Insularity, Political Status and Small Insular Spaces: a Critical Review
Molecular phylogeny and insular biogeography of the lowland tailorbirds of Southeast Asia...
10
Molecular phylogeny and insular biogeography of the lowland tailorbirds of Southeast Asia (Cisticolidae: Orthotomus) Frederick H. Sheldon a,⇑ , Carl H. Oliveros b , Sabrina S. Taylor c , Bailey McKay d , Haw Chuan Lim a , Mustafa Abdul Rahman e , Herman Mays f , Robert G. Moyle b a Museum of Natural Science and Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA b Biodiversity Institute and Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, KS 66045, USA c School of Renewable Natural Resources, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, USA d Department of Ecology, Evolution, and Behavior, The Bell Museum of Natural History, University of Minnesota, Saint Paul, MN 55108, USA e Geier Collections and Research Center, Cincinnati Museum Center, Cincinnati, OH 45203, USA f Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia article info Article history: Received 14 March 2012 Revised 20 May 2012 Accepted 21 May 2012 Available online 9 June 2012 Keywords: Greater Sunda Islands Habitat specialization Malay Peninsula Philippine islands Orthotomus Tailorbirds abstract The lowland tailorbirds of Southeast Asia (Orthotomus) offer an excellent opportunity for comparative biogeography because of their diversity in the Greater Sunda and Philippine islands. We reconstructed the phylogeny of all species in the genus using maximum likelihood, Bayesian, and coalescent methods on DNA sequences of three gene segments: an autosomal intron (TGF), a Z-linked intron (MUSK), and a mitochondrial coding gene (ND2). Although resolution is low in parts of the phylogeny, several well defined clades emerge. When considered in light of distribution, these clades indicate that the Greater Sunda and Philippine islands were occupied early in Orthotomus history by the ancestors of O. sericeus in the Greater Sundas and O. frontalis in the Philippines. Subsequently, tailorbirds diversified further in each island group: O. atrogularis, O. ruficeps, and O. sepium arose in the Greater Sundas, and O. castaneiceps castaneiceps, O. c. chloronotus, O. derbianus, O. samarensis, O. nigriceps, and O. cinereiceps in the Philippines. Among the continental taxa (including Sundaic birds), the older lineages (O. sutorius and O. sericeus) are habitat generalists and the recently evolved taxa are more specialized. In the Philippines, several taxa once considered conspecific with O. atrogularis turn out to be highly divergent species (>9% in ND2). Indeed, all Philippine allospecies are well diverged from one another. This finding supports the recent assertion of higher-than-appreciated bird endemicity in the Philippines. Ó 2012 Elsevier Inc. All rights reserved. 1. Introduction Tailorbirds are Old World warblers of gardens, thickets, wood- lands, and forests of tropical and subtropical east Africa and south- ern Asia. Their name derives from the practice in most species of stitching leaves together to hold their nests. These birds are very well known not only because they are common and easy to view, but also because of the prominent role of Darzee the tailorbird in Kipling’s famous story of ‘‘Rikki-Tikki-Tavi’’ (Kipling, 1894). Tailorbirds have distinctive morphology, which includes greenish or grayish backs; yellowish, grayish or whitish underparts; rufous (sometimes black) on the head; long bills; and cocked tails. Despite common characteristics of plumage and posture, however, tailorbirds are polyphyletic and consist of three distinct groups (Alström et al., 2006, 2011; Nguembock et al., 2007): the two African tailorbirds (Artisornis moreaui and A. metopias), which stitch their nests (Urban et al., 1997); the two mountain tailorbirds of Southeast Asia (Phyllergates cucullatus and P. heterolaemus), of which the first (at least) does not stitch its nest (Wells, 2007); and the 11 generally lower elevation tailorbirds of southern and Southeast Asia, which do stitch their nests (Madge, 2006). This paper concerns the phylogeny and biogeography of the last group, the genus Orthotomus, which we refer to as the lowland tailorbirds. They can be divided into three distributional groups (Fig. 1): (1) those restricted to the Sunda continental shelf (Sundaland), i.e., the Malay Peninsula and the region of the Greater Sunda Islands of Borneo, Sumatra, Java, and Palawan (O. sericeus, O. ruficeps, and O. sepium); (2) those widespread on the southern Asian mainland and reaching the Greater Sunda Islands (O. sutorius and O. atrogu- laris); and (3) those endemic to the Philippines (O. castaneiceps, O. frontalis, O. derbianus, O. cinereiceps, O. nigriceps, and O. samarensis). Because they comprise both widespread and restricted-range species, the lowland tailorbirds offer an opportunity to compare 1055-7903/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ympev.2012.05.023 ⇑ Corresponding author. Address: LSU Museum of Natural Science, 119 Foster Hall, Baton Rouge, LA 70803, USA. Fax: +1 225 578 3075. E-mail address: [email protected] (F.H. Sheldon). Molecular Phylogenetics and Evolution 65 (2012) 54–63 Contents lists available at SciVerse ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Transcript of Molecular phylogeny and insular biogeography of the lowland tailorbirds of Southeast Asia...
Molecular Phylogenetics and Evolution 65 (2012) 54–63
Contents lists available at SciVerse ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier .com/locate /ympev
Molecular phylogeny and insular biogeography of the lowland tailorbirdsof Southeast Asia (Cisticolidae: Orthotomus)
Frederick H. Sheldon a,⇑, Carl H. Oliveros b, Sabrina S. Taylor c, Bailey McKay d, Haw Chuan Lim a,Mustafa Abdul Rahman e, Herman Mays f, Robert G. Moyle b
a Museum of Natural Science and Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USAb Biodiversity Institute and Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, KS 66045, USAc School of Renewable Natural Resources, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, USAd Department of Ecology, Evolution, and Behavior, The Bell Museum of Natural History, University of Minnesota, Saint Paul, MN 55108, USAe Geier Collections and Research Center, Cincinnati Museum Center, Cincinnati, OH 45203, USAf Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia
a r t i c l e i n f o a b s t r a c t
Article history:Received 14 March 2012Revised 20 May 2012Accepted 21 May 2012Available online 9 June 2012
Keywords:Greater Sunda IslandsHabitat specializationMalay PeninsulaPhilippine islandsOrthotomusTailorbirds
1055-7903/$ - see front matter � 2012 Elsevier Inc. Ahttp://dx.doi.org/10.1016/j.ympev.2012.05.023
⇑ Corresponding author. Address: LSU Museum ofHall, Baton Rouge, LA 70803, USA. Fax: +1 225 578 3
E-mail address: [email protected] (F.H. Sheldon).
The lowland tailorbirds of Southeast Asia (Orthotomus) offer an excellent opportunity for comparativebiogeography because of their diversity in the Greater Sunda and Philippine islands. We reconstructedthe phylogeny of all species in the genus using maximum likelihood, Bayesian, and coalescent methodson DNA sequences of three gene segments: an autosomal intron (TGF), a Z-linked intron (MUSK), and amitochondrial coding gene (ND2). Although resolution is low in parts of the phylogeny, several welldefined clades emerge. When considered in light of distribution, these clades indicate that the GreaterSunda and Philippine islands were occupied early in Orthotomus history by the ancestors of O. sericeusin the Greater Sundas and O. frontalis in the Philippines. Subsequently, tailorbirds diversified further ineach island group: O. atrogularis, O. ruficeps, and O. sepium arose in the Greater Sundas, and O. castaneicepscastaneiceps, O. c. chloronotus, O. derbianus, O. samarensis, O. nigriceps, and O. cinereiceps in the Philippines.Among the continental taxa (including Sundaic birds), the older lineages (O. sutorius and O. sericeus) arehabitat generalists and the recently evolved taxa are more specialized. In the Philippines, several taxaonce considered conspecific with O. atrogularis turn out to be highly divergent species (>9% in ND2).Indeed, all Philippine allospecies are well diverged from one another. This finding supports the recentassertion of higher-than-appreciated bird endemicity in the Philippines.
� 2012 Elsevier Inc. All rights reserved.
1. Introduction
Tailorbirds are Old World warblers of gardens, thickets, wood-lands, and forests of tropical and subtropical east Africa and south-ern Asia. Their name derives from the practice in most species ofstitching leaves together to hold their nests. These birds are verywell known not only because they are common and easy to view,but also because of the prominent role of Darzee the tailorbirdin Kipling’s famous story of ‘‘Rikki-Tikki-Tavi’’ (Kipling, 1894).Tailorbirds have distinctive morphology, which includes greenishor grayish backs; yellowish, grayish or whitish underparts; rufous(sometimes black) on the head; long bills; and cocked tails. Despitecommon characteristics of plumage and posture, however,tailorbirds are polyphyletic and consist of three distinct groups(Alström et al., 2006, 2011; Nguembock et al., 2007): the two
ll rights reserved.
Natural Science, 119 Foster075.
African tailorbirds (Artisornis moreaui and A. metopias), whichstitch their nests (Urban et al., 1997); the two mountain tailorbirdsof Southeast Asia (Phyllergates cucullatus and P. heterolaemus), ofwhich the first (at least) does not stitch its nest (Wells, 2007);and the 11 generally lower elevation tailorbirds of southern andSoutheast Asia, which do stitch their nests (Madge, 2006). Thispaper concerns the phylogeny and biogeography of the last group,the genus Orthotomus, which we refer to as the lowland tailorbirds.They can be divided into three distributional groups (Fig. 1): (1)those restricted to the Sunda continental shelf (Sundaland), i.e.,the Malay Peninsula and the region of the Greater Sunda Islandsof Borneo, Sumatra, Java, and Palawan (O. sericeus, O. ruficeps, andO. sepium); (2) those widespread on the southern Asian mainlandand reaching the Greater Sunda Islands (O. sutorius and O. atrogu-laris); and (3) those endemic to the Philippines (O. castaneiceps,O. frontalis, O. derbianus, O. cinereiceps, O. nigriceps, and O.samarensis).
Because they comprise both widespread and restricted-rangespecies, the lowland tailorbirds offer an opportunity to compare
Fig. 1. Distribution of the 11 species of Orthotomus from Madge (2006). The ranges of O. sutorius and O. atrogularis extend into India and southern China (not shown).
F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63 55
patterns of taxic diversity with other bird groups that are similarlydistributed in Southeast Asia (Hosner et al., 2010; Lim et al., 2011;Lim and Sheldon, 2011; Lim et al., 2010; Lohman et al., 2010; Moy-le et al., 2005, 2011; Oliveros and Moyle, 2010; Outlaw and Voel-ker, 2008; Sheldon et al., 2009). Common patterns of endemismand sympatry examined in view of phylogeny are expected to shedlight on geographic events and biological forces responsible fordiversification of birds in the region (Avise, 2000; Cracraft, 1988).However, identifying common patterns caused by singular histor-ical events and using them to reconstruct evolutionary history ininsular Southeast Asia is difficult. During the last 20 years,researchers have realized that diversification of closely relatedrainforest species in Sundaland and the Philippines has not beendriven solely by Pleistocene connections and disconnections ofcurrently emergent landmasses. Although the heart of this regionhas been geologically stable for 50 Ma (Hall and Holloway, 1998),frequent and complex changes in habitat distribution have beendriven by alteration in climate due to polar glaciation and concom-itant sea level changes. Rainforest has expanded and contractedand shifted positions within Sundaland, such that barriers andrefugia have been created that do not fit current island locationsor habitat configurations (Brandon-Jones, 1998; Cannon et al.,2009; Flenley, 1998; Gathorne-Hardy et al., 2002; Heaney, 1991;Lim et al., 2011; Slik et al., 2011). This complexity has been com-pounded by repeated glacial cycles that started well before thePleistocene and which produced taxa of differing ages that cur-rently live in sympatry (Lim et al., 2011, 2010; Lim and Sheldon,2011; Oliveros and Moyle, 2010). In addition, extinction and idio-syncratic dispersal capabilities of taxa have further clouded thepast (Burney and Brumfield, 2009; Campbell et al., 2004; Lim andSheldon, 2011; Lim et al., 2010). Thus, interpreting modern distri-butions in light of phylogenetic patterns must be done cautiously.
Nevertheless, common biogeographic elements among taxonomicgroups suggest that perseverance and the use of niche modelingand coalescence analysis can illuminate the forces of diversifica-tion (Lim et al., 2011; Lim and Sheldon, 2011). In any event, thefirst step in discovering common patterns is to reconstruct thephylogeny of as many species groups as possible in the region.The main purpose of this paper is to add the phylogeny of anothergroup to the mix.
Another goal of the paper is to identify monophyletic groupswithin lowland tailorbirds to solidify classification. Until recently,incorrect name usage among Sundaic tailorbird species causedmuch confusion (reviewed by Dickinson et al., 1991; Mees,1996), but our understanding has improved substantially, espe-cially relative to the nomenclature and distribution of O. sericeus,O. sepium, and O. ruficeps (Dickinson, 1991; Oberholser, 1932; Wat-son et al., 1986). However, some alpha taxonomy is still in flux,especially for the Philippine endemics. For example, the blackhead-ed tailorbirds of the southern Philippines are split into three spe-cies (O. samarensis, O. nigriceps, and O. cinereiceps) (Madge, 2006),but their parapatric distribution and similar plumages suggest thatthey may be members of a single polymorphic species. Delacourand Mayr (1946) originally grouped them in two species, O. nigri-ceps (including subspecies nigriceps and samarensis) and O. cinerei-ceps, but shortly thereafter Mayr (1947) split them into threespecies. Sibley and Monroe (1990) noted that although O. nigricepsand O. samarensis are often considered conspecific, in their view O.samarensis is closer to O. cinereiceps than to O. nigriceps. Currently,their parapatric distribution and the similarities among these threespecies is recognized by treating them as a superspecies (Madge,2006). The most unsettled tailorbird problem concerns relation-ships among O. atrogularis and the Philippine endemics O. castanei-ceps, O. frontalis, and O. derbianus. The Philippine taxa were
56 F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63
originally treated as subspecies of O. atrogularis (Delacour andMayr, 1946). Parkes (1960, 1971) argued, however, that some ofthe Philippine populations should be considered distinct speciesbased on sympatry of the O. atrogularis subspecies derbianus andchloronotus on Luzon. Thus, he separated O. derbianus from O.atrogularis. Dickinson et al. (1991) subsequently split O. castanei-ceps (which included subspecies chloronotus and frontalis) from O.atrogularis. This revision made better sense because no tailorbirdspecies other than the Sundaic O. sericeus occurs on Palawan, andthus O. atrogularis as previously constructed had a disjunct distri-bution (Dickinson et al., 1991). Finally, Sibley and Monroe (1990)and Madge (2006) subdivided O. castaneiceps further by removingO. frontalis to a distinct species, and they treated O. atrogularis, O.castaneiceps, and O. frontalis as a superspecies. Collar (2011) indi-cated problems with this ultimate arrangement, especially thatthe O. castaneiceps subspecies castaneiceps and rabori look morelike the adjacent species O. derbianus than they do to their fellow(and disjunct) subspecies O. c. chloronotus. He also noted that evi-dence distinguishing O. frontalis from O. castaneiceps is marginal.
To address these taxonomic issues and provide another buildingblock for the comparative biogeography of bird diversity acrossSoutheast Asia, we reconstructed the phylogeny of the lowland tai-lorbirds using DNA sequences of mitochondrial and nuclear genes.
2. Methods
DNA sequences of all 11 Orthotomus species were compared(Table 1). All DNA samples are vouchered with museum speci-mens. Except for O. frontalis and O. atrogularis, we sequenced morethan one individual of each species, and these samples often repre-sent multiple subspecies. We obtained tissue collected specificallyfor molecular analysis of most taxa, but for Javan birds we had toextract DNA from museum skins (‘‘historic samples’’; specimensnoted with asterisks in Table 1). As outgroups, we used 15 speciesof Cisticolidae and Sylviidae that varied in genetic relatedness tothe ingroup (Alström et al., 2006; Nguembock et al., 2007). Theoutgroup included the two montane Southeast Asian tailorbirds,Phyllergates cucullatus and P. heterolaemus (Table 1), and two spe-cies whose DNA was sequenced previously, Pycnonotus cinereifrons(Genbank Nos. JN826845, JN826338, JN825845) and Melocichlamentalis (JN826602, JN826348, JN825855) (Moyle et al., 2012).
Three unlinked DNA markers were sequenced for this study: (1)mitochondrial nicotinamide adenine dinucleotide dehydrogenasesubunit 2 (ND2; 1041 bp); (2) the third intron of the Z-linked mus-cle-specific kinase gene (MUSK; 614 bp aligned); and (3) the fifthnuclear intron of transforming growth factor, b2 (TGF; 613 bpaligned), which occurs on chicken chromosome 3 (Kimball et al.,2009). Total genomic DNA of modern samples was extracted fromfrozen or alcohol-preserved muscle tissue using standard Qiagenextraction protocols (Qiagen, Valencia, CA). These were amplifiedusing primers L5215–H6313 (Hackett, 1996; Johnson and Soren-son, 1998), MUSK-I3F–MUSK-I3R (Kimball et al., 2009), andTGF5–TGF6 (Primmer et al., 2002), respectively. Polymerase chainreaction (PCR) was performed in 10 ll reactions on an MJ ResearchPTC-100 thermocycler using a thermal profile of 94 �C for 4 minfollowed by 30 cycles of 1 min at 94 �C, 1 min at 55 �C, and 2 minat 72 �C, and then a final extension for 10 min at 72 �C. PCR prod-ucts were purified with ExoSAP-IT (US78201, Amersham Biosci-ences, Piscataway, NJ) or Qiagen Qiaquick PCR purification kits.Purified PCR products were then sequenced with ABI Prism BigDyeTerminator chemistry (Ver. 3.1; Applied Biosystems, Foster City,CA) using the same primers used for PCR. Cycle sequencing prod-ucts were purified through Sephadex or precipitation in 70% etha-nol and then analyzed on an ABI 134 Prism 3130xl GeneticAnalyzer (Applied Biosystems, Foster City, CA). Sequencher 4.7
(Gene Codes Corp., Ann Arbor, MI) was used to reconcile comple-mentary gene sequences and align sequences across taxa.
DNA was extracted from museum specimen toepads using theQiagenDNEasy kit (Qiagen, Valencia, CA) and carrier RNA. Sampleswere eluted twice with 200 lL Buffer AE, and these eluates werecombined and concentrated with a speed vacuum concentratorto approximately 100 lL. DNA extraction and amplification werecarried out in a dedicated room that was separate from contempo-rary samples and PCR product. Negative controls were made for allextractions and amplifications. ND2 (1041 bp) was amplified usingpublished primers H6313 and L5215 (Hackett, 1996; Johnson andSorenson, 1998) and a series of short, overlapping internal primersdesigned from modern Orthotomus sequences (Table 2). Reagentsand consumables used for the historic samples were treated fol-lowing Champlot et al. (2010). All tubes (clear-walled), PCR strips,water, rabbit serum albumin (RSA), and buffer were placed within1 cm of UV bulbs and irradiated under UV light for 15 min, anddNTPS and Qiagen Hot Star Plus polymerase were treated withheat-labile double-strand specific DNase (Biotec Marine Biochem-icals, Tromsø, Norway). Amplification reactions consisted of1 � buffer (Qiagen), 0.8 mMdNTPs (Qiagen), 0.625 U Hot Star Pluspolymerase (Qiagen), 0.5 lM primers (Operon), 1 mg/ml RSA, andnanopure water for a total reaction volume of 25 lL. Thermocy-cling conditions consisted of 5 min at 95 �C, followed by 55 cyclesof 94 �C for 30 s, 50 �C for 30 s, and 72 �C for 1 min with a finalextension step of 72 �C for 7 min. PCR product was purified withthe Qiagen PCR Purification kit, cycle-sequenced with ABI PrismBigDye Terminator chemistry (Ver. 3.1; Applied Biosystems, FosterCity, CA), and purified with SephadexG-50 (SigmaAldrich) prior tosequencing on an ABI 3100 or 3130XL platform. Sequences aredeposited at Genbank: JX006104–JX006237.
Sequence variability and pairwise distances were examinedwith MEGA5 (Tamura et al., 2011). Phylogenetic analysis of concat-enated sequences was conducted using maximum likelihood (ML)implemented in the program RAxML 7.2.6 (Stamatakis et al., 2008).Sequences were divided into five partitions (three mitochondrialcodon positions and the two introns) and analyzed using theGTRGAMMA model of evolution. Clade support was evaluated with1000 fast bootstrap pseudoreplicates (Stamatakis et al., 2008). Wealso conducted Bayesian analysis (BA) using Markov Chain MonteCarlo (MCMC) tree searches in MrBayes 3.1.2 (Huelsenbeck andRonquist, 2001; Ronquist and Huelsenbeck, 2003). MtDNA se-quences were partitioned by codon position, and the nuclear in-trons were each treated as a separate partition. MrModeltest 2.3(Nylander, 2004) was used to determine the substitution modelbased on the AIC. Two independent runs of 20 million generationswere conducted with default chain heating conditions, samplingevery 2000 generations. Stationarity was evaluated with the pro-gram AWTY (Nylander et al., 2008) by plotting bipartition frequen-cies of each run in nonoverlapping bins of 2 million generations(‘‘Slide’’) and comparing the frequency of bipartitions betweenthe two runs with various burn-in proportions removed (‘‘Com-pare’’). Generations before the runs had stabilized and convergedon similar posterior probabilities for clades were discarded asburn-in. The remaining trees were retained and summarized in amajority rule consensus tree. Bayesian analyses were also con-ducted on the mitochondrial and nuclear data separately to exam-ine congruence in phylogenetic signal between the two markers.
Estimation of the species tree from separate gene trees wasconducted via Bayesian analysis in �BEAST 1.6.2 using an .XML filecreated in BEAUti 1.6.2 (Heled and Drummond, 2010). In this case,we used Phyllergates cucullatus and P. heterolaemus as outgroupsbecause we had multiple individuals of both species. The mostappropriate evolutionary model for each gene was determinedwith MrModelTest 2.3 (Nylander, 2004): MUSK, z-linked, GTR + I;TGF, autosomal, GTR + G; ND2, mitochondrial, GTR + I + G. We
Table 1Taxa and specimens compared in this study.
Speciesa Subspecies Numberb Collector Locality
OutgroupTurdus plumbeus (Red-legged Thrush) KUNHM6390 Robbins Dominican RepublicPrinia atrogularis (Hill Prinia) KUNHM13608 Nyari China: Guizhou ProvinceCisticola erythrops (Red-faced Cisticola) KUNHM15543 Thompson Ghana: Upper West RegionApalis rufogularis (Buff-throated Apalis) KUNHM8654 Rice Equatorial GuineaCettia fortipes (Brownish-flanked Bush Warbler) KUNHM6744 Benz China: Hunan ProvinceBradypterus caudatus (Long-tailed Bush Warbler) KUNHM19150 Oliveros PhilippinesCamaroptera brachyura (Bleating Warbler) KUNHM8343 Rice Equatorial GuineaSylvia communis (Greater Whitethroat) KUNHM4521 Peterson EnglandMelocichla mentalis (Moustached Grass-warbler) KUNHM15406 Thompson GhanaPycnonotus cinereifrons (Ashy-fronted Bulbul) KUNHM12667 Oliveros Philippines: PalawanPetrochelidon pyrrhonota (Cliff Swallow) KUNHM10618 Eaton USA: KansasHeliolais erythropterus (Red-winged Warbler) KUNHM15391 Robbins GhanaUrosphena squameiceps (Asian Stubtail) KUNHM10198 Nyari China: Guangxi ProvincePhyllergates cucullatus (Mountain Tailorbird) coronatus KUNHM10329 Robbins China: Guangxi Province
cinereicollis LSUMNS52577 Sheldon Malaysia: Sabah, Mt. Trus Madiphilippinus KUNHM21046 Sanchez-Gonzales Philippines: Luzon, Mt. Palali
P. heterolaemus (Rufous-headed Tailorbird) CMC38994 Kennedy Philippines: Mindanao, Mt. ApoCMC38130 Kennedy Philippines: Mindanao, Mt. ApoKUNHM19162 Oliveros Philippines: Mindanao, Mt. Balatucan
IngroupO. sutorius (Common Tailorbird) longicauda KUNHM13563 Nyari China: Guizhou Province
maculicollis J1136 Lim Singaporemaculicollis J1164 Lim Singaporeedela USNM219581c Palmer Indonesia: Java, Depokedela USNM220010c Palmer Indonesia: Java, Bajah
O. atrogularis (Dark-necked Tailorbird) atrogularis LSUMNS57037 Sheldon Malaysia: Sarawak: Tatau DistrictO. castaneiceps (Philippine Tailorbird) castaneiceps CMC36928 Kennedy Philippines: Panay, Antique Prov.
castaneiceps CMC36929 Kennedy Philippines: Panay, Antique Prov.chloronotus KUNHM20192 Sanchez-Gonzales Philippines: Luzon, Aurora Prov.chloronotus KUNHM19604 Oliveros Philippines: Luzon, Aurora Prov.chloronotus CMC36578 Kennedy Philippines: Luzon, Zambales Prov.chloronotusd CMC36579 Kennedy Philippines: Luzon, Zambales Prov.
O. frontalis (Rufous-fronted Tailorbird) frontalis KUNHM14056 Fernandez Philippines: Dinagat Island, Muncipality of LoretoO. derbianus (gray-backed Tailorbird) derbianus KUNHM18043 Oliveros Philippines: Luzon, Camarines Norte Prov.
nilesi FMNH350975 Heaney Philippines: CatanduanesO. sericeus (Rufous-tailed Tailorbird) sericeus KUNHM12631 Oliveros Philippines: Palawan Island, Puerto Princesa
sericeus KUNHM17792 Moyle Malaysia: Sabah, Ulu Kimanishesperius J1165 Lim Singaporehesperius J1167 Lim Singaporehesperius DOT17288 Sweet Singapore
O. ruficeps (Ashy Tailorbird) borneoensis LSUMNS47143 Sheldon Malaysia: Sabah, Klias Forest Reservecineraceus J1156 Lim Singaporecineraceus DOT17284 Sweet Singapore
O. sepium (Olive-backed Tailorbird) sepium ANSP56705c Kannegieter Indonesia: Javasepium AMNH269052c Menden Indonesia: Javasepium AMNH703336c Van Bermmel Indonesia: Javasepium USNM220247c Palmer Indonesia: Javasepium USNM219589c Palmer Indonesia: Java
O. cinereiceps (White-eared Tailorbird) obscurior NMP/CMC2068 Gonzales Philippines: Mindanao, South Cotabato Provinceobscurior KUNHM18228 Oliveros Philippines: Zamboanga Peninsula
O. nigriceps (Black-headed Tailorbird) KUNHM14063 Fernandez Philippines: Dinagat IslandKUNHM19057 Oliveros Philippines: Mindanao, Mt. Magdiwata
O. samarensis (Yellow-breasted Tailorbird) KUNHM14147 Fernandez Philippines: Samar IslandKUNHM14204 Fernandez Philippines: Samar Island
a Classification of tailorbirds follows Madge (2006).b AMNH = American Museum of Natural History skin specimen, ANSP = Academy of Natural Sciences of Philadelphia, CMC = Cincinnati Museum Center, DOT = American
Museum of Natural History tissue specimen, J = National University of Singapore specimen, KUNHM = University of Kansas Museum of Natural History, LSUMNS = LouisianaState University Museum of Natural Science, NMP = National Museum of the Philippines, USNM = United States National Museum.
c Indicates a sample from a museum specimen toe pad.d This specimen may be a hybrid O. derbianus derbianus x O. castaneiceps chloronotus.
F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63 57
employed a relaxed uncorrelated lognormal distribution for theclock model and the Yule process as the tree prior. �BEAST ranfor 100,000,000 generations with sampling every 5000 genera-tions, yielding 20,000 trees. To assess stationarity of the posteriordistribution and convergence of parameters we used Tracer 1.5(Drummond and Rambaut, 2007). A consensus tree was built withTreeAnnotator V1.6.2 using a burnin of 2000 (10% of) trees, and thefinal tree was visualized with FigTree V1.3.1 (Drummond and Ram-baut, 2007). Divergence dates among taxa were estimated from
ND2 sequences by setting �BEAST ND2 priors in BEAUti to corre-spond to a divergence rate of 2.5%/Ma (=1.25 � 10�8 substitu-tions/site/Ma, SD = 0.1, prior distribution = lognormal) asestimated by Smith and Klicka (2010) via regression of ND2 withcytochrome b. The rate priors for the nuclear genes were set atabout one tenth the ND2 rate, as per Carling et al. (2010): autoso-mal TRG, 1.30 x 10�9 substitutions/site/Ma, SD = 0.45, lognormal(Ellegren, 2007); z-linked MUSK 1.45 � 10�9 substitutions/site/Ma, SD = 0.45, lognormal (Axelsson et al., 2004; Ellegren, 2007).
Table 2Internal primers used to sequence ND2 derived from museum specimen toe pads.
Primer name 5’ to 3’ sequence
135F AAAATCTCACCACCCACGA209F TTCTATTCTCCAGCATAACCA267F GGACAATGAGACATCACCCAA268R TGGGTGATGTCTCATTGTC351F CCATTCCACTTCTGATTCCC354R TCTGGGAATCAGAAGTGGAA386R AGTTTTATTACTGTAGAGAGCA435F CCAATCTCACTACTCT435R AGAGTAGTGAGATTGG548R GGCTATGATTTTTCGG550F GAAAAATCATAGCCTTCTC705R CGGTTATTAGGGTTGA709F CCCTAATAACCGCATGAAC723F CGCCATACTTCTACTAACCAT748F TCCCTAGCAGGTCTACCACCA767F CATTAACAGGCTTCCTACCAA864F AGGACTATTCTTCTATCTCCG878R AAGAATAGTCCTAGTAGGGAT
58 F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63
3. Results
For most individuals, we obtained sequence lengths of 613nucleotides of MUSK, 614 nucleotides of TGF, and 1041 nucleotidesof ND2. However, from historic samples, only ND2 was sequenced.Ingroup comparisons of ND2 yielded 378 variable and 344 parsi-mony informative sites; of MUSK, 24 variable and 19 parsimonyinformative sites; and of TGF, 39 variable and 25 parsimony infor-mative sites. When the sequences were translated to amino acids,ND2 had 81 variable and 72 parsimony informative sites. ND2exhibited substitution patterns consistent with coding mtDNA(i.e., no stop codons, rate of substitution for codon position2 < 1 < 3).
Pairwise genetic distances among taxa were substantial for themitochondrial ND2 gene and short or negligible for the nucleargenes. For example, among the lowland tailorbirds, the largestuncorrected proportional distances were between O. sutorius andthe other species: average ND2 14.7% (SD 0.6%), MUSK 1.9% (SD0.2%), and TGF 2.5% (SD 0.3%). Average ND2 distances are listedin Table 3 to provide a guide to genetic variation, including withinspecies when more than one individual was compared. For exam-ple, five individuals of O. sutorius distributed among southern Chi-na, Singapore, and Java varied in divergence between 0.6% and 1.4%(average 0.8, SD 0.4), but there was no correspondence with geo-graphic distance. Two individuals of O. ruficeps from Singaporewere identical and differed from one individual from Sabah (northBorneo) by 1.3%. Five individuals of O. sepium from Java averaged0.1% (SD 0.01) divergence. Interestingly, the two individuals of O.
Table 3Averaged uncorrected percent ND2 distances among Orthotomus taxa.
Taxon 1 2 3 4 5 6 7 8 9 10 11 12 13 14
1 O. cucullatus 1.02 O. heterolaemus 6.5 0.043 O. sutorius 23.2 22.4 0.084 O. frontalis 23.5 23.0 13.8 –5 O. atrogularis 22.6 21.6 14.4 10.6 –6 O. ruficeps 22.7 22.3 14.9 10.0 5.4 0.87 O. sepium 22.7 21.8 15.0 10.4 6.1 3.2 0.18 O. sericeus 22.7 22.2 13.9 8.9 10.0 9.6 9.9 1.19 O. c. castaneiceps (Panay) 22.5 22.0 14.7 10.7 11.6 11.4 11.8 10.0 0.3
10 O. c. chloronotus (Luzon) 22.3 22.2 15.0 10.0 9.9 9.7 10.1 9.2 9.7 0.311 O. derbianus 22.2 22.1 15.4 12.0 12.0 11.7 12.6 11.6 12.5 9.0 0.712 O. samarensis 23.4 23.1 15.6 12.2 12.4 12.7 13.1 10.8 12.5 10.9 12.5 0.013 O. cinereiceps 22.7 22.7 15.0 12.9 11.5 12.0 13.0 11.9 12.2 11.3 12.9 11.5 3.414 O. nigriceps 22.8 22.1 14.1 10.3 11.2 11.7 12.2 9.6 11.0 9.4 10.6 10.0 7.9 0.3
cinereiceps sampled, one from the Zamboanga Peninsula in westMindanao and the other from South Cotabato in south Mindanao,differed by 3.4%. This distance, and the distances among the threeblack-headed Orthotomus of the southern Philippines (7.9–11.5%),are much greater than expected of allospecies.
When analyzed separately the nuclear genes produced phyloge-netic trees that resolved some basal relationships, but otherwiseproduced largely uninformative topologies; ND2 produced a moreresolved tree (Fig. 2). All three genes placed O. sutorius as sister tothe other lowland tailorbirds. O. frontalis was also a basally branch-ing taxon, but genes disagreed whether O. frontalis was sister to therest of the ingroup (MUSK) or sister to a clade comprising O. atrog-ularis and O. ruficeps (TGF). (ND2 did not resolve O. frontalis rela-tionships.) The phylogenetic trees built from concatenatedsequences (by ML and Bayesian analysis) and the �BEAST tree builtfrom gene trees were completely congruent, given lack of resolu-tion (Figs. 3 and 4). Lowland tailorbirds were found to be mono-phyletic with strong support, and O. sutorius was sister to therest. The basal configuration of the rest of the clades, however,was unclear. Concatenated sequences indicated a polytomy ofthree clades: (1) O. frontalis, (2) O. atrogularis–O. ruficeps–O. sepium,and (3) O. sericeus with the rest of the Philippine endemics. �BEASTproduced a polytomy with four clades: (1) O. frontalis, (2) O. atrog-ularis–O. ruficeps–O. sepium, (3) O. sericeus, and (4) the rest of thePhilippine endemics. Both analysis methods placed O. atrogularisas sister to O. ruficeps and O. sepium. Both also indicated threeclades of Philippine endemics (apart from O. frontalis): (1) O. casta-neiceps castaneiceps (from Panay); (2) the black-headed species ofthe southern Philippines in the following configuration: O. samar-ensis (O. nigriceps, O. cinereiceps); and (3) O. castaneiceps chloronotus(central Luzon) and O. derbianus (SE Luzon and Catanduanes).
Divergence dates were computed by �BEAST based on an ND2rate of 2.5%/Ma and a generation time of one year (Fig. 4). Unfortu-nately the confidence intervals are too large to specify geographicevents responsible for any cladogenetic events, especially given re-peated cyclical changes in sea levels and habitat positions.
4. Discussion
4.1. Broad patterns
On a broad geographic scale, the phylogeny of lowland tailor-birds suggests: (1) they originated in southern Asia and possiblySundaland; (2) they spread widely in Sundaland and the Philip-pines early in tailorbird history; and (3), most recently, more spe-cies have evolved in both island groups. A continental (as opposedto a Philippine) derivation of tailorbirds is likely because their clos-est relatives are cisticolids distributed across southern Asia and
Fig. 2. Bootstrapped majority-rule consensus gene trees constructed by MLanalysis. Note that MUSK or TGF were not sequenced for O. sepium.
F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63 59
Africa, and a continental taxon, O. sutorius, is the sister of all otherOrthotomus species. However, the precise area where Orthotomusoriginated is unknown. Tailorbird ancestors may have derived ininsular Sundaland and subsequently moved inland across southernAsia, as some other bird groups appear to have done (Lim et al.,2010), or ancestral tailorbirds may have derived inland in southernAsia and subsequently invaded Sundaland. The current disjunctdistribution of O. sutorius in southern Asia and Java may an artifactof ancient distribution or a recent phenomenon caused by glacial
influences on Sundaic habitats (see below). The two ‘‘middle-aged’’tailorbird lineages, O. sericeus in Sundaland and O. frontalis in thePhilippines, appear to have achieved early and widespread distri-bution in their island groups. O. sericeus occurs on the Malay Pen-insula and all the Sunda islands except Java, where it is replaced byO. sutorius; it is the only lowland tailorbird on Palawan. O. frontalisoccupies the southern Philippines. Its ancestors apparently reachedthose oceanic islands either by direct invasion from the mainlandto the north or (more likely) by moving through Sundaland. In con-trast to these older, monotypic lineages, clades of greater diversityevolved more recently in both island groups. In the Philippines,this radiation comprises O. castaneiceps, O. derbianus, O. samarensis,O. nigriceps, and O. cinereiceps, the last three taxa being sympatricwith O. frontalis. In Sundaland, the newer species are O. atrogularis,O. ruficeps, and O. sepium. They occupy nearly all of the large is-lands and the Malay Peninsula (O. sepium occurs only on Java; noneoccurs on Palawan). Whether these recent radiations were facili-tated by the extinction of older island tailorbird species isunknown.
Overall, the pattern of Orthotomus distribution suggests that rel-atively ancient invaders moved throughout insular Southeast Asia,reaching as far as the southern Philippines. These original inhabit-ants were either displaced by members of later evolving clades orbecame sympatric with them. This pattern of diversification is onlypartially consistent with the traditional view that Asian taxamoved in stepping-stone fashion across Sundaland to the Philip-pines (Darlington, 1957; Diamond and Gilpin, 1983; Dickerson,1928; Inger, 1954). If the data showed conclusively, as suggestedby the tree from concatenated sequences (Fig. 3), that the youngerPhilippine endemics are, in fact, sister to O. sericeus, then the step-ping-stone view would be supported, at least in part.
Some of the tailorbird diversification reflects habitat prefer-ences. Although tailorbird habitats are notoriously difficult to de-fine (e.g., Mitra and Sheldon, 1993), approximate patterns can beoutlined for the Sundaic species. O. sericeus and O. sutorius are lar-gely generalists (Sheldon et al., 2001; Wells, 2007), and the differ-ence in their dispersion in Sundaland is likely related to thepreference of O. sutorius for open, drier habitats. Its disjunct distri-bution between the southern Asian mainland and Java can be ex-plained by savannah-like corridors that are thought to havespanned central Sundaland from north to south periodically duringglacial periods (Bird et al., 2005) and the generally drier or seasonalhabitats currently present in parts of southern Asia and Java. Thecorridors would have allowed O. sutorius to move back and forthto Java until fairly recently, thus explaining the low genetic diver-gence between Malayan and Javan populations (ND2 � 1.0%). Inhistoric times, the disjunct populations have probably drawn clo-ser together; O. sutorius almost certainly has invaded the MalayPeninsula from the north as human-caused deforestation has in-creased drier, open habitat there (Medway and Wells, 1976; Wells,pers. comm.) The younger lineages of tailorbirds in Sundaland havesomewhat better defined habitats than O. sutorius and O. sericeus.This is especially true of O. atrogularis, which prefers older forestcanopy and edge, and O. ruficeps, which is most common in man-grove and coastal forests. Greater specialization would help themavoid competition with the pre-existing generalist tailorbirds.Unfortunately not much published information exists on the spe-cific habitat preferences of O. sepium in Java or of any of the co-existing species in the southern Philippines.
Other generic groups we have examined that are distributedacross insular Southeast Asia—Harpactes trogons (Hosner et al.,2010), Copsychus thrushes (Lim et al., 2010; Sheldon et al., 2009),and Arachnothera spiderhunters (Moyle et al., 2011)—exhibit someof the distributional characteristics of tailorbirds, such as earlyinvasion by generalists (Copsychus) and sympatry of groups of dif-ferent ages and habitat specialization (all three groups). Trogons
Fig. 3. Majority-rule consensus tree of lowland Orthotomus from concatenated MUSK, TGF, and ND2 sequences. Branch support numbers: Bayesian posterior probability/MLbootstrap. Branches with less than 95% Bayesian and 70% bootstrap support are collapsed.
60 F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63
and spiderhunters are distinguished from tailorbirds and Copsy-chus by encompassing monophyletic montane taxa that representrelatively old lineages (Apalharpactes in the trogons, Arachnotherajuliae in the spiderhunters). These older lineages are replaced inthe lowlands by more recently evolved taxa, a pattern that sug-gests displacement of older taxa to the mountains. The montanecounterparts of lowland tailorbirds are the mountain tailorbirdsPhyllergates cucullatus (widely distributed across Southeast Asiafrom the mainland to the Philippines and Wallacea) and P. hetero-laemus (endemic to Mindanao). These two species are sister taxaand not particularly closely related to lowland tailorbirds (Alströmet al., 2006, 2011). Nevertheless, they appear to be ecological coun-terparts of the lowland species, except that they occur in moun-tains on some Wallacean islands whether or not lowlandtailorbirds are present. Thus, they are not necessarily being keptat higher elevation by close lowland relatives, as have the montanetrogons and spiderhunters.
4.2. Local geographic patterns
On a more restricted geographic scale, the distribution of low-land endemic tailorbirds in the Philippines makes unusually goodevolutionary sense in terms of allopatric speciation (Mayr, 1964).These tailorbirds largely replace one another geographically: O.castaneiceps chloronotus occurs in northern Luzon; O. derbianus insouthern Luzon; O. castaneiceps in the western Visayan Islands(Panay, Negros, Cebu, etc.); O. samarensis on Samar, Leyte, andBohol; O. nigriceps in eastern Mindanao; and O. cinereiceps in wes-tern Mindanao. All of these taxa are genetically well differentiatedfrom one another (i.e., >7% uncorrected pairwise divergence),
suggesting they have experienced relatively long periods of isola-tion. One exception to this geographic pattern is O. frontalis, whichis sympatric with the black-headed species of the southern Philip-pines. But as noted previously, the distribution of O. frontalis hasbeen driven by different evolutionary forces than the morerecently derived Philippine endemics. Another exception concernsO. c. chloronotus and O. derbianus. These two species overlap in Cen-tral Luzon (Parkes, 1971; University of Kansas and University ofCincinnati specimens). However, they are difficult to tell apartand, thus, the distribution and characteristics of their contact zoneare uncertain. Given their large genetic divergence (ND2 9%), it isreasonable to assume that they have only recently come into con-tact. Overall, the substantial genetic differentiation among taxathat originally were lumped into single species or are still consid-ered allospecies supports the finding of Lohman et al. (2010) thatendemicity of Philippine forest birds has been substantiallyunderestimated.
In Sundaland, Java is the only island with an endemic tailorbird,O. sepium. Given the close genetic distance between O. sepium andO. ruficeps (3.2% in ND2, the closest of any tailorbird species) andthe apparent restriction of O. ruficeps to the northern part of Java(even though mangroves exist on the southern coast), it seemslikely that an ancestor of O. ruficeps–O. sepium reached Java earlyon and diverged into O. sepium. The current occupation of northernJava by O. ruficeps would be an even more recent event.
4.3. Classification
Phylogenetic analysis clarifies the taxonomic relationshipsamong Orthotomus. The species recognized on mainland Asia and
Fig. 4. Most probable species tree of lowland Orthotomus from �BEAST analysis of MUSK, TGF, and ND2 sequences. Branch numbers are posterior probability support. Thebottom scale is times in millions of years. Nodal numbers are the 95% ‘‘confidence interval’’ for the time of divergence.
F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63 61
in Sundaland are appropriately classified. However, the Philippinetaxa need revision. No Philippine species should be considered partof the superspecies O. atrogularis. The Philippine endemics havebeen evolving independently for a long time. Similarly, O. frontalisshould no longer be considered an allospecies of O. castaneiceps, asit represents a much older lineage. O. castaneiceps chloronotus ofLuzon should be recognized as a separate species from O. castanei-ceps castaneiceps due to its sister relationship with O. derbianus. Itis highly divergent from both of these taxa and distinguishablefrom the gray-backed O. derbianus by having a greenish back. Collar(2011), who anticipated its species ranking, suggested the commonname green-backed tailorbird. Orthotomus chloronotus Ogilvie-Grant, 1895, is the appropriate scientific name (Parkes, 1971; Wat-son et al., 1986). The black-headed species of the southern Philip-pines (O. samarensis, O. nigriceps, and O. cinerieceps) are highlydivergent from one another and morphologically distinct. Theyare appropriately divided into three species in recent classifica-tions (Dickinson, 2003; Madge, 2006). They may be consideredmembers of a superspecies according to taxonomic taste, but theyare more divergent from one another (ND2 > 7%) than normallyrecognized allospecies.
5. Conclusions
The phylogeny of Orthotomus provides an excellent startingpoint for population genetic and ecological studies of species in
the group. O. sutorius needs intensive coalescent analysis of itspopulations from India to Java. Such an analysis would help usunderstand the development of this complex species. Ecologicalcomparisons of O. sericeus on Palawan, where there are no lowlandtailorbird competitors, to populations on Sumatra, Java, and Bor-neo, where there are two competitors each, would help us discernniche parameters in this species. Such studies could be extended toany of the recently evolved Orthotomus species, because they pres-ent either differential combinations of sympatry (in Sundaland andsouthern Philippines) or well-defined, parapatric distributions (inthe Philippines).
Acknowledgments
We thank the museums that provided specimen material for thisstudy (Table 1) and the governments of China and Singapore forpermission to conduct recent research. For permission to undertakeresearch in the Philippines, we thank the Department of Environ-ment and Natural Resources of the Philippines and the ProtectedAreas and Wildlife Bureau. For permission to undertake researchin Malaysia we thank the Prime Minister’s Department, the ChiefMinister’s Departments of Sabah and Sarawak; Sabah Parks, Wild-life, and Forestry departments, and Sarawak Forestry Department,Forestry Corporation, and Biodiversity Institute. Brian Smith,Andrés Cuervo, and James Maley, David Wells, and anonymousreviewers provided much help with the analyses and manuscript.
62 F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63
This work was supported by the National Science Foundation (DEB-0743576 and DEB-0743491 to RGM, DEB-I0821703 to HLM, andDEB-0228688 to FHS), Coypu Foundation, University of Kansas,Louisiana State University, Universiti Malaysia Sarawak, andUniversity of Minnesota.
References
Alström, P., Ericson, P.G.P., Olsson, U., Sundberg, P., 2006. Phylogeny andclassification of the avian superfamily Sylvioidea. Molecular Phylogeneticsand Evolution 38, 381–397.
Alström, P., Hohna, S., Gelang, M., Ericson, P.G.P., Olsson, U., 2011. Non-monophylyand intricate morphological evolution within the avian family Cettiidaerevealed by multilocus analysis of a taxonomically densely sampled dataset.BMC Evolutionary Biology 11.
Avise, J.C., 2000. Phylogeography: The History and Formation of Species. HarvardUniversity Press, Cambridge, Massachusetts.
Axelsson, E., Smith, N.G.C., Sundstrom, H., Berlin, S., Ellegren, H., 2004. Male-biasedmutation rate and divergence in autosomal, Z-linked and W-linked introns ofchicken and turkey. Molecular Biology and Evolution 21, 1538–1547.
Bird, M.I., Taylor, D., Hunt, C., 2005. Palaeoenvironments of insular Southeast Asiaduring the last glacial period: a savanna corridor in Sundaland? QuaternaryScience Reviews 24, 2228–2242.
Brandon-Jones, D., 1998. Pre-glacial Bornean primate impoverishment andWallace’s line. In: Hall, R., Holloway, J.D. (Eds.), Biogeography and GeologicalEvolution of SE Asia. Backhuys Publishers, Leiden, pp. 393–403.
Burney, C.W., Brumfield, R.T., 2009. Ecology Predicts Levels of GeneticDifferentiation in Neotropical Birds. American Naturalist 174, 358–368.
Campbell, P., Schneider, C.J., Adnan, A.M., Zubaid, A., Kunz, T.H., 2004. Phylogenyand phylogeography of Old World fruit bats in the Cynopterus brachyotiscomplex. Molecular Phylogenetics and Evolution 33, 764–781.
Cannon, C.H., Morley, R.J., Bush, A.B.G., 2009. The current refugial rainforests ofSundaland are unrepresentative of their biogeographic past and highlyvulnerable to disturbance. Proceedings of the National Academy of Sciencesof the United States of America 106, 11188–11193.
Carling, M.D., Lovette, I.J., Brumfield, R.T., 2010. Historical divergence and gene flow:coalescent analyses of mitochondrial, autosomal and sex-linked loci in Passerinabuntings. Evolution 64, 1762–1772.
Champlot, S., Berthelot, C., Pruvost, M., Bennett, E.A., Grange, T., Geigl, E.M., 2010. Anefficient multistrategy DNA decontamination procedure of PCR reagents forhypersensitive PCR applications. PLOS ONE 5.
Collar, N.J., 2011. Species limits in some Philippine birds including the greaterflameback Chrysocolaptes lucidus. Forktail, 29–38.
Cracraft, J., 1988. From Malaysia to New Guinea: evolutionary biogeography withina complex continent-island arc contact zone. Acta XIX CongressusInternationalis Ornithologici 19, 2581–2593.
Darlington, P.J., 1957. Zoogeography: The Geographical Distribution of Animals.Wiley, New York.
Delacour, J., Mayr, E., 1946. Birds of the Philippines. Macmillan, New York.Diamond, J.M., Gilpin, M.E., 1983. Biogeographic umbilici and the origin of the
Philippine avifauna. Oikos 41, 307–321.Dickerson, R.E., 1928. Distribution of Life in the Philippines, Monograph 21. Bureau
of Science, Manila.Dickinson, E.C., 1991. Biogeography of Philippine birds. In: Dickinson, E.C., Kennedy,
R.S., Parkes, K.C. (Eds.), The Birds of the Philippines: An Annotated Check-list.BOU Check-list Series No. 12. British Ornithologists’ Union, Tring, Herts, UnitedKingdom, pp. 24–46.
Dickinson, E.C., 2003. The Howard & Moore Complete Checklist of the Birds of theWorld, 3rd ed. Christopher Helm, London.
Dickinson, E.C., Kennedy, R.S., Parkes, K.C., 1991. The Birds of the Philippines. BritishOrnithologists/Union, Tring, Herts, United Kingdom.
Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis bysampling trees. BMC Evolutionary Biology 7, 214.
Ellegren, H., 2007. Molecular evolutionary genomics of birds. Cytogenetic andGenome Research 117, 120–130.
Flenley, J.R., 1998. Tropical forests under the climates of the last 30,000 years.Climatic Change 39, 177–197.
Gathorne-Hardy, F.J., Syaukani, Davies, R.G., Eggleton, P., Jones, D.T., 2002.Quaternary rainforest refugia in south-east Asia: using termites (Isoptera) asindicators. Biological Journal of the Linnean Society 75, 453–466.
Hackett, S.J., 1996. Molecular phylogenetics and biogeography of tanagers in thegenus Ramphocelus (Aves). Molecular Phylogenetics and Evolution 5, 368–382.
Hall, R., Holloway, J.D., 1998. Biogeography and Geological Evolution of SE Asia.Backhuys, Leiden.
Heaney, L.R., 1991. A synopsis of climatic and vegetational change in Southeast Asia.Climatic Change 19, 53–61.
Heled, J., Drummond, A.J., 2010. Bayesian inference of species trees from multilocusdata. Molecular Biology and Evolution 27, 570–580.
Hosner, P.A., Sheldon, F.H., Lim, H.C., Moyle, R.G., 2010. Phylogeny andbiogeography of the Asian trogons (Aves: Trogoniformes) inferred fromnuclear and mitochondrial DNA sequences. Molecular Phylogenetics andEvolution 57, 1219–1225.
Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetictrees. Bioinformatics 17, 754–755.
Inger, R.F., 1954. Systematics and zoogeography of Philippine amphibia. Fieldiana33, 183–531.
Johnson, K.P., Sorenson, M.D., 1998. Comparing molecular evolution in twomitochondrial protein coding genes (cytochrome b and ND2) in the dabblingducks (Tribe: Anatini). Molecular Phylogenetics and Evolution 10, 82–94.
Kimball, R.T., Braun, E.L., Barker, F.K., Bowie, R.C.K., Braun, M.J., Chojnowski, J.L.,Hackett, S., Han, K.-L., Harshman, J., Heimer-Torres, V., Holznagel, W.,Huddleston, C.J., Marks, B.D., Miglia, K.J., Moore, W.S., Reddy, S., Sheldon, F.H.,Smith, J.V., Witt, C.C., Yuri, T., 2009. A well-tested set of primers to amplifyregions spread across the avian genome. Molecular Phylogenetics and Evolution50, 654–660.
Kipling, R., 1894. The Jungle Book. Macmillan, London.Lim, H.C., Sheldon, F.H., 2011. Multilocus analysis of the evolutionary dynamics of
rainforest bird populations in Southeast Asia. Molecular Ecology 20, 3414–3438.
Lim, H.C., Zou, F., Taylor, S.S., Marks, B.D., Moyle, R.G., Voelker, G., Sheldon, F.H.,2010. Phylogeny of magpie-Robins and shamas (Aves: Turdidae: Copsychus andTrichixos): implications for island biogeography in Southeast Asia. Journal ofBiogeography 37, 1894–1906.
Lim, H.C., Rahman, M.A., Lim, S.L.H., Moyle, R.G., Sheldon, F.H., 2011. RevisitingWallace’s haunt: coalescent simulations and comparative niche modelingreveal historical mechanisms that promoted avian population divergence inthe Malay Archipelago. Evolution 65, 321–334.
Lohman, D.J., Ingram, K.K., Prawiradilaga, D.M., Winker, K., Sheldon, F.H., Moyle,R.G., Ng, P.K.L., Ong, P.S., Wang, L.K., Braile, T.M., Astutic, D., Meier, R., 2010.Cryptic genetic diversity in ‘‘widespread’’ Southeast Asian bird species suggeststhat Philippine avian endemism is gravely underestimated. BiologicalConservation 143.
Madge, S.C., 2006. Family Cisticolidae (Cisticolas and allies) [Orthotomus accounts].In: del Hoyo, J., Elliott, A.B., Christie, D. (Eds.), Handbook of the Birds of theWorld, vol. 11. Lynx Edicions, Barcelona, pp. 423–427.
Mayr, E., 1947. Notes on tailorbirds (Orthotomus) from the Philippine Islands.Journal of the Washington Academy of Sciences 37, 140–141.
Mayr, E., 1964. Animal Species and Evolution. Belknap Press, Cambridge, MA.Medway, L., Wells, D.R., 1976. The Birds of the Malay Peninsula, vol. 5. H.F. & G.
Witherby, London.Mees, G.F., 1996. Geographical variation in birds of Java. Publications of the Nuttall
Ornithological Club 26, 1–119.Mitra, S., Sheldon, F.H., 1993. Use of an exotic tree plantation by Bornean lowland
forest birds. Auk 110, 529–540.Moyle, R.G., Schilthuizen, M., Rahman, M.A., Sheldon, F.H., 2005. Molecular
phylogenetic analysis of the white-crowned forktail Enicurus leschenaulti inBorneo. Journal of Avian Biology 36, 96–101.
Moyle, R.G., Taylor, S.S., Oliveros, C.H., Lim, H.C., Haines, C.L., Rahman, M.A., Sheldon,F.H., 2011. Diversification of an insular Southeast Asian genus: Phylogeneticrelationships of the spiderhunters (Aves: Nectariniidae). Auk 128, 777–788.
Moyle, R.G., Andersen, M.J., Oliveros, C.H., Steinheimer, F., Reddy, S., 2012.Phylogeny and biogeography of the core babblers (Aves: Timaliidae).Systematic Biology 61, 631–651.
Nguembock, B., Fjeldsa, J., Tillier, A., Pasquet, E., 2007. A phylogeny for theCisticolidae (Aves: Passeriformes) based on nuclear and mitochondrial DNAsequence data, and a re-interpretation of an unique nest-buildingspecialization. Molecular Phylogenetics and Evolution 42, 272–286.
Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.Evolutionary Biology Centre, Uppsala University Uppsala, Sweden.
Nylander, J.A.A., Wilgenbusch, J.C., Warren, D.L., Swofford, D.L., 2008. AWTY (are wethere yet?): a system for graphical exploration of MCMC convergence inBayesian phylogenetics. Bioinformatics 24, 581–583.
Oberholser, H.C., 1932. The birds of the Natuna Islands. United States NationalMuseum Bulletin 159, 1–137.
Oliveros, C.H., Moyle, R.G., 2010. Origin and diversification of Philippine bulbuls.Molecular Phylogenetics and Evolution 54, 822–832.
Outlaw, D.C., Voelker, G., 2008. Pliocene climatic change in insular Southeast Asia asan engine of diversification in Ficedula flycatchers. Journal of Biogeography 35,739–752.
Parkes, K.C., 1960. Notes on some Philippine tailor-birds. Bulletin of the BritishOrnithological Club 80, 76–78.
Parkes, K.C., 1971. Taxonomic and distributional notes on Philippine birds.Nemouria 4, 1–67.
Primmer, C.R., Borge, T., Lindell, J., Saetre, G.P., 2002. Single-nucleotidepolymorphism characterization in species with limited available sequenceinformation: high nucleotide diversity revealed in the avian genome. MolecularEcology 11, 603–612.
Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inferenceunder mixed models. Bioinformatics 19, 1572–1574.
Sheldon, F.H., Moyle, R.G., Kennard, J., 2001. Ornithology of Sabah: history,gazetteer, annotated checklist, and bibliography. Ornithological Monographs52, 1–285.
Sheldon, F.H., Lohman, D.J., Lim, H.C., Zou, F., Goodman, S.M., Prawiradilaga, D.M.,Winker, K., Braile, T.M., Moyle, R.G., 2009. Phylogeography of the magpie-robinspecies complex (Aves: Turdidae: Copsychus) reveals a Philippine species, aninteresting isolating barrier, and unusual dispersal patterns in the Indian Oceanand Southeast Asia. Journal of Biogeography 36, 1070–1083.
F.H. Sheldon et al. / Molecular Phylogenetics and Evolution 65 (2012) 54–63 63
Sibley, C.G., Monroe, B., 1990. Distribution and Taxonomy of Birds of the World. YaleUniversity, New Haven, Connecticut.
Slik, J.W.F., Aiba, S.-I., Bastian, M., Brearley, F.Q., Cannon, C.H., Eichhorn, K.A.O.,Fredriksson, G., Kartawinata, K., Laumonier, Y., Mansor, A., Marjokorpi, A.,Meijaard, E., Morley, R.J., Nagamasu, H., Nilus, R., Nurtjahya, E., Payne, J.,Permana, A., Poulsen, A.D., Raes, N., Riswan, S., van Schaik, C.P., Sheil, D.,Sidiyasa, K., Suzuki, E., van Valkenburg, J.L.C.H., Webb, C.O., Wich, S., Yoneda, T.,Zakaria, R., Zweifel, N., 2011. Soils on exposed Sunda shelf shapedbiogeographic patterns in the equatorial forests of Southeast Asia.Proceedings of the National Academy of Sciences of the United States ofAmerica 108, 12343–12347.
Smith, B.T., Klicka, J., 2010. The profound influence of the late Pliocene Panamanianuplift on the exchange, diversification, and distribution of New World birds.Ecography 33, 333–342.
Stamatakis, A., Hoover, P., Rougemont, J., 2008. A fast bootstrapping algorithm forthe RAxML web-servers. Systematic Biology 57, 758–771.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance, and maximum parsimony methods. Molecular Biologyand Evolution 28, 2731–2739.
Urban, E.K., Fry, C.H., Keith, S., 1997. The Birds of Africa, vol. 5. Academic Press,London.
Watson, G.E., Traylor, M.A., Mayr, E., 1986. Order Passeriformes, suborder oscines,family Sylviidae. In: Mayr, E., Cottrell, G.W. (Eds.), Check-list of Birds of theWorld, Museum of Comparative Zoology, vol. 11. Cambridge, Massachusetts, pp.3–294.
Wells, D.R., 2007. The Birds of the Thai-Malay Peninsula. Passerines, vol. 2.Christopher Helm, London.
