ORIGINAL PAPER

Novel glutaminase free L-asparaginase from Nocardiopsis albaNIOT-VKMA08: production, optimization, functionaland molecular characterization

Balakrishnan Meena • Lawrance Anburajan • Palaiya Sukumaran Dheenan •

Mehmuna Begum • Nambali Valsalan Vinithkumar • Gopal Dharani •

Ramalingam Kirubagaran

Received: 27 July 2014 / Accepted: 29 August 2014

� Springer-Verlag Berlin Heidelberg 2014

Abstract Studies were carried out for the optimization

and production of novel extracellular glutaminase-free

L-asparaginase from Nocardiopsis alba NIOT-VKMA08.

Among the tested carbon and nitrogen sources, maximum

L-asparaginase production was observed with a combina-

tion of L-asparagine and maltose (1.5 %) and twofold

increase in yield (18.47 IU mL-1) was observed with

newly optimized NIOT-asparaginase medium. Activity of

the purified enzyme was moderately inhibited by various

divalent cations and thiol group blocking reagents, with Km

and Vmax of 0.127 mM and 5.50 U lg-1. Optimum pH and

temperature of purified L-asparaginase for the hydrolysis of

L-asparagine was 8.0 and 37 �C, respectively. The enzyme

inhibited polyacrylamide formation in 10 % solution and it

was very specific for its natural substrate L-asparagine.

Partial glutaminase activity was not detected, which could

reduce the possibility of side effects during cancer therapy.

L-Asparaginase biosynthesis gene (ansA) was cloned and

transformed in E. coli JM109. The ansA gene sequence

reported in this study contains several base substitutions

with that of reported sequences in GenBank, resulting in

altered amino acid sequences of the translated protein.

Keywords L-Asparaginase � Nocardiopsis alba � ansA

gene � Polyacrylamide inhibition � NIOT � Asparaginase

medium

Introduction

L-Asparaginase (L-asparagine amidohydrolase, E.C.3.5.1.1)

is an antineoplastic agent [1] used in the lymphoblast leu-

kemia chemotherapy. It catalyzes the deamination of

L-asparagine, an essential amino acid for lymphoblast

growth into L-aspartic acid and ammonia. Based on this

principle, anti-cancer therapy is done using the drug’s ability

to cleave L-asparagine to ammonia and L-aspartic acid in

serum and cerebrospinal fluid. To sustain rapid malignant

growth, lymphatic tumour cells require massive amount of

asparagine from the diet and from other cells. Depleting the

asparagine concentration by continuous supplementation of

L-asparaginase, leads to the death of lymphoblasts [2].

Many investigations have reported that, L-asparaginase

restrain tumorous growth in mouse, rat and human by

inhibiting tumour-specific cells [3, 4]. Hence, the search for

novel sources for glutaminase-free L-asparaginase with low

toxicity is of great interest in current scientific research.

Asparaginase was introduced in food technology after

Swedish studies revealed the ubiquitous occurrence of

acrylamide in commonly consumed starch-based foods that

were baked, roasted or fried [5]. Asparaginase is a promising

enzyme to reduce the quantity of free asparagine in the starch

materials for food production, thus reducing the imminent

risk of generating acrylamide, a potentially carcinogenic

and neurotoxic compound [6]. Bacterial L-asparaginase

B. Meena and L. Anburajan contributed equally to this work.

B. Meena (&) � L. Anburajan � P. S. Dheenan � M. Begum �N. V. Vinithkumar

Andaman and Nicobar Centre for Ocean Science and

Technology, Earth System Sciences Organization, National

Institute of Ocean Technology (ESSO-NIOT), Dollygunj,

Port Blair 744 103, Andaman and Nicobar Islands, India

e-mail: bmeena79@yahoo.com

L. Anburajan

e-mail: anburajanl@yahoo.co.in

G. Dharani � R. Kirubagaran

Marine Biotechnology Group, ESSO-NIOT, Ministry of Earth

Sciences, Govt. of India, Chennai 600 100, India

123

Bioprocess Biosyst Eng

DOI 10.1007/s00449-014-1277-3

possesses considerable medical interest and is being

employed in the therapy of Acute Lymphoblastic Leukemia

(ALL) [7]. Asparaginase from Escherichia coli and Erwinia

chrysanthemi have been used successfully in leukemia

treatment for the past 40 years and are currently in practice

for the treatment of ALL [8]. Like bacteria, actinobacteria

are also a good source for the production of L-asparaginase

[9, 10]. In actinomycetaceae, Streptomyces species such as S.

karnatakensis, S. venezualae, S. longisporusflavus and a

marine Streptomyces sp. PDK2 have been explored for L-

asparaginase production [9]. Among the various sources for

L-asparaginase production, studies in actinobacteria are

meager. In recent past, more research is being done in this

organism since they have gained attention as rich sources of

antibiotics, anti-tumour drugs and other bioactive molecules.

Andaman and Nicobar (A & N) Islands in India is

holding diverse and unexploited ecosystems for the isola-

tion of novel actinobacteria with effective bioactive mol-

ecules [11]. As on date, only limited research on marine

actinobacteria from A & N Islands have been reported.

Rather, these Islands are an unexploited part of Indian

Ocean having rich potential of actinobacterial diversity for

research on their metabolites [12]. The L-asparaginase has

emerged as an excellent anti-cancer drug, reported earlier

from actinobacterial species. Considering the importance

of asparaginase, this study was carried out to produce,

optimize and characterize L-asparaginase from Nocardi-

opsis alba NIOT-VKMA08 from marine sediment of A &

N Islands. Hence various studies were carried out as

mentioned in later section to functionally characterize the

L-asparaginase biosynthesis gene (ansA) of the above-

mentioned strain with the ultimate goal of reconstructing a

microbial cell to overexpress high yield of anti-tumour

enzyme. To our knowledge this is the first report, unveiling

the ability of N. alba isolated from marine sediment to

synthesis potent and novel asparaginase with maximum

stability, substrate specificity and exceptional enzyme

activity.

Materials and methods

Sample collection and isolation of marine

actinobacteria

Marine sediment samples were collected from seven dif-

ferent stations of Port Blair Bay, South Andaman at the

depth of 06–14 m using a Van Veen Grab (KC Denmark

A/S, Denmark). The samples were immediately transferred

to sterile polythene bags and transported to the laboratory.

Isolation of actinobacteria was performed according to the

methodology of Ellaiah, [13] using starch casein agar

(SCA) medium added with nalidixic acid (25 lg mL-1;

HiMedia, India) to inhibit fast growing Gram-negative

bacteria. Sample inoculated plates were incubated at room

temperature (28 ± 2 �C) for 21 days and the colonies were

recognized by their characteristic chalky to leathery

appearance on SCA plates. Individual colonies were

selected and sub-cultured in SCA slants for further char-

acterization studies.

Conditions for L-asparaginase production

Production of L-asparaginase by NIOT-VKKMA08 strain

was performed in the medium reported previously by

Gulati et al. [14]. The production medium, asparagine

dextrose salts agar (L-asparagine 1.0 %, dextrose 0.2 %,

K2HPO4 0.1 %, MgSO4 0.05 %, agar 1.5 %) was supple-

mented with different concentrations of phenol red

(0.001–0.009 %), whereas the control plates were main-

tained without asparagine and phenol red. After 7 days of

incubation, the diameter of clear pink zone around the

colony was measured and documented.

Physiological characterizations of potential isolate

Morphological, biochemical, cultural and physiological

characterization of the potential strain, NIOT-VKMA08

was performed as recommended by the International

Streptomyces Project (ISP) and Shirling and Gottileb [15].

Microscopic depiction was performed with cover slip cul-

ture and cellophane method [16]. Formation of aerial,

substrate mycelium and spore arrangements on mycelium

were monitored under a phase contrast microscope (Nikon

Eclipse E600, USA) at 1009 magnification and scanning

electron microscopy (TESCAN VEGA3, Czech Republic).

The culture characteristics such as growth, coloration of

aerial and substrate mycelia and formation of soluble pig-

ment were investigated in seven different media including

SCA, ISP2–ISP7 using the procedures as recommended by

ISP. Biochemical characterization namely Gram’s reaction,

MR-VP, H2S production, nitrate reduction, oxidase, cata-

lase and starch hydrolysis were also performed as sug-

gested by ISP. Physiological characterizations such as,

effect of pH (5–11), growth rate in NaCl (5–30 %) and

survival at 50 �C were also evaluated. Further, the capa-

bility of isolates to utilize various carbon sources was

estimated using ISP2 agar medium with phenol red as

indicator [17]. Based on the above characteristics, genus

level identification of the potential strain was made by

Bergey’s manual of systematic bacteriology [18].

Identification of potential strain

The 16S rRNA sequence analysis and phylogenetic tree

construction by neighbor-joining method was performed

Bioprocess Biosyst Eng

123

for species level confirmation of Nocardiopsis sp. NIOT-

VKMA08. Genomic DNA of potential strain was isolated

by following the modified procedure of Kutchma et al.

[19]. The 16S rRNA amplification was performed with

universal primers 16Sf (50 AGAGTTTGATCCTGGCT

CAG 30) and 16Sr (50 GGTTACCTTGTTACGACTT 30).The final volume of reaction was 25 lL, which comprised

of Taq buffer (19), dNTP’s (200 lM) (MBI Fermentas,

USA), forward and reverse primer (0.5 lM), MgCl2(1.0 mM), Taq DNA polymerase (1.25 U; MBI Fermen-

tas), template (1 lL) and autoclaved Milli Q water. PCR

was performed with the initial denaturation at 98 �C for

3 min, followed by 30 cycles of reaction with denaturation

at 94 �C for 1 min; annealing at 53 �C for 1 min; extension

at 72 �C and final extension at 72 �C for 10 min. The

positive amplicons as judged by size was purified using

QIAquick PCR purification kit (Qiagen, Germany) and

sequenced on an ABI PRISM 377 genetic analyzer

(Applied Biosystems, USA). The acquired 16S rRNA

sequences of Nocardiopsis sp. NIOT-VKMA08 was

aligned manually using GenBank database with BLAST

[20]. The sequences with 98–100 % homology were con-

sidered for molecular taxonomy analysis. Multiple

sequence alignment was performed for the 16S rRNA

sequence generated in this study and sequences of Gen-

Bank database with CLUSTAL X program [21]. Phyloge-

netic tree was constructed using the neighbor-joining and

maximum-parsimony tree making methods in Molecular

Evolutionary Genetic Analysis (MEGA version 5.0) soft-

ware [22] based on bootstrap values of 1,000 replication

[23].

Production of L-asparaginase by shake flask

fermentation

Two different production medium viz., tryptone glucose

yeast extract (TGY) broth [7] contained (g L-1) glucose

10, K2HPO4 1.0, yeast extract 5.0, tryptone 5.0 with pH 7,

and tryptone fructose yeast extract (TFY) broth [24]

comprised (g L-1) tryptone 5.0, yeast extract 5.0, fructose

10, K2HPO4 1.0 with pH 7, were tested for L-asparaginase

production by N. alba NIOT-VKMA08. Fermentation was

performed with 100 mL production medium, incubated at

30 �C in shaker incubator for 10 days to estimate the cell

growth and L-asparaginase production. After incubation,

production medium was filtered through Whatman’s no. 1

filter paper and the filtrate was separated by centrifugation

at 10,000 rpm for 10 min. The centrifuged cell free

supernatant (CFS) was used as enzyme source for further

characterization studies. Enzyme activity was determined

at 24 h interval and the growth intensity was expressed in

dry weight of biomass [9].

Qualitative assay of L-asparaginase

Well diffusion assay was performed in asparagine dextrose

salt agar with 1 % (w/v) L-asparagine and L-glutamine as

substrates. Wells with 8 mm dimension were made using

sterile cork borer and in each well, 200 lL of CFS was

dispensed aseptically and incubated at room temperature.

After 12 h, clear pink zones around the wells due to ami-

dohydrolase indicate the positive result for L-asparaginase

activity.

Quantitative assay of L-asparaginase

L-Asparaginase activity in the culture filtrate was deter-

mined by the method described by Imada et al. [25]. In this

method, the rate of hydrolysis of L-asparagine was achieved

by measuring the released ammonia using Nessler’s

reagent. For this purpose 0.1 mL of CFS was added with

1 mL of 0.1 M sodium borate buffer and 0.04 M L-aspar-

agine solution and incubated at 37 �C for 30 min. The

reaction was stopped by the addition of 0.5 mL of 0.1 N

trichloroacetic acid. The resulting precipitated protein was

removed by centrifugation and each sample was individu-

ally mixed with 1 mL of 1 N NaOH and 0.2 mL of 0.1 M

EDTA. Subsequently, 0.5 mL of Nessler’s reagent was

added to the reaction tubes after 2 min of incubation.

Change in color from yellow to orange in reaction tube after

5 min was measured and documented at 450 nm using a

Lambda 25 UV/Vis spectrophotometer (PerkinElmer, Sin-

gapore). The recorded OD values were compared with

ammonium sulphate standard graph and the released

ammonia was documented as lM concentration. One

international unit (IU) of L-asparaginase is the amount of

enzyme needed to liberate 1 lmol of ammonia in 1 min at

30 �C. Protein content of CFS was estimated using bovine

serum albumin as standard according to the method of

Lowry et al. [26]. Asparaginase activity was calculated and

expressed in units mg-1 protein.

Optimization of culture conditions for L-asparaginase

production

Influence of different culture conditions such as batch time,

effect of initial pH, temperature, carbon and nitrogen

sources on enzyme production were determined.

Effect of batch time, initial pH and temperature

NIOT-VKMA08 strain was inoculated in TGY broth and

incubated at 30 �C in orbital shaker with 125 rpm. Culture

broth was analyzed every 24 h of incubation for enzyme

activity. Batch time analysis was performed from 0 to

Bioprocess Biosyst Eng

123

15 days to determine the effect of batch time on growth

and active metabolite production [7]. Impact of pH on

L-asparaginase production was examined by cultivating the

strain in TGY with the pH range of 5–10. Optimum tem-

perature for enzyme production was determined in TGY

broth at the range of 20–40 �C for 10 days [9].

Effect of carbon and nitrogen sources

To investigate the effect of carbon sources on L-asparagi-

nase production, NIOT-VKMA08 was cultivated in TGY

broth supplemented with glucose, starch, maltose, fructose,

lactose and sucrose at the final concentration of 1 % (w/v).

Impact of best carbon source (0.5–2.5 % w/v) on L-aspar-

aginase production by the strain was studied by the meth-

odology of Narayana et al. [9]. Different nitrogen sources

namely malt extract, peptone, yeast extract, soya peptone

were supplemented at the rate of 1–5 % (w/v) and with L-

asparagine, ammonium chloride, ammonium nitrate and

ammonium sulphate were added at the rate of 0.5–2.5 % in

TGY broth. Impact of best nitrogen source (yeast extract,

1–5 % w/v) on L-asparaginase production was also studied.

Effect of L-asparagine concentration (0.5–2.5 %) in enzyme

production under induced condition was performed as

described by Sudhir et al. [10].

Partial purification of L-asparaginase

Purification of the enzyme was performed by various steps

such as ammonium sulphate precipitation, dialysis and ion

exchange chromatography [27]. After each step, the L-aspar-

aginase activity and total protein content were determined.

Ammonium sulphate precipitation

Precipitation of L-asparaginase with ammonium sulphate

was performed according to the method of Zhang et al. [28]

with slight modification. Briefly, eight equal portions

(40 mL) of clarified CFS were placed in separate beakers

(100 mL) and incubated at 10 �C. The percentage of

ammonium sulphate required to achieve saturation

(0–80 %) with CFS was calculated as reported previously

by Yu and Tang [29]. Ammonium sulphate was added to

the CFS with stirring at 4 �C and the precipitate was sep-

arated by centrifugation (Sigma, USA) at 4 �C for 30 min.

Further, to obtain complete precipitation of crude enzyme,

the CFS was subjected to ammonium sulphate precipitation

at 45 % (w/v) saturation. After desalting, the precipitate

was suspended in sodium borate buffer (pH 8.6) to produce

the same volume of solution as the original sample of CFS

and the enzyme activity was determined. Briefly, ammo-

nium sulphate was added to CFS gradually with mechan-

ical stirring at 4 �C for 2 h and incubated overnight at

4 �C. Precipitate was separated by centrifugation at

10,000 rpm at 4 �C for 15 min and was suspended in

sodium borate buffer. The precipitated enzyme was dis-

solved in 10 mL of sodium borate buffer and the dialysis

was performed with the membrane of 12–14 kDa cut off

limit (HiMedia, India). Dialysis bag was placed in 250 mL

of 0.5 M chilled sodium borate buffer (pH 8.6) solution

with continuous stirring in ice cold condition for 8 h. After

dialysis, the supernatant was subjected for protein estima-

tion and enzymatic assay. The sample was lyophilized and

stored at 4 �C for further purification.

Ion exchange chromatography

Ion exchange chromatography was performed using

Q-Sepharose column in Fast Protein Liquid chromatogra-

phy (FPLC) (AKTAprime plus, Amesham Biosciences,

USA). The column was pre-equilibrated with buffer

(A) (50 mM Tris–HCl, pH 8.6) and the enzyme was eluted

by linear gradient buffer (B) (100 mM PO4, pH 8.6 with

500 mM NaCl) at a flow rate of 1 mL min-1. The active

fractions were collected and pooled, dialysed with distilled

water and lyophilized [30].

Characterization of partially purified enzyme

The lyophilized samples were used for the enzyme char-

acterization studies. Enzyme activity was performed with a

wide range of pH, temperature and incubation time [24].

Effect of pH, temperature on enzyme activity

and stability

The effect of pH on purified enzyme was investigated in the

range of 4.0–10.5 using 15 mM sodium acetate buffer (pH

4.0–6.0), sodium phosphate buffer (pH 6.5–8.0) and carbon-

ate–bicarbonate buffer (pH 8.5–10.5) with an incubation for

1 h. Stability of L-asparaginase at optimum pH was deter-

mined by incubating the enzyme at pH 8.0 at various time

intervals and the residual activity was evaluated in 15 mM

phosphate buffer (pH 8.0). Optimal temperature of purified

enzyme activity was measured by incubating the enzyme–

substrate mixtures for 1 h in the temperature range of

10–60 �C at pH 8.0 and the liberated ammonia was measured

by Nesslerlization method. Thermal stability of the purified L-

asparaginase was measured in terms of residual activity after

incubating the enzyme in 0.01 M L-asparagine with 15 mM

sodium phosphate buffer (pH 8.0) at 37 �C up to 5 h.

Temperature reversibility

Effect of temperature on enzyme activity was performed by

following the methodology of Mohan Kumar and

Bioprocess Biosyst Eng

123

Manonmani [31]. The purified enzyme was incubated at

10–50 �C for 1 h in duplicates. After incubation, one set of

the samples was taken out and cooled immediately in an

ice bath and then the residual activity was measured. The

other set of tubes was analyzed for enzyme activity at

prescribed time intervals by allowing the reaction mixture

to attain room temperature gradually.

Effect of inhibitor, detergents and metal ions

on enzyme activity

The effect of inhibitors such as ethylenediaminetetraacetic

acid (EDTA) (2 mM), b-mercaptoethanol (2 mM), iodoa-

cetamide, cysteine (1 mM) and urea (2.5 mM) on enzyme

activity was investigated. The effect of detergents namely

sodium dodecyl sulphate (SDS) (2 %), Triton X-100,

Tween-80 and Tween-20 (1 %) was investigated on

L-asparaginase activity with 10 mM CaCl2 and 1 M gly-

cine. Metals of various salts such as MgSO4, CaCl2, NaCl,

Na2SO4, Na2CO3, KCl, K2SO4, KI, CoCl2, CuSO4, MgCl2,

ZnSO4, FeCl3, FeSO4�H2O, NH4Cl, NH4NO3 and

(NH4)2SO4 were evaluated for their effect on enzyme

activity at the final concentration of 1 mM. The residual

enzyme activity was measured and documented after the

enzyme was incubated with respective inhibitor/chelator/

metal ions for 30 min at room temperature.

Determination of substrate specificity

Substrate specific activity of the purified enzyme was

determined with L-asparagine, L-glutamine, L-aspartic acid,

L-glutamic acid, L-histidine, glycine and L-arginine at the

final concentration of 10 mM [24]. Relative activity was

expressed as the percentage ratio of enzyme activity

determined against different structural analogs of L-aspar-

agine to enzyme activity with L-asparagine. The rate of

reaction was measured as the total ammonia released dur-

ing enzyme activity.

Determination of Km and Vmax

The kinetic constants, Km and Vmax were determined by the

method of Lineweaver and Burk [32]. The initial velocity

of the sample was estimated in different L-asparagine

concentrations (0.5 mM–2.0 M).

Inhibition of polyacrylamide formation

A reaction mixture of 5.0 mL of 10 % acrylamide solution,

2.5 mL of Milli Q water and 2.5 mL of Tris–HCl (pH 8.5)

was prepared. The purified enzyme was added to the

reaction mixture and incubated at 45 �C for 30 min. After

incubation, 200 lL of 10 % ammonium persulphate and

20 lL tetramethylethylenediamine were added. Reaction

tubes were incubated at room temperature and period of

solidification was recorded [33].

Molecular characterization of L-asparaginase

biosynthesis gene

Genomic DNA isolation, bacterial strain and plasmid

The genomic DNA of NIOT-VKMA08 was extracted

according to Kutchma et al. [19]. Escherichia coli JM109

was used as the bacterial host for transformation in cloning

studies and plasmid pDrive was used as cloning vector.

PCR amplification of L-asparaginase gene (ansA)

The ansA gene of NIOT-VKMA08 was PCR amplified

using gene-specific primers designed using a programme

available at http://frodo.wi.mit.edu/primer3 (F-50ATGACC

CAGACCCCGCTGCCCGGCTAC30, R-50TCACAGGGA

ACGGACCTCGCCCACGAC30). PCR was performed in

50 lL reaction mixture which contained 50 ng of genomic

DNA, 0.5 lM of each primer, 200 lM each of dNTP (MBI

Fermentas), 1.25 U of Pfu DNA polymerase (MBI Fer-

mentas), 19 Pfu buffer; 2.5 mM of MgSO4, and auto-

claved Milli Q water. The amplification was performed in a

master cycler (Eppendorf, Germany) with the following

conditions; the initial denaturation at 94 �C for 3 min,

followed by 30 repeated cycles with 94 �C for 30 s, 53 �C

for 1 min, 72 �C for 2 min and final extension at 72 �C for

5 min. PCR amplicon was analyzed and documented in gel

documentation system (UVP Bio Spectrum Imaging sys-

tem, USA).

Molecular cloning and sequencing

PCR amplicon of L-asparaginase biosynthesis gene (ansA)

was gel purified by MinElute Gel purification Kit (Qiagen,

Germany) and cloned into pDrive (Qiagen), according to

the manufacturer’s instructions. The pDrive-ansA construct

was transformed into competent E. coli JM109 (recA1,

endA1, gyrA96, thi-1, hsdR17 (rK-mk?), e14-(mcrA-),

supE44, relA1, D(lac-proAB)/F0 (traD36, proAB?, lac Iq,

lacZ DM15) and plated on Luria–Bertani (LB) agar con-

taining ampicillin (100 lg mL-1), IPTG (50 lM) and

X-gal (80 lg mL-1) and incubated overnight at 37 �C. The

white colonies were selected for PCR amplification with

vector primers M13f-M13r (MBI Fermentas) and the

clones with correct insert as judged by size were sequenced

on an ABI PRISM 377 genetic analyzer (Applied Biosys-

tems Inc., USA).

Bioprocess Biosyst Eng

123

In silico sequence analysis

The in silico sequence analysis was performed on the

attained nucleotide sequences which were compared with

database sequences using BLAST provided by NCBI

(http://www.ncbi.nlm.nih.gov) and were aligned, clustered

using CLUSTAL-X version 1.81 program [21]. The output

alignments were imported into GeneDoc program (http://

www.psc.edu/biomed/genedoc/) and BioEdit version 7.05

program (http://www.mbio.ncsu.edu/BioEdit/) to calculate

the percent identities among the nucleotide and amino acid

sequences. Molecular mass and theoretical pI of the poly-

peptide was predicted using ProtParam tool (http://www.

expasy.org/tools/protparam). The sequences generated in

this study has been deposited in GenBank database under

the accession number (KF724082).

Results

Isolation and screening of marine actinobacteria

for L-asparaginase production

A total of 179 different actinobacteria were isolated from

marine sediments of 7 stations located in Port Blair Bay

and screened for L-asparaginase production by rapid plate

assay. Of 179 isolates, 16 exhibited positive results for L-

asparaginase production. Among the positive isolates, the

highly potent strain NIOT-VKKMA08 was selected for

further characterization studies on L-asparaginase.

Biochemical characterization and molecular

identification of NIOT-VKMA08

The NIOT-VKMA08 is Gram positive, non-motile and

recorded excellent growth with abundant aerial mycelium

on yeast malt agar (ISP-2) with 50 % sea water. Moderate

growth was also recorded in oat meal agar (ISP-3) and

inorganic salt agar (ISP-4). Based on the growth charac-

teristics, ISP-2 medium prepared in 50 % sea water was

selected as the optimal medium for the cultivation of

potential strain. Moreover, NIOT-VKMA08 exhibited

excellent growth with abundant aerial mycelium at pH of

7–10, temperature range of 30–35 �C and NaCl range of

5–20 %. Aerial mycelium was unbranched and the spores

appeared as long chain (Fig. 1a), white colored with sparse

substrate mycelium and brownish orange reverse pigment.

16S rRNA sequence (1,466 bp) generated in this study has

been deposited in GenBank under the accession number

KF031009. BLAST and the phylogenetic analysis estab-

lished that the deduced nucleotide sequences of NIOT-

VKMA08 were highly homologous (100 %) with the

reported 16S rRNA sequences of Nocardiopsis alba

(GenBank accession no. KC119569) (Fig. 1b). Based on

the morphological, biochemical characteristics and phylo-

genetic analysis, the potential actinobacterial isolate NIOT-

VKMA08 was identified as Nocardiopsis alba.

Production of L-asparaginase by shake flask

fermentation

The promising isolate was inoculated into two different

production media viz., TGY and TFY. Upon submerged

fermentation, maximum enzyme production was observed

in TGY medium by NIOT-VKMA08. The strain of this

study exhibited maximum enzyme activity and was selec-

ted for further optimization and characterization studies.

Optimization of culture conditions for L-asparaginase

production

Effect of batch time

The production medium with the isolate was analyzed at

24 h interval for enzyme activity. Enzyme activity was

observed from the first day of incubation and it was found

increasing with maximum activity on 6th day

(6.73 IU mL-1) and reduced from 9th day. Maximum

enzyme production was related with the dry weight of

biomass and total protein of CFS (Fig. 2a).

Effect of pH and temperature

The effect of pH on L-asparaginase production was deter-

mined with different pH range of 5–10. The results showed

a negative impact on growth and enzyme production in

acidic condition. Low level of enzyme activity was

obtained at pH 5.0 (1.15 IU mL-1), 6.0 (1.25 IU mL-1)

and was maximum (6.79 IU mL-1) at pH 8.0. However,

similar levels in enzyme production were recorded at pH

7.4, 8.0 and 9.0 (Fig. 2a). To narrow down the pH range for

enzyme production, assay was carried out at pH 7.6, 7.8,

8.0, 8.2, 8.4, 8.6 which showed a maximum production

(7.13 IU mL-1) at pH 8.2. Effect of temperature on

enzyme production was studied at different temperatures

and the production was optimum (7.16 and 7.24 IU mL-1)

at 30–35 �C (Fig. 2b). The extreme pH and temperature

revealed a negative influence in the biomass and enzyme

production from the strain NIOT-VKMA08.

Effect of carbon and nitrogen sources

To maximize the production of L-asparaginase, experiments

were conducted using various carbon sources. NIOT-

VKMA08 expressed maximum enzyme activity

(9.51 IU mL-1) with maltose (1 %) as sole carbon source

Bioprocess Biosyst Eng

123

and the production was marginally favorable with starch

and glucose. Whereas, no significant effect was observed

with fructose, sucrose and lactose substrates. While opti-

mizing the enzyme production with starch, glucose

and maltose sources at 0.5–2.5 %, maximum enzyme

production of 10.93 IU mL-1 was observed with 1.5 %

maltose (Table 1). Of different nitrogen sources, yeast

extract favored maximum L-asparaginase production

(11.43 IU mL-1) followed by peptone with 7.75 IU mL-1.

Further experiments on the effects of various yeast extract

concentrations (1.0–5.0 %) on enzyme production were also

performed. An elevated range in asparaginase production

(11.43 IU mL-1) and biomass was observed with 2 % yeast

extract (Table 1). The declined phase in enzyme production

was observed with peptone and yeast extract at 4–5 %.

Effect of L-asparagine concentration on L-asparaginase

production

To select the most appropriate and optimal substrate con-

centrations for maximum enzyme production, experiment

was carried out with different concentrations of L-aspara-

gine and combination of L-asparagine, maltose and sucrose.

Results obtained at different initial concentrations of

maltose, starch and L-asparagine has been considered as

control experiments. The effect of initial concentrations of

glucose ([0.5 %) on L-asparaginase production from

NIOT-VKMA08 was insignificant. However, increased

level of L-asparaginase synthesis was recorded with wide

range of L-asparagine concentrations. In the case of

0.5–2.5 % L-asparagine, maximum L-asparaginase activity

of 12.43 IU mL-1 was recorded in 1.5 % of L-asparagine

without glucose. Maximum L-asparaginase activity of

12.91 IU mL-1 was achieved at 1.0 % maltose with 1.5 %

L-asparagine (Table 1).

Production of L-asparaginase in optimized

NIOT-asparaginase (ASP) medium

Growth kinetics and L-asparaginase production by NIOT-

VKMA08 strain were studied with novel optimized

parameters in NIOT-ASP medium. From the results it is

Fig. 1 a Scanning electron microscopy image of Nocardiopsis alba

NIOT-VKMA08. b Phylogenetic tree based on 16S rRNA sequences

using neighbor-joining method for the strain NIOT-VKMA08.

Branch distances represent nucleotide substitution rate and scale bar

represents the number of changes per nucleotide position

Bioprocess Biosyst Eng

123

evident that, compared to the basal medium, enzyme pro-

duction and biomass were found increased to

18.47 IU mL-1, 28 mg mL-1 and 49 mg mL-1 of

L-asparaginase, protein and biomass, respectively. These

results demonstrated that, the newly optimized condition

was in favor of increase in generation time leading to the

elevated production of L-asparaginase.

Partial purification of L-asparaginase

The degree of ammonium sulphate saturation in CFS on

salting out was examined by adding wide concentrations of

ammonium sulphate (0–80 %) at 4 �C with continuous

stirring. At 50 % salt saturation, no enzyme activity

remained in CFS and all enzymes were recovered in the

precipitate (Fig. 3a). It was also observed that, above 30 %

of salt concentration the enzyme isotherms were virtually

flat and at 50 % salt saturation point, enzyme activity was

near to zero in CFS. However, 80 % salt saturation was

required to precipitate the total protein in CFS (Fig. 3b).

Because of the presence of different proteins with different

hydration requirements [34], total protein curves did not

display a sharp concentration change at any specific salt

saturation. Moreover, it was found that 80 % of ammonium

sulphate saturation is required to precipitate most of the

proteins and also authenticated the hydrophobic nature of

the enzyme. In this study, L-asparaginase was precipitated

at 45 % ammonium sulphate which leads to high fold in

yield and purification of enzyme. Nocardiopsis alba NIOT-

VKMA08 showed crude L-asparaginase with total enzyme

activity of 18,723.43 IU and total protein of 11,730.71 mg.

After dialysis, the total enzyme activity observed was

6,261.80 IU and total protein estimated was 220 mg.

(Table 2). The enzyme purified with Q-Sepharose illus-

trated the specific activity of 93.28 IU mg-1 and the fold

of purification observed was 58.44 with 26.16 % yield.

Fractionation on Q-Sepharose ion exchange chromatogra-

phy exhibited two different protein molecular peaks, in

which one sharp distinctive peak represents L-asparaginase

activity (Fig. 4a).

Characterization of partially purified enzyme

Effect of pH, temperature on enzyme activity and stability

Reaction rate of L-asparaginase from NIOT-VKMA08 was

determined at various pH values with the maximum reac-

tion rate observed at pH 8.0. Hence, the enzyme was active

between pH 6.5 and 10 (Fig. 4b). At lower pH, enzyme

activity was found decreasing (20 %) and pH range profile

of the asparaginase activity approximated a sigmoid curve,

with maximum activity at alkaline pH and lack of activity

at acidic pH. However, more than 80 % of maximum

activity was recorded between pH 7.0 and 9.0. Moreover,

the enzyme was found stable at alkaline pH (8.0–10.0) and

also preserved more than 90 % of its original activity when

incubated up to 36 h (data not shown).

Reaction profile of L-asparaginase was also evaluated

at 20–75 �C, and the maximum activity was attained at

37 �C. At increasing temperatures, reaction rate declined

sharply with the loss of 80 % of its original activity at

75 �C (Fig. 4c). Further, the enzyme activity was exam-

ined with different incubation period (10–60 min),

wherein activity was maximum at 30 min and found

steady up to 60 min of incubation. Moreover, no loss in

enzyme activity and stability was observed at room

temperature for 24 h and also when maintained at -20 �C

for 3 weeks.

Temperature reversibility

Studies were carried out to determine the stability of

enzyme activity after exposure to different temperature and

its reversibility based on the earlier report of Mohan Kumar

and Manonmani [32]. Incubation at different temperatures

between 20 and 50 �C for 1 h and immediate cooling in ice

Fig. 2 a Effect of pH on enzyme production. b Effect of temperature

(�C) on enzyme production

Bioprocess Biosyst Eng

123

Table 1 Effect of various carbon and nitrogen sources on L-asparaginase production by Nocardiopsis alba NIOT-VKMA08

Carbon

source

Concentration

(%)

Initial

pH

Final

pH

Asparaginase

activity (IU mL-1)

Nitrogen

source

Concentration

(%)

Asparaginase

activity (IU mL-1)

Cell dry weight

(mg mL-1)

Starch 0.50 8.20 8.00 05.04 ± 0.029 Yeast extract 1.00 07.15 ± 0.003 31.34 ± 0.013

1.00 8.20 8.00 06.10 ± 0.009 2.00 11.43 ± 0.007 48.92 ± 0.021

1.50 8.20 8.00 07.13 ± 0.005 3.00 08.23 ± 0.065 48.10 ± 0.021

2.00 8.20 8.00 03.28 ± 0.021 4.00 05.34 ± 0.008 40.16 ± 0.032

2.50 8.20 7.90 02.31 ± 0.190 5.00 04.62 ± 0.012 37.78 ± 0.022

Peptone 1.00 06.23 ± 0.005 24.79 ± 0.018

2.00 07.75 ± 0.001 40.61 ± 0.061

3.00 05.22 ± 0.001 45.23 ± 0.075

4.00 03.89 ± 0.001 36.12 ± 0.076

5.00 01.82 ± 0.003 30.05 ± 0.053

Glucose 0.50 8.20 7.10 06.70 ± 0.001 Malt extract 1.00 01.65 ± 0.004 20.87 ± 0.061

1.00 8.20 6.50 04.23 ± 0.052 2.00 03.13 ± 0.007 36.58 ± 0.038

1.50 8.20 6.10 03.12 ± 0.004 3.00 04.57 ± 0.005 38.95 ± 0.046

2.00 8.20 5.30 01.98 ± 0.013 4.00 02.76 ± 0.021 29.79 ± 0.067

2.50 8.20 4.00 01.16 ± 0.022 5.00 01.45 ± 0.034 19.15 ± 0.010

Soya

peptone

1.00 01.89 ± 0.007 03.97 ± 0.034

2.00 02.79 ± 0.002 06.54 ± 0.019

3.00 03.64 ± 0.020 07.98 ± 0.047

4.00 02.72 ± 0.004 07.24 ± 0.055

Maltose 0.50 8.20 7.40 07.19 ± 0.006 5.00 01.34 ± 0.005 06.12 ± 0.063

1.00 8.20 7.30 09.51 ± 0.002

1.50 8.20 7.10 10.93 ± 0.005 L-Asparagine 0.50 09.46 ± 0.003 19.34 ± 0.048

2.00 8.20 7.00 08.43 ± 0.003 1.00 10.54 ± 0.007 27.80 ± 0.097

2.50 8.20 6.60 07.32 ± 0.092 1.50 12.43 ± 0.004 32.90 ± 0.041

2.00 10.14 ± 0.003 32.00 ± 0.030

2.50 07.49 ± 0.003 26.89 ± 0.027

Ammonium

chloride

0.50 01.84 ± 0.043 07.60 ± 0.009

1.00 02.89 ± 0.056 14.35 ± 0.016

Sucrose 0.50 8.20 6.00 02.11 ± 0.007 1.50 03.21 ± 0.021 24.57 ± 0.079

1.00 8.20 5.40 01.23 ± 0.032 2.00 02.12 ± 0.032 23.87 ± 0.040

1.50 8.20 4.30 00.86 ± 0.061 2.50 01.32 ± 0.021 08.90 ± 0.022

2.00 8.20 3.10 00.12 ± 0.002

2.50 8.20 2.60 – Ammonium

nitrate

0.50 02.35 ± 0.001 08.56 ± 0.091

1.00 03.25 ± 0.023 16.73 ± 0.064

1.50 04.01 ± 0.310 18.61 ± 0.011

2.00 04.23 ± 0.042 20.32 ± 0.014

2.50 01.45 ± 0.010 06.98 ± 0.018

Lactose 0.50 8.20 5.70 1.65 ± 0.212 Ammonium

sulphate

0.50 07.13 ± 0.060 31.33 ± 0.099

1.00 8.20 5.20 1.34 ± 0.014 1.00 11.24 ± 0.020 40.34 ± 0.024

1.50 8.20 4.20 0.94 ± 0.002 1.50 08.22 ± 0.043 34.56 ± 0.005

2.00 8.20 3.80 0.23 ± 0.005 2.00 08.13 ± 0.220 24.21 ± 0.023

2.50 8.20 3.30 – 2.50 07.52 ± 0.015 20.32 ± 0.056

Bioprocess Biosyst Eng

123

results in progressive loss of enzyme activity. However,

gradual cooling of the enzyme after incubation in different

temperature revealed negative impact in enzyme activity

(Table 3).

Effect of inhibitor, activators and metal ions on enzyme

activity

The L-asparaginase activity was assayed with different

inhibitors/activators; of which b-mercaptoethanol (b-ME),

cysteine and iodoacetamide showed 100 % inhibition in

enzyme activity. The inhibition activity by thiol group

blocking reagents, cysteine and iodoacetamide authenti-

cated the role of sulfhydryl groups in catalytic activity of

enzyme. Tween-80 and Triton-X100 revealed the

enhanced enzyme activity, whereas Tween-20 did not

influence the L-asparaginase activity and SDS revealed

33 % relative activity. Urea and EDTA did not reveal any

inhibitory effects on enzyme activity from N. alba NIOT-

VKMA08.

Metal ions, Mg2?, Na ?, Ca2?, Co2? and Zn2? were

found to restrain the enzymatic activity and Fe3?, KI and

K? acted as enhancers. The inhibition of enzyme activity

by Hg2?, Cd2? and Cu2? might be indicative of essential

vicinal sulfhydryl groups of the enzyme for productive

catalysis (Table 4).

Determination of substrate specificity

The substrate specificity of purified enzyme exhibited

positive enzyme activity with L-asparagine; however, no

glutaminase activity was observed (Table 5). This property

makes N. alba NIOT-VKMA08 a potential source for the

glutaminase free L-asparaginase production, which can be

used in medical applications.

Determination of Km and Vmax

Based on Lineweaver–Burk analysis, Km and Vmax of

purified L-asparaginase observed from NIOT-VKMA08

were 0.127 mM and 5.50 U lg-1, which indicate the

affinity of enzyme to L-asparagine.

Effect of L-asparaginase in polyacrylamide formation

Immediate solidification of polyacrylamide was occurred

in reaction mixture without the supplementation of

Fig. 3 a Effect of ammonium sulphate saturation percentage on

concentration of enzyme in precipitate and supernatant. b Effect of

ammonium sulphate saturation percentage on concentration of total

protein in precipitate and supernatant

Table 2 Purification profile of

L-asparaginase from

Nocardiopsis alba NIOT-

VKMA08

Purification step Total enzyme

(IU)

Total protein

(mg)

Specific activity

(IU mg-1)

Purification

fold

Yield

(%)

Crude 18,723.43 11,730.71 1.60 1.00 100.00

Ammonium sulphate

precipitation

13,090.00 4,970.00 2.63 1.65 69.91

Dialysis 6,261.80 220.00 28.46 17.83 33.44

Q-Sepharose

chromatography

4,897.37 52.50 93.28 58.44 26.16

Bioprocess Biosyst Eng

123

Fig. 4 a Q-Sepharose

chromatography of L-

asparaginase activity (IU mL-1)

and total protein (OD at

280 nm). b Effect of pH on

enzyme activity. c Effect of

temperature (�C) on enzyme

activity

Bioprocess Biosyst Eng

123

L-asparaginase. Whereas, delayed solidification was

observed with the addition of L-asparaginase (Table 6).

Partially purified enzyme firmly stopped the polyacryl-

amide formation, since the solidification period was

delayed with increased enzyme concentration ([60 min).

PCR amplification, molecular cloning and in silico

analysis of L-asparaginase biosynthesis gene (ansA)

The L-asparaginase biosynthesis gene (ansA) of N.

alba NIOT-VKMA08, encodes a polynucleotide of

963 bp (Fig. 5a) composed of 320 amino acids having

a molecular mass of 33402 Da., calculated based on in

silico estimates (http://www.expasy.org/tools/prot

param). Isoelectric points of ansA protein was deter-

mined as 5.15. The L-asparaginase gene was cloned in

pDrive, transformed in E. coli JM109 and the ansA

gene construct was confirmed by nucleotide sequence

analysis. In silico sequence analysis of ansA gene

from NIOT-VKMA08 revealed maximum base sub-

stitutions at nucleotide level when compared to the

whole genome sequences deposited in GenBank

(accession nos. CP002040, CP003219 and AP010968).

The nucleotide substitutions translated into maximum

amino acid changes than Streptomyces cattleya

(CP003219), Kitasatospora setae (AP010968) and

minimum changes than the Nocardiopsis dassonvillei.

In N. dassonvillei the major differences were observed

Table 3 Influence of

temperature (�C) reversibility of

the purified L-asparaginase from

Nocardiopsis alba NIOT-

VKMA08

Temperature

(�C)

Immediately assayed Cooled to room temperature and assayed

Residual activity (%) Loss in enzyme

activity (%)

Residual activity (%) Loss in enzyme

activity (%)

Control 100 ± 0.000 0.00 ± 0.000 100 ± 0.000 0.00 ± 0.000

20 95.68 ± 0.001 4.32 ± 0.001 89.43 ± 0.004 10.57 ± 0.004

30 88.97 ± 0.023 11.03 ± 0.023 75.32 ± 0.005 24.68 ± 0.005

35 85.46 ± 0.045 14.54 ± 0.045 64.51 ± 0.006 35.49 ± 0.006

37 85.16 ± 0.210 14.84 ± 0.210 59.13 ± 0.001 40.87 ± 0.001

40 83.23 ± 0.140 16.77 ± 0.140 50.59 ± 0.005 49.41 ± 0.005

50 80.19 ± 0.110 19.81 ± 0.110 41.43 ± 0.008 58.57 ± 0.008

Table 4 Effect of inhibitors,

activators and metal ions on L-

asparaginase activity

a 100 % of activity corresponds

to 0.5 U of enzyme

Inhibitors Relative activity (%)a Metal ions Relative activity (%)a

Control (no addition) 100.00 ± 0.000 Mg2? (MgCl2) 29.47 ± 0.009

b-Mercaptoethanol 0.000 Na? (NaCl) 128.21 ± 0.097

Cysteine 0.000 Ca2? (CaCl2) 23.69 ± 0.013

Iodoacetamide 0.000 Co2? (CoCl2) 91.24 ± 0.045

Tween-20 100.00 ± 0.001 Mn2? (MnCl2) 31.56 ± 0.003

Tween-80 123.45 ± 0.045 Zn2? (ZnCl) 10.43 ± 0.014

Triton-X100 161.26 ± 0.121 Fe3? (FeCl3) 145.97 ± 0.017

SDS 33.21 ± 0.133 KI 231.68 ± 0.012

Urea 100.00 ± 0.127 K? (KCl) 123.41 ± 0.005

EDTA 100.00 ± 0.001 Hg2? (HgCl2) 0.000

Cd2? (CdCl2) 0.000

Cu2? (CuCl2) 0.000

Table 5 Substrate specificities of purified L-asparaginase from No-

cardiopsis alba NIOT-VKMA08

Substrate Concentration (mM) Relative activity (%)a

L-Asparagine 10 100

L-Glutamine 10 ND

L-Aspartic acid 10 ND

L-Glutamic acid 10 ND

Thiourea 10 ND

L-Histidine 10 ND

Glutathione 10 ND

L-Arginine 10 ND

Glycine 10 ND

ND not detecteda 100 % of activity corresponds to 0.5 U of enzyme

Bioprocess Biosyst Eng

123

at N-terminal and C-terminal ends (Fig. 5b). To vali-

date the nucleotide variation, ansA gene was again

PCR amplified with genomic DNA from NIOT-

VKMA08 with Taq DNA polymerase (Qiagen). The

principle for this strategy was that, feasible misin-

corporations of nucleotides in gene amplification

might occurs at different positions using different

DNA polymerases and PCR protocols. PCR product

was cloned in pTZ57R/T (MBI Fermentas) and

sequenced. The nucleotide sequences of asparaginase

gene cloned into vector pTZ57R/T was the same as

determined using pDrive-ansA cassette.

Discussion

The Andaman and Nicobar (A & N) Island marine eco-

system are mostly unexplored, and may provide a rich

source of the microorganisms producing novel and efficient

antimicrobial compounds [35]. Andaman and Nicobar

group of Islands occupied 25 % of the total mangrove area,

in India and plays an important role in nutrient recycling

[36]. As on date, only limited research on marine actino-

bacteria from A & N Islands have been reported. So far, to

our knowledge no studies have been reported in the char-

acterization of marine actinobacteria from Port Blair bay of

Andaman Islands. Rather, these Islands are an unexploited

part of Indian Ocean and have rarely been explored for

microbial diversity research and their metabolites. Hence,

there is an immense possibility to identify and functionally

characterize new marine actinobacteria to identify novel

L-asparaginase. Accordingly, the present study at Port Blair

bay of Andaman Islands aimed to isolate and functionally

characterize the marine actinobacteria of industrial and

pharmaceutical important L-asparaginase. Actinobacteria

are good L-asparaginase producers [10] and extracellular

asparaginases are more valuable than intracellular, since

they can be generated profusely in the production medium

under normal conditions and can be purified economically

[7]. No report on actinobacterial L-asparaginase is available

from A & N Islands.

Primary screening study was carried out to isolate the

potential L-asparaginase producer from marine sedi-

ments. Of 179 isolates, 16 exhibited positive results for

Table 6 Effect of L-asparaginase on polyacrylamide formation

Enzyme Acrylamide

solution (mL)

Amount of

enzyme (mL)

Solidification of

acrylamide

Control 5.00 – Immediately

Crude extract 5.00 0.50 3 min

5.00 1.00 7 min

5.00 2.00 13 min

5.00 3.00 28 min

Purified L-

asparaginase

5.00 0.50 10 min

5.00 1.00 25 min

5.00 2.00 60 min (no

complete

solidification)

5.00 3.00 –

Fig. 5 a Agarose gel

electrophoresis of ansA gene

amplicon (a) 1 kb DNA ladder

(b) ansA amplicon. b GeneDoc

analysis of amino acid

substitutions of L-asparaginase

in Nocardiopsis alba NIOT-

VKMA08 with GenBank

reports; N. dassonvillei,

Streptomyces cattleya and

Kitasatospora setae,

(CP002040, CP003219 and

AP010968)

Bioprocess Biosyst Eng

123

L-asparaginase production. Among the positive isolates, the

highly potent strain NIOT-VKMA08 was selected for fur-

ther characterization studies on L-asparaginase. Among the

two medium used, maximum enzyme production was

observed in TGY medium by NIOT-VKMA08. Enzyme

activity was observed from the first day of incubation and it

was found increasing with maximum activity on 6th day.

Previous studies on L-asparaginase from Streptomyces

gulbargensis [37] and Streptomyces collinus [38] also

reported the maximum production on 144th hour (6th day).

The enzyme production was highly influenced by pH and

temperature, the production was high in alkali pH and

moderate temperature. In earlier studies, the elevated levels

of L-asparaginase production was recorded in Streptomyces

collinus with the optimum pH, temperature range at 8.5 and

28–30 �C [38].

To maximize the production of L-asparaginase, experi-

ments were conducted using various carbon sources. The

enzyme production was elevated with maltose, starch and

yeast extract as carbon and nitrogen sources, respectively.

Narayana et al. [9] also reported maltose as best carbon

source for L-asparaginase production from S. albidoflavus.

High level of acid production was observed with glucose

and lactose, which leads to the declined production of

L-asparaginase. It was reported that the pH of the fermen-

tation medium is an important criterion for L-asparaginase

production as the acidity in fermentation medium could

inhibit the L-asparaginase production [39]. To support this

concept, least levels of L-asparaginase activity was noticed

in acidic pH (\6.0) and optimal activity was detected at

near neutral and alkaline pH (6.5–9.5). This study

authenticated maltose and starch as exclusive source for

elevated L-asparaginase production for the strain NIOT-

VKMA08. Impact of yeast extract in enhancing production

of L-asparaginase from Erwinia aroideae was previously

reported [27]. Narayana et al. [9] also reported the negative

impact of yeast extract in higher concentration on enzyme

production in S. albidoflavus.

To select the most appropriate and optimal substrate

concentrations for maximum enzyme production, experi-

ment was carried out with different concentrations of

L-asparagine and combination of L-asparagine, maltose,

and sucrose. Results obtained at different initial concen-

trations of maltose, starch, and L-asparagine has been

considered as control experiments. The effect of initial

concentrations of glucose ([0.5 %) on L-asparaginase

production from NIOT-VKMA08 was insignificant. Simi-

lar report on declined levels of L-asparaginase production

has been previously observed in Pectobacterium cara-

tovorum with glucose medium [40]. However, increased

level of L-asparaginase synthesis was recorded with wide

range of L-asparagine concentrations. Similar observations

have been made on the enhancement of L-asparaginase

activity with L-asparagine from Streptomyces sp. [10].

Maximum L-asparaginase activity of 12.91 IU mL-1 was

achieved at 1.0 % maltose with 1.5 % L-asparagine. Bio-

mass and enzyme productivity was optimized in the novel

optimized NIOT-ASP medium and the productivity was

twofolds achieved in the newly optimized medium.

The degree of ammonium sulphate saturation in CFS on

salting out was examined by adding wide concentrations of

ammonium sulphate (0–80 %). In this study, L-asparagi-

nase was precipitated at 45 % ammonium sulphate which

leads to high fold in yield and purification of enzyme.

Mesas et al. [41] have reported the complete precipitation

of L-asparaginase in CFS of Corynebacterium glutamicum

at 45 % ammonium sulphate saturation. Nocardiopsis alba

NIOT-VKMA08 showed crude L-asparaginase with total

enzyme activity of 18,723.43 IU and total protein of

11,730.71 mg. Crude L-asparaginase with total enzyme

activity of 3,200 IU and total protein of 124 mg has been

reported from Streptomyces gulbargensis by Amena et al.

[37] and from marine Streptomyces sp. PDK7 with total

activity of 374.6 IU and total protein of 489.5 mg [42].

Partial purification was carried out by dialysis and

Q-Sepharose ion exchange chromatography. Similar stud-

ies showed that the L-asparaginase from Bacillus sp.

DKMBT10 was purified by two steps to obtain 43 %

recovery [43]. Previous reports revealed that, L-asparagi-

nase from S. albidoflavus was purified in Sephadex C-50

column to acquire 99.3 fold [9].

Optimum pH and temperature of purified L-asparaginase

for the hydrolysis of L-asparagine was 8.0 and 37 �C,

respectively. Similar pH range was reported for E. coli,

Pseudomonas aeruginosa and many other microbial L-as-

paraginases [30]. Maximum activity at a physiological pH

is one of the prerequisites of L-asparaginase for anti-tumor

activity [44]. El-Bessoumy et al. [30] and Mohan Kumar

and Manonmani [31] disclosed the maximum enzyme

activity at 37 and 30 �C in P. aeruginosa and Cladospo-

rium sp., respectively. The L-asparaginase activity was

assayed with different inhibitors/activators, the inhibition

activity by thiol group blocking reagents, cysteine and

iodoacetamide authenticated the role of sulfhydryl groups

in catalytic activity of enzyme. Similar inhibitory activity

was also observed with the purified L-asparaginase from

E. carotovora [45] and from Cladosporium sp. [32].

Tween-20 did not influence L-asparaginase activity and

SDS revealed 33 % relative activity but in L-asparaginase

from Cladosporium sp. lost 12 % activity in 1.0 % Tween-

20 and completely lost its activity in 2.0 % SDS [31]. Urea

and EDTA did not reveal any inhibitory effects on enzyme

activity from N. alba NIOT-VKMA08. L-Asparaginase

from P. carotovorum completely lost its activity in 2 M

urea, whereas 21 % of activity was retained in 2 mM SDS

[44].

Bioprocess Biosyst Eng

123

The purified enzyme was highly specific with its native

substrate L-asparagine, partial glutaminase activity was not

detected, which could reduce the possibility of side effects

during cancer therapy. Such observations have been

reported earlier by Kumar et al. [40]. Substrate affinity

(Km) of purified enzyme is very low than the reported

L-asparaginase from P. carotovorum [40]. The L-asparagi-

nase from different microorganisms have different sub-

strate affinities and play different physiological roles in

enzyme activity. Higher Km values (2.5 and 3.5 mM) for

L-asparaginase have been reported from C. glutamicum and

E. coli [46], whereas, lower Km value (0.074 mM) was

acquired for L-asparaginase from Vibrio succinogenes [47].

The enzyme inhibited polyacrylamide formation in 10 %

solution. Mahajan et al. [33] also reported similar obser-

vations on acrylamide formation in L-asparaginase from

Bacillus licheniformis.

Gene sequencing results of L-asparaginase also confirm

that, base divergence was conserved in genome and not

influenced by external parameters. Finding of protein

structure modification due to the nucleotide substitutions

will certainly provide the basis for performing site-directed

mutagenesis to improve the production and configuration

of asparaginase. In this study, recombinant strain with

L-asparaginase gene of N. alba NIOT-VKMA08 was con-

structed to replace the conventional production medium

and also optimization studies were carried to synthesis

glutaminase free L-asparaginase in higher quantity within

limited period. Future studies on the ansA gene expression

will certainly increase the production of glutaminase-free

L-asparaginase to fulfill the current requirement economi-

cally. Based on the literature survey and our knowledge,

this study represents the first in functional and molecular

characterization of novel L-asparaginase from Nocardiopsis

alba and brings out a new horizon in application of

recombinant L-asparaginase for the production of gluta-

minase free L-asparaginase.

L-Asparaginase from Nocardiopsis alba NIOT-

VKMA08 revealed excellent activity and stability over a

wide range of physiological conditions as well as the lower

Km value, indicating the affinity with substrate L-aspara-

gine. Moreover L-asparaginase of the present work was

glutaminase free and inhibited acrylamide formation, thus

the actinobacterial strain of this study will be a potential

source for L-asparaginase production for inhibiting

uncontrollable cell growth. Moreover, engineered E. coli

with L-asparaginase biosynthesis gene has potential

industrial application since it can produce the anti-tumor

enzyme at high rates and can avoid the complex downs-

treaming process associated with conventional bioprocess.

Acknowledgments The authors gratefully acknowledge the finan-

cial support by the Earth System Sciences Organization (ESSO),

Ministry of Earth Sciences, Government of India, New Delhi to

conduct this research. The authors are thankful to Dr. M. A. Atma-

nand, Director, ESSO-National Institute of Ocean Technology

(ESSO-NIOT), Chennai for the constant support and encouragement

to carry out this research work. The authors are profoundly thankful to

Prof. T. Subramoniam, D.Sc., F.N.A. and Dr. M. Vijayakumaran for

their critical comments and suggestions to improve this manuscript,

and Dr. Toms C. Joseph, Senior Scientist, Microbiology, Fermenta-

tion and Biotechnology Division, Central Institute of Fisheries

Technology (CIFT), Kochi, India for DNA sequencing, in silico

sequence analysis and molecular studies.

References

1. Wriston JC, Yellin TO (1973) L-Asparaginase: a review. Adv Enz

39:185–248

2. Kotzia GA, Labrou NE (2007) L-Asparaginase from Erwinia

chrysanthemi 3937: cloning, expression and characterization.

J Biotechol 127:657–669

3. Broome JD (1965) Antilymphoma activity of L-asparaginase

in vivo: clearance rates of enzyme preperations from guinea pig

serum and yeast in relation to their effect on tumor growth. JNCI

J Natl Cancer Inst 35:967–974

4. Berenbaum MC (1970) Immunosuppression by L-asparaginase.

Nature 225:550–552

5. Tareke E, Rydberg P, Karlsson P, Eriksson S, Tornqvist M (2002)

Analysis of acrylamide, a carcinogen formed in heated foodstuffs.

J Agric Food Chem 50:4998–5006

6. Friedman M (2003) Chemistry, biochemistry and safety of

acrylamide: a review. J Agric Food Chem 51:4504–4526

7. Peterson RE, Ciegler A (1969) L-Asparaginase production by

Erwinia aroideae. J Appl Microbiol 18:64–67

8. Savitri NA, Azmi W (2003) Microbial L-asparaginase: a potent

anti-tumour enzyme. Indian J Biotechnol 2:184–194

9. Narayana KJP, Kumar KJ, Vijalakshimi M (2008) L-Asparagi-

nase production by Streptomyces albidoflavus. Ind J Microbiol

48:331–336

10. Sudhir AP, Dave BR, Trivedi KA, Subramaniam RB (2012) Pro-

duction and amplification of L-asparaginase gene from actinomy-

cete isolate Streptomyces ABR2. Ann Microbiol 62:1609–1614

11. Sujatha P, Babiraju Kurada VVSN, Ramana T (2005) Studies on

antagonistic marine actinomycetes from the Bay of Bengal.

World J Microbiol Biotechnol 21:583–585

12. Meena B, Anbu Rajan L, Vinithkumar NV, Kirubagaran R (2013)

Novel marine actinobacteria from emerald Andaman & Nicobar

Islands: a prospective source for industrial and pharmaceutical

byproducts. BMC Microbiol 13:145

13. Ellaiah P, Kalyan D, Rao VS, Rao BV (1996) Isolation and

characterization of bioactive actinomycetes from marine sedi-

ments. Hindustan Antibiot Bull 38:48–52

14. Gulati R, Saxena RK, Gupta R (1997) A rapid plate assay for

screening L-asparaginase producing micro-organisms. Lett Appl

Microbiol 24:23–26

15. Shirling EB, Gottileb D (1966) Methods for characterization of

Streptomyces species. Int J Syst Bacteriol 16:312–340

16. Kawato M, Shinolue R (1959) A simple technique for the

microscopical observation. In: Memoirs of the Osaka university

liberal arts and education, Osaka, p 114

17. Biehle JR, Cavalieri SJ, Felland T, Zimmer BL (1996) Novel

method for rapid identification of Nocardia species by detection

of performed enzymes. J Clin Microbiol 34:103–107

18. Goodfellow M (2012) Phylum XXVI actinobacteria phyl nov. In:

Goodfellow M, Kampfer P, Busse HJ, Tru-jillo ME, Suzuki K,

Bioprocess Biosyst Eng

123

Ludwig W, Whitman WB (eds) Bergey’s manual of systematic

bacteriology, 2nd edn, pp 33–34

19. Kutchma AJ, Roberts MA, Knaebel DB, Crawford DL (1998)

Small-scale isolation of genomic DNA from Streptomyces

mycelia or spores. Biotechniques 24:452–456

20. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller

W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic Acids

Res 25:3389–3402

21. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins

DG (1997) The CLUSTAL X windows interface: flexible strat-

egies for multiple sequence alignment aided by quality analysis

tools. Nucleic Acids Res 25:4876–4882

22. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S

(2011) MEGA5: molecular evolutionary genetics analysis using

maximum likelihood, evolutionary distance, and maximum par-

simony methods. Mol Biol Evol 28:2731–2739

23. Felsenstein J (1985) Confidence limits on phylogenies: an

approach using the bootstrap. Evolution 39:783–789

24. Davidson L, Brear DR, Wingard P, Hawkins J, Kitto GB (1977)

Purification and properties of an L-glutaminase–L-asparaginase

from Pseudomonas acidovorans. J Bacteriol 129:1379–1386

25. Imada A, Igarasi S, Nakahama K, Isono M (1973) Asparaginase

and Glutaminase activities of microorganisms. J Gen Microbiol

76:85–99

26. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein

measure with the folin-phenol reagent. J Biol Chem 48:17–25

27. Liu FS, Zajic JE (1972) L-Asparaginase synthesis by Erwinia

aroideae. Appl Microbiol 23:667–668

28. Zhang Z, Chisti Y, Moo-Young M (1995) Isolation of a recom-

binant intracellular b-galactosidase by ammonium sulphate

fractionation of cell homogenates. Bioseparation 5:329–337

29. Yu J, Tang X (1991) Biotechnology, vol 1. East China University

of Chemical Technology Press, Shanghai, pp 272–281

30. El-Bessoumy AA, Sarhan M, Mansour J (2004) Production,

isolation and purification of L-asparaginase from Pseudomonas

aeruginosa 50071 using solid-state fermentation. J Biochem Mol

Biol 37:387–393

31. Mohan Kumar NS, Manonmani HK (2012) Purification, charac-

terization and kinetic properties of extracellular L-asparaginase

produced by Cladosporium sp. World J Microbiol Biotechnol

29:577–587

32. Lineweaver H, Burk D (1934) The determination of enzyme

dissociation constants. J Am Chem Soc 56:658–666

33. Mahajan RV, Saran S, Kameshwaran K, Kumar V, Saxena RK

(2012) Efficient production of L-asparaginase from Bacillus

licheniformis with low-glutaminase activity: optimization, scale

up and acrylamide degradation studies. Bioresour Technol

125:11–16

34. Foster PR, Deanill P, Lilly MD (1979) The kinetics of protein

salting out: precipitation of yeast enzymes by ammonium sul-

phate. Biotechnol Bioeng 18:545–580

35. Baskaran R, Vijayakumar R, Mohan PM (2011) Enrichment

method for the isolation of bioactive actinomycetes from man-

grove sediments of Andaman Islands, India. Malaysian J

Microbiol 7:26–32

36. Rajeswari S, Shome BR (2001) Microbial L-asparaginase from

mangroves of Andaman Islands. Indian J Mar Sci 30:183–184

37. Amena S, Vishalaksh N, Prabhakar M, Dayanand A, Lingappa K

(2010) Production, purification and characterization of L-aspara-

ginase from Streptomyces gulbargensis. Braz J Microbiol

41:173–178

38. Mostafa SA, Salama MS (1979) L-Asparaginase producing

Streptomyces from soil of Kuwait. Zentralbl Bakterol 134:

325–334

39. Heinemann B, Howard AJ (1969) Production of tumor—inhibi-

tory L-asparaginase by submerged growth of Serratia marscenc-

es. Appl Microbiol 18:550–554

40. Kumar S, Venkata Dasu V, Pakshirajan K (2011) Purification and

characterization of glutaminase-free L-asparaginase from Pecto-

bacterium carotovorum MTCC 1428. Bioresour Technol 102:

2077–2082

41. Mesas JM, Gil AJ, Martin JF (1990) Characterization and partial

purification of L-asparaginase from Corynebacterium glutami-

cum. J Gen Microbiol 136:515–519

42. Dhevagi P, Poorani E (2006) Isolation and characterization of

L-asparaginase from marine actinomycetes. Ind J Biotech

5:514–520

43. Moorthy V, Aishwarya R, Alagarsamy S, Rajesh TS (2010)

Production, purification and characterization of extracellular

L-asparaginase from a soil isolate of Bacillus sp. Afr J Microbiol

Res 4:1862–1867

44. Kumar S, Venkata Dasu V, Pakshirajan K (2010) Localization

and production of novel L-asparaginase from Pectobacterium

carotovorum MTCC 1428. Process Biochem 45:223–229

45. Warangkar SC, Khobragade CN (2010) Purification, character-

ization and effect of thiol compounds on activity of the Erwinia

carotovora L-asparaginase. Enzym Res 1:1–10

46. Willis RC, Woolfolk CA (1974) Asparagine utilization in Esch-

erichia coli. J Bacteriol 118:231–241

47. Distasio JA, Niederman RA, Kafkewitz D, Goodman D (1976)

Purification and characterization of L-asparaginase with anti-

lymphoma activity from Vibrio succinogenes. J Biol Chem

25:6929–6933

Bioprocess Biosyst Eng

123