This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Research Report

Neurogenic potential of progenitor cells isolated frompostmortem human Parkinsonian brains

ShanshanWanga, Michael S. Okuna, b, Oleg Suslova, Tong Zhenga, Nikolaus R. McFarlandb,Vinata Vedam-Maia, Kelly D. Footea, Steven N. Ropera, Anthony T. Yachnisc,Florian A. Siebzehnrubla, 1, Dennis A. Steindlera, 1,⁎aDepartment of Neurosurgery, The University of Florida, Center for Movement Disorders and Neurorestoration, College of Medicine, USAbDepartment of Neurology, The University of Florida, Center for Movement Disorders and Neurorestoration, College of Medicine, USAcDepartment of Pathology, The University of Florida, Center for Movement Disorders and Neurorestoration, College of Medicine, USA

A R T I C L E I N F O A B S T R A C T

Article history:Accepted 20 April 2012Available online 27 April 2012

The success of cellular therapies for Parkinson's disease (PD) will depend not only on aconducive growth environment in vivo, but also on the ex vivo amplification and targetedneural differentiation of stem/progenitor cells. Here, we demonstrate the in vitro proliferativeand differentiation potential of stem/progenitor cells, adult human neural progenitor cells(“AHNPs”) isolated from idiopathic PD postmortem tissue samples and, to a lesser extent,discarded deep brain stimulation electrodes. We demonstrate that these AHNPs can beisolated from numerous structures (e.g. substantia nigra, “SN”) and are able to differentiateinto both glia and neurons, but only under particular growth conditions including co-culturing with embryonic stem cell-derived neural precursors (“ESNPs”); this suggests that PDmultipotent neural stem/progenitor cells do reside within the SN and other areas, but bythemselves appear to lack key factors required for neuronal differentiation. AHNPs engraftfollowing ex vivo expansion and transplantation into the rodent brain, demonstrating theirregenerative potential. Our data demonstrate the presence and capacity of endogenous stem/progenitor cells in the PD brain.

© 2012 Elsevier B.V. All rights reserved.

Keywords:Parkinson's diseaseNeurogenesisNeural stem cellNeural progenitor cellCell culture

1. Introduction

Current pharmacological and surgical treatments for PD havebeen successful in addressing several motor symptoms, but todate have not been shown to be capable ofmodifying disease, oraddress levodopa resistance associated symptoms. Cell trans-plantation therapies have also faced numerous obstaclesincluding ethical, safety and technical issues. It has beenhypothesized that novel cell-based therapies aimed at stimula-

tion of endogenous dopamine production within the brainmayprovideamore physiological andmoreelegantway to overcomethe cardinal symptoms of PD (Arias-Carrion et al., 2007; Baquetet al., 2005; Geraerts et al., 2007; Preynat-Seauve et al., 2009).

While the existence of stem cells in the adult brain iswidely accepted in the scientific community, the magnitude,pathogenetic relevance and restorative potential of neurogen-esis in the diseased brain is far less understood. The numberof studies on these processes in the adult human brain is

B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

⁎ Corresponding author at: Department of Neurosurgery, University of Florida College of Medicine, PO Box 100265, Gainesville, FL 32610, USA.Fax: +1 352 392 8413.

E-mail address: steindler@neurosurgery.ufl.edu (D.A. Steindler).1 Share senior authorship.

0006-8993/$ – see front matter © 2012 Elsevier B.V. All rights reserved.doi:10.1016/j.brainres.2012.04.039

Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te /b ra i n res

Author's personal copy

limited. While studies have suggested the presence of precur-sor cells within the adult rodent substantia nigra (SN) (Lieet al., 2002), in general there is a lack of evidence for adulthuman neural progenitor cells (AHNPs) (Walton et al., 2006) inthe Parkinsonian brain, including the SN (Srivastava et al.,2008). It also remains uncertain as to whether AHNPs possessthe capacity to produce dopaminergic neurons (DA neurons)within the PD brain (Geraerts et al., 2007; Storch et al., 2004). Inthis study, we isolated and cultured AHNPs from the SN andthree other regions of postmortem PD brains. PD AHNPprimary cell lines were found to differentiate into neuronsand astrocytes when cultured under specific growth condi-tions.We conclude that adult stem/progenitor cells exist in theSN and other regions within the PD brain, and that these cellsrepresent a potentially valuable source for bioassays aimed atboth understanding disease course, and screening for poten-tial cellular and pharmacologic therapies.

2. Results

2.1. Isolation and culture of AHNPs from PD brain

Compared to other non-PD AHNP cultures (surgical resectionsfor temporal lobe epilepsy, n=5), PD AHNPs in primary cultureexhibited a lower adherence to a poly-ornithine-coatedsubstrate with more than 50% of cells detaching after a fewdays (data not shown). The surviving neural progenitor cellsformed a confluent monolayer after 4–7 weeks (Fig. 1A). AHNPcultures appeared to represent a stable expanding populationin two or three passages (Figs. 1B,C). Figs. 1D,E documentphenotypic changes that occurred within this cell populationduring expansion, including the appearance of many cellswith neuronal morphology. Larger numbers of round and flatcells were observed in SN AHNP primary cultures (Fig. 1F),while more spindle-shaped and bipolar cells were present incultures from other brain regions (Fig. 1G), but all of the cellsbecame morphologically uniform after two passages. Com-pared to epilepsy cultures, PD cells in primary culture grewsignificantly slower (p<0.05) (Fig. 1K). PD AHNPs wereobtained from tissue samples derived from cortex (CX),hippocampus (HC), subventricular zone (SVZ), and SN (seeTable 1), and could be expanded for more than 50 populationdoublings (Fig. 1L). Under neurosphere (Laywell et al., 1999)conditions, cells from all regions also grew as spheres(Fig. 1H). However, spheres decreased in size over 6 passages,when sphere cultures were aborted (Fig. 1I).

We also generated cell cultures from DBS lead electrodesremoved during lead replacement procedures (n=3). Primarycells were observed growing off of the electrodeswithin 72 h ofculture initiation. These cells continued to grow for 3–5 weeks(Fig. 1J), but could not be expanded beyond 2 passages.

2.2. Identification of AHNPs from the Parkinson's brain

Immunocytochemistry was performed to identify the cul-tured PD cells as neural stem/progenitor cells. Most cells fromall the brain regions sampled expressed neural stem cellmarkers nestin (Fig. 2A) and SOX2 (Brazel et al., 2005) (Figs. 2D,E), and themajority of the nestin/SOX2 positive cells were also

immunoreactive for the radial glial marker vimentin (Fig. 2C)(Bramanti et al., 2010), and the glutamate transporter GLAST(glutamate astrocyte-specific transporter, Zecevic, 2004, orEAAT1; Fig. 2F). The GLAST labeling of all these PD cells wasboth nuclear and cytoplasmic, while concurrent immunola-beling studies showed that murine adult neural progenitorcells exhibited exclusive cytoplasmic localization (data notshown). Nuclear location of the glutamate astrocyte-specifictransporter GLAST protein had been reported in humanglioma cells (Ye et al., 1999), but their labeling pattern didnot include a cytoplasmic component whereas the PD AHNPcells did exhibit light cytoplasmic in addition to strongnuclear labeling. The basis for this labeling pattern is notknown, but it suggests the possibility that PD cells might havealtered glutamate metabolism. We did not observe expressionof CD133 (data not shown), which is thought to be predom-inantly expressed in S, G2 or M phase stem cells but down-regulated in slow-cycling or dormant stem cells (Sun et al.,2009). These cells were also negative for multipotent mitoticglial markers A2B5 and NG2 (data not shown). No TuJ1positive neurons or GFAP positive astrocytes were detectedin any proliferating cell cultures after subculture. Though α-synuclein aggregates were observed in PD SN tissue fromthese patients, we did not detect α-synuclein in culturedAHNPs or their progeny (data not shown). We compared theproportion of nestin and SOX2 positive cells among popula-tions from the four brain regions studied here, but did not finda significant difference (ANOVA, p=0.47 and 0.49, respectively)(Fig. 2M). We detected mRNA expression of progenitor markersin SN-derived cell cultures as well as in SVZ and SN tissue byRT-PCR. Both cells (Fig. 2N) and tissue (Fig. 2O) expressednestin,SOX2, vimentin and GLAST, supportive of the existence of aprogenitor cell pool in the PD SN. Interestingly, only GLASTmRNA showed a marked difference between SN and SVZ intissue samples (Fig. 2N–O). Whether the weak expression ofGLAST in SN is one of the pathological characteristics of PDwillrequire further study.

2.3. Limited potential of in vitro-expanded PD AHNPs

To determine the neural lineage potential of the PD stem/progenitor cells, adherent AHNPs were induced to differenti-ate on poly-ornithine-coated glass coverslips with 3 types ofdifferentiation media (DM). After 4–7 days culture in DM, in allthe 3 groups of differentiation systems, approximately 50–60%of cells detached from the poly-ornithine-coated surface(Fig. 4A), and there were another 10–25% cells detached atlater stages. Addition of 1% fetal bovine serum to thedifferentiation media only saved the later period of celldeath (Fig. 4B), and in both conditions, immunocytochemicalanalysis on the surviving cells did not reveal any TuJ1 positiveneurons or GFAP positive astrocytes. We detected only weaknestin and vimentin expression (Fig. 4C).

2.4. In vitro evidence of improved neural differentiation ofPD AHNPs following co-culture with rodent embryonic andadult neural precursor cells

In contrast to isolated differentiation, AHNPs from PD patients'brain gave rise to both neurons and astrocytes when co-cultured

62 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

with mouse embryonic stem cell derived neural precursor(“ESNP”) cells. We hypothesized that a more conducive environ-ment to inducing neuronal differentiation from PDAHNPsmight

be generated from supporting astroglial cells (Song et al., 2002;Wang et al., 1994). Since the embryonic brain presents themost hospitable environment for neurogenesis and neuronal

Fig. 1 – Isolation and culture of AHNPs from the PD brain. Tissue samples of SN, SVZ, HC and CX from postmortem PD patientswere dissociated and plated into proliferative media. (A–J) Phase-contrast photomicrographs of PD AHNPs in culture. (A) Neuralprogenitor cells survive plating and remain attached to poly-ornithine-coated dishes, forming a confluent monolayer after4–7 weeks. Stably expanding populations of PD AHNPs have been established after 2–3 passages. (B) Clusters/spheres aregenerated during the initial stages (e.g. 3 days after subculture) of adherence to poly-ornithine substrate. (C) Confluent,adhesive culture with clusters of small, round cells overlying medium-sized bipolar, spindle-shaped and large cells withpolygonal and multipolar morphologies. (D) and (E) Morphological changes occur within AHNP cell populations, manymedium-sized or large cells evolve into neuron-like cells during expansion. (F,G) Characteristic cell morphologies in AHNPcultures. Larger numbers of round and flat cells were observed in SN AHNP primary cultures (F), while more spindle-shapedand bipolar cells are present in cultures from other brain regions (G); all of the cells become morphologically uniform after twopassages. (H,I) Primary neurosphere cultures. PD AHNPs can grow as spheres under our neurosphere growth conditions (H),but they decrease in size over 6 passages (I). (J) The panel shows a primary PD AHNP culture generated from DBS leadelectrodes removed for electrode replacement. (K) Compared to epilepsy AHNP cultures, PD cells in primary cultures grewsignificantly slower (p<0.02). (L) PD AHNPs do not exhibit growth rate reductions after more than 50 population doublings. Allthe data presented without labels in Fig. 1 are from PD SN AHNP cultures except for (G), which shows an SVZ AHNP culture.Scale bars=100 μm.

63B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

differentiation, including for cells of the dopaminergic lineage,we tried co-culturing PD AHNPs with cells that had the capacityto both support neuronal fate and survival aswell as differentiateinto tyrosine hydroxlase (TH)+ neurons: ESNPs. This notion wasbased on, and supported by the finding that adult precursor cellsshowed the potential to give rise to cells of all germ layers whenco-culturedwithembryoid bodies (“EBs”) (Clarke et al., 2000), thusinductive signals for differentiation to diverse lineages should bepresent in EB cultures. We therefore performed co-culturestudies of PD AHNPs with GFP-labeled mouse ESNP cells to testthe neurogenic potential of these PD AHNPs. Few of the co-cultured cells stayed adherent to the poly-ornithine-coatedsurfaces when incubated in DM1 (see experimental proceduresfor details), whilemost cells attached on the coverslips in DM2 orDM3, indicating that BDNF and/or NT-3 might play importantroles in cell survival and differentiation. In a DM2- and DM3‐incubated human SN AHNP and mouse GFP-ESNP co-culturesystem, mouse ESNPs differentiated into GFP+ neurons (identi-fied by TuJ1 and TH) and astrocytes (GFAP) (data not shown). Weobserved someGFP−/TuJ1+ (Figs. 2G–I), GFP−/TH+ (Figs. 2J,K) andGFP−/GFAP+ (Fig. 2L) cells, which represented human PD cells.Many GFP− cells were still Nestin positive after 8 days ofincubation with DM. This co-culture experiment demonstratedthat there were multipotent neural progenitor cells in the SNAHNP population, which can differentiate into neurons, includ-ing DA neurons, and astrocytes in vitro when provided with anappropriate environment. BothDM2 andDM3 incubated culturesgave rise to neurons and astrocytes, suggesting that ESNPs couldproduce some critical differentiation and survival factors. ThusFGF8 and SHH, two factors which are thought to be essential ingenerating DA neurons from adult neural stem cells, arenonessential in the presence of ESNPs. The presence of FGF8and SHH led to an immense increase in the numbers of TuJ1positive cells and TH positive cells among a GFP positivepopulation (data not shown), but did not distinctly enhanceTuJ1 positive and TH positive cell numbers among the GFPnegative PD population (p>0.05, see Fig. 5A).

To investigate whether conditioned medium from ESNPsalone could inducedifferentiationof PDAHNPs intoneurons andglia in vitro, we cultured PD AHNPs with conditioned mediumfrom differentiatingmurine ESNPs. No obvious detachment wasobserved in differentiating PD AHNP cultures containing condi-tioned medium (Fig. 4D), and approximately 5–10% of thesecells gradually differentiated into cells with apparent morpho-logical characteristics of neurons, e.g. extending long processes(Figs. 4E–L). However, none of these cells were immunopositive

for neuronal or glial markers. Co-culturing with ESNPs couldsuccessfully induce the PD AHNPs to differentiate into neuronsand astrocytes, but ESNP-conditioned medium could not,indicating that not only soluble factors are necessary for AHNPdifferentiation but also cell–cell contact between the PD cells andsupporting cells.

PD AHNPs from SVZ, HC, and CX were co-cultured withmouse GFP-ESNPs in DM3 media to induce differentiation.GFP−/TuJ1+, GFP−/TH+ and GFP−/GFAP+ cells were found inPD cell co-cultures derived from the three brain regions after8 days of induced differentiation. This suggests that not onlythe progenitors from PD SN, but also progenitors from otherbrain regions including the SVZ, HC, and CX have thepotential to develop into neurons, even DA neurons, andastrocytes in vitrowhen provided with an appropriate cellular/molecular environment. We quantified the numbers of GFP−/TH+ cells among four PD brain regions (n=5 per region), andfound that SN-derived PD AHNPs generated the lowestamount of TH+ neurons. The highest proportion of TH+neurons was found in CX-derived PD AHNPs (CX>HC>SVZ>SN, p<0.01, see Fig. 5B). This difference in differentiationcapacity could reflect a different level of disease severitywithin distinct brain regions in PD brains.

2.5. Co-cultured with adult mouse SVZ stem cells,progenitors from the Parkinsonian brain candifferentiate into neurons

To determine whether co-culturing with adult neural stemcells could stimulate PD AHNPs' differentiation, we also triedto co-culture the PD AHNPs with GFP-labeled adult mouse SVZstem cells. Co-cultured cells were fixed for immunocytochem-istry after 8 days in DM3 media. At this time point, TuJ1positive neurons were observed, some of them being GFPnegative, demonstrating that SN-derived PD AHNPs have thepotential to differentiate into neurons in the presence of adultneural stem cells. The majority of the GFAP positive astro-cytes in the co-culture system were GFP positive, suggestingthat these cells originated from adult mouse SVZ stem cells.We noticed some differences in these PD AHNPs' differenti-ation profile when compared to PD cells and ESNP co-cultures:co-culturing PD cells with ESNPs in DM3 medium rarelyresulted in detachment, but in a PD AHNP and adultSVZ stem/progenitor cell co-culture system about 30–40%cells detached during the first week in DM3 medium.Immunocytochemical analysis detected very few GFAP-

Table 1 – Isolation and derivation of neural progenitors.

Patient'sage/sex

Clinicaldiagnosis

Pathologicaldiagnosis

Regions sampled Stable cell linesestablished

Neurongeneration

65/male PD Idiopathic PD SN, SVZ, HC SN, SVZ, Yes84/female PD Idiopathic PD SN, SVZ, HC, primary motor CX SN, SVZ, CX Yes57/female PD and GBM Idiopathic PD, GBMa SN, DBS Rec SVZ, HC, frontal CX CX Not determined86/male PD Possible PDb SN, SVZ, HC, primary motor CX SN, SVZ, HC, Yes57/male PD Idiopathic PD SN, SVZ, HC, primary motor CX SN, SVZ, HC, CX Yes75/female PD SN, SVZ, HC, primary motor CX SN, SVZ, HC, CX Yes65/male PD SN, SVZ, HC, primary motor CX SN, SVZ Not determined

a GBM: glioblastoma multiforme.b A neurodegenerative disorder with possible Parkinson's disease.

64 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

positive/GFP-negative cells, and most of them appeared to bedying cells or cellular debris. These data show that progenitorcells from PD SNmay be impaired in their ability to form GFAPpositive astrocytes, although co-culturing with ESNPs couldsomewhatabrogate thedefect,while thepresenceof adultneuralstem cells could not completely help overcome this.

2.6. PD progenitor cells can give rise to TH+ cells upon invivo engraftment

Injection of AHNPs into the ventricles of adult mice resulted intheir engraftment in the SVZ and olfactory bulb (Fig. 3). PDSVZ derived AHNPs were found in the host SVZ, and

Fig. 2 – Identification and in vitro differentiation of PD AHNPs. Immunocytochemistry was utilized to establish PD AHNPs asneural stem/progenitor cells (A–F from SN cultures). Cells in expanding cultures express neural stem cell markers nestin(A; green) and SOX2 (E; red), and the majority of the nestin/SOX2 positive cells are also immunoreactive for radial glial markersvimentin (C; red) and GLAST (EAAT1) (F; green). (B) GFAP (green) expression in a subpopulation within these primary cultures.(M) There is no significant difference (p=0.47, 0.49) in the proportions of nestin and SOX2positive cellswithinAHNPpopulationsfrom the four brain regions studied here (SN, SVZ, HC, CX). RT-PCRwas performed on SN-derived cells and SVZ and SN tissue todetect mRNA for progenitor cell markers. Both cell (N) and tissue (O) RT-PCR results show nestin, SOX2, vimentin and GLASTexpression, suggesting a progenitor cell pool in the PD patients' SN and SVZ. The expression of GLAST in SN tissue is markedlyweaker than that seen in SVZ tissue. Under appropriate differentiation-inducing conditions, PD AHNPs have been shown tohave the capacity to differentiate into both neurons and astrocytes, revealing their multipotent neurogenic potential (G–Limageswere taken fromhumanPDSNAHNP andmouseGFP-ESNP co-cultures). Co-culturedwith GFP expressingmouse ESNPsin DM containing SHH, FGF8b, BDNF, NT-3, PDGF, ascorbic acid and retinoid acid, PD SN AHNPs (GFP-) gave rise to TuJ1 positiveneurons (G,H,I; labeledwithwhite arrow, red is Tuj1), THpositiveDAneurons (J,K; labeledwithwhite arrow, red is TH) andGFAPpositive astrocytes (L; red is GFAP). GFP is green in G–L. Nuclei are counterstained with DAPI (blue). Scale bars=50 μm.

65B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

expressed GFAP. PD SVZ and SN derived AHNPs were found inthe glomerular layer of the host olfactory bulb, where theyexpressed TH but not NeuN, in agreement with previousfindings that many glomerular neurons do not express NeuN(Parrish-Aungst et al., 2007). Engrafted AHNPs were identifiedusing human-specific ferritin antibodies. These findingsdemonstrate that progenitor cells isolated from the SN orSVZ of a Parkinsonian brain can, in principle, differentiate intoTH+ neuronal phenotypes. Furthermore, AHNPs from the SVZalso integrated into the neurogenic niche, while we did notobserve SVZ integration from SN derived AHNPs.

3. Discussion

In this study, we were able to successfully isolate andpropagate neural progenitor cells from the SN, SVZ, HC andCX of postmortem brain tissue of PD patients. These AHNPcells have elements in common with the floor plate radialglia-like cells that have been identified as dopaminergicneuronal progenitors in the midbrain (Bonilla et al., 2008).Neurogenic radial glia also have been reported to reside in theouter subventricular zone of the cerebral cortex (Hansen et al.,2010; Malatesta et al., 2008). PD AHNPs express nestin, SOX2,

vimentin and GLAST, which are reactive astrocyte markerssupportive of their potential reactive astrocytic nature as wellas their being part of a progenitor cell pool in the PD SN wherereactive gliosis certainly is a hallmark of the disease. Unlikereactive rodent astrocytes following injuries in the adultrodent forebrain, that can be multipotent stem/progenitorcells giving rise to neurons and glia readily in culture(Malatesta et al., 2008), these human progenitor cells failedto develop into neurons and astrocytes in standard cultureconditions that allow neuronal differentiation of adult humanprogenitor cells (Walton et al., 2006); we also performedelectrophysiological studies of non-PD AHNPs in our originalin vitro studies describing these cells and found them toexhibit immature biophysical properties of cultured neuronsand glia, suggesting that the AHNPs from the PD brain aredifficult to differentiate. When co-cultured with ESNPs, theAHNPs revealed their multipotent neurogenic potential,including the generation of TuJ1 and TH positive neurons, aswell as GFAP positive astrocytes. The PD AHNPs used for co-culture experiments were passaged 7–10 times after theiroriginal isolation, so we believe that the TuJ1 and TH positiveneurons, as well as GFAP positive astrocytes are derived fromthe PD AHNP cells and not from fully differentiated cells thatmight have been carried along during the original isolation. It

Fig. 3 – In vivo engraftment of PD AHNPs. AHNPs derived from SVZ and SN were injected into the lateral ventricles of adult FoxChase SCID mice. The mice were sacrificed 4 weeks after transplantation, and engrafted cells in the olfactory bulb werevisualized by immunohistochemistry for human specific ferritin and neuronal markers. (A) Confocal projection image of amature human neuron in the periglomerular layer co-expressing human ferritin and NeuN (GL: glomerular layer). (B) Neuronsin the glomerular layer co-expressed human ferritin (B) and TH (B′), but not NeuN (B″). (C) Confocal z-stack of boxed area in Bj.Scale bars 10 μm.

66 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

is known that cell–cell fusion can occur under normal co-culture conditions and contribute to observed intrinsicplasticity of somatic cells. Even though compared with theirproduction from embryonic stem cells the yield of DA neuronsfrom the PD AHNPs is quite low, it is still much higher thanthe documented extremely low cell fusion frequencies(Terada et al., 2002; Ying et al., 2002). In the studies here,however, we used GFP-labeled ESNPs/MASCs in co-culturewith GFP-negative PD AHNPs, and thus all fused cells shouldhave expressed GFP (which they did not; studies using FISHto check for mouse–human chromosome staining in thesame cells also did not reveal fused cells). Interestingly,when co-cultured with adult neural stem cells, they wereable to differentiate into TuJ1 positive neurons, but revealeda defect in forming GFAP positive astrocytes. This cellpopulation could potentially contribute to a new in vitromodel system for PD research, and may provide a potentialtarget for therapeutic intervention to regenerate functionalendogenous dopaminergic neurons in the human PD brain.Identifying the signals that can direct the differentiation ofSN progenitor cells of PD patients toward DA neurons mightbe a useful approach in the future for novel therapies for PD.These progenitor cells may prove to be an attractive sourcefor cell-based therapy for PD in that they both overcomethe ethical issues inherent to the use of embryonic orfetal stem cells, and open the possibility for autologous

transplantations. A previous study of the rodent SN hasrevealed the presence of a glial precursor cell that can giverise to neurons and glia in culture, but appear to be solelygliogenic in vivo (Lie et al., 2002). This cell appears to bedifferent from the AHNPs described here since it expressesthe NG2 proteoglycan (which AHNPs do not), and AHNPshere seem to be more in line with the AHNP cell we havedescribed from the non-PD adult human fore- and midbrain(Walton et al., 2006). Nonetheless, the fact that there areneurogenic cells in the human SN suggests the potential torecruit this type of cell for cell-based therapy approaches inPD. Likewise, this cell could be compared with counterpartsgenerated from normal, and PD induced pluripotent stemcells (iPSCs) and induced neurons/dopamine neurons(Nguyen et al., 2011; Park et al., 2008; Pfisterer et al., 2011;Takahashi et al., 2007; Yu et al., 2007) in future studiesattempting to categorize and standardize the state ofdifferentiation potential of reparative stem/progenitor cellsengineered using such iPS cell technology.

AHNP cells can be isolated from various brain regions of PDpatients, including the SN. In addition to their ability todifferentiate into TH+ neurons in vitro, these cells show animpressive propensity for functional engraftment within theneurogenic SVZ-rostral migratory stream-olfactory bulb axisfollowing in vivo transplantation. We chose to engraft in theSVZ/rostral migratory stream/olfactory bulb axis because of

Fig. 4 – In vitro-expanded PD AHNPs fail to develop into neurons and astrocytes in differentiation media with or withoutconditioned medium. Adherent AHNPs were induced to differentiate using 3 types of DM. After 4–7 days culture in DM, in all 3groups of differentiation systems, approximately 50–60% of cells detached from the poly-ornithine coated surface, and therewere another 10–25% of cells that detach in later stages. (A) PD SN AHNPs in DM3 after five days. (B) Addition of 1% fetal bovineserum to DM does not prevent cells from detaching, but rescues cells from a subsequent cell death period. (C)Immunocytochemical analysis of surviving cells does not reveal the presence of TuJ1 positive neurons or GFAP positiveastrocytes under both growth conditions (with or without serum). Weak nestin and vimentin expression is apparent withinthese cultures. PD AHNPs were cultured with conditionedmedium from differentiating murine ESNPs. No obvious detachmentwas observed in differentiating PD AHNP cultures exposed to conditioned medium (D), and 5–10% of these cells graduallydifferentiate into cells morphologically resembling neurons and extending long processes (E–L); however, none of these cellscould be labeledwith our battery of neuronal or glial markers. All the data presented in Fig. 4 are from PD SN AHNP cultures. Allscale bars without labels are 100 μm.

67B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

our previous studies (Deng et al., 2006) showing utility of thisneurogenic pathway for testing the engraftment potential ofheterologous populations of stem/progenitor cells. In ourprevious studies of AHNPs (Walton et al., 2006), we alsoobserved functional engraftment in the cortex and hippocam-pus, and such xenograft studies of an AHNP-like cell fromnon-PD sources, described by the Langmoen group (Olstorn etal., 2007) also reveal impressive engraftment in rodentmodels. Grafted AHNPs here integrated and survived for atleast 8 weeks after transplantation (data not shown). The factthat neural precursor cells can be isolated from the SN ofidiopathic PD and that these cells can integrate into the hostbrain and differentiate into TH+ neurons could indicate apossible potential for self-regeneration inherent to the

diseased SN region. Because of aberrant growth and differen-tiation patterns exhibited by PD AHNPs shown here in vitro,there may be a need for either ex vivo or perhaps even in situgene therapy to enhance the reactive neurogenic prowess ofthese cells. Likewise, the poor growth ability of DBS electrode-derived cells also studied here suggests one of the followingpossibilities: 1) there are too few clonogenic progenitor cellsthat can be harvested from these discarded electrodes, 2) theirproximity to the generating source of electrical currentcompromises their ability to expand in our culture system,or 3) there are some unrecognized bases for their poor abilityto give rise to expandable, potentially therapeutic cells.

Recent studies have shown that transplanted humanneural fetal cells in PD patients are susceptible to synucleinaggregation formation over time, suggestive of an infectiouspotential of the PD brain milieu whereby grafted precursorcells are at risk for “contracting” the disease (Hansen et al.,2011; Kordower et al., 2008; Li et al., 2008; Olanow andPrusiner, 2009), although there is also evidence that points toa potential sparing of grafted fetal cells in the disease (Mendezet al., 2008). The potential for a synucleiopathy in AHNPs wasstudied here using immunolabeling of cultured cells com-pared to sections from the PD patient brains; no synucleinaggregates, inclusions or immunopositive Lewy neurites wereobserved in any of our cultures despite the presence ofstaining in parental tissue sections from these PD cases.AHNPs might fail to exhibit a synucleiopathy for a variety ofreasons, including their state of immaturity in the studiesperformed here or technical difficulties with the antibodiesused in our cultures, although we encountered no suchproblems with any of our other antibody probes. Animalmodels of an apparent infectious protein nature of α-synuclein (mutant or wildtype) from Brundin and colleagues(Hansen et al., 2011) support previous notions of exosomaltransport (Emmanouilidou et al., 2010) and transmissibility ofcells in vitro and in vivo, along with transcellular uptakeleading to possible toxic cellular consequences of PD-molecular species from the extracellular microenvironmentthat might put newly engrafted AHNPs at risk following aprogressive disease course. One could certainly argue thatstudying the reparative or even possibly neuroprotectivefunctions of transplanted or endogenously recruited AHNPswill lead to insights into their possible protection (usingmolecular therapeutics or gene therapy) and eventual positivetherapeutic outcomes despite their seeming vulnerability. It isimportant to establish if AHNPs, despite possessing poten-tially genetic and molecular susceptibilities to a progressiveneuropathology (in essence a “stem cell pathology”) (Steindleret al., 2011), still have the potential to give rise to new neuronsand glia for potential bioassays, as well as for cellulartherapeutic regimens in PD. Nevertheless, the results fromour experiments present valuable information that it ispossible to recover progenitor cells from different regions ofthe diseased post-mortem brain, and this may prove to be asignificant tool in the future advancement of the field. It isnoteworthy that during the course of finishing this study apaper appeared (van den Berge et al., 2011) that reported theability to isolate and expand neural stem/progenitor cellsfrom the postmortem adult PD neurogenic subventricularzone. Even though this study did not attempt to examine

Fig. 5 – Expression of neuronal and glial markers byGFP-negative PD SN AHNPs under differentiating conditionsin DM2 and DM3, and a comparison of the yield of TH+neurons among PD AHNPs from four brain regions. (A) BothDM2 and DM3 incubated cultures gave rise to neurons andastrocytes. The presence of FGF8 and SHH did not distinctlyenhance TuJ1-positive, GFAP-positive and TH-positive cellnumbers among the GFP-negative PD population (p>0.05).(B) PD AHNPs from SN, SVZ, HC, and CXwere co-culturedwithmouseGFP-ESNPs inDM3media to inducedifferentiation. GFP−/TuJ1+, GFP−/TH+ and GFP−/GFAP+ cells were found in PDcell co-cultures derived from all four brain regions after 8 daysof induced differentiation. SN-derived PD AHNPs generatedthe lowest amount of TH+ neurons, while the highestproportionofTH+neuronswas found inCX-derivedPDAHNPs(CX>HC>SVZ>SN, n=5 per region, p<0.01).

68 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

clonogenic properties of cells from the SN as we have donehere, and hence did not recognize an apparent disease-associated phenotype of these cells, nor did they assess thein vivo plasticity of PD stem/progenitor cells as we have donehere utilizing the insinuation-friendly subventricular zone/rostral migratory stream axis, these two studies togethersupport the notion that clonogenic cells reside in the PD brainand are worthy of further study for their potential to bemobilized for protection and repair despite disease-associatedphenotypy.

In conclusion, the present study demonstrates that adultbrain stem/progenitor cells exist in the PD SN and other brainregions; these could be isolated and propagated from post-mortem PD brains. The PD AHNP primary cell lines failed todevelop into neurons and astrocytes in standard cultureconditions that allow neuronal differentiation of adulthuman progenitor cells, but succeeded to differentiate intoboth neurons (including TH+ DA neurons) and glia when co-cultured with ESNPs, while co-culture with adult neural stemcells showed defects in forming GFAP positive astrocytes.Transplantation experiments revealed that grafted PD AHNPscould integrate into the host brain and differentiate intoneurons including small numbers of TH+ neurons. Thisfinding may indicate that the neurogenic ability of PD AHNPsis possibly affected by the disease, or that there are essentialfactors missing in the growth conditions. PD AHNPs may thusprove to be a valuable tool for both disease modeling andcellular replacement strategies.

4. Experimental procedure

4.1. Isolation and culture of AHNPs from PD brain

Donor tissue was obtained at autopsy from PD patients (n=7,see Table 1, data presented in this paper are representativeand primarily from a 65-year-old male) with research consentand ethical approval following established guidelines withinthe University of Florida Institutional Review Board. SN, SVZ,HC, and CX (primary motor CX, n=5; frontal CX, n=1) wereidentified and dissected from the left hemisphere (2–12 hpost-mortem) (Laywell et al., 1999). AHNP cultures from PDbrain tissue were established as previously described(Scheffler et al., 2005; Walton et al., 2006), with somemodifications. In brief, tissue from different brain regions(see Table 1) was placed separately in ice-cold DMEM/F12 withantibiotics (Invitrogen), and immediately prepared for cellculture, while some tissue was cryopreserved for molecularbiology or fixed with 4% paraformaldehyde and then embed-ded in paraffin for immunohistochemistry. For adhesiveculture, tissue samples were manually dissociated into<1 mm3 pieces and plated onto poly-ornithine-coated (15 μg/mL, Sigma) plastic dishes (Goetz et al., 2006), covered withproliferative media (Walton et al., 2006) containing 10 ng/mLhLIF (Chemicon) (Oshima et al., 2007), 1 μg/mL laminin(Invitrogen) (Hall et al., 2008) and the media was partlychanged every other day. For long-term storage, cultureswere dissociated with trypsin-Versene (0.2%trypsin+0.008%EDTA), and cryopreserved in growth medium containing 10%DMSO. For primary neurosphere cultures, we dissociated

primary tissue into single cells using trypsin-versene andplated them with 2× proliferative media (without laminin)/2%methylcellulose (Sigma) (1:1) at a density of 100,000 cells/mL onto 6 well ultra low attachment dishes (Costar) (Laywellet al., 1999). Cultures were supplemented with 10 ng/mL ofbFGF and EGF every other day. Spheres were dissociated withtrypsin-versene into single cells and replated every 4 weeks.

Cultures from DBS electrodes were obtained by collectingDBS lead electrodes (n=3) or microelectrodes (n=3) frompatients undergoing elective surgery for lead replacement atthe University of Florida Shands hospital (indication forreplacement was lead fractures). Ethical approval and in-formed consent were obtained prior to surgery. The electrodeswere placed on poly-ornithine/laminin-coated cell cultureplates in proliferative medium as described above. Mediumwas partially changed every other day.

For immunocytochemistry, cells were plated on poly-ornithine-coated glass coverslips and grown to confluence,fixed with 4% paraformaldehyde and processed for immuno-cytochemistry as previously described (Walton et al., 2006).Primary antibodies were: anti-nestin (1:200, Millipore), anti-SOX2 (10 μg/mL, R&D), anti-GFAP (1:200, Chemicon), anti-vimentin (10 μg/mL, R&D), anti-Glutamate TransporterGLAST (1:1000, Chemicon), anti CD133 (1:50, Miltenyi Biotec),anti-A2B5 (1:500, Chemicon), anti-NG2 (1:1000, Chemicon),anti-βIII Tubulin (TuJ1, 1:2000, Promega; 1:2000, Covance),anti-Tyrosine Hydroxylase (TH, 1:250, Chemicon), anti-GreenFluorescent Protein (GFP, 1:700, Millipore; 1:700, Invitrogen),anti-α-synuclein (Syn1, 1:1000, BD Transduction; or humanspecific clone Syn211, 1:1000, Abcam). Nuclei were counter-stained with DAPI (Sigma). Fluorescence microscopy andunbiased cell counting were performed on a Leica DMLBupright microscope and images were captured with a Spot RTcolor CCD camera (Diagnostic Instruments). Unbiased cellcounting data was generated from five independent experi-ments, with each trial comprising a minimum of 10 visualfields at 40× magnification. All values were expressed asmean±SEM.

Total RNA was extracted using the RNeasy Mini Kit(Qiagen) with DNase I treatment on the column. Eluted RNAwas exposed to a second DNase I treatment in solution usingTurbo DNA-free (Ambion). For each RT-PCR reaction, 500 ngoligo dT(12–18), dNTP mix (0.5 mM each) and a correspondingamount of 1 μg of total RNA were added. Each RT reaction wasrun in triplicate using the SuperScript II kit (Invitrogen)according to the manufacturer's instructions. Primer se-quences are presented in Table 2 and PCR conditions areavailable upon request.

4.2. Co-culture studies with embryonic and adult neuralstem cells

To test the neural lineage potential of the PD AHNPs, 3types of DM were tested: (1) DM1: regular differentiationmedium (Goetz et al., 2006) plus platelet-derived growthfactor (PDGF, 20 ng/mL, R&D), ascorbic acid (200 μM, Sigma)and retinoic acid (100 nM, Sigma); (2) DM2: DM1 plus brain-derived neurotrophin (BDNF, 50 ng/mL, Chemicon) andneurotrophin-3 (NT-3, 50 ng/mL, Chemicon); (3) DM3: DM2plus SHH (100 ng/mL, Sigma) and FGF8b (100 ng/mL, Sigma)

69B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

(Baquet et al., 2005; Caldwell et al., 2001; Espejo et al., 2000;Yan et al., 2005). The medium was changed every 4 dayswith fresh growth factors, and retinoic acid was addedevery 24 h. To investigate whether conditioned mediumfrom ESNPs can induce differentiation of these PD AHNPsinto neurons and glia in vitro, we performed PD AHNPculture with the presence of conditioned medium fromdifferentiating mouse ESNPs. Mouse ESNPs were culturedusing our controlled four-step neural induction protocol(Goetz et al., 2006), conditioned medium was collectedevery 3 days in step IV (maturation of neural phenotypes),filtered through 0.2 μm filter, and stored at −20 °C until use.Conditioned medium was mixed 1:1 with DM3.

For co-culture experiments, 90% confluent PD progenitorswere dissociated into single cells after 4 days of serum/mitogen withdrawal. PD AHNPs were mixed with mouse GFPESNPs on the 2nd day of stage IV at a ratio of 1:1 by volumeand plated onto poly-ornithine-coated glass coverslips withDM1, DM2 and DM3 respectively. After 8 days in culture, theywere fixed and processed for immunocytochemistry asdescribed above.

To co-culture with the PD AHNPs, adult multipotentastrocytic stem cells (MASCs) were derived from SVZ ofpostnatal day 7 UBC/GFP mice, with isolation, preparation,and characterization performed as previously described(Laywell et al., 2000). The cell suspensions of adherent PD SNprogenitors and GFP-adult mouse SVZ stem cells were mixed1:1, plated onto poly-ornithine-coated glass coverslips, grownuntil 90% confluent, and the serum and growth factors wereremoved. After 4 days, the culture was transferred to DM3medium, and incubated for 8 days, then fixed with 4%paraformaldehyde and processed for immunocytochemistry.

4.3. Transplantation experiments

For animal transplantation, 50,000 AHNPs/μL in N2 mediumwere injected into the lateral ventricles of 3 month old FoxChase SCID mice following established Institutional AnimalCare and Use guidelines and animals were cared for inaccordance with these and NIH guidelines. Mice were anes-thetized by isoflurane inhalation, their skull exposed and ahole drilled at the coordinates Bregma −0.5 mm anterior,−0.5 mm lateral. 1 μL of a cell suspension was injected using aHamilton syringe at a depth of 2 mm, the syringe was left inplace for 5 min before retraction. The incision was closed withsurgical staples and the animals were allowed to recoverbefore being returned to their cages.

4 and 8 weeks after transplantation, animals were deeplyanesthetized using isoflurane and then perfused transcardiallywith 4% fresh paraformaldehyde in a 0.02 M phosphate buffer

solution (PBS, pH 7.4). Brains were removed, post-fixed overnight, cryoprotected in 30% sucrose in PBS and 30 μm cryostatsections were cut. Free-floating sections were immunostainedas described (Zheng et al., 2006), mounted onto slides, cover-slipped and examined on an Olympus IX81-DSU Spinning Diskconfocal microscope.

Acknowledgments

This work was supported by NIH/NINDS grant NS055165 andthe Maren, Thompson and McKinney Regenerative MedicineFunds (DAS). MSO is supported by grants from the NationalParkinson Foundation, the NIH/NINDS, and the NPF Center ofExcellence at the University of Florida. SNR is supported by aCitizens United for Research in Epilepsy grant. We thankTomoko Sahara for technical assistance, and the Roper lab inthe UF Department of Neurosurgery for ongoing studies ofnormal AHNP cells.

R E F E R E N C E S

Arias-Carrion, O., Freundlieb, N., Oertel, W.H., Hoglinger, G.U.,2007. Adult neurogenesis and Parkinson's disease. CNS Neurol.Disord. Drug Targets 6, 326–335.

Baquet, Z.C., Bickford, P.C., Jones, K.R., 2005. Brain-derivedneurotrophic factor is required for the establishment of theproper number of dopaminergic neurons in the substantianigra pars compacta. J. Neurosci. 25, 6251–6259.

Bonilla, S., Hall, A.C., Pinto, L., Attardo, A., Gotz, M., Huttner, W.B.,Arenas, E., 2008. Identification of midbrain floor plate radialglia-like cells as dopaminergic progenitors. Glia 56, 809–820.

Bramanti, V., Tomassoni, D., Avitabile, M., Amenta, F., Avola, R.,2010. Biomarkers of glial cell proliferation and differentiationin culture. Front. Biosci. (Schol. Ed.) 2, 558–570.

Brazel, C.Y., Limke, T.L., Osborne, J.K., Miura, T., Cai, J., Pevny, L.,Rao, M.S., 2005. Sox2 expression defines a heterogeneouspopulation of neurosphere-forming cells in the adult murinebrain. Aging Cell 4, 197–207.

Caldwell, M.A., He, X., Wilkie, N., Pollack, S., Marshall, G., Wafford,K.A., Svendsen, C.N., 2001. Growth factors regulate the survivaland fate of cells derived from human neurospheres. Nat.Biotechnol. 19, 475–479.

Clarke, D.L., Johansson, C.B., Wilbertz, J., Veress, B., Nilsson, E.,Karlstrom, H., Lendahl, U., Frisen, J., 2000. Generalizedpotential of adult neural stem cells. Science 288, 1660–1663.

Deng, J., Petersen, B., Steindler, D.A., Jorgensen, M., Laywell, E.D.,2006. Mesenchymal stem cells spontaneously express neuralproteins in culture and are neurogenic after transplantation.Stem Cells 24, 1054–1064.

Emmanouilidou, E., Melachroinou, K., Roumeliotis, T., Garbis, S.D.,Ntzouni, M., Margaritis, L.H., Stefanis, L., Vekrellis, K., 2010.

Table 2 – Sequences for RT-PCR primers.

Gene Forward Reverse

GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTCNestin TCCCTCCGCATCCCGTCAG CCGTCACCTCCATTAGCCACAGSOX2 AACACCAATCCCATCCACACTC GCTCCTACCGTACCACTAGAACGLAST (SCL1A3) CTGCTCACAGTCACCGCTGT AGCACGAATCTGGTGACGCGVimentin TGCTGGAAGGCGAGGAGAG AAGGTCATCGTGATGCTGAGAAG

70 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

Cell-produced alpha-synuclein is secreted in acalcium-dependent manner by exosomes and impactsneuronal survival. J. Neurosci. 30, 6838–6851.

Espejo, M., Cutillas, B., Arenas, T.E., Ambrosio, S., 2000. Increasedsurvival of dopaminergic neurons in striatal grafts of fetalventral mesencephalic cells exposed to neurotrophin-3 or glialcell line-derived neurotrophic factor. Cell Transplant. 9,45–53.

Geraerts, M., Krylyshkina, O., Debyser, Z., Baekelandt, V., 2007.Concise review: therapeutic strategies for Parkinson diseasebased on the modulation of adult neurogenesis. Stem Cells 25,263–270.

Goetz, A.K., Scheffler, B., Chen, H.X., Wang, S., Suslov, O., Xiang,H., Brustle, O., Roper, S.N., Steindler, D.A., 2006. Temporallyrestricted substrate interactions direct fate and specification ofneural precursors derived from embryonic stem cells. Proc.Natl. Acad. Sci. U. S. A. 103, 11063–11068.

Hall, P.E., Lathia, J.D., Caldwell, M.A., Ffrench-Constant, C., 2008.Laminin enhances the growth of human neural stem cells indefined culture media. BMC Neurosci. 9, 71.

Hansen, D.V., Lui, J.H., Parker, P.R., Kriegstein, A.R., 2010.Neurogenic radial glia in the outer subventricular zone ofhuman neocortex. Nature 464, 554–561.

Hansen, C., Angot, E., Bergstrom, A.L., Steiner, J.A., Pieri, L., Paul,G., Outeiro, T.F., Melki, R., Kallunki, P., Fog, K., et al., 2011.alpha-Synuclein propagates from mouse brain to grafteddopaminergic neurons and seeds aggregation in culturedhuman cells. J. Clin. Invest. 121, 715–725.

Kordower, J.H., Chu, Y., Hauser, R.A., Freeman, T.B., Olanow, C.W.,2008. Lewy body-like pathology in long-term embryonic nigraltransplants in Parkinson's disease. Nat. Med. 14, 504–506.

Laywell, E.D., Kukekov, V.G., Steindler, D.A., 1999. Multipotentneurospheres can be derived from forebrain subependymalzone and spinal cord of adult mice after protractedpostmortem intervals. Exp. Neurol. 156, 430–433.

Laywell, E.D., Rakic, P., Kukekov, V.G., Holland, E.C., Steindler,D.A., 2000. Identification of a multipotent astrocytic stem cellin the immature and adult mouse brain. Proc. Natl. Acad. Sci.U. S. A. 97, 13883–13888.

Li, J.Y., Englund, E., Holton, J.L., Soulet, D., Hagell, P., Lees, A.J.,Lashley, T., Quinn, N.P., Rehncrona, S., Bjorklund, A., et al.,2008. Lewy bodies in grafted neurons in subjects withParkinson's disease suggest host-to-graft disease propagation.Nat. Med. 14, 501–503.

Lie, D.C., Dziewczapolski, G., Willhoite, A.R., Kaspar, B.K., Shults,C.W., Gage, F.H., 2002. The adult substantia nigra containsprogenitor cells with neurogenic potential. J. Neurosci. 22,6639–6649.

Malatesta, P., Appolloni, I., Calzolari, F., 2008. Radial glia andneural stem cells. Cell Tissue Res. 331, 165–178.

Mendez, I., Vinuela, A., Astradsson, A., Mukhida, K., Hallett, P.,Robertson, H., Tierney, T., Holness, R., Dagher, A., Trojanowski,J.Q., et al., 2008. Dopamine neurons implanted into people withParkinson's disease survive without pathology for 14 years.Nat. Med. 14, 507–509.

Nguyen, H.N., Byers, B., Cord, B., Shcheglovitov, A., Byrne, J., Gujar,P., Kee, K., Schule, B., Dolmetsch, R.E., Langston, W., et al., 2011.LRRK2 mutant iPSC-derived DA neurons demonstrateincreased susceptibility to oxidative stress. Cell Stem Cell 8,267–280.

Olanow, C.W., Prusiner, S.B., 2009. Is Parkinson's disease a priondisorder? Proc. Natl. Acad. Sci. U. S. A. 106, 12571–12572.

Olstorn, H., Moe, M.C., Røste, G.K., Bueters, T., Langmoen, I.A.,2007. Transplantation of stem cells from the adult humanbrain to the adult rat brain. Neurosurgery 60, 1089–1098.

Oshima, K., Teo, D.T., Senn, P., Starlinger, V., Heller, S., 2007. LIFpromotes neurogenesis and maintains neural precursors incell populations derived from spiral ganglion stem cells. BMCDev. Biol. 7, 112.

Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A.,Lensch, M.W., Cowan, C., Hochedlinger, K., Daley, G.Q., 2008.Disease-specific induced pluripotent stem cells. Cell 134,877–886.

Parrish-Aungst, S., Shipley, M.T., Erdelyi, F., Szabo, G., Puche, A.C.,2007. Quantitative analysis of neuronal diversity in the mouseolfactory bulb. J. Comp. Neurol. 501, 825–836.

Pfisterer, U., Kirkeby, A., Torper, O., Wood, J., Nelander, J.,Dufour, A., Bjorklund, A., Lindvall, O., Jakobsson, J., Parmar,M., 2011. Direct conversion of human fibroblasts todopaminergic neurons. Proc. Natl. Acad. Sci. U. S. A. 108,10343–10348.

Preynat-Seauve, O., Burkhard, P.R., Villard, J., Zingg, W.,Ginovart, N., Feki, A., Dubois-Dauphin, M., Hurst, S.A.,Mauron, A., Jaconi, M., Krause, K.H., 2009. Pluripotent stemcells as new drugs? The example of Parkinson's disease. Int.J. Pharm. 381, 113–121.

Scheffler, B., Walton, N.M., Lin, D.D., Goetz, A.K., Enikolopov, G.,Roper, S.N., Steindler, D.A., 2005. Phenotypic and functionalcharacterization of adult brain neuropoiesis. Proc. Natl. Acad.Sci. U. S. A. 102, 9353–9358.

Song, H., Stevens, C.F., Gage, F.H., 2002. Astroglia induceneurogenesis from adult neural stem cells. Nature 417,39–44.

Srivastava, A.S., Malhotra, R., Sharp, J., Berggren, T., 2008.Potentials of ES cell therapy in neurodegenerative diseases.Curr. Pharm. Des. 14, 3873–3879.

Steindler, D.A., Okun, M.S., Scheffler, B., 2011. Stem cellpathologies and neurological disease. Mod. Pathol. 4, 2011 Epub November.

Storch, A., Sabolek, M., Milosevic, J., Schwarz, S.C., Schwarz, J.,2004. Midbrain-derived neural stem cells: from basic science totherapeutic approaches. Cell Tissue Res. 318, 15–22.

Sun, Y., Kong, W., Falk, A., Hu, J., Zhou, L., Pollard, S., Smith, A.,2009. CD133 (Prominin) negative human neural stem cells areclonogenic and tripotent. PLoS One 4, e5498.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T.,Tomoda, K., Yamanaka, S., 2007. Induction of pluripotent stemcells from adult human fibroblasts by defined factors. Cell 131,861–872.

Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D.M.,Nakano, Y., Meyer, E.M., Morel, L., Petersen, B.E., Scott, E.W.,2002. Bone marrow cells adopt the phenotype of other cells byspontaneous cell fusion. Nature 416, 542–545.

van den Berge, S.A., van Strien, M.E., Korecka, J.A., Dijkstraa, A.A.,Sluijs, J.A., Kooijman, L., Eggers, R., De Fillipis, L., Vescovi, A.L.,Verhaagen, J., van de Berg, W.D., Hol, E.M., 2011. Theproliferative capacity of subventricular zone is maintained inthe Parkinsonian brain. Brain 134, 3249–3263.

Walton, N.M., Sutter, B.M., Chen, H.X., Chang, L.J., Roper, S.N.,Scheffler, B., Steindler, D.A., 2006. Derivation and large-scaleexpansion of multipotent astroglial neural progenitors fromadult human brain. Development 133, 3671–3681.

Wang, L.C., Baird, D.H., Hatten, M.E., Mason, C.A., 1994. Astroglialdifferentiation is required for support of neurite outgrowth. J.Neurosci. 14, 3195–3207.

Yan, Y., Yang, D., Zarnowska, E.D., Du, Z., Werbel, B., Valliere, C.,Pearce, R.A., Thomson, J.A., Zhang, S.-C., 2005. Directeddifferentiation of dopaminergic neuronal subtypes fromhuman embryonic stem cells. Stem Cells 23, 781–790.

Ye, Z.-C., Rothstein, J.D., Sontheimer, H., 1999. Compromisedglutamate transport in human glioma cells:reduction—mislocalization of sodium-dependent glutamatetransporters and enhanced activity of cystine–glutamateexchange. J. Neurosci. 19, 10767–10777.

Ying, Q.L., Nichols, J., Evans, E.P., Smith, A.G., 2002. Changingpotency by spontaneous fusion. Nature 416, 545–548.

Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget,J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V.,

71B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2

Author's personal copy

Stewart, R., et al., 2007. Induced pluripotent stem celllines derived from human somatic cells. Science 318,1917–1920.

Zecevic, N., 2004. Specific characteristic of radial glia in thehuman fetal telencephalon. Glia 48, 27–35.

Zheng, T., Marshall II, G.P., Laywell, E.D., Steindler, D.A., 2006.Neurogenic astrocytes transplanted into the adult mouselateral ventricle contribute to olfactory neurogenesis, andreveal a novel intrinsic subependymal neuron. Neuroscience142, 175–185.

72 B R A I N R E S E A R C H 1 4 6 4 ( 2 0 1 2 ) 6 1 – 7 2