ARTICLE

Normal Lung Development and Function After Sox9Inactivation in the Respiratory EpitheliumAnne-Karina T. Perl,1* Ralf Kist,2,3 Zhengyuan Shan,1 Gerd Scherer,3 and Jeffrey A. Whitsett1

1Children’s Hospital Medical Center, Division of Pulmonary Biology, Cincinnati, Ohio2Institute of Human Genetics, University of Newcastle, Newcastle upon Tyne, United Kingdom3Institute of Human Genetics, University of Freiburg, Freiburg, Germany

Received 14 July 2004; Accepted 25 September 2004

Summary: Heterozygous mutations in the human SOX9gene cause campomelic dysplasia (CD), a skeletal mal-formation syndrome with various other organ defects.Severely affected CD patients usually die in the neonatalperiod due to respiratory distress. We analyzed the dy-namic expression pattern of Sox9 in the developingmouse lung throughout morphogenesis. To determine arole of Sox9 in lung development and function, Sox9 wasspecifically inactivated in respiratory epithelial cells ofthe mouse lung using a doxycycline-inducible Cre/loxPsystem. Immunohistochemical and RNA analysis dem-onstrated extensive inactivation of Sox9 in the embry-onic stage of lung development as early as embryonicday (E) 12.5. Lung morphogenesis and lung function af-ter birth were not altered. Compensatory upregulation ofSox2, Sox4, Sox8, Sox10, Sox11, and Sox17 was notdetected. Although Sox9 is expressed at high levelsthroughout lung morphogenesis, inactivation of Sox9from the respiratory epithelial cells does not alter lungstructure, postnatal survival, or repair following oxygeninjury. genesis 41:23–32, 2005. © 2005 Wiley-Liss, Inc.

Key words: Sox9; Sox10; Sox8; conditional inactivation;lung; development

INTRODUCTION

Sox9 is a member of a family of at least 20 relatedtranscription factors that have been divided into eightsubgroups (A–H) according to their homology (Scheperset al., 2002). Sequence and structural similarities withinthese groups and overlapping expression patterns mayindicate functional redundancy among members of eachsubgroup (Bowles et al., 2000; Britsch et al., 2001; Ng etal., 1997; Wegner, 1999). The acronym Sox (SRY-relatedHMG box) indicates that these transcription factorsshare a common DNA-binding domain, the HMG (high-mobility group) box, with the mammalian testis-deter-mining factor SRY. Like the transcription factors TCF andMATA, the Sox proteins bind to the minor groove ofDNA and facilitate DNA bending at the consensus bind-ing motif (A/TA/TCAAA/TG). Sox genes are highly con-

served throughout the animal kingdom (Bowles et al.,2000; Wegner, 1999).

Subgroup E genes (Sox8, Sox9, Sox10) play roles inchicken neural crest development at two distinct steps.First, in forming the neural tissue by commitment ofprogenitors to the neural crest lineage, and second, byinfluencing the differentiation of migrating neural crestcells (Cheung and Briscoe, 2003). Defects of the chon-drogenic lineage derived from cranial neural crest cellshave also been observed in Sox9-deficient mice (Mori-Akiyama et al., 2003). Mice lacking Sox8 develop toadulthood without severe defects (Sock et al., 2001).Sox8 is frequently coexpressed with either Sox9 orSox10, which may provide functional compensationamong group E Sox proteins (Britsch et al., 2001; Kent etal., 1996; Kuhlbrodt et al., 1998a; Ng et al., 1997). Veryweak Sox8 mRNA expression was detected in embry-onic mouse lungs at E13.5 by RT-PCR and no expressionin adult mouse lung by Northern blot analysis (Scheperset al., 2000). However, LacZ staining was not reported inthe embryonic or fetal lung of Sox8lacZ/lacZ mice (Sock etal., 2001).

Mutations in human SOX10 cause Waardenburg-Hirschsprung syndrome, which is characterized by de-fects in melanocyte differentiation and development ofthe enteric nervous system (Kuhlbrodt et al., 1998b;Pingault et al., 1998). Mice deficient for Sox10 lackperipheral glial cells, resulting in degeneration of sen-sory and motor neurons. Sox10lacZ/lacZ mice do notbreathe and die at birth (Britsch et al., 2001). Expression

A.-K.T. Perl and R. Kist contributed equally to this work.* Correspondence to: Anne-Karina Perl, PhD, Cincinnati Children’s Hos-

pital Medical Center, Divisions of Neonatology and Pulmonary Biology,3333 Burnet Ave., Cincinnati, OH 45229-3039.

E-mail: Anne.Perl@cchmc.orgContract grant sponsor: National Institutes of Health, Contract grant

number: HL 56387 (to J.A.W., A.K.P.), Contract grant sponsor: DeutscheForschungsgemeinschaft, Contract grant number: Sche 194/15-1 (to G.S.).

Published online inWiley InterScience (www.interscience.wiley.com)DOI: 10.1002/gene.20093

© 2005 Wiley-Liss, Inc. genesis 41:23–32 (2005)

of Sox10 in the developing and adult lung has not furtherbeen investigated.

Heterozygous SOX9 mutations in humans cause cam-pomelic dysplasia (CD), a complex syndrome character-ized by bone malformations, male-to-female sex reversal,and various other organ defects (Foster et al., 1994;Wagner et al., 1994). Severely affected CD patientspresent with lung defects, such as hypoplasia, tracheo-bronchiomalacia, edema, pneumonia, and pulmonaryhemorrhage and usually die in the neonatal period dueto respiratory distress (Houston et al., 1983; Mansour etal., 1995). The few surviving CD patients are frequentlydiagnosed with recurrent upper respiratory tract infec-tions (Mansour et al., 2002). Recent mouse models forCD have substantiated the role of Sox9 as a key regulatorat various steps of chondrocyte differentiation (Akiyamaet al., 2002; Bi et al., 1999).

Sox9 is induced by BMP (bone morphogenic protein)(Healy et al., 1999; Semba et al., 2000; Zehentner et al.,1999) and directly regulates type II collagen (Col2a1)(Bell et al., 1997; Lefebvre et al., 1997) and type XIcollagen (Col11a2) expression (Bridgewater et al.,1998). During somitic chondrogenesis, Shh and BMP2establish a positive regulatory loop between Sox9 andNkx3.2 (Zeng et al., 2002). Ectopic expression of Sox9induces testis development in the absence of Sry, prov-ing its essential role in male sex determination (Vidal etal., 2001). During early testis differentiation, Sox9 regu-lates AMH (anti-Mullerian hormone) gene expression ina complex with SF-1 (steroidogenic factor-1), WT1(Wilm’s tumor gene 1) and GATA 4 (De Santa Barbara etal., 1998; Nachtigal et al., 1998; Tremblay and Viger,1999). Sox8 may partially compensate for the reducedSox9 activity during testis development in campomelicdysplasia (Chaboissier et al., 2004; Schepers et al.,2003). Shh, BMPs, Nkx2.1, and GATA6 are all known tobe expressed in early lung development (Cardoso,2000), suggesting that similar genetic partners mightinteract with Sox9 in the lung. Overexpression of Sox 9or inactivation of �-catenin in chondrocytes of mouseembryos produce a similar phenotype of dwarfism withdecreased chondrocyte proliferation (Akiyama et al.,2004). Also, inactivation of Sox9 (Akiyama et al., 2002)or stabilization of �-catenin (Akiyama et al., 2004) inchondrocytes produces a similar phenotype of severechondrodysplasia. Akiyama et al. have shown that Sox9physically interacts with �-catenin and inhibits �-cateninfunction (Akiyama et al., 2004). When �-catenin isconditionally inactivated in the airway epithelium usingthe SPCrtTA/tetOCre-mediated recombination in �-catenin flox/flox mice, mice die at birth due to respiratoryfailure caused by a failure of the distal airway epitheliumto differentiate (Mucenski et al., 2003). However, it isunknown whether Sox9 plays a similar important func-tion in differentiation of the distal airway epithelium as itdoes in chondrocyte development. Sox9 is expressed ina variety of embryonic tissues including the bronchialepithelium of the lung (Ng et al., 1997). HeterozygousSox9wt/KO mice die shortly after birth from respiratory

failure (Bi et al., 2001), while homozygous Sox9KO/KO

mice die at E11.5 (Chaboissier et al., 2004). To investi-gate Sox9 function during embryonic and postnatal de-velopment, a conditional Sox9 mutant allele (Sox9flox)was generated (Kist et al., 2002).

In the present study, the expression pattern of Sox9and Sox10 was determined during lung morphogenesisin the mouse. Tissue specific SPCrtTA/tetOcre-mediatedinactivation of Sox9 in the respiratory epithelium ofSox9flox/flox mice did not alter lung morphogenesis orpostnatal lung function. Sox8 or Sox10, closely relatedSox Group E members, do not compensate for the lackof Sox9 protein expression in the respiratory epithelium.Other Sox genes (Sox 2, 4, 11, 17) detected in lung arenot upregulated in Sox9-deficient lungs. We concludethat Sox9 alone is not required for distal airway epithe-lium expansion, differentiation, and function.

RESULTS

Temporal-Spatial Distribution of Sox9 Protein inthe LungImmunohistochemical staining of Sox9 in the lung ofwildtype mice was assessed from E12.5 to adulthood. AtE12.5, Sox9 was detected in nuclei of epithelial cells ofthe developing lung buds and in some mesenchymalcells located in close proximity to the epithelium(Fig. 1B). In the proximal airways at E12.5, Sox9 wasdetected in nuclei of the mesenchymal cells forming twoposterior-lateral lines along the trachea and mainstembronchi (Fig. 1A). At E14.5, Sox9 staining was observedin mesenchymal cells along the ventral side of the tra-chea at the sites of tracheal rings (Fig. 1C). This distri-bution persisted in the fetal lung until birth. At E14.5,Sox9 staining in the epithelium was detected at the tipsof the lung tubules, and was less intense in the proximalregions (Fig. 1D). At E16.5, epithelial Sox9 expressionwas restricted to the distal tips of the lung buds, theintensity of staining decreasing with distance from thetip. Sox9 was absent in the bronchiolar epithelium(Fig. 1E,F). At E18.5, Sox9 was detected in a small subsetof cells in the terminal bronchioles and alveolar type IIcells. No Sox9 staining was detected in bronchiolar ep-ithelium at E18.5 (Fig. 1G,H). At postnatal day 17, Sox9was detected in some but not all cuboidal cells in theterminal bronchioles, around bronchiolar-alveolar ductjunctions and in a small subset of alveolar type II cells(Fig. 1I,J). In adult lungs, Sox9 was detected in most, butnot all, cells lining the bronchioles, and in subsets ofalveolar type II cells. Numbers of Sox9 staining cellslining the bronchiolar-alveolar duct junctions of normallungs increased with advancing age between 2–8 weeksof age. Sox9 was not detected in mesenchymal cells. Inthe epithelium, Sox9 was detected in most, but not all,cells of the bronchioles and some respiratory type II cells(Fig. 6A). Thus, Sox9 was widely expressed in endoder-mally derived epithelial cells of the developing lungthroughout lung morphogenesis.

24 PERL ET AL.

FIG. 1. Sox9 expression analysis during lung development. Immu-nohistochemical staining for Sox9 was assessed in lung tissue fromwildtype mice from E12.5 to PN17. At E12.5, Sox9 was detected inepithelial cells at the tips of the lung buds and in the mesenchymealong the lung tubules directly adjacent to the epithelium (B). Mes-enchymal staining of Sox9 formed two posterior/lateral stripesalong the trachea and main stem bronchi (A). At E14.5 and E16.5,Sox9 was expressed in epithelial cells of the peripheral lung andmesenchymal cells along the conducting airways and sites of car-tilage ring formation (see arrow in C). At E18.5, few epithelial cells inthe peripheral saccules stained for Sox9 (see arrows in H), and Sox9staining in the mesenchyme of the peripheral lung was no longerdetected (G,H). At PN17, Sox9 was detected in some, but not all,alveolar type II cells and in few cuboidal cells in the conductingairways (see arrows in J). Sox9 staining was not found in mesen-chymal cells of the peripheral lung at PN17. Scale bars � 200 �m(A,C,E,G,I), 40 �m (B,D,F,H,J). [Color figure can be viewed in theonline issue, which is available at www.interscience.wiley.com.]

FIG. 2. Strategy for conditional inactivation of Sox9 in the respira-tory epithelium. A: Derivation of SPCrtTA/tetOCre/Sox9flox/flox com-pound mutant mice. Double transgenic (SPCrtTA/tetOCre) micewere crossed to Sox9flox/flox mice to generate single and doubletransgenic mice on a Sox9wt/flox background. F1 generation micewith one floxed Sox9 allele (Sox9wt/flox) and one SPCrtTA or tetOCretransgene were backcrossed to Sox9flox/flox parents to obtain singletransgenic mice with two floxed Sox9 alleles (SPCrtTA/Sox9flox/flox

and tetOCre/Sox9flox/flox). Single transgenic mice were intercrossedto generate double transgenic mice on a Sox9flox/flox back-ground, herein called compound mutant mice (SPCrtTA/tetOCre/Sox9flox/flox). Upon doxycycline treatment of the dam, cells of therespiratory epithelium of compound mutant mice undergo recom-bination in the respiratory epithelium resulting in cell specific inac-tivation of Sox9, herein called Sox9�/�. B: The rtTA gene undercontrol of the SP-C promoter is expressed in the progenitor cells ofthe respiratory epithelium (Perl et al., 2002b). In the presence ofdoxycycline, rtTA activates Cre-recombinase that excises exon 2(half of the DNA-binding high-mobility group domain) and exon 3(encoding the entire transactivation domain) of the endogenousSox9 locus, resulting in functional inactivation of Sox9 in target cellsand all their daughter cells.

25CONDITIONAL INACTIVATION OF Sox9 IN THE LUNG

Conditional Inactivation of Sox9 in theRespiratory Epithelium

A transgenic mouse model was utilized in which doxy-cycline induces recombination of the Sox9flox/flox loci inthe progenitor cells of the developing lung resulting ininactivation of Sox9 in the respiratory epithelium (Perl etal., 2002b). The reverse tetracycline transactivator (rtTA)is expressed under control of the surfactant protein C(SP-C) promoter and controls Cre-recombinase expres-sion upon the presence of doxycycline (Fig. 2). Immu-nohistochemical staining for Sox9 was assessed in lung

tissue from Sox9�/� mice at E12.5, E14.5, E18.5, andpostnatal (PN) day 17 (Fig. 3). At E12.5, Sox9 proteinexpression was absent in most, but not all, epithelialcells of Sox9�/� mice (Fig. 3B). Sox9 staining was de-tected in the mesenchyme of the conducting airways,along two posterior-lateral lines (Fig. 3A), and in themesenchyme at the tips of lung buds, indicating epithe-lial-specific gene inactivation. At E14.5, Sox9 was com-pletely absent in epithelial cells of the peripheral lung(Fig. 3D). Sox9 expression in the mesenchyme ofSox9�/� mice was unchanged compared to wildtype. AtE18.5 and in the postnatal period, Sox9 staining wasdetected in a few cells in the bronchi (Fig. 3H), but notin the lung periphery, consistent with the known sites ofgene targeting by the SPCrtTA/tetOCre system (Perl etal., 2002b).

Normal Lung Morphology and Differentiation inSox9�/� Mice

Sox9�/� mice survived normally after birth and num-bers of compound mutant mice were found as pre-dicted by Mendelian inheritance. Lung histology wasnot altered at any stage analyzed (E12.5 to adulthood)by inactivation of Sox9 in the respiratory epithelialcells (Figs. 3, 4, 6). To assess whether Sox9 influencesepithelial differentiation, expression sites and levels ofpro-surfactant protein C (pro-SPC), a marker for pe-ripheral respiratory epithelium, and Clara cell secre-tory protein (CCSP), a marker for conducting airwayepithelium, were determined by immunohistochemis-try. Sites of staining of Pro-SPC and CCSP were un-changed in the respiratory epithelium of E18.5Sox9�/� mice (Fig. 4A–D). Sections of E18.5 lungs ofSox9�/� mice were stained for calcitonin gene-relatedpeptide (CGRP), a marker for neuroepithelial bodies,revealing normal numbers, size, and location of neu-roepithelial bodies (Fig. 4E,F). Immunohistology forThyroid Transcription Factor 1 (TTF-1), expressed inall epithelial cells, in lungs of 8-week-old Sox9�/� micewas normal (Fig. 4G,H). Control data are not shown.

Respiratory epithelial cells express a number of hostdefense proteins that serve as differentiation and func-tional markers. Inactivation of Sox9 did not turn offexpression of acidic chitinase, lysozyme M, and lyso-zyme P mRNAs (Fig. 5).

Sox9 Does Not Influence Oxygen Injuryand Repair

Since epithelial specific deletion of Sox9 in the lung didnot affect prenatal morphogenesis or postnatal matura-tion of the lung, we subjected the Sox9�/� mice toincreased oxygen levels to investigate lung integrity andfunction under stress conditions. Exposure to 95% oxy-gen causes progressive lung injury in adult mice. Weutilized a previously established protocol to screen forsusceptibility of lung injury during hyperoxia (Hokuto etal., 2003, 2004). Sox9�/� mice and control littermateswere exposed to oxygen for 96 h, weaned from 95%oxygen, and placed in room air (RA) for 7 days for

FIG. 3. Sox9 expression analysis in the lungs of Sox9�/� mice.Immunohistochemical staining for Sox9 was assessed in lung tissueof Sox9�/� mice from E12.5 to PN17. At E12.5, Sox9 was absent inmost but not all epithelial cells of Sox9�/� mice (A,B). Sox9 stainingwas detected in the mesenchyme around the trachea and mainstem bronchus, along two posterior/lateral stripes. Sox9 stainingwas detected in the mesenchyme at the tips of the lung buds but notin the epithelial cells, indicating epithelial specific gene inactivation.At E14.5, Sox9 was absent in epithelial cells of the peripheral lungwhile mesenchymal staining remained (C,D). At E18.5, neither epi-thelial nor mesenchymal Sox9 staining was detected in the periph-eral lung (E,F). A few cuboidal cells in the conducting airways stainfor Sox9 at PN17 (see arrows). No Sox9 staining was found in thelung periphery. Scale bars 200 �m (A,C,E,G), 40 �m (B,D,F,H).

26 PERL ET AL.

recovery (Fig. 6). During this time, severity of lung injury(alveolar hemorrhage, bronchiolar injury, inflammation,and remodeling) and survival of Sox9�/� mice were in-distinguishable from control littermates. Sox9 proteinwas expressed in most epithelial cells lining terminalbronchioles, bronchiolar-alveolar duct junctions, and in

some but not all alveolar type II cells before, during, andafter oxygen exposure (Fig. 6). In Sox9�/� mice, residualSox9 protein was found in a rare subset of bronchiolarepithelial cells and occasionally in some cells along bron-chiolar-alveolar duct junctions, but was not detected inalveolar type II cells. Numbers of Sox9-positive cells inmutant and control lungs did not change during oxygeninjury and repair.

Lack of Compensatory Upregulation of Other SoxFamily Members

To assess whether other SoxE family members compen-sate for the lack of Sox9 in the developing lung epithe-lium, expression of Sox8 and Sox10 was analyzed byimmunohistochemistry and RT-PCR. At E12.5, no Sox8staining was detected in control and Sox9�/� lungs(Fig. 8A,B). In Sox9�/� lungs no Sox10 protein was de-tected in the peripheral lung epithelium at E12.5 toE18.5 (Fig. 7). Starting at E14.5, Sox10 was found in thebronchiolar epithelium, a site where Sox9 was not foundin wildtype lungs (Figs. 1, 7). Sox8 and Sox10 mRNAexpression was assessed by RT-PCR in whole embryosand lungs of Sox9�/� and control mice at E12.5 andE13.5. Sox10 and Sox8 mRNAs were detected in wholeembryos at E12.5 and E13.5, but not in control andSox9�/� lungs (Fig. 9).

FIG. 5. Normal expression of genes regulating innate host defensein Sox9�/� lungs. RT-PCR analysis for acidic chitinase, lysozyme M,and lysozyme P was performed on mRNA isolated from adult controland Sox9�/� lungs. Expression levels of all mRNAs were unchangedin control and in Sox9�/� lungs.

FIG. 4. Normal lung morphology and cellular differentiation in Sox9�/� mice. Immunohistochemical staining for Pro–SPC (A,B), CCSP (C,D),and CGRP (E,F) in lungs from E18.5 Sox9�/� mice, TTF-1 (G,H) staining in lungs from adult Sox9�/� mice. Sites and extent of Pro-SPC,CCSP, CGRP, and TTF-1 were unchanged in the absence of Sox9. Due to redundancy and the lack of any change, the data of the controlsis not shown. Scale bars 250 �m (A,C,E,G), 50 �m (B,D,F,H). [Color figure can be viewed in the online issue, which is available atwww.interscience.wiley.com.]

27CONDITIONAL INACTIVATION OF Sox9 IN THE LUNG

Expression patterns of other Sox genes normallyfound in the lung were further assessed by immuno-histochemistry and RT-PCR in wildtype and Sox9�/�

lungs (Figs. 8, 9). In E12.5 Sox9�/� lungs, Sox2 wasdetected in epithelial cells of the conducting airwaysbut was absent in the epithelium of the distal lungbuds (Fig. 8C,D). Expression of Sox2 in the conduct-ing airways increases until adulthood in wildtypelungs but is not changed in the Sox9�/� mice (data notshown). Sox17 was not expressed in the epithelium ofthe embryonic lung of Sox9�/� mice at E12.5 (Fig.8E,F). Sox17 expression is not found in the lung epi-

thelium until E18.5 and is not upregulated in Sox9�/�

mice (data not shown). Expression patterns for Sox8,Sox2, or Sox17 in Sox9�/� mice are indistinguishablefrom control littermates (data not shown). Further-more, Sox2, Sox4, and Sox11 mRNA expression wasunchanged in Sox9�/� lungs (Fig. 9).

DISCUSSION

The early death of severely affected CD patients due torespiratory distress (Houston et al., 1983; Mansour et al.,

FIG. 6. Normal survival and repair after oxygen injury in Sox9�/�

mice. Immunohistochemistry for Sox9 was performed on lung tissueof adult control and Sox9�/� mice, before and after oxygen expo-sure. Sox9�/� (n � 21) and control littermates (n � 14) were placedin 95% oxygen for 3 days, weaned to room air, and allowed torecover for 7 days in room air. Lung histology was assessed before(A,B) and after injury (C,D). Repair was assessed after 1 day (E,F) or7 days (G,H) in room air. No changes between wt and Sox9�/�micewere found. [Color figure can be viewed in the online issue, which isavailable at www.interscience.wiley.com.]

FIG. 7. Sox9 inactivation does not alter Sox10 protein expression inthe developing lung. Immunohistochemical staining for Sox10 wasassessed in Sox9�/� lung tissue from E12.5–18.5. Sox10 was de-tected in the mesenchyme around the tips of the lung buds (B,D seearrowheads). At E14.5 and E18.5, staining for Sox10 was found inepithelial cells of bronchi (C–F, see arrows). In Sox9�/� lungs, Sox10protein staining was not found in areas depleted of Sox9 expres-sion. Scale bars 200 �m (A,C,E), 40 �m (B,D,F). [Color figure can beviewed in the online issue, which is available at www.inter-science.wiley.com.]

28 PERL ET AL.

1995) and the recurrent lung infections frequently ob-served in surviving CD patients (Mansour et al., 2002)raises the possibility that Sox9 could be involved in lungdevelopment or lung function. In accordance with theCD phenotype, heterozygous Sox9 mutant mice dieshortly after birth and display gasping respiration (Bi etal., 2001; Kist et al., 2002). However, it has not beeninvestigated if the respiratory problems are caused byskeletal defects, e.g., malformations of the chest andlarynx, or a possible lung dysfunction. In this study,temporal and spatial expression of Sox9 in the lung wasassessed. Sox9 was detected at high levels in the nucleiof peripheral, respiratory lung epithelial cells, but wasnot expressed in the epithelial cells of the proximal,conducting airways. In the mesenchyme, Sox9 expres-sion was found in the nuclei of proximal and peripheralmesenchymal cells throughout lung morphogenesis. Thesite of Sox9 expression in the lung epithelium changeddynamically during lung development, suggesting alikely role for Sox9 in the expansion and differentiationof the peripheral lung. In order to dissect tissue-specificSox9 functions in vivo and to test a role for Sox9 in lungdevelopment or function, we specifically inactivated

Sox9 in the respiratory epithelium using previously es-tablished Sox9flox mice (Kist et al., 2002) and SPCrtTA/tetOCre mice (Perl et al., 2002b). Previous experimentswith SPCrtTA/tetOCre transgenic mice demonstrated ex-tensive doxycycline-inducible Cre-mediated recombina-tion in epithelial cells of the proximal and distal lungtubules. Moreover, complete recombination in periph-eral lung progenitor cells occurs prior to lung bud for-mation before E8.5 (Perl et al., 2002b).

Although Sox9 protein is expressed in the epitheliallung tubules from E12.5–16.5, a time and location ofextensive expansion and branching morphogenesis, in-activation of Sox9 in epithelial cells of the developinglung did not alter branching, differentiation and devel-opment of the peripheral lung epithelium.

Neuroepithelial cells are thought to provide a micro-environment of lung progenitor cells from which thebronchiolar epithelium is repopulated after lung injury(Borthwick et al., 2001; Reynolds et al., 2000). In thenormal lung, neuroepithelial cells are frequently found atbranch points of the bronchioles. In control mice, Sox9protein was highly expressed in bronchiolar epithelialcells. However, inactivation of Sox9 had no influence onthe position and size of neuroepithelial bodies (clustersof neuroepithelial cells) in the murine lung. Further-more, Sox9 staining was unaltered during and after ox-ygen exposure in control mice and its inactivation didnot alter susceptibility to oxygen injury. While Sox9protein expression was detected in a rare subset ofbronchiolar epithelial cells in adult Sox9�/� mice, noexpansion of these Sox9-positive cells was found in in-

FIG. 8. Sox9 inactivation does not alter Sox8, Sox2, and Sox17protein expression in E12.5 lungs. Immunohistochemical stainingfor Sox8 (A,B), Sox2 (C,D), and Sox17 (E,F) was assessed inSox9�/� lung tissue from E12.5. Sox8 is not expressed in E12.5Sox9�/� lungs. Sox2 is expressed in epithelial cells of the trachea(see arrow) and not in distal epithelial cells. Sox17 is not expressedin the epithelium but in some mesenchymal cells at locations ofvessel formation (see arrow). Scale bars � 200 �m (A,C,E), 40 �m(B,D,F). [Color figure can be viewed in the online issue, which isavailable at www.interscience.wiley.com.]

FIG. 9. Sox9 inactivation does not change Sox8, Sox10, Sox2,Sox4, and Sox11 mRNAs expression in E12.5 and E13.5 lungs. AtE12.5 and E13.5, RT-PCR analysis of whole embryos, control, andSox9�/� lungs was performed for Sox8, Sox10, Sox2, Sox4, andSox11. Sox10 and Sox8 mRNAs expression was not detected atE12.5 or E13.5 in either control or Sox9�/� lungs. Sox2, Sox4, andSox11 mRNAs expression was not influenced by Sox9 inactivation.

29CONDITIONAL INACTIVATION OF Sox9 IN THE LUNG

jured epithelium. Therefore, Sox9 is not necessary formaintenance of the lung after oxygen injury.

The lack of any obvious developmental phenotypein the lungs of the Sox9�/� mice could be explained bycompensatory spatial and temporal expression ofother Sox genes. Due to close sequence homologyamong Group E Sox genes, we investigated proteinand mRNA expression of Sox8 and Sox10 in lungsfrom Sox9�/� mice. We could not confirm expressionof Sox8 in the fetal lung (Schepers et al., 2000), inagreement with the findings of Sock et al. (2001).Also, expression of Sox8, Sox10, Sox2, and Sox17proteins was not observed in the growing tips of thelung epithelium of Sox9�/� mice. Thus, lack of Sox9does not induce expression of Sox8, Sox10, Sox2, orSox17 in the distal lung epithelium. Likewise, expres-sion of Sox2, Sox4, and Sox11 mRNA normally ex-pressed in the lung were not altered. Compensationfor the lack of Sox9 expression does not require in-duction of expression of other Group E Sox genes,Sox2, Sox4, Sox11, and Sox17. While Sox9 is ex-pressed at high levels in the respiratory epithelial cellsof the fetal and postnatal lung, its expression is notrequired for normal lung development and function.We conclude that the respiratory problems of CDpatients result mainly from the cartilage and bonemalformations of the pharynx, bronchi, and chestrather than from reduced Sox9 expression in the re-spiratory epithelium.

MATERIALS AND METHODS

Mouse LinesThe 3.7-kb human SP-C promoter selectively directsgene expression to the respiratory epithelial cells of fetaland adult lung (Wert et al., 1993). Sox9flox/flox mice (Kistet al., 2002) were mated to SPCrtTA mice that expressthe rtTA activator under control of the human surfactantprotein C (SP-C) promoter (Perl et al., 2002a; Tichelaaret al., 2000). Transgenic mice expressing the Cre recom-binase under the Tet operator and a minimal CMV pro-moter, (tetO)7Cre mice (tetOCre) were intercrossed toSox9flox/flox mice. After two generations of breeding,SPCrtTA/Sox9flox/flox mice were bred to tetOCre/Sox9flox/flox to generate double transgenic mice in

Sox9flox/flox background, further referred to as com-pound mutants (SPCrtTA/tetOCre/Sox9flox/flox). Geno-types were verified by PCR (Kist et al., 2002; Perl et al.,2002b). After doxycycline food was administered to thepregnant dam, recombination occurs in epithelial cellsof the fetal lung resulting in inactivation of the Sox9 gene(SPCrtTA/tetOCre/Sox9�/�) referred as to Sox9�/�.

Animal Use and Doxycycline Administration

Mice were housed in pathogen-free conditions in accor-dance with IACCUC guidelines. Gestational age wasdated by detection of the vaginal plug and correlatedwith length and weight of each pup at the time ofsacrifice. Dams bearing single and double transgenicSox9flox/flox pups were maintained on doxycycline in thefood (625 mg/kg; Harlan Teklad, Madison, WI). The micewere killed in a CO2 chamber or by injection of 0.2–0.3 cc anesthetic (ketamine, xylazine, acepromazine).For all experiments dams were treated with doxycyclinefrom E0.5 to sacrifice. All experiments were done with atleast three pregnant females, resulting in at least fivecompound mutant mice per experiment. In each exper-iment compound mutant mice were compared to litter-mate controls (tetOCre/Sox9flox/flox).

Lung Histology

Lungs were dissected under the stereomicroscope andwhole-mount pictures taken before fixation. For histo-logical sections, chest cavities were left intact and ani-mals older than E16.5 were decapitated, the thorax wasfixed overnight in 4% paraformaldehyde in PBS at 4°C.Lungs of postnatal double transgenic mice and controllungs were inflated with fixative under 25 cm of pres-sure and fixed overnight at 4°C using 4% paraformalde-hyde. All samples for histology were washed with PBS,dehydrated through a graded series of ethanol, and pro-cessed for paraffin embedding. Sections (5 �m) wereloaded onto silanized slides. Staining was performed onat least five different mice for each marker.

Immunohistochemistry

Immunohistochemistry for all Sox proteins was per-formed on paraffin sections after antigen retrieval at1:100 or 1:200 dilutions. Sox2 antibody was purchasedfrom Santa Cruz Biotechnology (Santa Cruz, CA); Sox8

Table 1Primer sequences for RT-PCR

Gene Forward primer Reverse primer Size bp

�-actin 5� TGGAATCCTGTGGCATCCATGAAAC 3� 5� TAAAACGCAGCTCAGTAACAGTCCG 3� 349Sox8 5� TGGAGTCTGGTGCCTATGCCTGT 3� 5� GCCGAGCACTGCATCAGCTTTGT 3� 383Sox10 5� GCTGCTGCTATTCAGGCTCACTAC 3� 5� GGACATTACCTCGTGGCTG 3� 267Sox2 5� ACCAGCTCGCAGACCTACAT 3� 5� ACCCCTCCCAATTCTCTTGT 3� 388Sox4 5� GTGAAGCGCGTCTACCTGTT 3� 5� GTCGTCTTCGAACTCGTCGT 3� 336Sox11 5� TCCGACCTGGTGTTCACATA 3� 5� ACCGACAAGCTTCAAACAGC 3� 488Chitinase 5� CCTTCATCCTGAGAAACCCCTC 3� 5� TGCTTTGTCGGCACAGAATCC 3� 485LysozymeM 5� TGCTCAGGCCAAGGTCTATG 3� 5� TTGATCCCACAGGCATTCAC 3� 250LysozymeP 5� ATGGCTACCGTGGAGTCAAG 3� 5� TTGATCCCACAGGCATTCTT 3� 186

30 PERL ET AL.

and Sox10 antibodies were purchased from Chemicon(Temecula, CA). In wildtype mice some cross-reactivityof the Sox10 antibody with Sox9 protein was observed.Sox9 was a gift from Michael Wegner (Institute of Bio-chemistry, University of Erlangen). The Sox17 antibodywas a gift from Aaron Zorn and James Wells (CincinnatiChildren’s Hospital). Tissue sections were stained withhematoxylin-eosin. Immunohistochemistry for thyroidtranscription factor 1 (TTF-1), proSP-C, CCSP, and CGRPwere performed as previously described (Perl et al.,2002b; Tichelaar et al., 2000; Whitsett et al., 2002).

Oxygen Injury

At 8 weeks of age, 21 Sox9�/� mice (SPCrtTA/tetOCre/Sox9flox/flox) and 14 control littermates (tetOCre/Sox9flox/flox) that were on doxycycline from conceptionto weaning were exposed to 95% oxygen for 96 h, thenweaned and placed in room air (RA) for 7 days forrecovery. At least three mice per genotype were ana-lyzed before and after oxygen exposure, and at 1 and7 days of recovery. These mice are on a mixed geneticbackground and were backcrossed to FVBN at least fivetimes. Since tolerance to oxygen injury varies amongmouse strains, littermates were used for comparison.These conditions have previously been used in Hokutoet al. (2003, 2004). Conditions were optimized to reducethe number of fatal outcomes in the control group. Outof the 35 mice, four mice (two of each group) diedimmediately after weaning from oxygen. One controlmouse died during the recovery period.

RT-PCR

Pregnant mice were placed on doxycycline at discoveryof a vaginal plug and embryos were harvested at E12.5and E13.5. Whole embryos and isolated lungs were ho-mogenized in Trizol reagent (Life Technologies, Rock-ville, MD) and RNA extracted by using Phase lock GelEppendorf tubes according to the manufacturer’s in-structions. After weaning mice were taken off doxycy-cline, adult lungs were homogenized in Trizol reagent,and RNA extracted according to the manufacturer’s in-structions. RNA was treated with DNAse prior to cDNAsynthesis. All RNA from one isolated lung was dividedinto two aliquots and reverse-transcribed in the presenceor absence of reverse transcriptase. cDNAs of embryosand lungs were analyzed by PCR for mRNA for Sox8,Sox10, Sox2, Sox4, and Sox11. cDNAs of adult lungswere analyzed for acidic chitinase (Suzuki et al., 2001),lysozyme M, and lysozyme P. All PCRs were done withfive or more individual lungs. For normalization, PCR for�-actin mRNA was performed. To control for DNA con-tamination, PCR reactions were conducted on the sam-ples where reverse transcriptase was absent in the cDNAreaction, no DNA contamination was found (data notshown). All PCRs were performed at 58°C annealingtemperature for 30 cycles. For primer sequences andPCR product length, see Table 1.

ACKNOWLEGMENTS

We thank Michael Wegner (Institute of Biochemistry,University of Erlangen) for the Sox9 antibody, AaronZorn and James Wells (CCHMC) for the Sox17 antibody,Henry Akibini (CCHMC) for the lysozymeM and ly-sozymeP PCR primers, and Cindy Bachurski (CCHMC)for the acidic chitinase PCR primers. We thank DavidLoudy for technical assistance.

LITERATURE CITED

Akiyama H, Chaboissier MC, Martin JF, Schedl A, de Crombrugghe B.2002. The transcription factor Sox9 has essential roles in succes-sive steps of the chondrocyte differentiation pathway and is re-quired for expression of Sox5 and Sox6. Genes Dev 16:2813–2828.

Akiyama H, Lyons JP, Mori-Akiyama Y, Yang X, Zhang R, Zhang Z, DengJM, Taketo MM, Nakamura T, Behringer RR, McCrea PD, de Crom-brugghe B. 2004. Interactions between Sox9 and beta-catenincontrol chondrocyte differentiation. Genes Dev 18:1072–1087.

Bell DM, Leung KK, Wheatley SC, Ng LJ, Zhou S, Ling KW, Sham MH,Koopman P, Tam PP, Cheah KS. 1997. SOX9 directly regulates thetype-II collagen gene. Nat Genet 16:174–178.

Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. 1999. Sox9is required for cartilage formation. Nat Genet 22:85–89.

Bi W, Huang W, Whitworth DJ, Deng JM, Zhang Z, Behringer RR, deCrombrugghe B. 2001. Haploinsufficiency of Sox9 results in de-fective cartilage primordia and premature skeletal mineralization.Proc Natl Acad Sci U S A 98:6698–6703.

Borthwick DW, Shahbazian M, Krantz QT, Dorin JR, Randell SH. 2001.Evidence for stem-cell niches in the tracheal epithelium. Am JRespir Cell Mol Biol 24:662–670.

Bowles J, Schepers G, Koopman P. 2000. Phylogeny of the SOX familyof developmental transcription factors based on sequence andstructural indicators. Dev Biol 227:239–255.

Bridgewater LC, Lefebvre V, de Crombrugghe B. 1998. Chondrocyte-specific enhancer elements in the Col11a2 gene resemble theCol2a1 tissue-specific enhancer. J Biol Chem 273:14998–15006.

Britsch S, Goerich DE, Riethmacher D, Peirano RI, Rossner M, NaveKA, Birchmeier C, Wegner M. 2001. The transcription factorSox10 is a key regulator of peripheral glial development. GenesDev 15:66–78.

Cardoso WV. 2000. Lung morphogenesis revisited: old facts, currentideas. Dev Dyn 219:121–130.

Chaboissier MC, Kobayashi A, Vidal VI, Lutzkendorf S, Van De Kant HJ,Wegner M, De Rooij DG, Behringer RR, Schedl A. 2004. Functionalanalysis of Sox8 and Sox9 during sex determination in the mouse.Development 131:1891–1901.

De Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux M, Moniot B,Sudbeck P, Scherer G, Poulat F, Berta P. 1998. Direct interactionof SRY-related protein SOX9 and steroidogenic factor 1 regulatestranscription of the human anti-Mullerian hormone gene. Mol CellBiol 18:6653–6665.

Foster JW, Dominguez-Steglich MA, Guioli S, Kowk G, Weller PA,Stevanovic M, Weissenbach J, Mansour S, Young ID, GoodfellowPN, et al. 1994. Campomelic dysplasia and autosomal sex reversalcaused by mutations in an SRY-related gene. Nature 372:525–530.

Healy C, Uwanogho D, Sharpe PT. 1999. Regulation and role of Sox9 incartilage formation. Dev Dyn 215:69–78.

Hokuto I, Perl AK, Whitsett JA. 2003. FGF-signaling is required forpulmonary homeostasis following hyperoxia. Am J Physiol LungCell Mol Physiol 286:L580–587. Epub 2003 Nov 14.

Hokuto I, Machiko Ikegami, Mitsuhiro Yoshida, Kiyoshi Takeda, ShizuoAkira, Perl AK, William Hull, Susan Wert, Whitsett JA. 2004. Stat-3is required for pulmonary homeostasis during hyperoxia. J ClinInvest 113:28–37

Houston CS, Opitz JM, Spranger JW, Macpherson RI, Reed MH, GilbertEF, Herrmann J, Schinzel A. 1983. The campomelic syndrome:

31CONDITIONAL INACTIVATION OF Sox9 IN THE LUNG

review, report of 17 cases, and follow-up on the currently 17-year-old boy first reported by Maroteaux et al. in 1971. Am J Med Genet15:3–28.

Kent J, Wheatley SC, Andrews JE, Sinclair AH, Koopman P. 1996. Amale-specific role for SOX9 in vertebrate sex determination. De-velopment 122:2813–2822.

Kist R, Schrewe H, Balling R, Scherer G. 2002. Conditional inactivationof Sox9: a mouse model for campomelic dysplasia. genesis 32:121–123.

Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M.1998a. Sox10, a novel transcriptional modulator in glial cells.J Neurosci 18:237–250.

Kuhlbrodt K, Schmidt C, Sock E, Pingault V, Bondurand N, GoossensM, Wegner M. 1998b. Functional analysis of Sox10 mutationsfound in human Waardenburg-Hirschsprung patients. J Biol Chem273:23033–23038.

Lefebvre V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B.1997. SOX9 is a potent activator of the chondrocyte-specificenhancer of the pro alpha1(II) collagen gene. Mol Cell Biol 17:2336–2346.

Mansour S, Hall CM, Pembrey ME, Young ID. 1995. A clinical andgenetic study of campomelic dysplasia. J Med Genet 32:415–420.

Mansour S, Offiah AC, McDowall S, Sim P, Tolmie J, Hall C. 2002. Thephenotype of survivors of campomelic dysplasia. J Med Genet39:597–602.

Mori-Akiyama Y, Akiyama H, Rowitch DH, de Crombrugghe B. 2003.Sox9 is required for determination of the chondrogenic cell lin-eage in the cranial neural crest. Proc Natl Acad Sci U S A 100:9360–9365.

Mucenski ML, Wert SE, Nation JM, Loudy DE, Huelsken J, BirchmeierW, Morrisey EE, Whitsett JA. 2003. beta-Catenin is required forspecification of proximal/distal cell fate during lung morphogen-esis. J Biol Chem 278:40231–40238.

Nachtigal MW, Hirokawa Y, Enyeart-VanHouten DL, Flanagan JN, Ham-mer GD, Ingraham HA. 1998. Wilms’ tumor 1 and Dax-1 modulatethe orphan nuclear receptor SF-1 in sex-specific gene expression.Cell 93:445–454.

Ng LJ, Wheatley S, Muscat GE, Conway-Campbell J, Bowles J, Wright E,Bell DM, Tam PP, Cheah KS, Koopman P. 1997. SOX9 binds DNA,activates transcription, and coexpresses with type II collagenduring chondrogenesis in the mouse. Dev Biol 183:108–121.

Perl AK, Tichelaar JW, Whitsett JA. 2002a. Conditional gene expressionin the respiratory epithelium of the mouse. Transgen Res 11:21–29.

Perl AK, Wert SE, Nagy A, Lobe CG, Whitsett JA. 2002b. Early restric-tion of peripheral and proximal cell lineages during formation ofthe lung. Proc Natl Acad Sci U S A 99:10482–10487.

Pingault V, Bondurand N, Kuhlbrodt K, Goerich DE, Prehu MO, PulitiA, Herbarth B, Hermans-Borgmeyer I, Legius E, Matthijs G, AmielJ, Lyonnet S, Ceccherini I, Romeo G, Smith JC, Read AP, WegnerM, Goossens M. 1998. SOX10 mutations in patients with Waar-denburg-Hirschsprung disease. Nat Genet 18:171–173.

Reynolds SD, Giangreco A, Power JH, Stripp BR. 2000. Neuroepithelialbodies of pulmonary airways serve as a reservoir of progenitorcells capable of epithelial regeneration. Am J Pathol 156:269–278.

Schepers GE, Bullejos M, Hosking BM, Koopman P. 2000. Cloning andcharacterisation of the Sry-related transcription factor gene Sox8.Nucleic Acids Res 28:1473–1480.

Schepers GE, Teasdale RD, Koopman P. 2002. Twenty pairs of sox:extent, homology, and nomenclature of the mouse and human soxtranscription factor gene families. Dev Cell 3:167–170.

Schepers G, Wilson M, Wilhelm D, Koopman P. 2003. SOX8 is ex-pressed during testis differentiation in mice and synergizes withSF1 to activate the Amh promoter in vitro. J Biol Chem 278:28101–28108.

Semba I, Nonaka K, Takahashi I, Takahashi K, Dashner R, Shum L,Nuckolls GH, Slavkin HC. 2000. Positionally-dependent chondro-genesis induced by BMP4 is co-regulated by Sox9 and Msx2. DevDyn 217:401–414.

Sock E, Schmidt K, Hermanns-Borgmeyer I, Bosl MR, Wegner M. 2001.Idiopathic weight reduction in mice deficient in the high-mobility-group transcription factor Sox8. Mol Cell Biol 21:6951–6959.

Suzuki M, Morimatsu M, Yamashita T, Iwanaga T, Syuto B. 2001. Anovel serum chitinase that is expressed in bovine liver. FEBS Lett506:127–130.

Tichelaar JW, Lu W, Whitsett JA. 2000. Conditional expression offibroblast growth factor-7 in the developing and mature lung.J Biol Chem 275:11858–11864.

Tremblay JJ, Viger RS. 1999. Transcription factor GATA-4 enhancesMullerian inhibiting substance gene transcription through a directinteraction with the nuclear receptor SF-1. Mol Endocrinol 13:1388–1401.

Vidal VP, Chaboissier MC, de Rooij DG, Schedl A. 2001. Sox9 inducestestis development in XX transgenic mice. Nat Genet 28:216–217.

Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J, Pasantes J,Bricarelli FD, Keutel J, Hustert E, et al. 1994. Autosomal sexreversal and campomelic dysplasia are caused by mutations in andaround the SRY-related gene SOX9. Cell 79:1111–1120.

Wegner M. 1999. From head to toes: the multiple facets of Sox pro-teins. Nucleic Acids Res 27:1409–1420.

Wert SE, Glasser SW, Korfhagen TR, Whitsett JA. 1993. Transcriptionalelements from the human SP-C gene direct expression in theprimordial respiratory epithelium of transgenic mice. Dev Biol156:426–443.

Whitsett JA, Clark JC, Picard L, Tichelaar JW, Wert SE, Itoh N, Perl AK,Stahlman MT. 2002. Fibroblast growth factor 18 influences prox-imal programming during lung morphogenesis. J Biol Chem 277:22743–22749.

Zehentner BK, Dony C, Burtscher H. 1999. The transcription factorSox9 is involved in BMP-2 signaling. J Bone Miner Res 14:1734–1741.

Zeng L, Kempf H, Murtaugh LC, Sato ME, Lassar AB. 2002. Shh estab-lishes an Nkx3.2/Sox9 autoregulatory loop that is maintained byBMP signals to induce somitic chondrogenesis. Genes Dev 16:1990–2005.

32 PERL ET AL.