Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326

Mutations in squirrel monkey glucocorticoid receptorimpair nuclear translocation

Song Hera, ∗, Paresh D. Patelb, Alan F. Schatzberga, David M. Lyonsa

a Department of Psychiatry, Stanford University Medical Center, 1201 Welch Rd., MSLS, P-126, Stanford, CA 94305-5485, USAb University of Michigan Medical Center, Mental Health Research Institute, MI 48104-1687, USA

Received 4 October 2004; accepted 29 November 2004

Abstract

To identify the determinants of impaired glucocorticoid receptor (GR) signaling in a model of glucocorticoid resistance, cloned GRfrom Guyanese squirrel monkeys (gsmGR) was tagged with enhanced green fluorescent protein, and nuclear translocation was examined intransfected COS1 cells. In keeping with evidence that gsmGR transactivational competence is impaired, we found that nuclear translocationis likewise diminished in gsmGR relative to human GR (hGR). Experiments with GR chimeras revealed that replacement of the gsmGRl ino acid5 616Ser, andS©

K ells

1

tciacettnffct

at

slo-rti-ncts

ctionter-GR

odel

GR)t GR

isionser,

titu-

ities

tionient

tly

0d

igand binding domain (LBD) with that from hGR increased translocation. Truncated gsmGR constructs lacking the LDB after am52 also showed increased translocation even in the absence of cortisol. Three back-mutations of gsmGR to hGR (Thr551Ser, Alaer618Ala) in the LBD confirmed that these amino acids play a role in diminished translocation.2005 Elsevier Ltd. All rights reserved.

eywords: Glucocorticoid receptor; Nuclear translocation; Ligand binding domain; Nuclear localization signal; Mutation; Squirrel monkey; COS1 c

. Introduction

The glucocorticoid receptor (GR) is an intracellular pro-ein that lies in the cytoplasm when unbound by gluco-orticoid ligand. Ligand binding triggers GR activation asmmunophilins, heat shock proteins (hsps), and other GR-ssociated chaperone proteins disengage from the GR–ligandomplex[1,2]. The activated GR–ligand complex contains anxposed nuclear localization signal (NLS) downstream fromhe DNA binding domain (DBD) that promotes transloca-ion of the GR–ligand complex from the cytoplasm into theucleus[3,4]. Within the nucleus, the GR–ligand complex

orms dimers, recruits co-activators and other transcriptionactors and induces transactivation by binding to glucocorti-oid response elements (GREs) on the promoter of diversearget genes to influence their transcription.

Molecular determinants of GR signaling have been char-cterized in recent studies of spontaneously occurring muta-

ions in the human GR gene. These studies have identified

∗ Corresponding author. Tel.: +1 650 725 6639; fax: +1 650 498 7761.

mutations that impair GR ligand binding, nuclear trancation, and transactivation in familial forms of glucococoid resistance in humans[5–9]. Particularly mutations ithe ligand binding domain (LBD) may have profound effeon various aspects of the glucocorticoid signal transdupathway[10]. Here, we use a similar approach to characize the functional consequences of naturally occurringmutations in a previously described squirrel monkey mof glucocorticoid resistance[11–13].

Cloned GR from Guyanese squirrel monkeys (gsmclosely resembles human GR (hGR) in structure, but nofunction [11,13,14]. The amino acid sequence of gsmGR97% homologous to hGR, with five amino acid substitutin the LBD (Gly516Ala, Ser551Thr, Ser616Ala, Ala618SIle761Leu), no substitutions in the DBD, and 21 substions in the N-terminal relative to hGR[13–15]. Both gsmGRand hGR have equally high dexamethasone binding affinwhen GR cDNA is expressed in COS1 cells[13] or retic-ulocyte lysate[12]. Dexamethasone-induced transactivaby gsmGR is, however, an order of magnitude less efficthan hGR[13]. Binding affinities for cortisol are modes

E-mail address:hersong@stanford.edu (S. Her). decreased in gsmGR relative to hGR, but cortisol-induced

960-0760/$ – see front matter © 2005 Elsevier Ltd. All rights reserved.oi:10.1016/j.jsbmb.2004.11.010

320 S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326

transactivation has not been examined. In the experimentspresented here, we confirm that transactivation by gsmGRis impaired, demonstrate diminished translocation of greenfluorescent protein (GFP)-tagged gsmGR, and show that di-minished translocation is related to spontaneous mutations inthe LBD.

2. Materials and methods

2.1. Cell culture and luciferase activity assay

COS1 cells were obtained from American Type CultureCollection (Manassa, VA) and cultured in serum-containingmedia (Dulbecco’s modified Eagles’s medium supplementedwith 10% fetal bovine serum, 100 U/ml penicillin, 100 U/mlstreptomycin) in 5% CO2 at 37◦C as recommended by thesupplier. Cells were plated in 24-well culture flasks at 4× 104

cells per well in the assay medium (10% charcoal-strippedFBS in DMEM), grown overnight, and cotransfected withpGRE-luciferase reporter[13] and pCMV-�-gal-SPORT(Life Technologies, Inc.) along with GR construct, usingSuperfect (Qiagen, Valencia, CA). Media was changed 3 hafter transfection with assay media and cells were incubatedfor 24 h. Cells were incubated for an additional 24 h withor without the hormone cortisol (Sigma, St Louis, MO)b fromm h thats forg ayedf col( sd sea ec

2

to-t RI-Z nu-f omt erset A).c thep -T -u 9 bpw ndt

2

sert-i theS i-

Fig. 1. Schematic diagram of the functional domains of GR, and the chimeraconstructs in which various gsmGR domains were replaced with correspond-ing hGR domains. A–D represent chimera A, chimera B, chimera C andchimera D, respectively. DBD, DNA binding domain, HG, hinge region,LBD, ligand binding domain, NLS, nuclear localization signal.

fied Aequorea GFP (pEGFP-C2, CLONTECH Laboratories,Inc., Palo Alto, CA). In a previous study, we used a gsmGRthat contained an isoleucine inserted at position 498, in-terrupting the NLS that lies downstream of the DBD[13].Recently, we confirmed a subsequent report[15] that theisoleucine insertion is not present in squirrel monkey wild-type GR (unpublished data). Therefore, wild-type gsmGRwithout the isoleucine insertion was used for all experimentsreported here.

GR chimeras were constructed by subcloning gsmGRand hGR fragments generated by appropriate restrictionenzyme sites (Fig. 1). Chimeras A and B were constructedby replacing the hGR DNA fragment fromSalI/BamHI andClaI/BamHI with counterparts of the gsmGR DNA fragment.Chimeras C and D were constructed usingSacI/SalI andSacI/ClaI restriction enzyme sites, respectively, in hGR,and were replaced with corresponding fragments fromgsmGR. Point mutations were introduced into the coding se-quences of the GFP-gsmGR with QuickChange mutagenesismethod (Stratagene, La Jolla, CA) using mutagenic primers(OPERON, Alameda, CA) as shown inTable 1. All constructswere under the control of a CMV promoter. The chimera con-structs were confirmed by restriction enzyme maps in agarosegels and by sequencing the ligated regions, and the pointmutations were verified by sequencing around the point muta-tions (Beckman DNA sequence facility, Stanford University).

2

-e , and0 ands er-fl FP-t d toI u-b nti-� ew adishp ouseI was

efore harvesting. The 24 h incubation was choseneasures collected at 6 h intervals between 12 and 42

howed similar kinetics and maximal efficacy at 24 hsmGR and hGR in COS1 cells. Cell extracts were ass

or luciferase activity according to the supplier’s protoPromega, Madison, WI) and�-galactosidase activity aescribed previously[13]. Data are reported as luciferactivity normalized to �-galactosidase activity in tho-transfection.

.2. RNA isolation and RT-PCR

To investigate isoleucine insertion at position 498,al RNA was extracted from frozen tissues using TOL (Invitrogen, Carlsbad, CA), according to the ma

acturer’s instructions. First-strand synthesis of cDNA frhe isolated total RNA was performed using the revranscriptase, Superscript II (Invitrogen, Carlsbad, CDNA fragment of the gsmGR was amplified usingrimers ACTCTGAACTTCCCTGGTCGAAC and GTGAAGTTCCTGAAA CCTGGTATCG. After the PCR prodcts were confirmed by 1% agarose gel, the amplified 62ere subcloned into pDrive Cloning Vector (QIAGEN) a

hen sequenced.

.3. Plasmid constructs and mutagenesis

GFP-tagged gsmGR and hGR were generated by inng squirrel monkey GR and human GR cDNA intoacI/BamHI sites at the 3′-end of the coding region of mod

.4. Western blot analysis

Samples were boiled at 100◦C for 5 min in the presnce of 2% SDS, 5% 2-mecaptoethanol, 10% glycerol.01% bromophenol blue immediately after preparationtored at−80◦C until use. Western blot analysis was pormed as described previously[13]. Briefly, aliquots wereoaded on 10% polyacrylamide gel for detection of Gagged GR and�-galactosidase. Proteins were transferremmunobilon-P (Millipore, Bedford, MA). Blots were incated with each primary antibody (Anti-GFP, 1:1,000; a-galactosidase, 1:500) at 4◦C overnight, followed by threashes for 5 min and subsequent incubation with horsereroxidase-conjugated antibody against rabbit IgG or m

gG depending on primary antibody. Peroxidase signal

S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326 321

Table 1Mutagenic primers for GR mutations

Primer Sequence (5′ to 3′) Mutant

gsmGR348F CAGGGGAAACAGACTTAAAGCTTCTGGAAGAAAGC Gln120LysgsmGR348R GCTTTCTTCCAGAAGCTTTAAGTCTGTTTCCCCTG Gln120LysgsmGR616F CCCCAGGTAAAGAGACGAATGAGAGTCCTTGGAAATCAG Gln210GlugsmGR616R CTGATTTCCAAGGACTCTCATTCGTCTCTTTACCTGGG Gln210GlugsmGR 1528F CAAGAAACCTCTGAAAATCCCGGGAACAAAACAATAGTTCCTGCAACG Ala516GlygsmGR 1528R CGTTGCAGGAACTATTGTTTTGTTCCCGGGATTTTCAGAGGTTTCTTG Ala516GlygsmGR 1635F GTATGCCGGTTATGATAGCTCGGTACCAGACTCAACCTGG Thr551SergsmGR 1635R CCAGGTTGAGTCTGGTACCGAGCTATCATAACCGGCATAC Thr551SergsmGR 1839 F GGAGATCATATAGACAATCAAGTGCAAACCTACTGTGTTTTGCTCC Ala616Ser/Ser618AlagsmGR 1839 R GGAGCAAAACACAGTAGGTTTGCACTTGATTGTCTATATGATCTCC Ala616Ser/Ser618AlagsmGR 2259F GTTAGCTGAAATCATCACCAATCAGATACCAAAATACTCAAATGGAAATATC Leu761IlegsmGR 2259R GATATTTCCATTTGAGTATTTTGGTATCTGATTGGTGATGATTTCAGCTAAC Leu761Ile

visualized with ECL plus reagent according to the manu-facturer’s recommendation (Santa Cruz Biotech, Ins, SantaCruz, CA), followed by exposure to x-ray films and subse-quent quantification by densitometer.

2.5. Fluorescence imaging and GR nucleartranslocation

Cells were cultured on glass coverslips (12 mm circle,Corning, San Mateo, CA) in 24-well culture plates that weresterilized by UV, and allowed to express the appropriate GFP-GR protein for 36 h after transfection prior to any cortisoltreatment. The cells were fixed by 4% paraformaldehyde in1× PBS for 20 min. Coverslips were then mounted on slideswith mounting solution (2% propyl gallate and 80% glyc-erol in 1× PBS) containing 4′,6-diamidino-2-phenylindole(DAPI) for nuclear staining. Cells were imaged using eithera 20× or 60× oil immersion objective on a Nikon microphot-SA fluorescence microscope. Images were obtained using acooled CCD camera (Optronics Magnafire, Goleta, CA), andwere analyzed using Adobe Photoshop 5.0 Software (SanJose, CA).

For individual experiments, images from all conditionswere analyzed using identical acquisition parameters. Expo-sure times ranged from 20 to 300 ms depending on the in-t wasp ndi-t ce int singp ao n theg minedb GRs latedb res-c Thet yingt y nor-m res, at clearG

2.6. Data analysis

Data were analyzed using one-way analysis of varianceand Studentt-tests for independent samples. Sigmoidal curvefitting and associated EC50 parameters were calculated usingthe Boltzman equation in Microcal Origin 5.0 (Northampton,MA).

3. Results

3.1. Transcriptional activation and expression ofGFP-tagged GR fusion proteins

We first tested transcriptional activity of GFP-tagged pro-teins to ensure that GFP-GR constructs were suitable forthis study. In the presence of 10 nM cortisol, both hGR andgsmGR GFP-tagged constructs showed less transactivationthan their respective untagged constructs (72% in GFP-hGRand 82% in GFP-gsmGR,Fig. 2). Although transactivationwith GFP-tagged GRs was consistently diminished, the effectwas similar for both GRs, and the relative difference betweengsmGR and hGR transactivation was not abolished.

F nt inb r GFP-t id andp suredft ts eachw sp

ensity of the fluorophore. Subcellular GR localizationerformed blindly on randomly selected cells in each co

ion, and was quantified as the ratio of green fluorescenhe nucleus to total fluorescence (nucleus plus cytosol) ureviously described procedures[16]. Briefly, the total aref each cell was determined from fluorescence viewed ireen channel, and the area of each nucleus as detery DAPI staining viewed in the blue channel. The totalignal per cell measured in the green channel was calcuy multiplying the area of each cell by its mean green fluoence intensity normalized by subtracting background.otal GR signal in each nucleus was estimated by multiplhe nuclear area by its mean green fluorescence intensitalized by subtracting background. From these measu

ranslocation score for each cell was computed as the nuR signal divided by the total cellular GR signal.

ig. 2. Diminished transactivation of gsmGR relative to hGR is evideoth GFP-tagged and non-tagged constructs. Either non-tagged GR o

agged GR was cotransfected with pGRE-Luciferase reporter plasmCMV-�-gal-SPORT control vector. Transfected COS1 cells were mea

or luciferase activity after 10 nM cortisol treatment for 24 h at 37◦C. Theransactivation assay was done in at least two independent experimenith six samples. Results are presented as mean± S.D. (**) Represent< 0.01 from Studentt-test.

322 S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326

Fig. 3. Comparable expression of GFP-tagged GR in COS1 cells. (A) Rep-resentative immunoblotting image of GFP-tagged-hGR and GFP-tagged-gsmGR expressed in COS1 cells. After transfection with each construct,20�g of cell extract was loaded in each lane, and anti-GFP and anti�-galactosidase were used to detect GR and�-galactosidase expression.(B) Bars represent mean densitometric GR expression normalized to�-galactosidase in four independent experiments. Results are presented asmean± S.D.

To verify equivalent expression of GFP hGR and GFPgsmGR constructs driven by the CMV promoter, we per-formed a Western blot assay using anti-GFP as the primaryantibody. The major advantage of using anti-GFP is that itprovides equal reactivity to both GFP-tagged GRs. The an-tibody detected a band at 121 kDa, consistent with fusion ofa predicted 94 kDa GR and a 27 kDa GFP, in COS1 cell ex-tracts transiently transfected with GFP-tagged gsmGR andhGR (Fig. 3A). Equivalent expression levels of gsmGR andhGR were assessed by densitometric GR expression normal-ized to�-galactosidase expression (Fig. 3B).

3.2. Effects of GR to GRE reporter ratio ontransactivation

To establish a suitable ratio of GFP-tagged GR expressionvector to GRE reporter vector for luciferase activity assays,two different combinations of GR and GRE reporter wereused in the transfections (Fig. 4). One was a low ratio con-taining 0.2�g GR construct and 1.0�g GRE reporter, andthe other was a high ratio containing 1.0�g GR constructand 0.2�g GRE-reporter. Luciferase activities of both hGRand gsmGR were significantly higher at the low ratio thanat the high ratio. More interestingly, at the low ratio the lu-ciferase activities of hGR were significantly higher than thoseof gsmGR suggesting that pGRE-luciferase reporters weres eenh trast,a GREr ffer-

Fig. 4. GR transactivation response as a function of the ratio of GR expres-sion vector to GRE reporter vector. GFP-GR construct was cotransfectedwith pGRE-Luciferase reporter plasmid and pCMV-b-gal-SPORT controlvector in COS1 cells. Low ratio (GR < GRE), the ratio of GR construct andpGRE reporter vector is GR construct: GRE reporter:�-gal control vec-tor = 0.2:1.0:0.3. High ratio (GR > GRE), GR construct:GRE reporter:�-galcontrol vector = 1.0:0.2:0.3. Cells were treated for 24 h with 10 nM cortisolat 37◦C. Each bar represents the mean luciferase activity normalized to�-galactosidase activity with six samples from two independent experiments.Error bars represent± S.D. (**) Representsp< 0.01.

ent from those of gsmGR. These results indicate that ampleamounts of reporter vector are needed to assess differencesin GR transactivation, and the low ratio therefore was usedthroughout all subsequent experiments.

3.3. Diminished nuclear translocation of GFP-gsmGR

We then examined the time course of subcellular transloca-tion of GFP-tagged GRs after cortisol treatment to determinewhether gsmGR nuclear translocation is impaired. The timecourse of GFP-GR translocation was determined by perform-ing time-lapse microscopy over the course of 60 min on livingCOS1 cells carrying transiently overexpressed constructs. Asshown inFig. 5, both human and monkey GRs were mostlycytoplasmic in the absence of cortisol. Addition of 100 nMcortisol to the assay medium resulted in a time-dependentbut differential translocation of GRs into the nuclear com-partment. Nuclear migration of hGR was rapid and clearlyevident 20 min after cortisol treatment, and the receptor wasalmost entirely nuclear within 60 min. In contrast, at 60 minafter cortisol treatment, gsmGR was only approximately 50%nuclear.

F agesw vingC

ufficiently supplied to detect significant differences betwGR and gsmGR transactivational competence. In cont the high ratio of GFP-tagged GR expression vector toeporter vector the luciferase activities of hGR were no di

ig. 5. Impaired time-dependent translocation of gsmGR. Real time imere analyzed at 20 min intervals with 100 nM cortisol treatment in liOS1 cells at room temperature.

S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326 323

Fig. 6. Impaired dose-dependent translocation and transactivation of gsmGR. (A) Representative confocal images of GR translocation with different dosesof cortisol. Cells transfected with each construct were treated with the indicated cortisol dose, followed by fixing with 4% formaldehyde and analysis of GRtranslocation. The nucleus was counter-stained red with PI after RNaseA treatment. The merged image (M) represents the fusion of red (N, nucleus) andgreen(GR) fluorescence. Yellow reflects translocation of GR into the nucleus. The experiments were performed three times with similar results. (B) Quantitative assayof dose-dependent GR translocation. Each point represents the mean score of fluorescence in the nucleus vs. the whole cell body (nucleus plus cytoplasm) formore than 10 cells from two independent transfections as described in Section2. (C) Quantitative assay of dose-dependent transactivation. Each point representsthe mean luciferase activity normalized to�-galactosidase activity in triplicate samples from two independent transfections. Error bars represent± S.D.

Image analysis of GR translocation revealed dose-dependent cortisol-induced nuclear translocation of bothGRs. With 100 nM cortisol, merged images showed that mostof the hGR translocated into the nucleus, whereas gsmGRswere still detectable in cytosol (Fig. 6A). Moreover, gsmGRfailed to achieve the same maximal level of translocation ashGR, reaching 65% of hGR translocation even at 200 nMcortisol. EC50 values for translocation of gsmGR by cortisolwere three-fold greater than those for hGR (Fig. 6B). Consis-tent with these findings, transactivation was also dependentupon cortisol dosage, with a three-fold greater EC50 valuefor gsmGR than for hGR (Fig. 6C). Thus, translocation andtransactivation of hGR and gsmGR were both dependent oncortisol dose, but GR translocation and transactivation werefar greater for hGR than for gsmGR.

3.4. Effects of N-terminal substitutions on nucleartranslocation

Two of the 21 amino acid substitutions in the gsmGR N-terminal (120Lys and210Glu) result in the loss of chargedamino acids that can potentially change the conformationand reactivity of gsmGR in a way that might impair nucleartranslocation. However, translocation and transactivation of

gsmGR constructs with Lys120Gln and Glu210Gln substi-tutions were indistinguishable from wild-type gsmGR (datanot presented).

3.5. Translocation of GR chimeras

In order to map which functional domain of gsmGR isimpaired for nuclear translocation, four GR chimeras wereconstructed (Fig. 1). Chimeras A and B contained the LBDfrom gsmGR, and chimeras C and D contained the LBD ofhGR. Nuclear translocation in COS1 cells treated with 10 nMcortisol was greater for chimeras that contained the hGR LBDrelative to their counterparts with the gsmGR LBD (Fig. 7).

3.6. Inhibitory effects of LBD on gsmGR translocation

To further assess the function of the LBD in gsmGRnuclear translocation, carboxyl-terminus-truncated mutantswere used in the translocation assay. None of fourC-terminus-truncated gsmGR constructs showed ligand-dependent nuclear translocation in the presence of 10 nMcortisol (data not shown), or even at a 10-fold higher con-centration, i.e., 100 nM cortisol (Fig. 8). Constructs truncatedat amino acid 516, which have the major NLS (amino acids

324 S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326

Fig. 7. Translocation of gsmGR is increased by replacement of the LBDfrom hGR. The four GR chimera constructs are depicted inFig. 1. Cellstransfected with GR chimera constructs were treated with 10 nM cortisol for30 min at 37◦C. Each bar represents the mean score of fluorescence in thenucleus vs. the whole cell body (nucleus plus cytoplasm) for more than 10cells from two independent transfections. Error bars represent± S.D. (**)Signify significantly different from gsmGR atp< 0.01 by Studentt-test.

478–500), showed diminished levels of nuclear translocation.In contrast, the gsmGR construct truncated at amino acid 552consistently showed similar high levels of translocation inboth the presence and absence of cortisol.

3.7. Rescued translocation by back mutations in the LBD

To determine which specific amino acids in the LBDare involved in GR translocation impairment, three singleback-mutants (Ala516Gly, The551Ser, or Lys762IIe) andone double back-mutant (Ala616Ser and Ser618Ala) to hGRwere constructed using mutagenic primers (Table 1). GRtranslocation was increased relative to wild-type gsmGRin the Thr551Ser single mutant (44% increase), and theAla616Ser/Ser618Ala double mutant (36% increase,Fig. 9).Additive increases in nuclear translocation, up to 73% of thatobtained in chimera C, were also obtained with triple back-mutations of gsmGR to hGR at amino acids 551, 616, and618 (Fig. 9).

F con-s rboxylt s weret hem ucleusp lts arep

Fig. 9. Partially rescued translocation for gsmGR by back-mutations inthe LBD. Cells transfected with various point mutations in the LBDwere treated with 10 nM cortisol for 30 min at 37◦C. Each bar rep-resents the mean score of fluorescence in the nucleus vs. the wholecell body (nucleus plus cytoplasm) for 10 cells from two independenttransfections. Error bars represent mean± S.D. Asterisks signify signifi-cantly different from gsmGR at* p< 0.05 or** p< 0.01 by Studentt-test.A516S = Ala516Gly, T551S = Thr551Ser, A616S/S618A = Ala616Ser andSer618Ala, L762I = Leu762Ile, C = chimera C as depicted inFig. 1.

4. Discussion

The present study indicates that spontaneous mutationsin the LBD diminish GR nuclear translocation and subse-quent transactivation. Replacement of the LBD in gsmGRwith that from hGR enhanced nuclear translocation of vari-ous GR chimeras. Truncated gsmGR constructs lacking theLDB after amino acid 552 also showed increased transloca-tion even in the absence of cortisol. Three back-mutationsof gsmGR to hGR (Thr551Ser, Ala616Ser, and Ser618Ala)in the LBD confirmed that these amino acids play a role indiminished translocation and transactivational competence.

Our finding that transactivation is impaired in gsmGR rel-ative to hGR concurs with earlier observations in transientlytransfected CV-1 cells, SMK-7 cells, and COS1 cells[13].These results are not consistent with the report by Scammellet al.[15] that Bolivian squirrel monkey GR is transcription-ally competent in COS7 cells. This discrepancy may be ex-plained by our finding that transactivation of GRE reportersis vulnerable to saturation. Differences between hGR andgsmGR transactivation are not discerned using high ratiosof GR expression vector to GRE reporter. Low ratios of thesame vectors, however, clearly show five-fold lower transac-tivational competence for gsmGR compared to hGR. Suffi-cient amounts of GRE reporter to GR protein are needed toassess differences in transactivation.

weret ns-f ausen of en-d vationr ionali u-1r e ofG ni-f GFP

ig. 8. The LBD inhibits GR nuclear translocation. Various gsmGRtructs were truncated at the indicated amino acid number to the caerminus. Cells transfected with these C-terminal-truncated constructreated with 100 nM cortisol for 30 min at 37◦C. Each bar represents tean score of fluorescence in the nucleus vs. the whole cell body (nlus cytoplasm) for 20 cells from two independent transfections. Resuresented as mean± S.D. (**) Representsp< 0.01 from Studentt-test.

To investigate nuclear translocation, GR constructsagged with GFP to allow real-time visualization in traected COS1 cells using fluorescence microscopy. Becative COS1 cells do not express appreciable amountsogenous GR, measures of translocation and transactieflect the activity of expressed GFP-tagged GR. Functnterference by the GFP moiety with the N-terminal taegion is known to diminish transactivational competencFP-tagged GR[17]. We found that GFP-tagged GR ma

ests less transactivation relative to untagged GR, but the

S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326 325

moiety does not diminish the relative difference between hGRand gsmGR transactivation.

Spontaneous mutations in the LBD of hGR are knownto affect translocation and transactivation in familial humanforms of glucocorticoid resistance[7,18,19]. Correspond-ingly, diminished translocation of gsmGR may be relatedto naturally occurring mutations in the LBD of wild-typegsmGR. This hypothesis concurs with our findings from ex-periments with GR chimeras, C-terminal truncated gsmGRconstructs, and back-mutations of gsmGR to hGR at threeamino acids in the LBD. Chimera C, for example, had thegsmGR LBD replaced with that from hGR and this in-creased translocation relative to wild-type gsmGR. A trun-cated gsmGR construct lacking the LBD after amino acid552 likewise showed increased translocation even in the ab-sence of cortisol. This finding agrees with earlier observa-tions by Jewell et al.[9] that LBD removal after amino acid550 increases nuclear translocation of truncated hGR. Back-mutations of gsmGR to hGR at three amino acids (Thr551Ser,Ala616Ser, and Ser618Ala) confirmed that specific alter-ations in the LBD are involved in nuclear translocation. Thelatter two point mutations are in the hsp association area ofthe LBD and their involvement is consistent with specula-tions about glucocorticoid resistance in another related NewWorld primate—the cotton-top marmoset[20,21]. The othermutation, Thr551Ser, lies within the tau-2 region in the LBD,a nal[

hass co-c NewW andb d-i dingac byg thanh ga R[ tiva-t R.P tionw es[ ectso

ex-p thec ronepL iticalf soci-aa leart plex[ andt co-

chaperones: the peptidylprolyl isomerases FK506-bindingproteins (FKBP) 51, 52 or cyclosporin A-binding proteincyclophilin 40, or the protein phosphatase PP5[28,29]. Ofparticular interest, is recent evidence indicating that squirrelmonkey FKBP51 is a potent inhibitor of GR transactivation[15]. Although this aspect of GR signaling clearly warrantsfurther attention, it cannot account for our findings becausesquirrel monkey FKBP51 was not present in our experimentswith GR-transfected COS1 cells.

Nuclear translocation of the GR-ligand complex is me-diated by a well-characterized NLS that spans amino acids478–500. Diminished translocation of gsmGR cannot be at-tributed to mutations in this major NLS because the aminoacid sequence for gsmGR and hGR are identical in this region.A second ill-defined motif that overlaps the LBD has beenshown to have NLS-like functions[3]. A truncated gsmGRconstruct containing the major NLS but lacking the LBD afteramino acid 516 demonstrates diminished translocation rela-tive to wild-type gsmGR, or gsmGR truncated after aminoacid 552. These results indicate the possible existence of asecond NLS between the major NLS and amino acid 552.Within this region there are two mutations in gsmGR thatcould possibly impair the second suspected NLS.

A related possibility is that diminished translocation ofgsmGR reflects impaired unmasking of the major NLS[30].The NLS is normally masked by the non-liganded LBD, andu ing[ omh nslo-ca loca-t ack-m 618.I tions( onals vert

ofg im-p , orb n theL mu-t andb , im-p tiveu d toc d bym

A

andP .M.K alu-a

nd is thought to facilitate a nuclear matrix-targeting sig22].

Diminished translocation due to mutations in the LBDeveral possible mechanistic explanations. Initially, gluorticoid resistance in squirrel monkeys and a few otherorld primates was thought to reflect diminished GR lig

inding affinities[23]. But recently two independent stues reported that gsmGR and hGR have equally high binffinities for dexamethasone in COS1 cells[13] or reticulo-yte lysate[12]. Dexamethasone-induced transactivationsmGR is, however, an order of magnitude less efficientGR in COS1 cells[13]. We likewise found that the bindinffinity for cortisol is∼40% less in gsmGR relative to hG

13], whereas cortisol-induced translocation and transacion are diminished by∼300% in gsmGR compared to hGoint mutations in the LBD are known to affect translocaithout significantly affecting GR ligand binding affiniti

24,25], but mutations could conceivably alter other aspf ligand binding and thereby diminish translocation.

Inefficient chaperone processing is another possiblelanation for impaired gsmGR nuclear translocation. Inytoplasm, GR interacts with a complex array of chaperoteins, including hsp90, hsp70, hop, hsp40 and p23[26].igand-dependent displacement of these proteins is cr

or translocation, and specific interaction domains asted with hsp binding lie in the LBD[1,25,27]. At aminocid 643, for example, proline plays a crucial role in nuc

ranslocation of rat GR by stabilizing the GR-hsp90 com25]. Hsp90 is required for normal nuclear translocation,ypically is bound to one of the immunophilin-related

nmasking is thought to be induced by GR ligand bind9,31]. Jewell’s group showed that removal of the LDB frGR truncated at amino acid 550 increased nuclear traation in the presence or absence of dexamethasone[9]. Thisgrees with our observations of increased nuclear trans

ion of gsmGR truncated at amino acid 552, and the butations of gsmGR to hGR at amino acids 616 and

ncreased translocation induced by these specific mutaAla616Ser and Ser618Ala) may reflect three-dimensitructural changes in the LBD that more effectively uncohe NLS.

In summary, we found that nuclear translocationsmGR is impaired by mutations in the LBD, and theairment is partly restored by replacement of the LBDack-mutations of gsmGR to hGR at three amino acids iBD, i.e., Thr551Ser, Ala616Ser, and Ser618Ala. These

ations diminish translocation by possibly disrupting liginding, disturbing interactions with chaperone proteinsairing the functions of a second NLS, or impeding effecnmasking of the major NLS. Ongoing studies now neelarify which of these aspects of GR signaling is impaireutations in the LBD.

cknowledgements

This work was supported by the Pritzker Foundationublic Health Service grants MH47573 and DA16902. Aarssen, L. Liu, D. Schaal, and J. Truntzer provided invble assistance with various aspects of this research.

326 S. Her et al. / Journal of Steroid Biochemistry & Molecular Biology 94 (2005) 319–326

References

[1] G. Giannoukos, A.M. Silverstein, W.B. Pratt, S.S. Simons Jr., Theseven amino acids (547–553) of rat glucocorticoid receptor requiredfor steroid and hsp90 binding contain a functionally independentLXXLL motif that is critical for steroid binding, J. Biol. Chem. 274(51) (1999) 36527–36536.

[2] A.C. Wikstrom, C. Widen, A. Erlandsson, E. Hedman, J. Zilliacus,Cytosolic glucocorticoid receptor-interacting proteins, Ernst ScheringRes Found Workshop 40 (2002) 177–196.

[3] J.G. Savory, B. Hsu, I.R. Laquian, W. Giffin, T. Reich, R.J. Hache,Y.A. Lefebvre, Discrimination between NL1- and NL2-mediated nu-clear localization of the glucocorticoid receptor, Mol. Cell. Biol. 19(2) (1999) 1025–1037.

[4] A.C. Maiyar, M.L. Leong, G.L. Firestone, Importin-alpha medi-ates the regulated nuclear targeting of serum- and glucocorticoid-inducible protein kinase (Sgk) by recognition of a nuclear localiza-tion signal in the kinase central domain, Mol. Biol. Cell. 14 (3)(2003) 1221–1239.

[5] T. Kino, A. Vottero, E. Charmandari, G.P. Chrousos, Famil-ial/sporadic glucocorticoid resistance syndrome and hypertension,Ann. N.Y. Acad. Sci. 970 (2002) 101–111.

[6] D.M. Hurley, D. Accili, C.A. Stratakis, M. Karl, N. Vamvakopoulos,E. Rorer, K. Constantine, S.I. Taylor, G.P. Chrousos, Point mutationcausing a single amino acid substitution in the hormone bindingdomain of the glucocorticoid receptor in familial glucocorticoid re-sistance, J. Clin. Invest. 87 (2) (1991) 680–686.

[7] E. Charmandari, T. Kino, E. Souvatzoglou, A. Vottero, N. Bhat-tacharyya, G.P. Chrousos, Natural glucocorticoid receptor mutantscausing generalized glucocorticoid resistance: molecular genotype,genetic transmission, and clinical phenotype, J. Clin. Endocrinol.

, As fa-with7 (6)

J.A.nu-

tors,

[ nez,cho-chedlner-28–

[ iger-or-

ech-0.

[ ssionmirilin.

[ Im-the

3–4)

[ icoidssion(2)

[ res-onGen.

[16] T.C. Voss, I.A. Demarco, C.F. Booker, R.N. Day, Computer-assistedimage analysis protocol that quantitatively measures subnuclearprotein organization in cell populations, Biotechniques 36 (2004)240–247.

[17] R.K. Tyagi, Y. Lavrovsky, S.C. Ahn, C.S. Song, B. Chatterjee, A.K.Roy, Dynamics of intracellular movement and nucleocytoplasmic re-cycling of the ligand-activated androgen receptor in living cells, Mol.Endocrinol. 14 (8) (2000) 1162–1174.

[18] S.M. Werner, Bronnegard, molecular basis of glucocorticoid-resistantsyndromes, Steroids 61 (4) (1996) 216–221.

[19] T. Kino, R.H. Stauber, J.H. Resau, G.N. Pavlakis, G.P. Chrousos,Pathologic human GR mutant has a transdominant negative effecton the wild-type GR by inhibiting its translocation into the nu-cleus: importance of the ligand-binding domain for intracellularGR trafficking, J. Clin. Endocrinol. Metab. 86 (11) (2001) 5600–5608.

[20] D.D. Brandon, A.J. Markwick, M. Flores, K. Dixon, B.D. Albert-son, D.L. Loriaux, Genetic variation of the glucocorticoid receptorfrom a steroid-resistant primate, J. Mol. Endocrinol. 7 (2) (1991)89–96.

[21] F.C. Dalman, L.C. Scherrer, L.P. Taylor, H. Akil, W.B. Pratt, Lo-calization of the 90-kDa heat shock protein-binding site within thehormone-binding domain of the glucocorticoid receptor by peptidecompetition, J. Biol. Chem. 266 (6) (1991) 3482–3490.

[22] Y. Tang, R.H. Getzenberg, B.N. Vietmeier, M.R. Stallcup, M. Eggert,R. Renkawitz, D.B. DeFranco, The DNA-binding and tau2 transac-tivation domains of the rat glucocorticoid receptor constitute a nu-clear matrix-targeting signal, Mol. Endocrinol. 12 (9) (1998) 1420–1431.

[23] M. Tomita, D.D. Brandon, G.P. Chrousos, A.C. Vingerhoeds, C.M.Foster, D. Fowler, D.L. Loriaux, M.B. Lipsett, Glucocorticoid re-

ientsNew86)

. dene-

y oc-. 11

Aorti-and0.ndExp.

ari-(2)

apa-p90-coid

D.F.teinroid

003)

.A.cor-ne-

57.J.A.icoid93)

Metab. 89 (4) (2004) 1939–1949.[8] A. Vottero, T. Kino, H. Combe, P. Lecomte, G.P. Chrousos

novel, C-terminal dominant negative mutation of the GR causemilial glucocorticoid resistance through abnormal interactionsp160 steroid receptor coactivators, J. Clin. Endocrinol. Metab. 8(2002) 2658–2667.

[9] C.M. Jewell, J.C. Webster, K.L. Burnstein, M. Sar, J.E. Bodwell,Cidlowski, Immunocytochemical analysis of hormone mediatedclear translocation of wild type and mutant glucocorticoid recepJ. Steroid. Biochem. Mol. Biol. 55 (2) (1995) 135–146.

10] E. Charmandari, D.P. Merke, P.J. Negro, M.F. Keil, P.E. MartiA. Haim, P.W. Gold, G.P. Chrousos, Endocrinologic and psylogic evaluation of 21-hydroxylase deficiency carriers and matnormal subjects: evidence for physical and/or psychologic vuability to stress, J. Clin. Endocrinol. Metab. 89 (5) (2004) 222236.

11] G.P. Chrousos, D. Renquist, D. Brandon, C. Eil, M. Pugeat, R. Vsky, G.B. Cutler Jr., D.L. Loriaux, M.B. Lipsett, Glucocorticoid hmone resistance during primate evolution: receptor-mediated manisms, Proc. Natl. Acad. Sci. U.S.A. 79 (6) (1982) 2036–204

12] P.D. Reynolds, S.J. Pittler, J.G. Scammell, Cloning and expreof the glucocorticoid receptor from the squirrel monkey (Saiboliviensis boliviensis), a glucocorticoid-resistant primate, J. CEndocrinol. Metab. 82 (2) (1997) 465–472.

13] P.D. Patel, D.M. Lyons, Z. Zhang, H. Ngo, A.F. Schatzberg,paired transactivation of the glucocorticoid receptor cloned fromGuyanese squirrel monkey, J. Steroid Biochem. Mol. Biol. 72 ((2000) 115–123.

14] P.D. Reynolds, Y. Ruan, D.F. Smith, J.G. Scammell, Glucocortresistance in the squirrel monkey is associated with overexpreof the immunophilin FKBP51, J. Clin. Endocrinol. Metab. 84(1999) 663–669.

15] J.G. Scammell, W.B. Denny, D.L. Valentine, D.F. Smith, Overexpsion of the FK506-binding immunophilin FKBP51 is the commcause of glucocorticoid resistance in three New World primates,Comp. Endocrinol. 124 (2) (2001) 152–165.

ceptors in Epstein-Barr virus-transformed lymphocytes from patwith glucocorticoid resistance and a glucocorticoid-resistantWorld primate species, J. Clin. Endocrinol. Metab. 62 (6) (191145–1154.

[24] P. de Lange, J.W. Koper, N.A. Huizenga, A.O. Brinkmann, F.HJong, M. Karl, G.P. Chrousos, S.W. Lamberts, Differential hormodependent transcriptional activation and -repression by naturallcurring human glucocorticoid receptor variants, Mol. Endocrinol(8) (1997) 1156–1164.

[25] C.A. Caamano, M.I. Morano, F.C. Dalman, W.B. Pratt, H. Akil,conserved proline in the hsp90 binding region of the glucoccoid receptor is required for hsp90 heterocomplex stabilizationreceptor signaling, J. Biol. Chem. 273 (32) (1998) 20473–2048

[26] W.B.D.O. Pratt, Toft, regulation of signaling protein function atrafficking by the hsp90/hsp70-based chaperone machinery,Biol. Med. (Maywood) 228 (2) (2003) 111–133.

[27] R.H. DeRijk, M. Schaaf, E.R. de Kloet, Glucocorticoid receptor vants: clinical implications, J. Steroid Biochem. Mol. Biol. 81(2002) 103–122.

[28] D.L. Riggs, P.J. Roberts, S.C. Chirillo, J. Cheung-Flynn, V. Prpanich, T. Ratajczak, R. Gaber, D. Picard, D.F. Smith, The Hsbinding peptidylprolyl isomerase FKBP52 potentiates glucocortisignaling in vivo, EMBO J. 22 (5) (2003) 1158–1167.

[29] C.R. Sinars, J. Cheung-Flynn, R.A. Rimerman, J.G. Scammell,Smith, J. Clardy, Structure of the large FK506-binding proFKBP51, an Hsp90-binding protein and a component of stereceptor complexes, Proc. Natl. Acad. Sci. U.S.A. 100 (3) (2868–873.

[30] G. Akner, A.C. Wikstrom, K. Mossberg, K.G. Sundqvist, JGustafsson, Morphometric studies of the localization of the glucoticoid receptor in mammalian cells and of glucocorticoid hormoinduced effects, J. Histochem. Cytochem. 42 (5) (1994) 645–6

[31] H. Baumann, K. Paulsen, H. Kovacs, H. Berglund, A.P. Wright,Gustafsson, T. Hard, Refined solution structure of the glucocortreceptor DNA-binding domain, Biochemistry (Mosc). 32 (49) (1913463–13471.