Nuclear expression of a cytoplasmic male sterility gene modifies

mitochondrial morphology in yeast and plant cells

Yann Duroc 1, Catherine Gaillard 1, Sophie Hiard, Corinne Tinchant,Richard Berthome, Georges Pelletier, Francoise Budar *

Station de Genetique et d’Amelioration des Plantes, Institut Jean-Pierre Bourgin, INRA, Route de Saint-Cyr, 78026 Versailles cedex, France

Received 22 August 2005; received in revised form 14 November 2005; accepted 14 November 2005

Available online 5 December 2005

Abstract

ORF138 is the mitochondrion-encoded protein responsible for Ogura cytoplasmic male sterility (cms) in radish (Raphanus sativus) and

Brassica sp. As a means of developing technical tools for analyzing the mechanism of cms in relation to the structure of the sterility protein, we

generated gene constructs for ORF138, the green fluorescent protein GFP and an ORF138-GFP fusion, to give nuclear expression with

mitochondrial targeting of the encoded proteins. These genes were introduced into the yeast Saccharomyces cerevisiae and were transiently and

stably expressed in plant cells. The targeting of nuclear-encoded ORF138 protein to the mitochondria did not prevent the growth of yeast cells on

fermentable or non-fermentable media, but modified the cytological appearance of mitochondria in both yeast and plant cells. However, the

production from a nuclear gene and mitochondrial targeting of ORF138 did not induce male sterility in transgenic A. thaliana plants. This may be

due to the submitochondrial location of nuclearly expressed ORF138.

# 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Cytoplasmic male sterility; GFP fusion; Mitochondrial targeting; Mitochondrial morphology; Saccharomyces cerevisiae; Submitochondrial localization

www.elsevier.com/locate/plantsci

Plant Science 170 (2006) 755–767

1. Introduction

Cytoplasmic male sterility (cms) is a phenomenon specific

to plant reproduction that has been extensively exploited for

hybrid seed production. It can occur in natural populations and

reflects a conflict between the maternally inherited mitochon-

drial genome, which induces male sterility without affecting

the overall phenotype of the plant, and the nuclear genome,

which restores male fertility [1–3]. In most studied cms

systems, a specific mitochondrial gene, constitutively

expressed, causes pollen abortion [4]. There are probably

few mechanisms by which a constitutively expressed

mitochondrial gene could impair male reproductive function

without affecting vegetative development or female gameto-

genesis. Thus, unraveling the molecular mechanism of a

natural cms system should provide insight into the role played

by the mitochondria in male gametogenesis in plants.

* Corresponding author. Tel.: +33 1 30 83 31 80; fax: +33 1 30 83 33 19.

E-mail address: budar@versailles.inra.fr (F. Budar).1 These authors contributed equally to this work.

0168-9452/$ – see front matter # 2005 Elsevier Ireland Ltd. All rights reserved.

doi:10.1016/j.plantsci.2005.11.008

However, before this can be achieved, we need to improve

our knowledge of the structure of the cms-associated protein,

its interaction with mitochondrial membranes and the

structure-function relationship of this protein.

A number of mitochondrial genes have been shown to be

associated with cms in the last 15 years, but very few of the

encoded proteins have been studied experimentally [4–6].

There is no evidence to suggest that the physiological

mechanism of cms is similar in all systems. Mitochondrial

genes associated with cms generally display no similarity, but

similarities have been found between the pol and nap cms-

associated open reading frames (orf) in Brassica [7] and

between the cms-associated orf79 in rice and orf107 in

Sorghum [8]. However, cms-associated proteins have been

shown to have similar features. They are generally small (less

than 30 kDa) and contain at least one hydrophobic domain.

This may be responsible for the association of these proteins

with mitochondrial membranes, as has been observed in the

rare studies carried out on these proteins.

Structure-function relationships for a given protein can be

studied by investigating the differences in function of known

variants. For cms, we could produce sterile plants by genetic

Y. Duroc et al. / Plant Science 170 (2006) 755–767756

transformation and study the activity of cms proteins in these

plants. This strategy provides an opportunity to test directed

changes in protein structure directly in a plant model. As

mitochondrial transformation is not technically feasible in

plants, such a strategy would require the production of nuclear

transformants with genes encoding cms proteins fused to

mitochondrial targeting signals. However, the only reported

example of the successful production of male sterile plants by

nuclear expression of a cms gene concerns the orf239 gene

from bean (Phaseolus vulgaris) [9]. Similar attempts with

Texas-maize and Petunia cms-associated proteins did not give

rise to sterile plants [10–12].

Alternatively, the biochemical properties of the cms protein

could also be studied in a more easy to handle, albeit

heterologous, system. An attractive model species for this

strategy is the yeast Saccharomyces cerevisiae, which has been

an exceptional model system for mitochondrial function for

many years. Our extensive knowledge of the biogenesis and

function of mitochondria in yeast, and the possibility of studying

cells with impaired mitochondrial function make this model

very attractive for explorations of the possible effects of a cms

protein on normal mitochondrial functioning. The Texas maize

T-URF13 protein has been successfully produced and targeted to

mitochondria in yeast, and the uncoupling induced by its

interaction with methomyl and fungal toxins was then analyzed

[13–15].

A mitochondrial gene, orf138, encoding a protein associated

with mitochondrial inner membranes [16,17] has been shown to

be responsible for Ogura cms in Brassica and Raphanus species

[18,19]. It is present in natural populations of wild radish

(Raphanus raphanistrum) in Asia and Europe [20]. As in most

cms systems studied, the protein thought to be responsible for

the sterile phenotype is present in all organs of sterile plants,

including hypocotyls, leaves, roots and buds [16], but no

morphological or respiratory defect is detected in the vegetative

tissues of these plants [21]. This feature is common to several

cms systems and accounts for the difficulties encountered in

studies of the mechanism of cms [6].

We constructed genes for the production of ORF138, GFP

and an ORF138-GFP fusion from the nucleus and their

targeting to mitochondria. We present here the results obtained

following the introduction of these genes into yeast and plant

cells. These results concern the phenotypes induced by the

ORF138 and ORF138-GFP proteins, when targeted to

mitochondria, particularly concerning mitochondrial morphol-

ogy. The submitochondrial distribution of the produced

proteins may account for these phenotypes.

2. Material and methods

2.1. S. cerevisiae strains

We used S. cerevisae strain BY384 (Mata; his3D25;

leu2D1; lys2D2102; trp1D63; ura3-52), provided by J. Boeke.

It was grown in synthetic complete (SC) medium without uracil

and methionine. We added 100 mM methionine to repress the

expression of genes located downstream from the Met25

promoter. The carbon source in the medium was 2% glucose,

2% galactose, 2% raffinose, or 3% glycerol.

2.2. Synthesis of a nuclear-like form of the orf138 gene

(orf138n) and construction of fusion genes

The orf138n coding sequence was synthesized by PCR,

using overlapping long primers in four successive amplification

reactions. The final PCR product was cloned into pBluescript

and sequenced. Undesirable point mutations introduced during

synthesis were corrected by site-directed mutagenesis. The

resulting gene encodes the ORF138 protein (Fig. 1A).

The orf138n coding sequencewas fused to the mitochondrial

targeting sequence of the b-subunit of the ATP synthase of

Nicotiana plumbaginifolia (preb), kindly provided by Marc

Boutry [22].

A chimeric gene consisting of the preb and orf138n coding

sequences followed by the S65T mutated gfp [23,24] coding

sequencewas also constructed. A control fusion was constructed

from the preb targeting sequence and GFP (S65T). Schematic

representations of the fusion proteins are shown in Fig. 1B.

2.3. Introduction of the gene constructs into yeast

expression vectors

The preb-gfp and preb-orf138n-gfp genes were inserted

between the EcoRI and EcoRV sites and the preb-orf138n gene

was inserted between the HindIII and SalI sites of pRS426Met.

The resulting plasmids were named Met-preb-gfp, Met-preb-

orf138n-gfp and Met-preb-orf138n, respectively. The

pRS426Met vector [25] is essentially pRS426 [26] carrying

an expression cassette with the Met25 promoter and the PGK

terminator.

2.4. Yeast transformation and determination of plating

efficiency

We used 1.5 mg of DNA corresponding to plasmids Met-

preb-gfp, Met-preb-orf138n, Met-preb-orf138n-gfp and

pRS426Met to transform strain BY384, as previously described

[27]. For each transformation, we plated 250 mL of the mixture

on SC (-URA) (2%, w/v, glucose) medium supplemented with

methionine. After 2 days of incubation at 30 8C, the plates werereplicated on SC (-URA) medium containing 3% (v/v) glycerol

or 2% (w/v) glucose, with or without methionine.

2.5. Extraction of total yeast proteins

Yeast cells carrying Met-preb-gfp, Met-preb-orf138n and

Met-preb-orf138n-gfp were cultured at 30 8C in 25 mL of SC

medium (2%, w/v, glucose) with or without 100 mM of

methionine until an OD600 of about 1.5 was reached. To ensure

that equivalent numbers of cells were used, we used a volume

corresponding to an OD600 of 15 (about 10 mL of culture),

which was centrifuged for 5 min at 3000 � g. The pellet was

resuspended in 200 mL of Laemmli loading buffer, vortexed for

5 min in the presence of 0.45 mm glass beads and boiled for

Y. Duroc et al. / Plant Science 170 (2006) 755–767 757

Fig. 1. Construction of the genes used for the transformation of yeast and plant cells. (A) Sequence alignment of mitochondrial (wild type) and ‘‘nuclear’’ (synthetic)

orf138 genes. orf138 is the original mitochondrial gene, and orf138n has been modified to resemble a nuclear gene, as described in Section 2, to optimize nuclear

expression. Substituted nucleotides are indicated in bold and the putative polyadenylation signal (AATAAA) is underlined. The peptide sequence of ORF138 is given

below in the one-letter code. (B) Schematic representation of the constructs designed for nuclear expression in S. cerevisiae and plant cells. The orf138n coding

sequence is represented by hatched bars, the gene encoding GFP(S65T) is represented by white rectangles and the preb mitochondrial targeting sequence is

represented by black rectangles. The names of the genes are indicated on the left: preb-gfp encodes preb-GFP(S65T), preb-orf138n-gfp encodes the preb-ORF138-

GFP fusion protein and preb-orf138n encodes preb-ORF138.

5 min. Themixturewas centrifuged for 5 mn at 10,000 � g, and

an aliquot of the supernatant was used for Western-blot

analysis.

2.6. Yeast mitochondrion isolation and fractionation

Yeast mitochondria were isolated from 4 L of yeast culture

in SC medium containing 2% (w/v) raffinose, as described by

Guerin et al. [28].

Mitochondrial membranes were fractionated as follows.

Mitochondria were resuspended in 250 mM sucrose, 1 mM

EDTA, 1 mM EGTA, 10 mM HEPES pH 7.2. Low-osmotic

strength buffer (10 mM HEPES, 1 mM EDTA, 1 mM EGTA,

pH 7.2) was added until a sucrose concentration of 10 mM was

obtained. The suspension was then shaken gently for 20 min at

4 8C, after which the concentration of sucrose was adjusted to

250 mM by adding high-strength osmotic buffer (2 M sucrose,

10 mM HEPES, 1 mM EDTA, 1 mM EGTA, pH 7.2).

Mitochondria were then shaken gently for a further 20 min

at 4 8C. The sample was loaded onto a stepped sucrose gradient

(3 mL 60%, 7 mL 35%, 4 mL 25% sucrose in 10 mM HEPES

1 mM EDTA, 1 mM EGTA, pH 7.2) and centrifuged at

Y. Duroc et al. / Plant Science 170 (2006) 755–767758

150,000 � g for 1 h at 4 8C in a swingout rotor. Outer

membrane-enriched vesicles were collected from the 25/35

interface; the mitoplast-enriched fraction was collected from

the 35/60 interface. The two fractions were diluted in low-

osmotic strength buffer and the membranes were concentrated

by centrifugation at 100,000 � g for 1 h at 4 8C.Isolated mitochondria were treated with carbonate to assess

the strength of the association between ORF138 and the

membrane [29]. Samples were incubated for 30 min on ice in

100 mM Na2CO3 pH 11.5 and centrifuged at 4 8C for 30 min at

100,000 � g. The supernatant (soluble fraction) was collected

and the pellet (membrane fraction) was resuspended in 100 mM

Tris–HCl pH 7.5.

2.7. Introduction of the gene constructs into plant

expression vectors

The preb-orf138n, preb-gfp, and preb-orf138n-gfp genes

were inserted into the single HindIII site of an expression

cassette containing the CaMV 35S promoter (with a duplicated

enhancer sequence) and terminator (T. Michael, unpublished

personal communication) in a derivative of pBluescript

(Stratagene). We checked that the orientation of the inserts

was correct by restriction analysis. We used these plasmids for

transient expression in onion and N. benthamiana cells.

The promoter of the A9 gene of Arabidopsis thaliana [30]

was amplified by PCR from the Landsberg erecta ecotype,

using the following primers:

Forward primer: ATCTAGACATAACGGTGAGAGT-

TAATA

Reverse primer: TGGTACCTCTAATTAGATACTATATTG

The XbaI and KpnI sites used for cloning are underlined. The

XbaI site is present in the genomic sequence, the KpnI site was

introduced to facilitate subsequent manipulations. After

sequence verification, an expression cassette was constructed

with the A9 promoter and the CaMV 35S terminator, flanked by

two NotI restriction sites. The preb-orf138n, preb-gfp, and

preb-orf138n-gfp genes were inserted into the HindIII cloning

site between the promoter and terminator. We checked that the

orientation of the inserts was correct by restriction analysis.

For the stable transformation of A. thaliana, NotI restriction

fragments containing the genes of interest were inserted into the

unique NotI site of the pEC2 binary vector [31]. The resulting

plasmids were verified by restriction analysis and used to

transform an Agrobacterium tumefaciens strain (C58C1)

carrying the pMP90 helper plasmid [32].

2.8. Transient and stable transformation of plant cells

Tungsten particles (diameter 0.5 mm) were sterilized by

incubation in 70% ethanol for 10 min, rinsed with 1.5 mL

sterile water and kept on ice in 50% glycerol until use. We

mixed 100 mL of these particles (15–20 mg) with 5–10 mg of

plasmid DNA (for 3–6 shots). Spermidine (40 mL of 0.1 M

solution) and CaCl2 (100 mL of 2.5 M solution) were then

added and the mixture kept on ice for 10 min, with vortexing

every 3 min. The particles were centrifuged for 30 s in a

benchtop centrifuge. The supernatant was discarded and the

particles were rinsed twice in cold ethanol and resuspended in

60 mL of 100% ethanol. The DNA-coated particles were then

transferred to macrocarrier disks.

Onion slices or Nicotiana benthamiana leaves were placed

on solid medium [33] in Petri dishes and bombarded with the

DNA-coated particles using a Biorad PDS-1000/He Biolistic

Particle Delivery system (900 psi rupture disks) according to

the manufacturer’s instructions.

Explants were then incubated for 48–72 h in a culture

chamber and analyzed by confocal microscopy.

Stable A. thaliana transformants (ecotype Wassilewskija)

carrying the verified constructs were generated using Agro-

bacterium strain C58C1 (pMP90), as previously described [34].

2.9. Extraction of A. thaliana mitochondrial proteins

We grew the F2 progeny of several transformants carrying

the preb-orf138n gene under the control of the 35S promoter on

soil in the greenhouse for 5 weeks. We ground about 20–50

plants (leaves and stems) together in extraction buffer (0.3 M

sucrose, 25 mM tetrasodium pyrophosphate, 2 mM EDTA,

10 mM KH2PO4, 1% (w/v) PVP-40, 1% (w/v) BSA, 20 mM

ascorbate, pH 7.5). The homogenate was then filtered through

four layers of Miracloth (Calbiochem) and subjected to three

cycles of differential centrifugation as previously described

[35]. The organelle-enriched pellet was resuspended in the

minimum volume of washing buffer (0.3 M sucrose, 10 mM

HEPES, 0.2% (w/v) BSA, pH 7.5). Vesicles were ruptured by

five cycles of freezing and thawing involving successive

immersions in liquid nitrogen and incubations at room

temperature. The insoluble fraction was collected by centri-

fugation at 20,000 � g for 30 min at 4 8C and resuspended in a

minimum volume of washing buffer.

2.10. Affinity purification of antibodies

Mitochondria were prepared from male-sterile Brassica

napus plants as previously described [36]. Purified mitochon-

dria obtained from 10 g of flower buds from greenhouse-grown

plants were lysed in 62.5 mM Tris–HCl (pH 6.8) supplemented

with 2% (w/v) SDS, 5% (v/v) b-mercaptoethanol, and 10% (v/

v) glycerol. Proteins were precipitated in acetone, collected by

centrifugation and resuspended in 50 mM Tris–HCl (pH 7.5).

Rabbit anti-ORF138 IgG was affinity-purified using a

modified version of a previously described procedure [37].

Total mitochondrial protein extracts from B. napus sterile

plants were spotted onto a nitrocellulose membrane (HybondC,

Amersham). The membrane was incubated for 1 h at 37 8Cwith

50 mM Tris–HCl (pH 7.5) supplemented with 150 mM NaCl,

0.05% (v/v) Tween 20 and 3% (w/v) nonfat milk powder (buffer

A). The membrane was then incubated with crude rabbit anti-

ORF138 immune serum [16] (1 mL/cycle) for 1 h at 37 8C. Themembrane was washed four times at 37 8C for 1 min each with

buffer B (buffer B = buffer A minus milk powder). The bound

Y. Duroc et al. / Plant Science 170 (2006) 755–767 759

antibodies were eluted with threewashes (1 min each) in 0.5 mL

5 mM glycine–HCl (pH 3) containing 500 mMNaCl, 0.25% (v/

v) Tween 20 and 1% (w/v) BSA. Eluates were pooled and

neutralized with solid Tris. The membrane was washed three

times, in 3 mL of buffer B.We then carried out six further cycles

of incubation with the ORF138 antiserum, followed by washing

and elution. Affinity-purified IgG was divided into 0.25 mL

aliquots, frozen in liquid nitrogen and stored at �80 8C.

2.11. SDS–PAGE and immunoblot analysis of protein

extracts

An aliquot of each culture or fraction was processed by

SDS–PAGE. The concentration of acrylamide used for PAGE is

given in the legend to each figure. The proteins were

electroblotted onto nitrocellulose membranes (HybondC,

Amersham) or PVDF (Immobilon, Millipore). Immunoblotting

was carried out with the following antibodies: unpurified

(diluted 1:5000; plant extracts) or purified (diluted 1:200; yeast

extracts) rabbit ORF138 antisera; a mixture of two monoclonal

antibodies against GFP (Boehringer; diluted 1:1000); a

polyclonal rabbit antiserum against ferrochelatase (Hem15;

diluted 1:1000); a monoclonal mouse antibody against porin

(Molecular Probes; diluted 1:500). The ORF138 and ferroche-

latase antibodies were then detected with peroxidase-con-

jugated anti-rabbit IgG (Sigma). The GFP and porin antibodies

were detected with peroxidase-conjugated secondary anti-

mouse IgG (Caltag). Secondary antibodies were detected with

the ECL kit (Amersham). The apparent molecular weights of

the proteins were estimated with prestained low-molecular

weight or broad-range molecular weight markers (Biorad) or

with a prestained MW marker (Fermentas).

2.12. Cytological observations

Yeasts carrying Met-preb-gfp, and Met-preb-orf138n-gfp

were cultured for 2 days at 30 8C in 2 mL of SC medium

(containing 2% galactose) with or without 100 mMmethionine.

Cells were centrifuged for 5 min at 4000 � g, and resuspended

in 20 mL of culture medium. An aliquot (3 mL) of this cell

suspension was then immobilized in 3 mL of 0.8% low-melting

point agarose at 36 8C on glass slides.

Onion slices were peeled and epiderm fragments mounted

on microscope slides. N. benthamiana leaf fragments were

mounted directly on microscope slides.

Cells producing GFP were observed under a Leica TCS-NT

confocal laser scanning microscope (Leica Microsystems,

Heidelberg, Germany) with an argon/krypton laser (Omni-

chrome, Chino, CA). GFP fluorescence was observed using an

FITC filter set (BP530/30) with an argon (488 nm) laser.

Medium-scan (450 lines per second) images (1024 � 1024

pixels) were taken using a 63 � 1.32 NA PL APO objective for

yeasts, and a 40 � 0.8 w HCX APO L objective for plant cells.

In some experiments, a sequential filter set with a second

photomultiplier was used to collect the transmitted light. In

these cases, the light emitted by GFP was collected using the

configuration described above.

3. Results

3.1. Construction of genes for production and targeting to

mitochondria of ORF138, GFP and ORF138-GFP proteins

The orf138 coding sequence has a high A + T content (65%)

and carries putative internal polyadenylation site (AATAAA).

We used PCR to synthesize a version of this gene (orf138n)

encoding exactly the same peptide, but with an A + T content of

only 50% and no internal polyadenylation signal, mimicking a

nuclear gene (Fig. 1A). We constructed a chimeric gene in

which the orf138n and gfp coding sequences were fused. The

proteins were targeted to the mitochondria by fusing their

coding sequences to the mitochondrial presequence of the N.

plumbaginifolia b-ATPase gene (preb). Duby et al. [38]

precisely dissected the sequence necessary for efficient import

of GFP into plant and yeast cells and showed that the first 47

aminoacids of the signal peptide were sufficient for efficient

mitochondrial import. The same group previously showed that

a presequence extending to the 59th residue was also efficient

for mitochondrial targeting of fusion proteins [11]. The

presequence of b-ATPase from N. plumbaginifolia was also

used for the import of GFP into mitochondria of stable

Arabidopsis transformants [39]. The presequence used in this

study encodes the first 59 amino acids of the b-subunit

precursor and includes the cleavage site. We constructed three

genes encoding fusion proteins (Fig. 1B). These constructs

were designed to ensure targeting of the ORF138, GFP and

ORF138-GFP proteins to the mitochondria.

3.2. Production of mitochondrially targeted GFP, ORF138,

and ORF138-GFP in yeast

We used the yeast S. cerevisiae as a heterologous

eukaryotic model, to investigate whether ORF138 had a

general effect on mitochondria. As we did not know whether

ORF138 would impair yeast growth, we introduced the preb-

orf138n, preb-gfp and preb-orf138n-gfp genes downstream

from the Met25 promoter, which is repressed in the presence

of methionine. The plasmids carrying the preb-gfp, preb-

orf138n and preb-orf138n-gfp genes were introduced into

yeast strain BY384, as was the insert-less vector, pRS426Met.

Transformants were selected on glucose-containing selective

(synthetic complete, URA minus) medium and replicated on

glycerol-containing selective medium. Plating efficiency and

colony size were similar in strains transformed with the three

constructs and in strains transformed with the insert-less

vector. We repeated the experiment, adding 100 mM of

methionine to the glucose-containing medium used for the

selection of transformants, to prevent selection against cells

expressing the genes. Plates were then replicated in parallel,

on glucose- or glycerol-containing selective media, with or

without methionine. In these conditions, no significant

difference in growth or colony size was detected for any of

the constructs.

We checked that the various proteins were produced in vivo,

by extracting total proteins from several transformants,

Y. Duroc et al. / Plant Science 170 (2006) 755–767760

Fig. 2. Immunodetection of the preb-ORF138, preb-GFP, and preb-ORF138-GFP fusion proteins in S. cerevisiae. Extracts equivalent to 1.1 OD units of culture were

run on a 10% acrylamide gel. Lanes 1, 3, and 5 contain protein extracts from repressed cells whereas lanes 2, 4 and 6 contain protein extracts from non- repressed cells.

Lanes 1 and 2: extracts from preb-gfp harboring cells. Lanes 3 and 4: extracts from preb-orf138n harboring cells. Lanes 5 and 6: extracts from preb-orf138n-gfp

harboring cells. Numbers on the left indicate sizes of molecular weight markers (kDa). Two identical gels were processed in parallel and the corresponding

membranes hybridized with antibodies directed against GFP (A) or ORF138 (B).

carrying out SDS–PAGE and immunoblotting with antibodies

against ORF138 and/or GFP. Yeast strains carrying the various

constructs were found to produce the fusion proteins at

detectable levels (Fig. 2A and B). These antibodies detected

smaller amounts of ORF138-GFP fusion protein than of GFP

and ORF138.

3.2.1. Production and mitochondrial targeting of ORF138-

GFP modifies mitochondrial morphology

We observed yeast cells producing mitochondrion-targeted

GFP and ORF138–GFP fusion proteins by fluorescence

microscopy, after the cells had been cultured in galactose

synthetic complete (SC) medium without methionine (Fig. 3).

Yeast cells producing preb-GFP displayed numerous fluor-

escent organelles, associated in tubular branched networks, as

previously described [40,41]. In contrast, cells producing preb-

ORF138-GFP showed fluorescence concentrated in globular

organelles, reminiscent of some yeast mdm mutants [41] or of

rapamycin-treated cells displaying autophagy of mitochondria

[42]. Light and fluorescence micrographs were used to count

the number of GFP-producing cells. We calculated the

percentage of GFP-containing cells that had globular mito-

chondria. We counted GFP-containing cells on six fields for

preb-GFP and ten fields for preb-ORF138-GFP (Table 1).

Significantly, fewer fluorescent cells were detected for preb-

ORF138-GFP than for preb-GFP. The normal mitochondrial

tubular network was observed in a very small percentage of

Table 1

Percentage of yeast cells presenting a globular mitochondrial phenotype

following the production of preb-ORF138-GFP or preb-GFP fusion proteins

Construct name % GFP-expressing cells % globular

Preb-GFP 15 � 4 10 � 3

Preb-ORF138-GFP 6 � 2 85 � 15

We counted fluorescent cells on 6 or 10 independent images obtained by light

and fluorescence microscopy of the same field, and estimated the % of cells

expressing GFP. The number of cells with globular organelles was estimated as

a percentage of GFP-expressing cells. Examples of the images analyzed are

given in Fig. 3.

fluorescent cells producing preb-ORF138-GFP, mostly being

replaced by globular organelles.

3.2.2. Submitochondrial distribution of the ORF138 and

ORF138-GFP proteins in yeast

Mitochondria were purified from yeast strains producing

either preb-ORF138 or preb-ORF138-GFP. Following alka-

line carbonate treatment and centrifugation, both proteins

were found to be intrinsically associated with mitochondrial

membranes (Fig. 4A and B), like ORF138 in sterile plants

[16]. The ORF138 signal detected in immunoblots performed

with preb-ORF138-producing cells appears has a doublet

(Fig. 4A and C). We sometimes observe doublet bands for

ORF138 in immunoblots from other cell types, including

plant cells (data not shown). We interpret this observation has

a partial proteolysis of the protein in some extracts. In

Fig. 4A, the porin also appears as a doublet in the insoluble

fraction.

We fractionated mitochondrial extracts into outer mem-

brane- and inner membrane-enriched fractions, to determine

the precise location of the fusion proteins. We assessed the

efficiency of fraction enrichment by immunolocalization of

ferrochelatase (an inner membrane protein) or porin (an outer

membrane protein). In preb-ORF138-producing cells, the

ORF138 protein was shown to be present in both the outer and

inner membranes (Fig. 4C). Similar levels of ORF138 were

detected in both fractions, strongly suggesting that the protein

was associated with both mitochondrial membranes in these

cells. This pattern differs from that observed in the

mitochondria of sterile plants, in which ORF138 is associated

solely with the inner membrane [17]. The difference in relative

abundance of the upper and lower signals of the doublet in

inner and outer membrane fraction (Fig. 4C) might be due to

different abundance or efficiency of proteases in the respective

fractions. In preb-ORF138-GFP-producing yeast cells, the

ORF138 protein was found exclusively in the outer membrane

fraction (Fig. 4D). These results were confirmed by

immunodetection of the GFP moiety of the fusion protein

(Fig. 4D).

Y. Duroc et al. / Plant Science 170 (2006) 755–767 761

Fig. 3. Confocal microscopy of yeast cells producing the preb-GFP and preb-ORF138-GFP fusion proteins. The results of our analysis of confocal images are shown

in Table 2. (A) and (C) are transmission view images and correspond to the fluorescence view images shown in (B) and (D), respectively. (A and B) Yeast cells

producing preb-GFP; (C and D) yeast cells producing preb-ORF138-GFP. The framed parts in (B) and (D) are magnified at the bottom of the images. Scale

bar = 20 mm.

3.3. Production of mitochondrially targeted GFP, ORF138,

and ORF138-GFP in plant cells

3.3.1. Production and mitochondrial targeting of ORF138

in plant cells affects mitochondrial morphology

The observed changes in mitochondrial morphology in yeast

cells producing the ORF138-GFP fusion protein were

unexpected. These changes may be due to a specific feature

of yeast mitochondria. We investigated this possibility by

carrying out transient expression experiments in plants. We

bombarded onion epidermal cells with tungsten particles coated

with DNA for the constructs encoding preb-GFP, preb-

ORF138-GFP, or both preb-GFP and preb-ORF138. Fluores-

cence was observed as numerous small foci in cells producing

preb-GFP (Fig. 5A). In plant cells producing preb-ORF138-

GFP, fluorescence was observed in heterogeneous foci, with the

larger patches suggestive of organelle aggregation (Fig. 5B) and

reminiscent of the mitochondrial morphology observed in some

A. thaliana mutants [43,44]. Similar observations were made in

stably transformed A. thaliana plants (see next section, Fig. 6B).

In co-bombardment experiments with plasmids carrying the

preb-orf138n and preb-gfp genes, the phenotype was inter-

mediate between those of cells transformed with one or other of

these plasmids alone. The organelles of the cotransformants

were larger and less numerous than those of cells producing

only preb-GFP. They were slightly less heterogeneous in size

than in those of cells producing the ORF138-GFP fusion protein

(Fig. 5C). Similar results were obtained in transient expression

experiments in which N. benthamiana leaves were bombarded

with particles coated with the same constructs (data not shown).

3.3.2. The production of ORF138 and its mitochondrial

targeting do not induce male sterility in A. thaliana

We produced stable A. thaliana transformants producing the

preb-ORF138, preb-GFP, or the preb-ORF138-GFP protein

under the control of the CaMV 35S or A9 promoter. Several

tens of independent transformants were obtained for each

construct (Table 2).

As inappropriate control of transgene expression has

frequently been assumed to result in a lack of sterility in

transgenic plants producing cms proteins, we checked the tissue

specificity of our constructs in plants producing preb-GFP. GFP

Y. Duroc et al. / Plant Science 170 (2006) 755–767762

Fig. 4. Localization of the preb-ORF138 and preb-ORF138-GFP fusion proteins in S. cerevisiae. (A) Carbonate treatment of mitochondrial membranes from yeast

cells producing preb-ORF138. Proteins (6 mg) from the soluble and insoluble fractions of carbonate-treated total mitochondrial extracts were analyzed by PAGE in an

8% acrylamide gel, followed by blotting and detection with purified anti-ORF138 antibodies (lanes 1–3) or anti-porin antibodies (lanes 4–6). Lanes 1 and 4: whole

mitochondrial proteins. Lanes 2 and 5: soluble fraction after carbonate treatment. Lanes 3 and 6: insoluble fraction after carbonate treatment. Numbers on the left

indicate the sizes of molecular weight markers (kDa). (B) Carbonate treatment of mitochondrial membranes from yeast cells producing preb-ORF138-GFP. Proteins

(6 mg) from the soluble and insoluble fractions from carbonate-treated total mitochondrial extracts were analyzed by PAGE in an 8% acrylamide gel, followed by

blotting and detection with purified anti-ORF138 antibodies (lanes 1–3), anti-GFP antibodies (lanes 4–6), or anti-porin antibodies (lanes 7–9). Lanes 1, 4 and 7: whole

mitochondrial proteins. Lanes 2, 5 and 8: soluble fraction after carbonate treatment. Lanes 3, 6 and 9: insoluble fraction after carbonate treatment. Numbers on the left

indicate the sizes of molecular weight markers (kDa). (C) Fractionation of mitochondria from yeast cells producing preb-ORF138. Mitochondria were subjected to

fractionation and 5 mg of protein from total mitochondrial extracts and inner and outer membrane-enriched fractions was analyzed by PAGE in an 8% acrylamide gel,

followed by blotting and detection with purified anti-ORF138 antibodies (lanes 1–3), anti-ferrochelatase antibodies (lanes 4–6) or anti-porin antibodies (lanes 7–9).

Lanes 1, 4 and 7: whole mitochondrial protein extracts. Lanes 2, 5 and 8: inner membrane-enriched fraction. Lanes 3, 6 and 9: outer membrane-enriched fraction.

Numbers on the left indicate sizes of molecular weight markers (kDa). (D) Fractionation of mitochondria from yeast cells producing preb-ORF138-GFP.

Mitochondria were subjected to fractionation and 5 mg of protein from total mitochondrial extracts and inner and outer membrane-enriched fractions was analyzed by

PAGE in an 8% acrylamide gel. The gel was blotted and proteins were detected with purified anti-ORF138 antibodies (lanes 1–3), anti-GFP antibodies (lanes 4–6),

anti-ferrochelatase antibodies (lanes 7–9) or anti-porin antibodies (lanes 10–12). Lanes 1, 4, 7 and 10: wholemitochondrial protein extracts. Lanes 2, 5, 8 and 11: inner

membrane-enriched fraction. Lanes 3, 6, 9 and 12: outer membrane-enriched fraction. Numbers on the left indicate the sizes of molecular weight markers (kDa).

Y. Duroc et al. / Plant Science 170 (2006) 755–767 763

Fig. 5. Fluorescence of onion epidermal cells producing the preb-GFP, preb-ORF138 and preb-ORF138-GFP fusion proteins. (A) Production of preb-GFP. (B)

Production of preb-ORF138-GFP. (C) Coproduction of preb-GFP and preb-ORF138. Scale bar = 50 mm.

Fig. 6. Observation of fluorescence in preb-GFP-producing transgenic A. thaliana. Confocal microscopy of transgenic plants. The left panels show GFP

fluorescence, the right panels show autofluorescence of chloroplasts in the red channel of the same field. Central panels show merged images. (A) Anther from

a transgenic plant carrying the A9-preb-gfp construct. (B) Anther from a transgenic plant carrying the A9-preb-orf138-gfp construct. Scale bar = 50 mm.

fluorescence was readily detected in transgenic plants carrying

the 35S-preb-GFP construct. Fluorescent organelles were

observed in several types of cell, including trichomes,

epidermal cells, and stomatal guard cells. No fluorescent

Table 2

Expression of the transgenes in stably transformed Arabidopsis

Promoter Gene Number of

transgenic plants (T1)

Number of

sterile plantsa

35S CaMV preb-gfp 29 1

preb-orf138n 58 1

preb-orf138n-gfp 164 nd

A9 preb-gfp 26 1

preb-orf138n 47 0

preb-orf138n-gfp 67 3

T1: the number of observed plants corresponds to independent transgenic

plants; nd: not determined.a No completely sterile plant was observed. The figures concern partially

sterile plants.

organelles were observed in the tapetal cells of the anther or in

the microspores. We therefore concluded that the CaMV 35S

promoter had little if any activity in these cell types. The A9

gene promoter has been shown to be specifically active in

tapetal cells [30]. We detected GFP fluorescence in the tapetal

cells of all observed transgenic plants carrying the A9-preb-

GFP or the A9-preb-ORF138-GFP constructs, indicating

strong expression from the A9 promoter in this tissue

(Fig. 6). The modification of mitochondrial morphology in

the presence of the ORF138-GFP fusion is clear on these organs

(Fig. 6).

The fertility of the A. thaliana transformants carrying these

constructs did not differ significantly from that in similar

experiments performed routinely in the laboratory (Table 2). In

particular, transformation with the preb-orf138 coding

sequence under control of the 35S or the A9 promoter was

not correlated with an increase in male sterility. We checked

that ORF138 was produced in transgenic plants by extracting

mitochondrial proteins from several transformants, carrying out

Y. Duroc et al. / Plant Science 170 (2006) 755–767764

Fig. 7. Immunodetection of the ORF138 protein in mitochondrial extracts of

transgenic A. thaliana. Insoluble fractions of mitochondrion-enriched extracts

(50 mg) of A. thaliana were analyzed by PAGE in a 15% acrylamide gel,

followed by blotting and detection with anti-ORF138 antibodies. (1) Positive

control: mitochondrial proteins from sterile rapeseed (5 mg). (2) Negative

control: non transgenic A. thaliana WS. (3–6) Four independent transgenic

plants carrying the 35S-preb-orf138n. Horizontal arrows on the right indicate

the position of specific signals from monomers and dimers of ORF138.

Numbers on the left indicate the sizes of molecular weight markers (kDa).

SDS–PAGE on the insoluble fraction and immunoblotting with

antibodies against ORF138 (Fig. 7). We found that the ORF138

protein was produced and targeted to mitochondria in

transgenic plants, but did not induce male sterility.

4. Discussion

Transgenic A. thaliana plants producing ORF138 targeted to

the mitochondria are not male sterile. This lack of male sterility

following the nuclear expression of a cms gene is shared by

several cms systems [10–12]. Inappropriate timing and/or

spatial control of transgene expression is often put forward as

the main explanation for this lack of sterility. Use of the GFP

reporter gene showed that the 35S promoter was only weakly

active, if at all, in tapetal cells. Similar observations have been

reported in previous studies [45]. The tapetum has been shown

to be the target tissue of the sterility mechanism, as

development is initially impaired in this highly active cell

layer [46]. It is possible that the induction of male sterility by a

nuclear orf138 genewould require specific expression in tapetal

cells. We therefore generated constructs including the tapetum-

specific promoter A9, which has the ideal spatial and temporal

expression profile for this purpose [30]. The GFP reporter gene

was used to check the efficiency of the A9 promoter for driving

tapetum-specific expression of GFP in our experiments.

However, the A9-preb-orf138 construct did not induce male

sterility in the transgenic plants. Thus, a lack of expression of

the cms gene in the correct tissue and at the correct time is not

the primary reason for the lack of male sterility in these

transgenic plants.

Other non-mutually exclusive hypotheses can be proposed

to account for the lack of male sterility in transgenic plants

expressing nuclear copies of cms genes. Too little of the protein

may accumulate in cases in which a quantitative threshold must

be exceeded for activity. Alternatively, inappropriate folding or

submitochondrial location of the cms protein may be

responsible. If the cms gene is expressed in a plant species

different from that in which it originated, the absence of specific

partners of the cms protein necessary for sterility may also be a

problem. This seems unlikely in this case, but the possibility

cannot be formally excluded. The Ogura cms originates from

Raphanus sativus and has been successfully transferred to

Brassica species [47]. As Arabidopsis belongs to the same

family as Raphanus and Brassica, possible partners conserved

in these two genera are probably also present in A. thaliana.

We previously showed that the male sterility induced by

orf138 depends on a threshold gene copy number (and probably

protein production) being exceeded in rapeseed cybrids [48].

The production of too small a quantity of the sterility protein

would therefore probably not result in a sterility phenotype.

However, only quantitative analysis of ORF138 production in

the tapetal cells of transgenic plants would be able to confirm or

reject this hypothesis and such analysis is not technically

feasible.

It is also possible that the import of the cms protein from the

cytosol results in its incorrect submitochondrial targeting. Our

results, obtained in yeast cells producing mitochondrially

targeted GFP, ORF138 and ORF138-GFP proteins, are

consistent with this hypothesis. In previous studies, we have

shown that ORF138 is an intrinsic mitochondrial membrane

protein, associated with the inner mitochondrial membrane of

sterile plants [16,17]. We report here that both ORF138 and

ORF138-GFP are intrinsic mitochondrial membrane proteins

in yeast cells. ORF138 was also associated with the insoluble

fraction of mitochondrial proteins from transgenic A. thaliana

plants. We performed fractionation experiments on yeast

mitochondrial extracts and found that the preb-ORF138

protein was present in both mitochondrial membranes,

whereas the preb-ORF138-GFP fusion protein was detected

only in the outer membrane-enriched fraction. This was

confirmed by immunodetection of theGFPmoiety of the fusion

protein. These results indicate that the proteins produced are

efficiently targeted to mitochondria, with a significant

proportion remaining in the outer mitochondrial membrane.

We therefore conclude that only some of the ORF138 protein

produced in the cytosol and targeted to the mitochondria of

yeast cells ends up in the correct compartment of mitochondria

(i.e. that in which it is found in the mitochondria of sterile

plants). We suggest that the inappropriate distribution in the

mitochondria of the produced ORF138 may contribute to the

absence of a male sterility phenotype in transgenic plants. A

similar explanation may apply to the similar results obtained

with other cms genes. The bean cms-associated protein is

unique in not being located in the mitochondria. It is instead

found in cell walls and in the callose layer of microspore

tetrads; it is also the only cms production for which the

successful induction of male sterility by the production of the

cms protein from a nuclear transgene has been reported [9]. As

some of the ORF138 protein targeted to the mitochondria was

found in the innermembrane, we cannot exclude the possibility

that the absence of phenotype results from too small an amount

of protein being correctly distributed. Nevertheless, we feel

that correct submitochondrial targeting of cms proteins

Y. Duroc et al. / Plant Science 170 (2006) 755–767 765

produced from nuclear transgenes may have been under-

estimated in previous studies.

The use of GFP fusion proteins made it possible to observe

mitochondria by fluorescence microscopy. GFP has proved to

be a powerful tool for monitoring mitochondrial shape in vivo

and changes in mitochondria morphology in various condi-

tions [39–41,43,44,49]. We observed mitochondrial morphol-

ogy in yeast and plant cells producing preb-GFP and preb-

ORF138-GFP. We found that preb-ORF138-GFP had a

dramatic effect on mitochondrial morphology in both cell

types. Yeast mitochondria rapidly change shape during cell

growth and can be modified by mutations affecting the

division or fusion of mitochondria [50] and by mutations

affecting other mitochondrial functions, including respiration

[41]. However, strains producing preb-ORF138 (or preb-

ORF138-GFP) showed no inhibition of respiration, at least in

the conditions tested in this study. The morphological

phenotype observed when ORF138-GFP was targeted to

yeast mitochondria was similar to that of the mutants mdm32

and mdm34 [41]. Interestingly, this phenotype is reminiscent

of autophagy in rapamycin-treated yeast cells [42]. In yeast,

autophagy is induced by starvation conditions and involves

the sequestration of organelles, including mitochondria, in a

lytic vacuole [51–55].

It is difficult to assess the similarity in mitochondrial

morphology between yeast and plant cells producing preb-

ORF138-GFP. In plant cells, cotransformants producing the

preb-ORF138 and preb-GFP proteins also displayed clear

changes in mitochondrial morphology, although these changes

were less marked than with the fusion protein. Thus, the

observed morphology is not exclusively linked to the ORF138-

GFP fusion. It is also seen when the ORF138 protein is present

in the outer membrane of the mitochondria. The presence of

ORF138 in the outer mitochondrial membrane therefore leads

to an abnormal mitochondrial morphology, via a direct

aggregative effect or indirectly via a more complex pathway.

The more marked effect of preb-ORF138-GFP may be due to

aggravation due to the fusion with GFP, or due to all the protein

being present in the outer membrane, whereas the preb-

ORF138 was present in both the inner and outer membranes.

The submitochondrial location of the ORF138 produced

from a nuclear gene in our experiments is not analogous to that

in sterile plants. Any interpretation of the mechanism of male

sterility based on our results would therefore not be valid.

Future studies on cms should take this into account and

experimental systems should be selected with care to ensure

that the topology of the proteins concerned in the mitochondrial

membranes is analogous to that in sterile plants. This could be

achieved, for instance, by generating transgenic yeast cells in

which the orf138 gene has been inserted into the mitochondrial

genome. As the genetic code used by yeast mitochondria is

different from that used by nuclear genes and by plant

mitochondrial genes, this experiment would require the entire

recoding of the orf138 gene.

This study clearly shows that inappropriate control of

expression is not the only reason for the lack of induction of

male sterility by production of mitochondrially targeted cms

proteins in transgenic plants. Very few studies have dealt with the

complementation of mitochondrial mutations by a mitochond-

rially targeted protein encoded by a nuclear gene. This is the case

for var1p and Aap1p (ATP synthase subunit 8) in S. cerevisiae

[56,57], and the product of urfa in Schizosaccharomyces pombe

[58]. Another example concerns a mitochondrial mutation in the

subunit 6 of the human ATPase. This mutation is involved in

Leigh syndrome, and was successfully complemented by a

protein imported into the mitochondria in transfected cells [59].

Recently, the complementation of a complex I N. sylvestris

mitochondrial mutant was realized by targeting to mitochondria

the NAD7 subunit, whose gene was deleted in the mitochondrial

genome of the mutant [60]. To our knowledge, these are the only

published reports of successful experiments of this type. Their

scarcity is remarkable, especially in yeast, for which mitochon-

drial mutants have been known and studied for more than 50

years. The lack of studies reporting the relocation of

mitochondrial genes to the nuclear genome may be due to the

necessity of recoding mitochondrial yeast and human genes into

the universal genetic code to ensure correct translation. This may

also be due to the folding requirements and membrane

interactions of the proteins, which may be incompatible with

their import from the cytosol. Law et al. [57] also reported that

ATP9 produced from a nuclear gene and targeted to

mitochondria was unable to complement a mitochondrial atp9

mutation, even though in vitro import of the precursor was

observed. This work and our present study suggest that

addressing of a protein to mitochondria might not be sufficient

for its correct intramitochondrial targeting and folding, hence to

its proper function.

Acknowledgments

This work was supported by a grant awarded to C. Gaillard

by the French ‘‘Association pour la Promotion des Recherches

sur les Oleagineux’’ (PROMOSOL). Y. Duroc was supported

by the ‘‘Centre Technique Interprofessionnel des Oleagineux

Metropolitains’’ (CETIOM). We would like to thank E.

Lesuisse for sharing antibodies and M. Boutry for providing

the preb targeting signal-carrying plasmid. We would also like

to thank O. Grandjean for help with confocal microscopy and

R. Berthome, I. Small, M. Grelon, S. Bonhomme, C. Mezard,

H. Mireau and F. Nogue for stimulating discussions and critical

reading of the manuscript.

References

[1] J.H. Werren, L.W. Beukeboom, Sex determination, sex ratios, and genetic

conflict, Ann. Rev. Ecol. Syst. 29 (1998) 233–261.

[2] S.A. Frank, Polymorphism of attack and defense, Trends Ecol. Evol. 15

(2000) 167–171.

[3] F. Budar, P. Touzet, R. de Paepe, The nucleo-mitochondrial conflict in

cytoplasmic male sterilities revisited, Genetica 117 (2003) 3–16.

[4] M.R. Hanson, S. Bentolila, Interactions of mitochondrial and nuclear

genes that affect male gametophyte development, Plant Cell 16 (Suppl.)

(2004) S154–S169.

[5] P.S. Schnable, R.P. Wise, The molecular basis of cytoplasmic

male sterility and fertility restoration, Trends Plant Sci. 3 (1998) 175–

180.

Y. Duroc et al. / Plant Science 170 (2006) 755–767766

[6] F. Kempken, D.R. Pring, Plant breeding: male sterility in higher plants-

fundamentals and applications, in: K. Esser (Ed.), Progress in Botany,

Springer-Verlag, Berlin Heidelberg, 1999, pp. 139–166.

[7] Y. L’Homme, R.J. Stahl, X.-Q. Li, A. Hameed, G.G. Brown, Brassica nap

cytoplasmic male sterility is associated with expresion of a mtDNA region

containing a chimeric gene similar to the polCMS-associated orf224 gene,

Curr. Genet. 31 (1997) 325–335.

[8] H.V. Tang, D.R. Pring, L.C. Shaw, R.A. Salazar, F.R. Muza, B. Yan, K.F.

Schertz, Transcript processing internal to a mitochondrial open reading

frame is correlated with fertility restoration in male-sterile sorghum, Plant

J. 10 (1996) 123–133.

[9] S. He, A.R. Abad, S.B. Gelvin, S.A. Mackenzie, A cytoplasmic male

sterility-associated mitochondrial protein causes pollen disruption in

transgenic tobacco, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 11763–

11768.

[10] J.M. von Allmen, W.H. Rottmann, B.G. Gengenbach, A.J. Harvey, D.M.

Lonsdale, Transfer of methomyl and hmt-toxin sensitivity from T-cyto-

plasm maize to tobacco, Mol. Gen. Genet. 229 (1991) 405–412.

[11] F. Chaumont, B. Bernier, R. Buxant, M.E. Williams, C.S. Levings III, M.

Boutry, Targeting the maize T-urf13 product into tobacco mitochondria

confers methomyl sensitivity to mitochondrial respiration, Proc. Natl.

Acad. Sci. U.S.A. 92 (1995) 1167–1171.

[12] H. Wintz, H.C. Chen, C.A. Sutton, C.A. Conley, A. Cobb, D. Ruth, M.R.

Hanson, Expression of the CMS-associated urfS sequence in transgenic

petunia and tobacco, Plant Mol. Biol. 28 (1995) 83–92.

[13] J. Huang, S.-H. Lee, C. Lin, R. Medici, E. Hack, A.M. Myers, Expression

in yeast of the T-URF13 protein from Texas male-sterile maize mitochon-

dria confers sensitivity to methomyl and to Texas-cytoplasm-specific

fungal toxins, EMBO J. 9 (1990) 339–347.

[14] N. Glab, R.P. Wise, D.R. Pring, C. Jacq, P.P. Slonimski, Expression in

Saccharomyce cerevisiae of a gene associated with cytoplasmic male

sterility from maize: respiratory dysfunction and uncoupling of yeast

mitochondria, Mol. Gen. Genet. 223 (1990) 24–32.

[15] N. Glab, P.X. Petit, P.P. Slonimski, Mitochondrial dysfunction in yeast

expressing the cytoplasmic male sterility T-urf13 gene from maize:

analysis at the population and individual cell level, Mol. Gen. Genet.

236 (1993) 299–308.

[16] M. Grelon, F. Budar, S. Bonhomme, G. Pelletier, Ogura cytoplasmic male-

sterility (CMS)-associated orf138 is translated into a mitochondrial

membrane polypeptide in male-sterile Brassica cybrids, Mol. Gen. Genet.

243 (1994) 540–547.

[17] Y. Duroc, C. Gaillard, S. Hiard, M.C. Defrance, G. Pelletier, F. Budar,

Biochemical and functional characterization of ORF138, a mitochondrial

protein responsible for Ogura cytoplasmic male sterility in Brassiceae,

Biochimie 87 (2005) 1089–1100.

[18] S. Bonhomme, F. Budar, D. Lancelin, I. Small, M.-C. Defrance, G.

Pelletier, Sequence and transcript analysis of the Nco2.5 Ogura-specific

fragment correlated with cytoplasmic male sterility in Brassica cybrids,

Mol. Gen. Genet. 235 (1992) 340–348.

[19] S. Krishnasamy, C.A. Makaroff, Characterization of the radish mitochon-

drial orfB locus: possible relationship with male sterility in Ogura radish,

Curr. Genet. 24 (1993) 156–163.

[20] H. Yamagishi, T. Terachi, Molecular and biological studies on male-sterile

cytoplasm in the Cruciferae. IV. Ogura-type cytoplasm found in the wild

radish, Raphanus raphanistrum, Plant Breed. 116 (1997) 323–329.

[21] J. Farineau, L. Pascal, G. Pelletier, Study of respiratory and photosynthetic

activities in several cytoplasmic hybrids of rapeseed with cytoplasmic

male sterility, Plant Physiol. Biochem. 28 (1990) 333–342.

[22] M. Boutry, N.-H. Chua, A nuclear gene encoding the beta subunit of the

mitochondrial ATP synthase gene in Nicotiana plumbaginifolia, EMBO J.

4 (1985) 340–342.

[23] J. Haseloff, B. Amos, GFP in plants, Trends Genet. 11 (1995) 328–329.

[24] R. Heim, R.Y. Tsein, Engineering green fluorescent protein for improved

brightness, longer wavelengths and fluorescence resonance energy trans-

fer, Curr. Biol. 6 (1996) 178–182.

[25] M.A. Freire, C. Tourneur, F. Granier, J. Camonis, A. El Amrani, K.S.

Browning, C. Robaglia, Plant lipoxygenase 2 is a translation initiation

factor-4E binding protein, Plant Mol. Biol. 44 (2000) 129–140.

[26] T.R. Christianson, R. Sikorski, M. Dante, J. Schero, P. Hieter, Multi-

fonctional yeast high copy-number shuttle vectors, Gene 110 (1992) 119–

122.

[27] R.D. Gietz, R.H. Schiestl, A.R. Willems, R.A. Woods, Studies on the

transformation of intact cells by the LiAc/ss-DNA/PEG procedure, Yeast

11 (1995) 355–360.

[28] B. Guerin, P. Labbe, M. Somlo, Preparation of yeast mitochondria

(Saccharomyces cerevisiae) with good P/O and respiratory control ratios,

Method Enzymol. 55 (1979) 149–159.

[29] Y. Fujiki, A.L. Hubbard, S. Fowler, P.B. Lazarow, Isolation of intracellular

membranes by means of sodium carbonate treatment: application to

endoplasmic reticulum, J. Cell Biol. 93 (1982) 97–102.

[30] W. Paul, R. Hodge, S. Smartt, J. Draper, R. Scott, The isolation and

characterisation of the tapetum-specific Arabidopsis thaliana A9 gene,

Plant Mol. Biol. 19 (1992) 611–622.

[31] M.E. Cartea, M.Migdal, A.M. Galle, G. Pelletier, P. Guerche, Comparison

of sense and antisense methodologies for modifying the fatty acid

composition of Arabidopsis thaliana oilseed, Plant Sci. 136 (1998)

181–194.

[32] C. Koncz, J. Schell, The promoter of TL-DNA gene 50 controls the

tissue specific expression of chimeric genes carried by a novel type

of Agrobacterium binary vector, Mol. Gen. Genet. 204 (1986) 383–

396.

[33] T.Murashige, F. Skoog, A revisedmedium for rapid growth and bio-assays

with tobacco tissue cultures, Physiol. Plant 15 (1962) 473–497.

[34] N. Bechtold, J. Ellis, G. Pelletier, In Planta, Agrobacteriummediated gene

transfer by integration of adult Arabidopsis thaliana plants, C.R. Acad.

Sci. Paris 316 (1993) 1194–1199.

[35] A. Millar, A. Liddell, C. Leaver, Isolation and subfractionation of mito-

chondria from plants, Method Cell Biol. 65 (2001) 53–74.

[36] M. Bellaoui, G. Pelletier, F. Budar, The steady-state level of mRNA from

the Ogura cytoplasmic male sterility locus in Brassica cybrids is deter-

mined post-transcriptionally by its 30 region, EMBO J. 16 (1997) 5057–

5068.

[37] M. Lin, D.H. Turpin, W.C. Plaxton, Pyruvate kinase isozymes from the

green alga, Selenastrum minutum, Arch. Biochem. Biophys. 269 (1989)

219–227.

[38] G. Duby, M. Oufattole, M. Boutry, Hydrophobic residues within the

predicted N-terminal amphiphilic alpha-helix of a plant mitochondrial

targeting presequence play a major role in in vivo import, Plant J. 27

(2001) 539–549.

[39] D.C. Logan, C.J. Leaver, Mitochondria-targeted GFP highlights the

heterogeneity of mitochondrial shape, size and movement within living

plant cells, J. Exp. Bot. 51 (2000) 865–871.

[40] B. Westermann, W. Neupert, Mitochondria-targeted green fluorescent

proteins: convenient tools for the study of organelle biogenesis in Sac-

charomyces cerevisiae, Yeast 16 (2000) 1421–1427.

[41] K. Dimmer, S. Fritz, F. Fuchs, M. Messerschmitt, N. Weinbach, W.

Neupert, B. Westermann, Genetic basis of mitochondrial function and

morphology in Saccharomyces cerevisiae, Mol. Biol. Cell 13 (2002) 847–

853.

[42] I. Kissova, M. Deffieu, S. Manon, N. Camougrand, Uth1p is involved in

the autophagic degradation of mitochondria, J. Biol. Chem. 279 (2004)

39068–39074.

[43] D.C. Logan, I. Scott, A.K. Tobin, The genetic control of plant mitochon-

drial morphology and dynamics, Plant J. 36 (2003) 500–509.

[44] X. Feng, S. Arimura, H.Y. Hirano,W. Sakamoto, N. Tsutsumi, Isolation of

mutants with aberrant mitochondrial morphology from Arabidopsis thali-

ana, Genes Genet. Syst. 79 (2004) 301–305.

[45] S.L. Medberry, B.E. Lockhart, N.E. Olszewski, The Commelina yellow

mottle virus promoter is a strong promoter in vascular and reproductive

tissues, Plant Cell 4 (1992) 185–192.

[46] J. Gourret, R. Delourme, M. Renard, Expression of ogu cytoplasmic male

sterility in cybrids of Brassica napus, Theor. Appl. Genet. 83 (1992) 549–

556.

[47] G. Pelletier, C. Primard, F. Vedel, P. Chetrit, R. Remy, P. Rousselle, M.

Renard, Intergeneric cytoplasmic hybridization in Cruciferae by proto-

plast fusion, Mol. Gen. Genet. 191 (1983) 244–250.

Y. Duroc et al. / Plant Science 170 (2006) 755–767 767

[48] M. Bellaoui, A. Martin-Canadell, G. Pelletier, F. Budar, Low-copy-

number molecules are produced by recombination, actively maintained

and can be amplified in the mitochondrial genome of Brassicaceae:

relationship to reversion of the male sterile phenotype in some cybrids,

Mol. Gen. Genet. 257 (1998) 177–185.

[49] S.W. Gorsich, J.M. Shaw, The importance of mitochondrial dynamics

during meiosis and sporulation, Mol. Biol. Cell (2004).

[50] H. Sesaki, R.E. Jensen, Division versus fusion: Dnm1p and Fzo1p antag-

onistically regulate mitochondrial shape, J. Cell Biol. 147 (1999) 699–706.

[51] Y. Ohsumi, Molecular mechanism of autophagy in yeast, Saccharomyces

cerevisiae, Philos. Trans. R. Soc. Lond. B Biol. Sci. 354 (1999) 1577–

1580 (discussion 1580–1).

[52] D.J. Klionsky, S.D. Emr, Autophagy as a regulated pathway of cellular

degradation, Science 290 (2000) 1717–1721.

[53] A. Abudugupur, K. Mitsui, S. Yokota, K. Tsurugi, An ARL1 mutation

affected autophagic cell death in yeast, causing a defect in central vacuole

formation, Cell Death Differ. 9 (2002) 158–168.

[54] N. Camougrand, A. Grelaud-Coq, E. Marza, M. Priault, J.J. Bessoule, S.

Manon, The product of the UTH1 gene, required for Bax-induced cell

death in yeast, is involved in the response to rapamycin, Mol. Microbiol.

47 (2003) 495–506.

[55] M. Priault, N. Camougrand, K.W. Kinnally, F.M. Vallette, S. Manon, Yeast

as a tool to study Bax/mitochondrial interactions in cell death, FEMS

Yeast Res. 4 (2003) 15–27.

[56] M. Sanchirico, A. Tzellas, T.D. Fox, H. Conrad-Webb, P.S. Periman, T.L.

Mason, Relocation of the unusual VAR1 gene from the mitochondrion to

the nucleus, Biochem. Cell Biol. 73 (1995) 987–995.

[57] R.H. Law, L.B. Farrell, D. Nero, R.J. Devenish, P. Nagley, Studies on the

import into mitochondria of yeast ATP synthase subunits 8 and 9 encoded

by artificial nuclear genes, FEBS Lett. 236 (1988) 501–505.

[58] R. Neu, S. Goffart, K. Wolf, B. Schafer, Relocation of urf a from the

mitochondrion to the nucleus cures the mitochondrial mutator phenotype

in the fission yeast Schizosaccharomyces pombe, Mol. Gen. Genet. 258

(1998) 389–396.

[59] G. Manfredi, J. Fu, J. Ojaimi, J.E. Sadlock, J.Q. Kwong, J. Guy, E.A.

Schon, Rescue of a deficiency in ATP synthesis by transfer of MTATP6, a

mitochondrial DNA-encoded gene, to the nucleus, Nat. Genet. 30 (2002)

394–399.

[60] B. Pineau, C. Mathieu, C. Gerard-Hirne, R. De Paepe, P. Chetrit, Targeting

the NAD7 subunit to mitochondria restores a functional complex I and a

wild type phenotype in the Nicotiana sylvestris CMS II mutant lacking

nad7, J. Biol. Chem. 280 (2005) 25994–26001.