Overexpression of PgDREB2A transcription factor enhancesabiotic stress tolerance and activates downstreamstress-responsive genes

Parinita Agarwal • Pradeep K. Agarwal •

Arvind J. Joshi • Sudhir K. Sopory •

Malireddy K. Reddy

Received: 27 August 2009 / Accepted: 2 October 2009 / Published online: 14 October 2009

� Springer Science+Business Media B.V. 2009

Abstract The DREB transcription factors comprise

conserved ERF/AP2 DNA-binding domain, bind specifi-

cally to DRE/CRT motif and regulate abiotic stress medi-

ated gene expression. In this study we show that

PgDREB2A from Pennisetum glaucum is a powerful

transcription factor to engineer multiple stress tolerance in

tobacco plants. The PgDREB2A protein lacks any potential

PEST sequence, which is known to act as a signal peptide

for protein degradation. Therefore, the transgenic tobacco

plants were raised using full-length cDNA without modi-

fication. The transgenics exhibited enhanced tolerance to

both hyperionic and hyperosmotic stresses. At lower con-

centration of NaCl and mannitol, seed germination and

seedling growth was similar in WT and transgenic, how-

ever at higher concentration germination in WT decreased

significantly. D15 and D46 lines showed 4-fold higher

germination percent at 200 mM NaCl. At 400 mM man-

nitol seed germination in WT was completely arrested,

whereas in transgenic line it was more than 50%. Seedlings

of D15 and D46 lines showed better growth like leaf area,

root number, root length and fresh weight compared to wild

type for both the stresses. The quantitative Real time PCR

of transgenic showed higher expression of downstream

genes NtERD10B, HSP70-3, Hsp18p, PLC3, AP2 domain

TF, THT1, LTP1 and heat shock (NtHSF2) and pathogen-

regulated (NtERF5) factors with different stress treatments.

Keywords Abiotic stress � Pennisetum glaucum �PgDREB2A � Transcription factor � Transgenics

Introduction

To meet the increasing demands for plant-based agricul-

tural commodities it would be imperative to enhance pro-

ductivity of land in current use, expand agriculture to

marginal lands and redesigning of crops to cope up with

abiotic stress. Plants being sessile are strongly influenced

by abiotic stress such as high salt, drought and freezing.

Drought, salinity and extreme temperatures are the major

problems for agriculture because they prevent plants from

exploiting their full genetic potential. These factors cause

metabolic toxicity, membrane disorganization, closure of

stomata, decreased photosynthetic activity, generation of

reactive oxygen species (ROS) and altered nutrient acqui-

sition [1]. It is well established that tolerance to abiotic

stresses is mediated by a number of biochemical reactions

and physiological processes, which essentially means that

it is a multigenic trait. A number of genes and their

products respond to stresses at transcriptional and transla-

tional level. Enhancing abiotic stress tolerance potential by

activating a stress-response signal transduction pathway in

transgenic plants is a promissory approach [2]. The

manipulation of a transcription factor can control a broad

range of downstream events; therefore can combat abiotic

P. Agarwal (&) � P. K. Agarwal � S. K. Sopory �M. K. Reddy (&)

International Centre for Genetic Engineering and Biotechnology,

Aruna Asaf Ali Road, New Delhi 110 067, India

e-mail: Parinita.a@rediffmail.com

M. K. Reddy

e-mail: reddy@icgeb.res.in

P. Agarwal � A. J. Joshi

Department of Life Science, Bhavnagar University,

Bhavnagar 364 002, India

Present Address:P. K. Agarwal

Central Salt and Marine Chemicals Research Institute (Council

of Scientific and Industrial Research), Bhavnagar 364 002, India

123

Mol Biol Rep (2010) 37:1125–1135

DOI 10.1007/s11033-009-9885-8

stress efficiently. To date, genome wide transcriptome

analysis has identified several transcription factors that are

induced or repressed by many environmental stresses [3].

Most of them belong to different transcription factor fam-

ilies like DREB, ERF, bZIP, MYB, Helix-Loop-Helix,

WRKY and NAC. There are reports in which increased

levels of tolerance has been achieved through the overex-

pression of a major transcription system regulating ABA-

independent gene expression in response to dehydration

involving DREB2-type proteins, and with cold stress

involving DREB1-type proteins. Both proteins show

binding to DRE/CRT cis-acting elements of rd29A pro-

moter of Arabidopsis [4–7]. Cross talk between dehydra-

tion and cold occurs at transcription level [8]. The

mechanism of gene activation of DREB1-type proteins has

been well studied [9, 10], however the activation mecha-

nism for DREB2 type has not been well elucidated.

A database search of Arabidopsis genome show the pres-

ence of eight DREB2 homologues, among them, DREB2A

and DREB2B are regarded to be major transcription factors

that function under drought and high salinity stress con-

ditions [11, 12]. The DREBs can be used to produce

transgenics with higher tolerance to drought, high salt, high

temperature and cold stress, however the end results are

highly dependent on the nature of promoter (stress-induced

promoters or constitutive promoters), host plants being

manipulated and presence of certain domains in the

sequence of the DREB gene regulating its biological

functions [5, 6, 13–16]. Although DREB1/CBF regulates

cold stress responsive gene expression and DREB2 tran-

scription factor drought-responsive gene expression, it is

interesting how DREB1 and DREB2 activate cold and

drought specific set of genes by binding to the same

dehydration responsive element (DRE/C-repeat element).

Recently, transcriptome studies in overexpression lines of

DREB2 and DREB1 transgenic plants have identified only

eight genes in common [5]. The promoter analysis and gel

mobility shift assay of the DREB2A and DREB1A up-

regulated genes show that the DREB2A and DREB1A

proteins have different binding specificities, genes down-

stream of DREB2A prefer ACCGAC to GCCGAC [5].

In our earlier work [17] we reported the cloning of an

important ABA-independent type transcription factor

PgDREB2A from Pennisetum glaucum, based on a fact

that genes from hardy plants could have evolved better

protection properties. PgDREB2A showed preferential

binding to ACCGAC element in dephosphorylated state. In

present study we show that overexpression of PgDREB2A

gene in tobacco leads to enhanced salinity and drought

stress tolerance.

Materials and methods

Construction of plant transformation vector and tobacco

transformation

The ORF of PgDREB2A cDNA (NCBI accession no.

AY829439) was PCR amplified using forward 50-CCGCT

CGAGATGCAGTCCTTGACTGATGG-30 and reverse 50-TGCTCTAGACAGTTCCCTGACTACAGGC-30 primers

with the flanking restriction sites Xho1, Xba1, respectively.

The digested PgDREB2A gene was cloned as an XhoI/

XbaI fragment in pRT101 vector [18]. There after the

entire cassette with CAMV 35S constitutive promoter,

PgDREB2A gene and terminator was cloned in pCAM-

BIA1301 at the HindIII site and mobilized into the Agro-

bacterium strain GGV3301. The Agrobacterium cells

containing the plasmid (Fig. 1a) were used to transform in

tobacco (Nicotiana tabacum cv. Xanthi) plants using a

CaMV35S Nos Poly A

XhoI XbaI

Hind IIIHind III

PgDREB2A

LB RB

CaMV35S Hygromycin

Poly A

CaMV35S

Lac z alpha

MCS GUS gene

Poly A

soNsoN

M WT D1 D5 D15 D16 D20 D24 D32 D33 D43 D46

1 Kb

D46 D43 D16 D15 D1 WT

A

B C

Fig. 1 a A diagrammatic

representation of pCAMBIA

1301 plant transformation

vector used for transforming

tobacco leaf explants. The

vector is harboring the

CaMV35S promoter,

PgDREB2A gene and poly A

cassette in HindIII cloning site.

The pCAMBIA 1301 vector

contains hygromycin gene for

transformation selection and

GUS as a reporter gene. b PCR

of the genomic DNA of wild

type and transgenics. c Northern

analysis of wild type and

transgenics (D1, D15, D16, D43

and D46)

1126 Mol Biol Rep (2010) 37:1125–1135

123

standard protocol [19]. The putative transgenic plants

regenerated directly from leaf edges in the presence of

hygromycin (20 mg/l) were transferred on MS [20] basal

medium with hygromycin (20 mg/l) in jam bottles. The

transgenics were screened by GUS assay, PCR and

Northern blotting analysis. The seeds from these plants (T1

seeds) were further germinated on hygromycin containing

MS medium to study transgenic T1 seedlings.

Histochemical GUS staining

Putative transgenic plants were screened histochemically

by GUS analysis [21]. Leaves from control and transgenic

plants were cut to 1 cm 9 1 cm size and rinsed in 50 mM

phosphate buffer, pH 7.0. Leaf sections were incubated

with 1 mM 4-methyl-umbelliferyl-b-D-glucuronide pre-

pared in 50 mM of phosphate buffer, vacuum infiltrated for

10 min and incubated overnight at 37�C in dark. The tissue

was rinsed with 80% ethanol for 4 h to remove chlorophyll.

Genomic DNA extraction and PCR analysis

Genomic DNA was isolated from different T0 lines using

CTAB (N-acetyl-N,N,N-trimethylammonium bromide)

method [22]. The PCR was conducted to confirm the

presence of gene using same primers used for cloning of

PgDREB2A cDNA in plant transformation vector.

Northern blotting analysis

Total RNA was isolated from wild type and transgenic

plants employing the guanidium isothiocyanate method

[23]. Approximately 20 lg of total RNA was resolved on

1% formaldehyde agarose gel and transferred to positively

charged Hybond N membrane (Amersham, USA). The full

length PgDREB2A probe was labelled using [a 32P] dCTP

in a standard nick-translation labeling reaction (Invitrogen,

USA). Hybridization, post hybridization was carried out as

described earlier [24]. The blots were autoradiographed.

Plant stress treatments

To analyze the stress tolerance of PgDREB2A over-

expressing tobacco plants, the seeds from T0 transgenic

plants were germinated on MS medium supplemented with

0, 50, 100, 200, 300 mM NaCl and 200 and 400 mM

mannitol under culture room conditions. The percent ger-

mination was scored 15 days after seed inoculation.

T1 seedlings were also tested for growth on different

NaCl and mannitol concentration. The 8-day-old wild type

(WT) and hygromycin (20 mg/l) resistant T1 seedlings

were transferred to MS medium supplemented with 0, 100,

200, 300 mM NaCl and 200 and 400 mM mannitol.

Different growth parameters like percent survival, root

length, number of roots, leaf surface area and fresh weight

of seedlings were scored after 30 days of growth.

The one-month-old wild type (WT) and hygromycin

positive T1 seedlings were maintained and allowed to grow

in beakers with � MS hydroponic culture for 45 days prior

to apply different stress treatments. Tissue was then sam-

pled for real time quantitative RT-PCR analysis. The dif-

ferent stress treatments were given for the period of 6 h

because in our earlier observation the PgDREB2A tran-

script gets expressed at 6 h [17]. The different stress

treatments were as follows: Cold treatment: the seedlings

were exposed to 4�C for 6 h; Drought stress: the roots were

slightly blotted with tissue paper and seedlings were kept

wrapped in dry tissue paper for 6 h; Heat stress: the

seedlings were exposed to 42�C for 6 h; Salt treatment:

seedlings were transferred to 250 mM NaCl solution for

6 h. A set of seedlings was maintained under control

conditions. After 6 h of each treatment, the tissues were

snap frozen and used for RNA extraction.

Quantitative real time PCR

The Real time quantitative RT-PCR amplification of

selected genes was performed with specific oligonucleo-

tides primers (Table 1) using the first strand cDNA, syn-

thesized from RNA samples collected from WT and

transgenic tobacco seedlings exposed to different stress

treatments and from their corresponding control seedlings.

DNase treatment was given for removing contaminating

genomic DNA from RNA samples. The PCR reactions (19

PCR buffer, 200 lm dNTPs, 150 ng of each gene specific

primer, 5 U Taq Polymerase and 19 SYBR-GreenR using

Icycler (BioRad, USA) were carried out at 94�C for 1 min,

55�C for 1 min and 72�C for 1 min for 30 cycles. At the

end of the PCR cycles, the products were analysed through

a meltcurve analysis to check the specificity of PCR

amplification. Two replicates of each reaction were per-

formed, and data were analyzed by Livak method [25] and

expressed as normalized expression ratio (2-DDCT) of

particular gene to specific stress treatment. Expression ratio

was calculated as DDCT = DCT (gene) - DCT (b-tubulin);

DCT (gene) = DCT (transgenic line) - DCT (wild type

plant); DCT (b-tubulin) = DCT (transgenic line) - DCT

(wild type plant).

Determination of ion content in plants

Leaves from three-month-old transgenic and wild type

plants, grown in vitro on MS basal alone and MS medium

supplemented with 200 mM NaCl, were collected and

rinsed briefly in de-ionized water to reduce surface con-

tamination. The tissues were dried in oven at 80�C for 24 h

Mol Biol Rep (2010) 37:1125–1135 1127

123

followed by digestion in 3:1 HNO3 and HClO4 (v/v)

solution. Samples were completely dried on the hot plate

and suitably diluted prior to measurement of ion concen-

tration by Flame photometer.

Statistical analysis

Data of 10 plants of WT and T1 transgenic lines for each

experiment were collected. Each experiment was repeated

three times and the mean values and standard deviations

were calculated. For NaCl and mannitol tolerance assays

two factor ANOVA was carried out using Microsoft Excel.

The CD values were calculated at P = 0.05 level to find

the significant difference between the means over different

lines. The mean values significantly different with each

other are labeled with different alphabets.

Results

Confirmation of putative T0 transgenic plants

The putative transgenic lines selected on hygromycin

containing medium were confirmed by GUS analysis.

Among the 35 lines analyzed, 20 lines were found GUS

positive. Some plants showed proper blue colour in tested

leaves while in others the scattered blue spots were seen.

The GUS positive plants were subsequently transferred to

pots containing vermiculite for hardening and finally

transferred to earthen pots with garden soil.

The GUS positive transgenic lines were confirmed by

PCR using gene specific primers for the PgDREB2A gene.

Ten transgenic lines showed single product of expected

size of 1000 bp (Fig. 1b). Northern blot analysis of five T0

transgenic lines was carried out to confirm the mRNA level

in transgenics and WT plants. A single band was observed in

all the transgenic lines (D1, D15, D16, D43 and D46) but the

corresponding band was missing in the WT plants (Fig. 1c),

probably due to use of heterologous probe. The presence of a

single transcript indicated that transcription initiation and

termination of PgDREB2A mRNA occurred as expected.

Seeds from the T0 plants were studied for Mendelian

principle of segregation. Seeds from the T0 plants (D1, D15

and D46) when germinated on hygromycin-containing

medium segregated in 3:1 ratio of Hygr/Hygrs (Table 2).

The transgenic plants (T0) showed no morphological

difference in the vegetative and floral tissues, as compared

to WT (wild-type) plants. Seed set in WT and transgenic

plants was also similar. Further, T1 transgenic progeny was

studied to establish the stress tolerance potential of tobacco

transgenics overexpressing PgDREB2A. Several important

growth parameters such as root length, number of roots,

leaf surface area and fresh weight of seedlings was mea-

sured as an indicator of salinity and dehydration tolerance

because changes in root and shoot growth are of potential

importance in increasing stress tolerance.

Table 1 List of selected genes studied by real time PCR assay for showing their upregulation in tobacco transgenics

S. no GeneName/accession no. Primer sequence (50 ? 30) Function

1 NtERD10B/AB049336 ACGGACGAATACGGCAATC Dehydrin

TCTCCTTAATCTTCTCCTTCATCC

2 NtERF5/AY655738 TGGTCAAGAATTAGAAGAGGTAAC Ethylene responsive transcription factor

ACAGCAGCAGGAGACAATC

3 NtHSF2/AB014484 AGAGTTGGATGAATCTACAAGTTG Heat shock factor

CACTGTCTACTGGTTTGCTTTC

4 HSP70-3/AY372071 GGTCCAGGAAGCAGAGAAG Heat shock protein

GAGCATCATCATCCATAGGTG

5 Hsp18p/X70688 GGCTATGATTCCAAGTTTCTTTG Heat shock protein

CCACTGCTTCTTTCCATACG

6 PLC3/EFD43044 TTATGGGTGAAGGGTGGTATTATG Signal transduction

GGTCGTGTAGTGAAACTGCTC

7 AP2 domain TF/AJ299252 AATACAGAGGAATAAGGCAGAGAC Signal transduction

CTCAGCAGCGGGCATTTC

8 THT1/AJ131768 TAAAGCAAACCCTAATCCTCTC Stress elicitors

ATTCCTAACTTCCTATAACTCTCC

9 LTP1/AY562132 CATTGTTGGTGGTGGTGTG Lipid metabolism

TGGAAGGGCTAATCTTGTAGG

1128 Mol Biol Rep (2010) 37:1125–1135

123

Tobacco plants overexpressing PgDREB2A

show salinity tolerance

To study the effect of salt stress on germination, the WT

and T1 (D1, D15 and D46) seeds were germinated on MS

medium supplemented with 0, 50, 100, 200, 300 mM

NaCl. At 0 mM concentration the germination of wild type

and transgenic lines was similar, therefore the germination

data of 50–300 mM NaCl was scored. Under salt stress, the

transgenic seeds showed earlier germination as compared

to WT seeds. The percent of seed germination reduced with

increasing concentration of NaCl in both WT and trans-

genics (Fig. 2a–d). Among the transgenic lines studied,

D46 showed the highest percent of germination on 100 and

200 mM NaCl (Table 2). On 300 mM NaCl neither the

transgenics nor the WT showed germination till 15-day of

seed inoculation.

For testing the salinity tolerance, 8-day-old wild type

(WT) and hygromycin (20 mg/l) resistant T1 seedlings

(D15 and D46) were transferred to MS medium supple-

mented with 0, 100, 200, 300 mM NaCl and 200 and

400 mM mannitol. Some growth parameters such as

number of roots, length of roots, leaf area, fresh weight of

seedlings (Fig. 2e–l) and percentage survival (Table 3)

were measured after 30 days of growth. The root length in

both WT and transgenic seedlings reduced by 3-fold at

300 mM NaCl (Fig. 2e). The number of roots in WT

showed a 2-fold decrease, whereas in transgenics (D15 and

D46) only single fold reduction was observed (Fig 2j). The

fresh weight of WT seedlings showed a 5- fold decrease at

300 mM NaCl, while D15 and D46 showed 3.4 and 2.3

fold decrease, respectively.

Regeneration of wild type and transgenic plants

on 200 mM NaCl

To further confirm the tolerance of transgenic plants to

NaCl, regeneration potential of transgenic plants over-

expressing PgDREB2A gene was tested. Petioles of control

and transgenic lines were cultured on 200 mM NaCl sup-

plemented MS medium. After one-month petioles of D15

and D46 line showed proliferation of axillary shoots,

whereas in wild type no growth was observed (Fig. 2m–o).

Accumulation of Na? and K? content in transgenic

plants on 200 mM NaCl

A complete investigation of the effect of a particular

genetic change on the salt stress response should include

the quantification of ions in the plant tissue. Total Na? and

K? (Fig. 2p, q) levels were measured in transgenic and

wild type plants grown under saline (200 mM NaCl) and

normal conditions. The WT and T1 transgenic plants in MS

basal showed minimal Na? accumulation, because MS

basal does not contain sodium salt. After 3-months of

growth on 200 mM NaCl wild type and transgenics showed

approximately 10% Na? accumulation. The K? concen-

tration of wild type and D46 transgenic plants grown under

200 mM NaCl and normal conditions remained same,

however transgenic plants of D15 line showed 1.5 fold

higher concentration on NaCl supplemented medium.

PgDREB2A transgenics show dehydration tolerance

To analyze the effect of hyperosmotic stress on germina-

tion the T1 seeds (D1, D15 and D46) and WT were ger-

minated on MS basal medium and medium containing 200

and 400 mM mannitol. The percent seed germination was

scored after 15-day of inoculation. The transgenic seeds

started germination earlier as compared to WT seeds on

both the concentrations. At lower concentration of man-

nitol seed germination rate of transgenic was not very

different to WT, however the seedling growth and vigour

was quite better. D46 showed highest rate of germination

with both 200 and 400 mM mannitol (Table 2; Fig. 3a, b).

To study the dehydration tolerance of transgenic plants,

the hygromycin positive 8-day-old WT and T1 seedlings

were transferred to MS medium supplemented with

Table 2 Analysis of segregation ratio, percent germination of wild type (WT) and T0 transgenic seeds (D1, D15 and D46) on different

concentrations of NaCl and mannitol

Transgenic

lines

Segregation ratio

Hygr/HygrsGermination (%)

NaCl conc (mM) Mannitol conc (mM)

50 100 200 300 200 400

WT 80 65 15 – 65 –

D1 3.2:1 42 53 38 – 61 –

D15 2.5:1 88 61 57 – 84 50

D46 3:1 88 88 65 – 88 73

On MS basal medium the germination of WT and transgenic seeds was similar, Data was taken after 15 days of inoculation

Mol Biol Rep (2010) 37:1125–1135 1129

123

200 mM and 400 mM mannitol. The treatment caused

growth retardation in both WT and transgenic plants but the

effect was more pronounced in WT seedlings (Fig. 3c, d).

Some growth parameters such as number and length of roots,

leaf area, fresh weight of seedlings and percentage survival

was measured after 30 days of growth on mannitol medium.

The transgenic lines had longer and large number of roots,

greater leaf area and fresh weight of seedlings as compared

to WT plants (Fig. 3e–h). The WT and transgenics showed

an increase in the number of roots per seedling on 200 mM

mannitol, as compared to 0 mM mannitol, however at

400 mM the number of roots in WT decreased, whereas in

both the transgenics it was not significantly affected

(Fig. 3f). The transgenics showed better survival as com-

pared to the WT plants (Table 3), the WT plants started to

show yellowing soon after transfer and showed very slow

growth, however the transgenics showed appearance of new

green leaf approximately after one week of transfer.

FEA B

G HWT

D46

WTD1

D15 D46C D

J6

4

2

ab b b

c bf

de e

h

f c

120

80

40

0Roo

t len

gth

(mm

)I

a

b c

de e

f

gg

hi i

WT D15 D46

Num

ber

of r

oots

0

Lea

f ar

ea (

mm

2 ) 60

40

20

0

K

a

b cb

d

e

d

f

ga h

c

L

ab

c

d

eb

f f

gh

i

j

60

0

80

120

F.w

t / s

eedl

ing

(mg)

0 100 200 300

M ON

12Q6P

% K

+io

ns

4

8

MS NaCl0

% N

a+io

ns

2

4

0MS NaCl

0 100 200 300

0 100 200 3000 100 200 300

Fig. 2 Seed germination of

WT, D1, D15 and D46

transgenic lines on a 50 mM,

b 100 mM, c 200 mM and

d 300 mM NaCl. Comparison

of growth of WT and D46

seedlings on e 0 mM,

f 100 mM, g 200 mM and

h 300 mM NaCl. The graphs

represent the mean and SD over

three replicates for i root length,

j number of roots, k leaf surface

area, l fresh weight of seedlings.

The means with different

alphabets are significant at the

5% level. One-month-old

culture showing regeneration of

petiole explants from m wild

type, n D15 and o D46

transgenic plants on 200 mM

NaCl supplemented medium.

Endogenous ion content in wild

type and transgenic plants were

analyzed using flame

photometer. The graphs

represent percent of Na? ion

(p) and K? ion (q) in dry leaves

of WT and transgenic lines

(D15 and D46)

1130 Mol Biol Rep (2010) 37:1125–1135

123

Quantitative RT-PCR analysis of plants overexpressing

PgDREB2A

To understand the stress tolerance mechanism, transgenics

were studied for the expression of some stress target genes

like dehydrins, heat shock proteins, proteins involved in

signal transduction and biotic response, and tolerance in

two T1 transgenic lines (D15 and D46). The tobacco

homologue of the genes (from NCBI) which are reported to

be upregulated in transgenic Arabidopsis overexpressing

AtDREB2A [5, 6] were selected and primers were designed

(Table 1). The NtERD10B gene which encodes a 2 LEA

protein showed higher expression upon heat and salt stress

and to a lesser extent by dehydration and cold treatment

(Fig. 4a). In D46 the NtERF5 gene, which encodes the ERF

(ethylene response factor) family of transcription factors

showed highest expression with heat and dehydration stress

(Fig. 4b). The three genes encoding heat shock proteins

(NtHSF2, HSP70-3, Hsp18p) were induced not only by heat

stress but also by dehydration and salt stress (Fig. 4c–e).

Hsp18p shows heat induction in both the transgenic lines,

whereas HSP70-3 showed a very high expression only in

D15 transgenic line (Fig. 4d, e). The PLC3 an important

component of signal transduction showed temperature

sensitivity, with increased expression at both high and low

temperature in both the transgenic lines (Fig. 4f). The AP2

domain containing transcription factor showed maximum

induction with heat stress but was also upregulated by

dehydration, salt and cold stresses (Fig. 4g). The tyramine

hydroxycinnamoyltransferase (THT1) gene and lipid

transfer protein (LTP1) also showed enhanced expression

by stress treatments (Fig. 4h, i). In both the transgenic lines

(D15 and D46) all the genes except THT1 showed maxi-

mum expression with heat stress treatment, although

induction of all the genes was found by salt and dehydration

stress and to a further, lesser extent by cold stress also.

Discussion

Abiotic stress tolerance is a multigenic trait; therefore the

introduction of any single gene may not give sustained

tolerance to abiotic stresses [26, 27]. In this study we have

functionally validated the role of PgDREB2A in abiotic

Table 3 Analysis of percent survival of 8-day-old wild type (WT)

and T1 seedlings (D1, D15 and D46) on different concentrations of

NaCl and mannitol

Transgenic

lines

Survival (%)

NaCl conc (mM) Mannitol conc (mM)

0 100 200 300 200 400

WT 98 25 6 2 70 30

D1 98 65 26 12 71 52

D15 100 77 46 25 76 66

D46 100 88 55 38 87 68

Data was taken after 30 days of culture

A B

4

6

ab b d

bddF

DC

WTD15

D46 D1 Num

ber

of r

oots

2

0

c

25

20

15a (m

m2 )

bb

a ad

G

WT

D465

10

0

Lea

f ar

e

c

20

80

60

40 a

b

aa

c

b

HE80

60

40

20

aa

bc

da

WT D15 D46

d

F. w

t / s

eedl

ing

(mg)

0

c

Roo

t len

gth

(mm

)

200 4000

200 400

200 400

200 400

Fig. 3 Seed germination of WT

and transgenics on a 200 mM

and b 400 mM mannitol.

Growth comparison of 30-day-

old seedlings of WT and D46 on

c 200 mM and d 400 mM

mannitol. The graphs represent

the mean and SD over three

replicates for e root length

f number of roots g leaf surface

area h fresh weight of seedlings.

The means with different

alphabets are significant at the

5% level

Mol Biol Rep (2010) 37:1125–1135 1131

123

stress tolerance. PgDREB2A transcription factor has con-

served ERF/AP2 domain. It showed 71% similarity and

60% identity with AtDREB2A and 73% similarity and 63%

identity with OsDREB2A. Its constitutive overexpression in

tobacco confers both salinity and dehydration tolerance.

The constitutive overexpression of DREB1A in trans-

genic Arabidopsis induced strong expression of down-

stream stress-responsive genes under unstressed conditions,

enhancing freezing and dehydration tolerance [13]. How-

ever, constitutive overexpression of DREB2A in transgenic

Arabidopsis was not sufficient for induction of stress-

inducible genes, domain analyses of Arabidopsis DREB2A

gene revealed the presence of negative regulatory domain

in the central region (136–165 aa), deletion of this region

transforms DREB2A to a constitutive active form

(DREB2A CA, [5]). It is suggested that this region is an

inhibitory domain in the normal condition and is modified

under salt/drought stress. Using PEST find program, Sa-

kuma et al. [5], reports the presence of the PEST sequence

(RSDASEVTSTSSQSEVCTVETPGCV) in the negative

regulatory domain consisting of many phosphorylation

target sites for protein kinases such as PKC and CK2. The

PEST sequence acts as signal peptide for protein degra-

dation [28]. The phosphorylation of PEST sequence has

been reported to be important for protein degradation [29].

In contrast to Arabidopsis no PEST sequence was found in

PgDREB2A. Similarly in ZmDREB2A PEST sequence is

not reported, the negative regulatory domain is also absent

and moreover protein modification is not needed for

ZmDREB2A to be active [7].

Growth is often used as a parameter to assess tolerance,

as it is the endpoint of metabolic process. Tobacco plants

constitutively overexpressing PgDREB2A showed normal

seed set in T0 transgenics lines. There was no dwarf

character seen in the transgenics, and in overall growth

transgenics were similar to WT plants. Transgenics in T1

generation showed increased tolerance to dehydration

(mannitol) and salinity (NaCl) stress as indicated by ger-

mination and growth behavior. The increase in number of

roots in transgenics (D15 and D46) at 200 and 400 mM

mannitol is an adaptive feature to maximize water uptake,

and is of great importance to plants. The mannitol provides

direct dehydration, and salt conditions provide physiolog-

ical droughtness along with other cellular toxicity, thereby

inhibits plant growth. The regulation of ions is an indis-

pensable component of growth and adaptation. In plants the

balance of Na? and K? ions is important for salt tolerance.

Ionic measurements were studied in mature leaves of

transgenics as old leaves seem to function as ion sinks

keeping young leaves free from Na? ions load [30]. It is

reported that Na? is always higher in plant leaves (xylem

fed) than in fruits or seeds (phloem fed), thereby suggesting

that plants maintain lower Na? concentrations in the seeds

by controlling the transport of Na? [31, 32]. The

PgDREB2A transgenic lines did not show higher accumu-

lation of Na? compared to WT plants, this reflects that

PgDREB2A transcription factor does not activate ion

exchange antiporters, there is no report mentioning the

regulation of transporters by overexpression of DREB2A

transcription factor [5, 6].

A B C

1 2 3 4 5D15

1 2 3 4 5D46

810

2

6

0

4

NtERD10BA

10

2

68

5321 4D15

0

4

D4621 3 4 5

NtERF5B

810

2

6

0

4

D1521 3 4 5

D4621 3 4 5

NtHSF2C

D15 D46 D15 D46 D15 D46

810

2

6

0

4

HSP70-3D

810

2

6

0

4

Hsp18pE

810

2

6

0

4

PLC3F

0 1 2 3 4 5D15

1 2 3 4 5D46

0 1 2 3 4 5D46

1 2 3 4 5D15

1 2 3 4 5D46

1 2 3 4 5D15

0

810

2

64

AP2 TFG

810

2

64

THT1H

810

2

64

LTP1I

1 2 3 4 5D46

1 2 3 4 5D15

20

1 2 3 4 5D46

1 2 3 4 5D15

20

1 2 3 4 5D46

1 2 3 4 5D15

20

Fig. 4 Expression ratios of nine

genes upregulated in

PgDREB2A tobacco transgenics

(D15 and D46) by different

stress treatments as revealed by

quantitative RT-PCR analyses

(a–i). The figure on the X-axis

represent different stress

treatments given for a period of

6 h (1 [control conditions],

2 [drought], 3[salt], 4 [heat],

5 [cold]). The Y-axis represents

expression ratio compared with

wild type under corresponding

stress treatment

1132 Mol Biol Rep (2010) 37:1125–1135

123

Transgenic Arabidopsis overexpressing DREB2A CA

upregulated not only drought and salt stress-responsive

genes but also heat-shock related genes, resulting in sig-

nificant drought, salt as well as thermotolerance [5, 6].

Constitutive or stress-inducible expression of ZmDREB2A

improved stress tolerance to drought and heat. Microarray

analyses of transgenic Arabidopsis plants overexpressing

ZmDREB2A revealed upregulation of LEA, heat shock,

detoxification and seed maturation genes [7].

Transgenics overexpressing PgDREB2A showed upreg-

ulation of dehydrins, heat shock related genes, signal

transduction proteins, biotic stress related genes and lipid

transfer proteins. Dehydrins act as structural stabilizers

with suggested chaperone-like properties and protect vari-

ous nuclear and cytoplasmic macromolecules from coag-

ulation during dehydration [33]. The NtERD10B (dehydrin)

upregulated in PgDREB2A transgenics, also showed

increased expression under cold and drought stress in

tobacco transgenics overexpressing DREB1A gene of

Arabidopsis [34]. Among the 21 members of the Arabid-

opsis Hsf family, HsfA3 is the only Hsf that is transcrip-

tionally induced during heat shock by DREB2A, which in

turn regulates the expression of Hsp-encoding genes. Fur-

ther, more studies indicate that Hsp genes reported to be

DREB2A dependent are actually activated dominantly or

even exclusively via HsfA3 [35]. NtHSF2, closely related

to AtHsfA3 (67% similarity, 48% identity) shows

increased expression in PgDREB2A transgenics. HSPs

function as molecular chaperones and assist in protein

folding, assembly and transport, and targeting of damaged

proteins for proteolysis; thereby protecting the cells under

stress conditions. The Hsp18p and HSP70-3 show high

expression by heat, dehydration and salt stress in

PgDREB2A tobacco transgenics. Upregulation of NtERF5

gene suggests that PgDREB2A gene crosstalks with biotic

stress signal pathways. Earlier also, DREB2A was found to

crosstalk with adr1 (activated disease resistance1) acti-

vated signaling pathways [36]. The NtERF5 protein, binds

weakly to GCC box cis-elements, which mediate pathogen-

regulated transcription of several PR (pathogenesis related)

genes and NtERF5-overexpressing plants suppress TMV

proliferation, leading to enhanced viral resistance [37].

Hydroxycinnamic acids derived from phenylpropanoid

pathway occur as conjugates (amides) with sugar, cell wall

carbohydrates and organic acids, the formation of amides

serve a defensive purpose in solanaceous plants including

tobacco [38]. The synthesis of N-(hydroxycinnamoyl)-tyr-

amines is catalyzed by hydroxycinnamoyl-CoA:tyramine

hydroxycinnamoyltransferase (THT)1. THT was first dis-

covered in tobacco mosaic virus-inoculated tobacco leaves

[38] and has since been studied with regard to biotic and

abiotic elicitor- and stress-stimulated activity increases in

tobacco and other plants [39–41]. The LTP genes, encode

enzymes involved in lipid metabolism. LTPs are involved

in membrane biogenesis and the transport of phospholipids

[42, 43]. In addition, LTPs are induced in plant cells upon

exposure to biotic and abiotic stresses [44–46]. LTP1 gene

is also upregulated in tobacco transgenics overexpressing

ASR1 gene and showing increased salt tolerance [47].

In PgDREB2A transgenics all the nine genes showed

increased expression towards multiple stresses like heat,

salt and dehydration stress, however the expression under

cold stress was only faintly induced. Recently genomic

studies show considerable overlap of plant responses to

osmotic stresses like dehydration and salinity as there is a

greater crosstalk between salt and dehydration stress sig-

naling pathways as compared to salt and cold stresses

[48–52]. Transcriptome profiling studies of plants have

shown that there exist overlaps between transcripts during

drought or heat stress or a combination of drought and heat

stress [6, 35, 53].

In conclusion, functional analysis of PgDREB2A shows

that the gene without any modification enhances salt and

dehydration tolerance in tobacco transgenics and upregu-

lates downstream genes not only by osmotic stress but also

by heat stress treatments, highlighting its cross talk between

osmotic and heat stress responses. Thus, PgDREB2A is an

important transcription factor that can be used to confer

abiotic stress tolerance in plants.

Acknowledgements This work was supported by internal grants

from ICGEB, NATP (Indian Council and Agriculture Research, New

Delhi). P.A. is thankful to Council of Scientific and Industrial

Research (CSIR), New Delhi for SRF; and Bhavnagar University for

providing facilities.

References

1. Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant

cellular and molecular responses to high salinity. Ann Rev Plant

Physiol Plant Mol Biol 51:463–499

2. Cushman JC, Bohnert HJ (2000) Genomic approaches to plant

stress tolerance. Curr Opin Plant Biol 3:117–124

3. Chen WQJ, Zhu T (2004) Networks of transcription factors with

roles in environmental stress response. Trends Plant Sci 9:591–596

4. Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006) Role of

DREB transcription factors in abiotic and biotic stress tolerance

in plants. Plant Cell Rep 25:1263–1274

5. Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki

K, Yamaguchi-Shinozaki K (2006) Functional analysis of an

Arabidopsis transcription factor, DREB2A, involved in drought-

responsive gene expression. Plant Cell 18:1292–1309

6. Sakuma Y, Maruyama K, Qin F, Osakabe Y, Seki M, Shinozaki

K, Yamaguchi-Shinozaki K (2006) Dual function of an Arabid-opsis transcription factor DREB2A in water-stress-responsive and

heat-stress-responsive gene expression. Proc Natl Acad Sci USA

103:18828–18833

7. Qin F, Kakimoto M, Sakuma Y, Maruyama K, Osakabe Y, Tran

L-S P, Shinozaki K, Yamaguchi-Shinozaki K (2007) Regulation

and functional analysis of ZmDREB2A in response to drought and

heat stresses in Zea mays L. Plant J 50:54–69

Mol Biol Rep (2010) 37:1125–1135 1133

123

8. Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular

responses to dehydration and low temperature: differences and

cross-talk between two stress signaling pathways. Curr Opin

Plant Biol 3:217–223

9. Maruyama K, Sakuma Y, Kasuga M, Ito Y, Seki M, Goda H,

Shimada Y, Yoshida S, Shinozaki K, Yamaguchi-Shinozaki K

(2004) Identification of cold-inducible downstream genes of the

Arabidopsis DREB1A/CBF3 transcriptional factor using two

microarray systems. Plant J 38:982–993

10. Zhao TJ, Sun S, Liu Y, Liu JM, Liu Q, Yan YB, Zhou HM (2006)

Regulating the drought-responsive element (DRE)-mediated

signaling pathway by synergic functions of trans-active and trans-

inactive DRE binding factors in Brassica napus. J Biol Chem

281:10752–10759

11. Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S,

Shinozaki K, Yamaguchi-Shinozaki K (2000) Organization and

expression of two Arabidopsis DREB2 genes encoding DRE-

binding proteins involved in dehydration- and high-salinity-

responsive gene expression. Plant Mol Biol 42:657–665

12. Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamag-

uchi-Shinozaki K (2002) DNA-binding specificity of the ERF/

AP2 domain of Arabidopsis DREB’s transcription factors

involved in dehydration- and cold inducible gene expression.

Biochem Biophys Res Commun 290:998–1009

13. Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-

Shinozaki K, Shinozaki K (1998) Two transcription factors,

DREB1 and DREB2, with an EREBP/AP2 DNA binding domain

separate two cellular signal transduction pathways in drought-

and low-temperature-responsive gene expression, respectively, in

Arabidopsis. Plant Cell 10:1391–1406

14. Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki

K (1999) Improving plant drought, salt, and freezing tolerance by

gene transfer of a single stress-inducible transcription factor. Nat

Biotechnol 17:287–291

15. Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura

S, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003)

OsDREB genes in rice, Oryza sativa L., encode transcription

activators that function in drought-, high-salt- and cold-respon-

sive gene expression. Plant J 33:751–763

16. Chen M, Wang Q-Y, Cheng X-G, Xu Z-S, Li L-C, Ye X-G,

Xia L-Q, Ma Y–Z (2007) GmDREB2, a soybean DRE-binding

transcription factor, conferred drought and high-salt tolerance

in transgenic plants. Biochem Biophys Res Commun 353:

299–305

17. Agarwal P, Agarwal PK, Nair S, Sopory SK, Reddy MK (2007)

Stress inducible DREB2A transcription factor from Pennisetumglaucum is a phosphoprotein and phosphorylation negatively

regulates its DNA binding activity. Mol Genet Genomics

277:189–198

18. Topfer R, Matzeit V, Gronenborn B, Schell J, Steinbiss H–H

(1987) A set of plant expression vectors for transcriptional and

translational fusions. Nucl Acids Res 15:5890

19. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG,

Farley RT (1985) A simple and general method for transferring

genes into plants. Science 227:1229–1231

20. Murashige T, Skoog F (1962) A revised medium for rapid growth

and bioassays with tobacco tissue cultures. Physiol Plant 15:

431–497

21. Jefferson RA (1987) Assaying chimeric genes in plants: the GUS

fusion system. Plant Mol Biol Rep 5:387–405

22. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure from

small quantities of fresh leaf tissue. Phytochem Bull 19:11–15

23. Chomczynski P, Sacchi N (1987) Single-step method of RNA

isolation by acid guanidinium thiocyanate–phenol–chloroform

extraction. Anal Biochem 162:156–159

24. Reddy MK, Nair S, Tewari KK (1998) Cloning, expression and

characterization of a gene which encodes a topoisomerase I with

positive supercoiling activity in pea. Plant Mol Biol 37:773–784

25. Livak KJ, Schmittgen TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2(-Delta

Delta C(T)) method. Methods 25:402–408

26. Steponkus PL, Uemura M, Joseph RA, Gilmour SJ, Thomashow

MF (1998) Mode of action of the COR15a gene on the freezing

tolerance of Arabidopsis thaliana. Proc Natl Acad Sci USA

95:14570–14575

27. Shimamura C, Ohno R, Nakamura C, Takumi S (2006)

Improvement of freezing tolerance in tobacco plants expressing a

cold-responsive and chloroplast-targeting protein WCOR15 of

wheat. J Plant Physiol 163:213–219

28. Rogers S, Wells R, Rechsteiner M (1986) Amino acid sequences

common to rapidly degraded proteins: the PEST hypothesis.

Science 234:364–368

29. Salmeron J, Janzen J, Soneji Y, Bump N, Kamens J, Allen H, Ley

SC (2001) Direct phosphorylation of NF-kappaB1 p105 by the

IkapaB kinase complex on serine 927 is essential for signal

induced p105 proteolysis. J Biol Chem 276:22215–22222

30. Mishra NS, Pham XH, Sopory SK, Tuteja N (2004) Pea DNA

helicase 45 overexpression in tobacco confers high salinity tol-

erance without affecting yield. Proc Natl Acad Sci USA 102:

509–514

31. Garg AK, Kim JK, Owens TG, Ranwala AP, Choi YD, Kochian

LV, Wu RJ (2002) Trehalose accumulation in rice plants confers

high tolerance levels to different abiotic stresses. Proc Natl Acad

Sci USA 99:15898–15903

32. Singla-Pareek SL, Reddy MK, Sopory SK (2003) Genetic engi-

neering of the glyoxalase pathway in tobacco leads to enhanced

salinity tolerance. Proc Natl Acad Sci USA 100:14672–14677

33. Close TJ (1997) Dehydrins: a commonality in the response of

plants to dehydration and low temperature. Physiol Plant

100:291–296

34. Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K

(2004) A combination of the Arabidopsis DREB1A gene and

stress-inducible rd29A promoter improved drought-and low-

temperature stress tolerance in tobacco by gene transfer. Plant

Cell Physiol 45:346–350

35. Schramm F, Larkindale J, Kiehlmann E, Ganguli A, Englich G,

Vierling E, von Koskull-Doring P (2008) A cascade of tran-

scription factor DREB2A and heat stress transcription factor

HsfA3 regulates the heat stress response of Arabidopsis. Plant J

53:264–274

36. Chini A, Grant JJ, Seki M, Shinozaki K, Loake GJ (2004)

Drought tolerance established by enhanced expression of the CC-NBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1.

Plant J 38:810–822

37. Fischer U, Droge-Laser W (2004) Overexpression of NtERF5, a

new member of the tobacco ethylene response transcription factor

family enhances resistance to Tobacco mosaic virus. Mol Plant

Microbe Inter 17:1162–1171

38. Negrel J, Martin C (1984) The biosynthesis of feruloyltyramine

in Nicotiana tabacum. Phytochemistry 23:2797–2801

39. Negrel J, Javelle F (1997) Purification, characterization and

partial amino acid sequencing of hydroxy cinnamoyl-CoA:tyra-

mine N-(hydroxycinnamoyl) transferase from tobacco cell-sus-

pension cultures. Eur J Biochem 247:1127–1135

40. Schmidt A, Grimm R, Schmidt J, Scheel D, Strack D, Rosahl S

(1999) Cloning and expression of a potato cDNA encoding hy-

droxycinnamoyl-CoA:tyramine N-(Hydroxycinnamoyl)transfer-

ase. J Biol Chem 274:4273–4280

41. Ishihara A, Kawata N, Matsukawa T, Iwamura H (2000) Induc-

tion of N-hydroxy cinnamoyltyramine synthesis and tyramine

1134 Mol Biol Rep (2010) 37:1125–1135

123

N-hydroxycinnamoyltransferase (THT) activity by wounding in

maize leaves. Biosci Biotechnol Biochem 64:1025–1031

42. Sommerville CR, Browse J (1991) Plant lipids: metabolism,

mutants, and membranes. Science 252:80–87

43. Kader JC (1996) Lipid-transfer proteins in plants. Ann Rev Plant

Physiol Plant Mol Biol 47:627–654

44. Wu G, Robertson A, Liu X, Zheng P, Wilen R, Nesbitt N, Gusta

L (2004) A lipid transfer protein gene BG-14 is differentially

regulated by abiotic stress, ABA, anisomycin, and sphigosine in

bromegrass (Bromus inermis). J Plant Physiol 161:449–458

45. Sapitnitskaya M, Maul P, McCollum GT, Guy CL, Weiss B,

Samach A, Porat R (2006) Postharvest heat and conditioning

treatments activate different molecular responses and reduce

chilling injuries in grapefruit. J Exp Bot 57:2943–2953

46. Molina A, Diaz I, Vasil IK, Carbonero P, Garcia-Olmedo F

(1996) Two cold- inducible genes encoding lipid transfer protein

LTP4 from barley show differential responses to bacterial

pathogens. Mol Gen Genet 252:162–168

47. Kalifa Y, Perlson E, Gilad A, Konrad Z, Scolnik PA, Bar-Zvi D

(2004) Over- expression of the water and salt stress-regulated

Asr1 gene confers an increased salt tolerance. Plant Cell Environ

27:1459–1468

48. Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eul-

gem T, Mauch F, Luan S, Zou G, Whitham SA, Budworth PR,

Toa Y, Xie Z, Chen X, Lam S, Kreps JA, Harpe JF, Si-Ammour

A, Mauch-Mani B, Heinlein M, Kobayashi K, Hohn T, Dang JL,

Wang X, Zhu T (2002) Expression profile matrix of Arabidopsistranscription factor genes suggests their putative functions in

response to environmental stresses. Plant Cell 14:559–574

49. Kreps JA, Wu YJ, Chang HS, Zhu T, Wang X, Harper JF (2002)

Transcriptome changes for Arabidopsis in response to salt,

osmotic and cold stress. Plant Physiol 130:2129–2141

50. Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y,

Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama

K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hay-

ashizak Y, Shinozaki K (2002) Monitoring expression profile of

7000 Arabidopsis genes under drought, cold-and high-salinity

stresses using a full-length cDNA microarray. Plant J 31:279–292

51. Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T,

Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama

K, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hayashizaki Y,

Shinozaki K (2002) Monitoring expression profile of 7000 Ara-bidopsis genes under ABA treatments using a full-length cDNA

microarray. Funct Integr Genomics 2:282–291

52. Buchanan CD, Lim S, Salzman RA, Kagiampakis I, Morishige

DT, Weers BD, Klein RR, Pratt LH, Cordonnier-Pratt MM, Klein

PE, Mullet JE (2005) Sorghum bicolor’s transcriptome response

to dehydration, high salinity and ABA. Plant Mol Biol 58:

699–720

53. Rizhsky L, Liang H, Mittler R (2002) The combined effect of

drought stress and heat shock on gene expression in tobacco.

Plant Physiol 130:1143–1151

Mol Biol Rep (2010) 37:1125–1135 1135

123