyrdquoCurrentOpinion inCell Biology vol 16no 6 pp 663ndash669 2004

[17] M Hallek and N Pflug ldquoChronic lymphocytic leukemiardquoAnnals of Oncology vol 21 supplement 7 pp vii154ndashvii1642010

[18] P Cramer and M Hallek ldquoPrognostic factors in chronic lym-phocytic leukemia-what do we need to knowrdquo Nature ReviewsClinical Oncology vol 8 no 1 pp 38ndash47 2011

[19] AMasoodMA Shahshahan andA R Jazirehi ldquoNovel appro-aches to modulate apoptosis resistance basic and clinical


implications in the treatment of chronic lymphocytic leukemia(CLL)rdquo Current Drug Delivery vol 9 no 1 pp 30ndash40 2012

[20] P Ouillette S Fossum B Parkin et al ldquoAggressive chroniclymphocytic leukemia with elevated genomic complexity isassociated with multiple gene defects in the response to DNAdouble-strand breaksrdquo Clinical Cancer Research vol 16 no 3pp 835ndash847 2010

[21] A Rosenwald E Y Chuang R E Davis et al ldquoFludarabinetreatment of patients with chronic lymphocytic leukemiainduces a p53-dependent gene expression responserdquo Blood vol104 no 5 pp 1428ndash1434 2004

[22] M G Bacalini S Tavolaro N Peragine et al ldquoA subset ofchronic lymphocytic leukemia patients display reduced levels ofPARP1 expression coupled with a defective irradiation-inducedapoptosisrdquoExperimentalHematology vol 40 no 3 pp 197ndash2062012

[23] httpwwwclinicaltrialsgovct2showNCT00516724[24] httpwwwclinicaltrialsgovct2showNCT00664781[25] httpwwwclinicaltrialsgovct2showNCT01945775[26] L Galluzzi N Joza E Tasdemir et al ldquoNo death without

life vital functions of apoptotic effectorsrdquo Cell Death andDifferentiation vol 15 no 7 pp 1113ndash1123 2008

[27] T G Cotter ldquoApoptosis and cancer the genesis of a researchfieldrdquo Nature Reviews Cancer vol 9 no 7 pp 501ndash507 2009

[28] G V Chaitanya J S Alexander and P P Babu ldquoPARP-1 cleav-age fragments signatures of cell-death proteases in neurode-generationrdquoCell Communication and Signaling vol 8 article 312010

[29] U Fischer R U Janicke and K Schulze-Osthoff ldquoMany cuts toruin a comprehensive update of caspase substratesrdquo Cell Deathand Differentiation vol 10 no 1 pp 76ndash100 2003

[30] N Margolin S A Raybuck K P Wilson et al ldquoSubstrate andinhibitor specificity of interleukin-1120573-converting enzyme andrelated caspasesrdquo The Journal of Biological Chemistry vol 272no 11 pp 7223ndash7228 1997

[31] C SoldaniM C LazzeM G Bottone et al ldquoPoly(ADP-ribose)polymerase cleavage during apoptosis when and whererdquoExperimental Cell Research vol 269 no 2 pp 193ndash201 2001

[32] D DrsquoAmours F R Sallmann V M Dixit and G G PoirierldquoGain-of-function of poly(ADP-ribose) polymerase-1 uponcleavage by apoptotic proteases implications for apoptosisrdquoJournal of Cell Science vol 114 no 20 pp 3771ndash3778 2001

[33] Y Eguchi S Shimizu and Y Tsujimoto ldquoIntracellular ATPlevels determine cell death fate by apoptosis or necrosisrdquoCancerResearch vol 57 no 10 pp 1835ndash1840 1997

[34] C Lemaire K Andreau V Souvannavong andA Adam ldquoInhi-bition of caspase activity induces a switch from apoptosis tonecrosisrdquo FEBS Letters vol 425 no 2 pp 266ndash270 1998

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


overactivation of PARP1 which causes depletion of theNAD+and ATP pool of the cell [12 13]

During the execution phase of apoptosis caspases cleaveseveral proteins that are necessary for the cell function andsurvival Among them PARP1 is cleaved by caspases 3 and7 into a sim25 kDa N-terminal fragment containing the DNA-binding domain (DBD) and a sim85 kDa C-terminal fragmentthat retains basal enzymatic activity but cannot be stimulatedby DNA damage [14] This cleavage is necessary to eliminatePARP1 activation in response to DNA fragmentation pro-tecting the cells fromATP depletion and subsequent necroticdeath and preventing futile attempts of DNA repairThroughthese processes PARP1 cleavage may help to commit cells tothe apoptotic pathway [15] Thus PARP1 plays a central rolein apoptosis determining the cell fate [16]

CLL is a highly heterogeneous disease in terms of biologyand hence clinical presentation The clinical course of CLLcan vary from asymptomatic and indolent for several years toseverely symptomatic since diagnosis requiring treatmentClinical staging age and performance status remain themajor factors defining prognosis and need for treatmentNewprognostic factors include cytogenetic analysis immun-oglobulin mutation analysis and expression of 70 kDa zetaassociated protein (ZAP-70) and CD38 [17 18] Severalstudies have identified the signal transduction pathways thatcontribute to antiapoptotic signaling in CLL cells and CLL isconsidered a malignancy resulting from defects in apoptosis[19]

Among other genetic defects defects in the ds-DNAbreak response have been implicated in the pathogenesis ofCLL Impairment of the DNA damage response has beencorrelated to aggressive CLL [20] unresponsiveness to stan-dard therapy and adverse clinical outcomes of patients withCLL [21]

A recent study showed that reduced expression of PARP1is associated with an impairment of CLL responsiveness tocell death [22] This is to our knowledge the only study onPARP1 expression in CLL

As PARP1 inhibitors are currently under study in thecontext of phase II [23 24] and phase III clinical trials [25]mostly for advanced or relapsed breast and ovarian cancerthe need to further understand the role of PARP1 in hema-tological malignancies is mandatory This study tries to shedlight on the possible role of PARP1 in the pathways that driveapoptosis in CLL The aim of our study is to determine thelevels of PARP1 expression in patients with CLL before andafter immunochemotherapy as well as to compare them withthose of healthy individuals

2 Patients and Methods

21 Patients Twenty-six patients with B-cell chronic lym-phocytic leukemia (CLL) were included in the studyInformed consent was obtained from all patients The diag-nosis of CLL was established in each case using morpholog-ical histopathological and immunophenotypic criteria Allpatients had immunophenotypically confirmed disease byperipheral blood at the time of first sample collection Fifteen

patients among them received treatment with rituximabbased immunochemotherapy according to common clinicalpractice after the first sample collection and a second samplewas obtained after 3 treatment cyclesWe also obtained bloodsamples from 15 healthy blood donors to be used as a controlgroup

We obtained from all patients and healthy controlsperipheral whole blood samples that were collected inethylenediaminetetraacetic acid (EDTA) All samples wereprocessed within 6 hours from collection Following RNAextraction and cDNA synthesis the samples were kept atminus80∘C A quantitative real-time polymerase chain reaction(qRT-PCR) was performed in order to measure PARP1mRNA levels Moreover PARP1 protein was detected by animmunoblotting assay following protein extraction asdescribed below

22 Methods

221 RNA Extraction and Reverse Transcription The Trizolprotocol (Invitrogen Carlsbad CA USA) was used to extractand purify total RNA from peripheral whole blood sam-ples Reverse transcription was performed using MMLV-derived reverse transcriptase enzyme (M-MLV RT Invitro-gen) according to standard protocols

222 Primer Design for Real-Time PCR Primers for PARP1and 120573-actin were designed with the help of the Primer3software (University of Massachusetts USA) using therelevant annotated cDNA sequences from NCBI BLAST(NM 0016183 for PARP1 and NM 0011013 for 120573-actin)mdashprimer sequences for PARP1 forward CCTGATCCCCCAC-GACTTT reverse GCAGGTTGTCAAGCATTTC and for120573-actin forward AGGATGCAGAAGGAGATCACT reverseGGGTGTAACGCAACTAAGTCATAG

223 Real-Time PCR Real-time PCR was performed withthe use of 2X iTaq Universal SYBR GREEN Supermix (Bio-Rad California USA) on a CFX96 Real-Time PCR system(Bio-Rad California USA) using the following cycling con-ditions for both PARP1 and 120573-actin 510158401015840 at 95∘C 1510158401015840 at 59∘Cand 510158401015840 at 72∘C all steps repeated for 40 cycles Relativequantitation of PARP1 and 120573-actin transcripts was performedwith the standard curve method PARP1 expression was infact compared between samples as a ratio of PARP1actintranscript levels

224 Immunoblotting Total cellular protein was obtainedfrom about 107 cells from each sample using RIPA bufferLysates were incubated on ice for 15 minutes and then cen-trifuged for 10 minutes at 14000 rpm Protein extracts werethen separated by SDS-PAGE electrophoresis on acrylamide5 stacking and 75 separating gels using the Mini-Protean electrophoresis cell (BioRad) according to standardprocedures Molecular weight values were estimated usingprestained protein markers (Full Range RainbowMarker GEHealthcare) Proteins were transferred from the gel to PVDF




A 10 (385) 0 (0)B 9 (346) 8 (533)C 7 (269) 7 (467)






3 Results









lowast






4 Discussion


SamplesA B

Pre PrePost Post

(kD

a)

95

72

55

43

34


120573-Actin













References








































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of



















A 10 (385) 0 (0)B 9 (346) 8 (533)C 7 (269) 7 (467)






3 Results









lowast






4 Discussion


SamplesA B

Pre PrePost Post

(kD

a)

95

72

55

43

34


120573-Actin













References








































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of



















lowast






4 Discussion


SamplesA B

Pre PrePost Post

(kD

a)

95

72

55

43

34


120573-Actin













References








































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
























References








































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















PARP1-driven apoptosis in chronic lymphocytic leukemia

Documents

Transcript of PARP1-driven apoptosis in chronic lymphocytic leukemia