pi

Fa

b

a

ARRAA

KNBCABL

1

ccopilorada

o1f

0d

Toxicology 273 (2010) 12–18

Contents lists available at ScienceDirect

Toxicology

journa l homepage: www.e lsev ier .com/ locate / tox ico l

52–Bcl3 complex promotes cyclin D1 expression in BEAS-2B cellsn response to low concentration arsenite

eng Wanga,b, Yongli Shia, Santosh Yadava, He Wanga,∗

Department of Environmental Health Science, School of Public Health and Tropical Medicine, Tulane University, New Orleans, LA, USADepartment of Laboratory Medicine, Southwest Hospital, Third Military Medical University, Chongqing, People’s Republic of China

r t i c l e i n f o

rticle history:eceived 1 March 2010eceived in revised form 24 March 2010ccepted 18 April 2010vailable online 24 April 2010

eywords:F-�Bcl3yclin D1rseniteEAS-2Bung cancer

a b s t r a c t

Arsenic is a well-recognized human carcinogen that causes a number of malignant diseases, includinglung cancer. Previous studies have indicated that cyclin D1 is frequently over-expressed in many cancertypes. It is also known that arsenite exposure enhances cyclin D1 expression, which involves NF-�Bactivation. However, the mechanism between cyclin D1 and the NF-�B pathway has not been well studied.This study was designed to characterize the underlying mechanism of induced cell growth and cyclinD1 expression in response to low concentration sodium arsenic (NaAsO2) exposure through the NF-�B pathway. Cultured human bronchial epithelial cells, BEAS-2B, were exposed to low concentrationsodium arsenite for the indicated durations, and cytotoxicity, gene expression, and protein activity wereassessed. To profile the canonical and non-canonical NF-�B pathways involved in cell growth and cyclinD1 expression induced by low concentration arsenite, the NF-�B-specific inhibitor-phenethyl caffeate(CAPE) and NF-�B2 mRNA target sequences were used, and cyclin D1 expression in BEAS-2B cells wasassessed. Our results demonstrated that exposure to low concentration arsenite enhanced BEAS-2B cells

growth and cyclin D1 mRNA and protein expression. Activation and nuclear localization of p52 and Bcl3in response to low concentration arsenite indicated that the non-canonical NF-�B pathway was involvedin arsenite-induced cyclin D1 expression. Moreover, we further demonstrated that p52/Bcl3 complexformation enhanced cyclin D1 expression through the cyclin D1 gene promoter via its �B site. The up-regulation of cyclin D1 mediated by the p52–Bcl3 complex in response to low concentration arsenite

ssessiful ef

might be important in amechanisms of the harm

. Introduction

Arsenic-containing compounds have been classified as humanarcinogens by the International Agency for Research on Can-er. These compounds can cause malignant disorders in differentrgans and tissues, including the lung. Exposure to arsenic com-ounds can occur via different portals such as inhalation and

ngestion of contaminated air, water and food. Exposure to a lowevel of arsenic is of particular concern because of the diversityf entry pathways and the natural existence of arsenic in envi-

onment. Epidemiological studies have indicated that long-termrsenic exposure can increase the incidence of human pulmonaryisease, including asthma, chronic obstructive pulmonary disease,nd lung cancer (Celik et al., 2008; Guha Mazumder, 2007). Acute

∗ Corresponding author at: Department of Environmental Health Science, Schoolf Public Health and Tropical Medicine, Tulane University, 2129 Tiderwater Building,440 Canal St., New Orleans, LA 70112, USA. Tel.: +1 504 988 1081;ax: +1 504 988 1726.

E-mail address: hwang2@tulane.edu (H. Wang).

300-483X/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved.oi:10.1016/j.tox.2010.04.009

ng the health risk of low concentration arsenite and understanding thefects of arsenite.

© 2010 Elsevier Ireland Ltd. All rights reserved.

exposure to high-dose arsenic has been well studied (Bernstamand Nriagu, 2000). It has been shown that high-dose arsenicresults in cell death, which contributes to the associated pathogeniceffects such as inflammation, hyperplasia and fibrosis (Lage etal., 2006; Pedlar et al., 2002; Soucy et al., 2003). Interestingly,high-dose arsenic treatments of cells affect the expression ofalmost completely non-overlapping subsets of genes in compari-son with low-dose treatments, suggesting a threshold switch from asurvival-based biological response at low doses to a death responseat high doses (Andrew et al., 2003).

Available epidemiological data suggest that long-term exposureof low concentration arsenic via inhalation or ingestion can increasethe risk of human lung cancer (IARC, 2004; Liao et al., 2009). How-ever, the mechanisms that account for the carcinogenic effect of lowconcentration arsenic remain to be investigated (Zhang et al., 2009).Previous studies have suggested a link between arsenic and cyclin

D1; cyclin D1 has been shown to be up-regulated by arsenic inmouse JB6 Cl41 cells (Ouyang et al., 2006), human fibroblasts (Vogtand Rossman, 2001) and BEAS-2B cells (Andrew et al., 2009). CyclinD1 is a pivotal cell cycle-regulatory molecule and a well-studiedtherapeutic target for cancer, as it has been found to be frequently

cology

o2(obhlcbDsc

wgasDt

tioeasi2

st2

2

2

TwgLSrs

2

2apstrioew

2

caTgwpa

F. Wang et al. / Toxi

ver-expressed in a large spectrum of human cancers (Peer et al.,008). It is also considered as an oncogenic driver in human cancerGautschi et al., 2007; Kim and Diehl, 2009). The over-expressionf cyclin D1 often correlates with an increased gene copy num-er (Bosch et al., 1994). The increased cyclin D1 gene copy numberas been reported in cancerous diseases including non-small cell

ung cancer; this increase in gene copy numbers is generally asso-iated with protein over-expression (Betticher et al., 1996). Studiesy Diehl et al. demonstrated that the nuclear accumulation of cyclin1 maintains a constant proliferative stress that sensitizes cells to

econdary genetic alterations, a process which is likely to promotearcinogenesis (Gladden and Diehl, 2005; Gladden et al., 2006).

The expression of cyclin D1 can be regulated by the NF-�B path-ay (Barre and Perkins, 2007; Sandur et al., 2009). There are a

rowing number of reports suggest that p100/52 can function asregulator of cell proliferation. Studies by Nadiminty et al. (2008)

uggest that in androgen-sensitive LNCaP cells, p52 promotes cyclin1 expression, enhances growth and protects cells against apop-

otic cell death and cell cycle arrest.The NF-�B pathway involves a number of subunits and is under

he control of a number of co-regulators. As a member of thenhibitory �B-family, Bcl3 plays an important role as a co-activatorf p52. Bcl3 has also been described as a regulator of cell prolif-ration and tumorigenesis both in vitro and in vivo (Massoumi etl., 2006). Reports suggest that Bcl3 is a common target gene foreveral cell proliferation cytokines, and high expression of Bcl3 isnvolved in increased human cell proliferation (Westerheide et al.,001).

In this study, we tested the hypothesis that low concentrationodium arsenite mediates NF-�B2 (p52)/Bcl3 activation, leading tohe expression and increased activity of cyclin D1 protein in BEAS-B cells.

. Materials and methods

.1. Cell culture and treatments

The human bronchial cell line (BEAS-2B) was purchased from the Americanype Culture Collection (ATCC, Wiltshire, USA). After the flask was pre-coatedith fibronectin (0.01 mg/ml) and collagen (0.03 mg/ml) overnight, cells were

rown in serum-free growth medium supplemented with additives (BEGM kit,onza/Clonetics) in T-75 flasks in a humidified atmosphere with 5% CO2 at 37 ◦C.ubcultures for the experiments were set up the day before treatment. When cellseached 80–90% confluence, they were treated with the indicated concentrations ofodium arsenite (NaAsO2) for various exposure durations.

.2. Cell toxicology assay

To investigate the cytotoxicity of low concentrations of sodium arsenite in BEAS-B cells, the MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide)ssay was conducted. A total of 2 × 105 cells were cultured in each well of a 24-welllate to 70–80% confluence. Cells were exposed to the indicated concentrations ofodium arsenite. Next, thiazolyl blue tetrazolium bromide (0.5 mg/ml) was added tohe culture medium and incubated for 3 h at 37 ◦C. After the incubation period, theesulting formazan crystals were dissolved with anhydrous isopropanol suppliedn 10% Triton X-100 plus 0.1 N HCl. The absorbance was measured at a wavelengthf 570 nm using the FLUOstar Optima multi-detection plate reader. Cell viability isxpressed as the percentage of viable cells relative to the control. All experimentsere performed at least in triplicate.

.3. Cell lysis and protein analysis

Cells were harvested after arsenite treatment (time and concentrations are indi-ated in each figure legend). The lysates were sonicated and centrifuged for 5 min

t 10,000 × g, and supernatant fractions were stored at −70 ◦C or used immediately.he total protein extracts were separated by sodium dodecyl sulfate-polyacrylamideel electrophoresis and transferred to nitrocellulose membranes. Target proteinsere probed with specific antibodies. The protein band, specifically bound to therimary antibody, was detected by the LI-COR membrane scan system, using IRDye®

s the secondary antibody.

273 (2010) 12–18 13

2.4. Gene expression analysis

Total RNA was extracted with Trizol reagent (Invitrogen) according to the man-ufacturer’s introduction. All extracted total RNA samples were degraded with DNaseI (Invitrogen) to avoid DNA contamination. cDNAs were generated by reverse-transcription with the Script IIITM RT-PCR system (Invitrogen). Primers sequencesfor select genes were obtained from http://pga.mgh.harvard.edu/primerbank/ andwere synthesized by Invitrogen (listed in Table 1). The SYBR green supermix (Bio-Rad Laboratories) was used for real-time polymerase chain reaction analysis. Therelative difference in expression between groups was expressed using cycle time(Ct) values as follows: the Ct values of the genes of interest were first normalized tothe values obtained for �-actin in the same sample, and then the relative transcriptlevels were expressed as a proportion of the control.

2.5. Fluorescence microscopy analysis

Cells were seeded in multi-well slides at a density of 2 × 104 cells per well ingrowth medium. When the cells reached 80% confluence, they were treated with200 nM arsenite for 48 h. Next, the slides were rinsed with cold PBS, the cells werefixed with ice-cold methanol for 10 min at 4 ◦C, and finally, the cells were permeabi-lized with 0.3% Triton X-100 in PBS for 3 min. After washing with PBS, each slide wasblocked with 5% bovine serum albumin (BSA) in Triton X-100/PBS for 1 h. The slideswere then probed overnight at 4 ◦C with appropriate antibodies diluted with TritonX-100/PBS. After probing, the slides were incubated for 90 min at room temperaturewith Alexa Fluor 594 goat anti-rabbit (Invitrogen). Nuclei were stained using DAPI.

2.6. Small RNA interference

Human NF-�B2 mRNA target sequences were purchased from Sigma.The NF-�B2 mRNA target sequences were 5′CUGUCAAGAUCUGUAACUA3′ ,5′GCAUCAAACCUGAAGAUUU3′ and 5′CUAUUACCCUCUGGUGGAA3′ . The resultingsiRNAs were transfected into BEAS-2B cells using Lipofectamine 2000 reagent at aconcentration of 200 pmol per well in a 6-well plate. Transfected cells were grownat 37 ◦C in 5% CO2, and then the cells were treated with arsenite for the indicatedtime points and harvested for western blot analysis.

2.7. Immunoprecipitation analysis

Nuclear extracts were prepared using the Qproteome Cell Compartment Kit(Qiagen) according to the manufacturer’s protocol. For immunoprecipitation usinganti-Bcl3 antibodies, the nuclear extracts were diluted with IP buffer at a final con-centration of 20 mM HEPES, pH 7.9, 5% glycerol, 100 mM NaCl, 0.5% Nonidet P-40,and 1× protease inhibitor mix. This diluted nuclear extract was mixed with pre-incubated Dynabeads (Invitrogen) with anti-Bcl3 antibodies for 1 h at 4 ◦C. Aftermixing, the beads were washed with PBS. The beads–Ig–protein complex was resus-pended in 0.1 M citrated buffer (pH 2–3) for 2 min, and then the supernatants weretransferred and adjusted to pH 7.5 by adding 1 M Tris. Finally, the proteins wereseparated by 12% polyacrylamide gel electrophoresis and immunoblotted with ananti-p100/52 antibody.

2.8. ChIP assay

After exposure to the indicated concentrations of arsenic, cells were washed andfixed with 1% formaldehyde at room temperature for 10 min and the reaction wasstopped by 125 mM glycine for 5 min. Cells were washed with 1 ml ice-cold PBS,harvested into a tube, centrifuged, resuspended in 0.5 ml lysis buffer and sonicated.Immunoprecipitation was performed overnight with anti-p52 antibodies. Next, DNAisolation and purification was conducted. For PCR, 10 �l isolated DNA was used for40 cycles of amplification. The primers used were described previously (Schumm etal., 2006).

2.9. Statistical analysis

Statistical analysis for gene expression and the cytotoxicity assay were per-formed using the ANOVA or the t-test in GraphPad PRISM (GraphPad Software). Weconsidered p values less than 0.05 as statistically significant.

3. Results

3.1. Low concentration of arsenite exposure enhances BEAS-2Bcell growth

A large body of studies has documented the cytotoxic effects

of arsenite on various mammalian cells lines. To better understandhow normal human bronchial cells in response to arsenite, culturedBEAS-2B cells were exposed to various concentrations of arsenite.After various exposure durations, the MTT assay was used to char-acterize cell survival. We found a significant increase (p < 0.05) in

14 F. Wang et al. / Toxicology 273 (2010) 12–18

Table 1Primer sequences for real-time reverse transcriptase polymerase chain reaction analysis.

Gene name Accession number Forward Reverse

GGGTGCCGCTGCATG

c(ts3wrset(pa

3c

dgtswttcdl

F2mc

NF-�B2 (p100) NM 002502NF-�B1 (p105) NM 003998Cyclin D1 NM 053056�-Actin NM 001101

ell survival (146.3%) after exposure to 200 nM arsenite for 48 hFig. 1A). The data showed that cell viability increased in responseo low concentration arsenite (<2 �M). However, with a 48 h expo-ure to higher concentration (20 �M), cell viability was reduced to0.8% (Fig. 1A). The relative protein and mRNA levels of cyclin D1ere also determined by protein expression assays and RT-PCR,

espectively. To investigate the relative mRNA and protein expres-ion, total mRNAs and proteins were extracted following a 48 hxposure to various concentrations of arsenite and analyzed byhe immunoblot assay and RT-PCR. In BEAS-2B cells, mRNA levelsFig. 1B) and protein levels (Fig. 1C) of cyclin D1, which is a cell cycleromoter, increased when cells were exposed to low concentrationrsenite.

.2. Activation of the non-canonical NF-�B pathway in BEAS-2Bells in response to low concentration arsenite

It is well-known that the NF-�B pathway is involved in theevelopment of many pathologies, including pathological cellrowth. To characterize the effects of low concentration arsenite onhe NF-�B pathways in BEAS-2B cells, the activation status of theubunits of both the canonical and non-canonical NF-�B pathwaysere determined after cells were exposed to various concentra-

ions of arsenite for 48 h. Our data showed that arsenite inducedhe activation of the non-canonical NF-�B pathway in BEAS-2Bells. NF-�B2 (p100/52) was up-regulated in a dose- and time-ependent manner in response to the low concentration exposure

evels (Fig. 2A and D). Moreover, Bcl3 was also increased (Fig. 2A and

ig. 1. Low concentration arsenite enhanced BEAS-2B cell growth. (A) Cells were expo4 h and 48 h). Cells viability was measured using MTT. (B) After treatment with the indRNA levels were analyzed by RT-PCR. (C) Total protein was isolated after treatment, and

ompared to the control (p < 0.05).

CAGACCAGTGTCATTGAG CCATGCCGATCCAGCAGAGAACAGATGGCCCATAC TGTTCTTTTCACTAGAGGCACCAGAGCCCGTGAAAAAGA CTCCGCCTCTGGCATTTTGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

D), which is known as an NF-�B2 transcriptional activator (Rocha etal., 2003). The effects of low concentration arsenite on p100 mRNAlevels were also analyzed using RT-PCR. The relative p100 mRNAlevel increased by exposure of cells to 2 �M arsenite comparedwith non-arsenite treated samples (Fig. 2C). In addition, the relativep100 mRNA level also increased by exposure to 200 nM arsenite ina time-dependent manner (Fig. 2F).

Compared to the non-canonical NF-�B pathway in responseto low concentration arsenite, the different effects were observedfor the canonical NF-�B pathway. After treatment with low con-centration arsenite (<200 nM), no significant protein expressionchange was observed in subunits of the canonical pathway, includ-ing p105/50 and p65 (Fig. 2E and F). Moreover, p105/50 and p65protein (Fig. 2B) and mRNA levels (Fig. 2C) were down-regulatedafter exposure to 2 �M arsenite.

3.3. Low concentration of sodium arsenite promotestranslocation of p52 and Bcl3 into the nucleus

It is well-known that p52 is a nuclear factor that can regulatethe expression of many genes in the nucleus. The precursor, p100,is degraded to p52, and then p52 translocates into the nucleus and

eventually regulates the expression of numerous genes (Park etal., 2006). In this study, the effects of low concentration of sodiumarsenite on the localization of NF-�B2 (p52) and Bcl3 were studiedusing immunofluorescent microscopy analysis. The localization ofp52 and Bcl3 in BEAS-2B cells was affected by 200 nM arsenite. p52

sed to the indicated concentrations of sodium arsenite for different periods (0 h,icated concentrations of arsenite, total RNA was extracted, and relative cyclin D1protein expression was analyzed by immunoblot assay. *A significant fold change

F. Wang et al. / Toxicology 273 (2010) 12–18 15

Fig. 2. The effects of low concentration arsenite on the NF-�B pathways in BEAS-2B cells. (A and B) Cells were treated with the indicated arsenite concentrations for 48 h.Total protein was extracted, and protein expression was assessed by immunoblot assay. (C) After treatment with 2 �M arsenite for 48 h, relative p100 and p105 mRNA levelswere measured by RT-PCR. (D and E) Cells were exposed to 200 nM arsenite for the indicated durations, and relative protein expression was analyzed by immunoblot assay.(F) Cells were exposed to 200 nM arsenite for 48 h, and relative p100 and p105 mRNA levels were measured by RT-PCR. *A significant fold change compared to the control(p < 0.05).

Fig. 3. p52 and Bcl3 translocations after exposure to low concentration sodium arsenite were detected by fluorescence microscopy analysis. (A) p52 translocation in responseto exposure to 200 nM arsenite was observed by fluorescence microscopy. (B) Bcl3 translocation in response to exposure to 200 nM arsenite was observed by fluorescencemicroscopy.

16 F. Wang et al. / Toxicology 273 (2010) 12–18

Fig. 4. The non-canonical NF-�B pathway regulates cyclin D1 up-regulation and growth of BEAS-2B cells in response to low concentration arsenite exposure. (A) Cells werepretreated with the NF-�B pathway inhibitor-CAPE and were then exposed to the indicated concentrations of arsenite for 48 h. Relative protein expression was analyzed byi quenb 52 ani ter by

a(b

3m

mOlngewwritow

mmunoblot assay. (B and C) Cells were transfected with p100/52 mRNA targeted sey immunoblot assay. Cells viability was measured by MTT. (D) The formation of p

mmunoprecipitation. (E) ChIP assays were conducted for the cyclin D1 gene promo

nd Bcl3 translocated into the nucleus after exposure to arseniteFig. 3). This finding indicates that low concentration arsenic affectsoth the localization and protein levels of p52 and Bcl3.

.4. Low concentration of arsenite induces cell proliferationediated by the non-canonical NF-�B pathway in BEAS-2B cells

Previous studies have demonstrated that the cyclin D1 gene pro-oter is activated by the p52–Bcl3 complex (Rocha et al., 2003).ur data indicate that arsenite up-regulated cyclin D1 protein

evels and promoted the translocation of p52 and Bcl3 into theucleus. To identify the role of the non-canonical pathway in cellrowth and cyclin D1 induction after low concentration arsenitexposure, BEAS-2B cells were pretreated with the NF-�B path-ay inhibitor-CAPE, and NF-�B (p100/52) mRNA target sequencesere used. Pretreatment with 30 �M of CAPE inhibited p100/52 up-

egulation after exposure to both 200 nM and 2 �M, which resultedn impaired arsenite-induced cyclin D1 expression (Fig. 4A). To fur-her test the specific role of the non-canonical NF-�B pathwayn cyclin D1 expression and cell growth, cells were transfectedith siRNA to interfere with p100 mRNA target sequences. The

ces and then exposed to 200 nM arsenite. Relative protein expression was detectedd the Bcl3 complex in BEAS-2B cells exposed to 200 nM arsenite was analyzed byusing a p52-specific antibody.

interference led to impaired p100 expression, which resulted indecreased production of p52 and was followed by inhibition ofarsenite-induced cyclin D1 up-regulation (Fig. 4B). Furthermore,compared to the non-siRNA transfection group, cell viability wasalso reduced (Fig. 4C).

3.5. The p52/Bcl3 complex enhances cyclin D1 gene expressionthrough the gene promoter via its �B site

Bcl3, which functions as a p52 activator, is also a regulator of cellproliferation and tumorigenesis in vitro and in vivo (Massoumi etal., 2006). In this study, up-regulation and translocation of Bcl3 wasobserved after exposure to low concentration arsenite. To investi-gate the connection between Bcl3 and p52, immunoprecipitationwas conducted to analyze p52–Bcl3 complex formation. Forma-tion of the complex was enhanced by arsenite treatment (Fig. 4D).

Therefore, we concluded that the non-canonical NF-�B pathwaywas involved in BEAS-2B cell proliferation induced by low concen-tration arsenite.

To characterize the mechanism of low concentration arsenite-induced cell growth and cyclin D1 up-regulation mediated by the

cology

pepl

4

sfhecEscglgbeail(ou

ie(p02iba

eawufie

c(�Twdm(tIuNDswstduur

F. Wang et al. / Toxi

52–Bcl3 complex, ChIP assays were performed to analyze theffect of the complex in the nucleus. Our data suggested that the52–Bcl3 complex enhanced cyclin D1 expression via the �B site

ocated in the cyclin D1 gene promoter sequence (Fig. 4E).

. Discussion

The biological effects of arsenic compounds have been inten-ively studied. High-dose arsenic trioxide is currently being usedor the treatment of promyelomyctic leukemia in clinical practice;owever, as an inhalable carcinogen, it can cause cancer in min-rs (Cui et al., 2008). Another arsenic compound, sodium arsenite,an enter the body through contaminated food and drinking water.pidemiological evidence strongly supports the link between expo-ure to arsenic and human cancers in the lung, skin, bladder andolon. Therefore, although high-dose arsenic inhibits cancer cellrowth in patients suffering from cancers (Straub et al., 2007),ow-dose arsenic has no benefits in normal subjects. The carcino-enic effects of low concentration arsenic are of particular concernecause environmental exposure to arsenic is generally at low lev-ls. The previous maximum contamination limit (MCL) of arsenicnnounced by the Environmental Protection Agency (EPA) in drink-ng water was 50 ppb, which is about ∼0.7 �M. The MCL wasowered to 10 ppb (∼0.14 �M) in the new EPA guidelines in 2006EPA, 2001). However, we are still concerned about the effectsf arsenic exposure, even at low exposure levels, because of thenique biological properties of arsenic-containing compounds.

It has been reported that urine arsenic levels can reach ∼1 �Mn subjects exposed to arsenic-contaminated air, and in subjectsxposed to normal air, the urine arsenic level is about 0.5 �MHalatek et al., 2009). Furthermore, blood arsenic levels in peo-le drinking arsenic-contaminated water at a concentration of.02 �g/ml (∼0.27 �M) can reach 7.3 ng/ml (∼0.1 �M) (Pi et al.,000). Therefore, in addition to inhalation, the ingestion of arsen-

te is also an important mode of exposure to the airway epitheliumecause absorbed arsenic in the blood can reach the bronchial cellsnd may affect the survival of airway epithelial cells.

Our data indicated that low concentration arsenite significantlynhanced the growth of BEAS-2B cells. After exposure to 200 nMrsenite, which is modestly higher than the new MCL of arsenic inater, the mRNA and protein levels of a number of genes that reg-late cell growth changed in comparison to untreated cells. Thesendings suggest that the so-called safe dosage can result in aberrantxpression of certain relevant genes and proteins.

The NF-�B pathways are involved in a wide range of biologi-al processes, such as cell growth, inflammation and tumorigenesisDemchenko et al., 2010; Missiou et al., 2010; Sun et al., 2010). NF-B pathways are classified as either canonical or non-canonical.he canonical pathway is well-documented as a constitutive path-ay in tissues and organs (Gilmore, 2006). The more recentlyescribed non-canonical NF-�B pathway has important, althoughore restricted, roles in both normal and pathological processes

Bista et al., 2010; Xiao et al., 2006). Therefore, the deregula-ion of each NF-�B pathway could lead to a variety of disorders.n this study, after exposure to low concentration arsenite, thep-regulation of p100/52 and Bcl3 indicated that the alternativeF-�B pathway was activated by arsenite. The inhibition of cyclin1 expression by interference with NF-�B2 (p100) mRNA target

equences demonstrated that the non-canonical NF-�B2 pathwayas involved in the induction of cyclin D1 by arsenite; however, no

ignificant change was found in the canonical NF-�B pathway. Even

he canonical NF-�B pathway subunits (p105/50 and p65) wereown-regulated after treatment with 2 �M arsenite. Although thenderlying reason for the down-regulation of canonical NF-�B sub-nits remains unclear, our findings are consistent with previouseport (Mathas et al., 2003).

273 (2010) 12–18 17

Bcl3 is a putative oncogene that encodes for a protein belongingto the inhibitory �B-family (McKeithan et al., 1987). It is a criticalregulator of cell survival and proliferation. Increased Bcl3 expres-sion leads to increased cell survival, proliferation, and malignantpotential (Courtois and Gilmore, 2006; McKeithan et al., 1997).Moreover, Bcl3 functions as an activator of p52, which translocatesinto the nucleus to up-regulate cyclin D1 expression (Park et al.,2006). In our results, nuclear localization of the p52 and Bcl3 andNF-�B2 (p52)/Bcl3 complex formation was observed after exposureto 200 nM arsenite, which eventually induced the up-regulation ofcyclin D1 through the cyclin D1 promoter region via its �B site.

In summary, this study demonstrated non-canonical NF-�Bpathway activation in response to low concentration sodium arsen-ite, which manifested as the up-regulation and nuclear localizationof p52 and Bcl3 and eventually led to the up-regulation of cyclinD1. The safety of arsenic at this concentration is of particular con-cern because cyclin D1 is frequently over-expressed in many kindsof cancer cells and is involved in cancer development.

We used a human bronchial epithelial cell line (BEAS-2B) as amodel to test the toxic effects of a so-called safe dose of arsen-ite on normal epithelium. This knowledge may be used for riskassessment and targeted protection. As a normal epithelial modelexposed to low concentration arsenite, our findings will be morerelevant to assess the effect of low concentration arsenite on epithe-lial cells in the lung, bladder and other organs exposed to absorbedarsenic in bodily fluids such as serum and urine.

The up-regulation of cyclin D1 by low concentration arsenicmight be an important mechanism for the development and pro-gression of lung cancer. We believe that this tumorigenic pathwayactivated by arsenite is a new target for preventive and therapeuticinterventions.

Conflict of interest

None.

Acknowledgments

This work was supported by the Tulane University Cancer Centerand the Department of Environmental Health Science, School ofPublic Health and Tropical Medicine, Tulane University.

References

Andrew, A.S., Mason, R.A., Memoli, V., Duell, E.J., 2009. Arsenic activates EGFR path-way signaling in the lung. Toxicol. Sci. 109, 350–357.

Andrew, A.S., Warren, A.J., Barchowsky, A., Temple, K.A., Klei, L., Soucy, N.V., O’Hara,K.A., Hamilton, J.W., 2003. Genomic and proteomic profiling of responses to toxicmetals in human lung cells. Environ. Health Perspect. 111, 825–835.

Barre, B., Perkins, N.D., 2007. A cell cycle regulatory network controlling NF-kappaBsubunit activity and function. EMBO J. 26, 4841–4855.

Bernstam, L., Nriagu, J., 2000. Molecular aspects of arsenic stress. J. Toxicol. Environ.Health B: Crit. Rev. 3, 293–322.

Betticher, D.C., Heighway, J., Hasleton, P.S., Altermatt, H.J., Ryder, W.D., Cerny, T.,Thatcher, N., 1996. Prognostic significance of CCND1 (cyclin D1) overexpressionin primary resected non-small-cell lung cancer. Br. J. Cancer 73, 294–300.

Bista, P., Zeng, W., Ryan, S., Bailly, V., Browning, J., Lukashev, M.E., 2010. TRAF3 con-trols activation of the canonical and alternative NF{kappa}B by the lymphotoxinbeta receptor. J. Biol. Chem. 285, 12971–12978.

Bosch, F., Jares, P., Campo, E., Lopez-Guillermo, A., Piris, M.A., Villamor, N., Tassies, D.,Jaffe, E.S., Montserrat, E., Rozman, C., et al., 1994. PRAD-1/cyclin D1 gene over-expression in chronic lymphoproliferative disorders: a highly specific marker ofmantle cell lymphoma. Blood 84, 2726–2732.

Celik, I., Gallicchio, L., Boyd, K., Lam, T.K., Matanoski, G., Tao, X., Shiels, M., Hammond,E., Chen, L., Robinson, K.A., Caulfield, E., Herman, J.G., Guallar, E., Alberg, A.J., 2008.Arsenic in drinking water and lung cancer: a systematic review. Environ. Res.

108, 48–55.

Courtois, G., Gilmore, T.D., 2006. Mutations in the NF-kappaB signaling pathway:implications for human disease. Oncogene 25, 6831–6843.

Cui, X., Kobayashi, Y., Akashi, M., Okayasu, R., 2008. Metabolism and the para-doxical effects of arsenic: carcinogenesis and anticancer. Curr. Med. Chem. 15,2293–2304.

1 cology

D

E

G

G

G

G

G

H

I

K

L

L

M

M

M

M

M

N

8 F. Wang et al. / Toxi

emchenko, Y.N., Glebov, O.K., Zingone, A., Keats, J.J., Bergsagel, P.L., Kuehl, W.M.,2010. Classical and/or alternative NF{kappa}B pathway activation in multiplemyeloma. Blood.

PA, 2001. National Primary Drinking Water Regulations, Arsenic and Clarifica-tions to Compliance and New Source Contaminants Monitoring, vol. 66, pp.6975–7066.

autschi, O., Ratschiller, D., Gugger, M., Betticher, D.C., Heighway, J., 2007. Cyclin D1in non-small cell lung cancer: a key driver of malignant transformation. LungCancer 55, 1–14.

ilmore, T.D., 2006. Introduction to NF-kappaB: players, pathways, perspectives.Oncogene 25, 6680–6684.

ladden, A.B., Diehl, J.A., 2005. Location, location, location: the role of cyclin D1nuclear localization in cancer. J. Cell. Biochem. 96, 906–913.

ladden, A.B., Woolery, R., Aggarwal, P., Wasik, M.A., Diehl, J.A., 2006. Expressionof constitutively nuclear cyclin D1 in murine lymphocytes induces B-cell lym-phoma. Oncogene 25, 998–1007.

uha Mazumder, D.N., 2007. Arsenic and non-malignant lung disease. J. Environ. Sci.Health A: Tox. Hazard. Subst. Environ. Eng. 42, 1859–1867.

alatek, T., Sinczuk-Walczak, H., Rabieh, S., Wasowicz, W., 2009. Associationbetween occupational exposure to arsenic and neurological, respiratory andrenal effects. Toxicol. Appl. Pharmacol. 239, 193–199.

ARC, 2004. Some Drinking-Water Disinfectants and Contaminants, IncludingArsenic. World Health Organization/International Agency for Research on Can-cer Lyon, France.

im, J.K., Diehl, J.A., 2009. Nuclear cyclin D1: an oncogenic driver in human cancer.J. Cell. Physiol. 220, 292–296.

age, C.R., Nayak, A., Kim, C.H., 2006. Arsenic ecotoxicology and innate immunity.Integr. Comp. Biol. 46, 1040–1054.

iao, C.M., Shen, H.H., Chen, C.L., Hsu, L.I., Lin, T.L., Chen, S.C., Chen, C.J., 2009. Riskassessment of arsenic-induced internal cancer at long-term low dose exposure.J. Hazard. Mater. 165, 652–663.

assoumi, R., Chmielarska, K., Hennecke, K., Pfeifer, A., Fassler, R., 2006. Cyld inhibitstumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling. Cell125, 665–677.

athas, S., Lietz, A., Janz, M., Hinz, M., Jundt, F., Scheidereit, C., Bommert, K., Dorken,B., 2003. Inhibition of NF-kappaB essentially contributes to arsenic-inducedapoptosis. Blood 102, 1028–1034.

cKeithan, T.W., Rowley, J.D., Shows, T.B., Diaz, M.O., 1987. Cloning of the chromo-some translocation breakpoint junction of the t(14;19) in chronic lymphocyticleukemia. Proc. Natl. Acad. Sci. U.S.A. 84, 9257–9260.

cKeithan, T.W., Takimoto, G.S., Ohno, H., Bjorling, V.S., Morgan, R., Hecht, B.K.,Dube, I., Sandberg, A.A., Rowley, J.D., 1997. BCL3 rearrangements and t(14;19) inchronic lymphocytic leukemia and other B-cell malignancies: a molecular andcytogenetic study. Genes Chromosomes Cancer 20, 64–72.

issiou, A., Wolf, D., Platzer, I., Ernst, S., Walter, C., Rudolf, P., Zirlik, K.M., Kostlin,

N., Willecke, F.K., Munkel, C., Schonbeck, U., Libby, P., Bode, C., Varo, N., Zir-lik, A., 2010. CD40L induces inflammation and adipogenesis in adipose cells—apotential link between metabolic and cardiovascular disease. Thromb. Haemost.,103.

adiminty, N., Chun, J.Y., Lou, W., Lin, X., Gao, A.C., 2008. NF-kappaB2/p52 enhancesandrogen-independent growth of human LNCaP cells via protection from apop-

273 (2010) 12–18

totic cell death and cell cycle arrest induced by androgen-deprivation. Prostate68, 1725–1733.

Ouyang, W., Li, J., Ma, Q., Huang, C., 2006. Essential roles of PI-3K/Akt/IKKbeta/NFkappaB pathway in cyclin D1 induction by arsenite inJB6 Cl41 cells. Carcinogenesis 27, 864–873.

Park, S.G., Chung, C., Kang, H., Kim, J.Y., Jung, G., 2006. Up-regulation of cyclin D1by HBx is mediated by NF-kappaB2/BCL3 complex through kappaB site of cyclinD1 promoter. J. Biol. Chem. 281, 31770–31777.

Pedlar, R.M., Ptashynski, M.D., Evans, R., Klaverkamp, J.F., 2002. Toxicological effectsof dietary arsenic exposure in lake whitefish (Coregonus clupeaformis). Aquat.Toxicol. 57, 167–189.

Peer, D., Park, E.J., Morishita, Y., Carman, C.V., Shimaoka, M., 2008. Systemicleukocyte-directed siRNA delivery revealing cyclin D1 as an anti-inflammatorytarget. Science 319, 627–630.

Pi, J., Kumagai, Y., Sun, G., Yamauchi, H., Yoshida, T., Iso, H., Endo, A., Yu, L., Yuki, K.,Miyauchi, T., Shimojo, N., 2000. Decreased serum concentrations of nitric oxidemetabolites among Chinese in an endemic area of chronic arsenic poisoning ininner Mongolia. Free Radic. Biol. Med. 28, 1137–1142.

Rocha, S., Martin, A.M., Meek, D.W., Perkins, N.D., 2003. p53 represses cyclin D1 tran-scription through down regulation of Bcl-3 and inducing increased associationof the p52 NF-kappaB subunit with histone deacetylase 1. Mol. Cell. Biol. 23,4713–4727.

Sandur, S.K., Deorukhkar, A., Pandey, M.K., Pabon, A.M., Shentu, S., Guha, S., Aggarwal,B.B., Krishnan, S., 2009. Curcumin modulates the radiosensitivity of colorectalcancer cells by suppressing constitutive and inducible NF-kappaB activity. Int.J. Radiat. Oncol. Biol. Phys. 75, 534–542.

Schumm, K., Rocha, S., Caamano, J., Perkins, N.D., 2006. Regulation of p53 tumoursuppressor target gene expression by the p52 NF-kappaB subunit. EMBO J. 25,4820–4832.

Soucy, N.V., Ihnat, M.A., Kamat, C.D., Hess, L., Post, M.J., Klei, L.R., Clark, C., Bar-chowsky, A., 2003. Arsenic stimulates angiogenesis and tumorigenesis in vivo.Toxicol. Sci. 76, 271–279.

Straub, A.C., Stolz, D.B., Vin, H., Ross, M.A., Soucy, N.V., Klei, L.R., Barchowsky,A., 2007. Low level arsenic promotes progressive inflammatory angiogene-sis and liver blood vessel remodeling in mice. Toxicol. Appl. Pharmacol. 222,327–336.

Sun, H.Z., Yang, T.W., Zang, W.J., Wu, S.F., 2010. Dehydroepiandrosterone-inducedproliferation of prostatic epithelial cell is mediated by NFKB via PI3K/AKT sig-naling pathway. J. Endocrinol. 204, 311–318.

Vogt, B.L., Rossman, T.G., 2001. Effects of arsenite on p53, p21 and cyclin D expressionin normal human fibroblasts—a possible mechanism for arsenite’s comutagenic-ity. Mutat. Res. 478, 159–168.

Westerheide, S.D., Mayo, M.W., Anest, V., Hanson, J.L., Baldwin Jr., A.S., 2001. Theputative oncoprotein Bcl-3 induces cyclin D1 to stimulate G(1) transition. Mol.Cell. Biol. 21, 8428–8436.

Xiao, G., Rabson, A.B., Young, W., Qing, G., Qu, Z., 2006. Alternative pathways ofNF-kappaB activation: a double-edged sword in health and disease. CytokineGrowth Factor Rev. 17, 281–293.

Zhang, D., Li, J., Gao, J., Huang, C., 2009. c-Jun/AP-1 pathway-mediated cyclin D1expression participates in low dose arsenite-induced transformation in mouseepidermal JB6 Cl41 cells. Toxicol. Appl. Pharmacol. 235, 18–24.