Mitotane increases the radiotherapy inhibitory effect and induces G2-arrest in combined treatment on...

Endocrine-Related Cancer (2008) 15 623–634

Mitotane increases the radiotherapyinhibitory effect and induces G2-arrest incombined treatment on both H295R andSW13 adrenocortical cell lines

L Cerquetti1,2, B Bucci2, R Marchese2, S Misiti1,2, U De Paula3, R Miceli3,AMuleti2, D Amendola2, P Piergrossi2, E Brunetti2, V Toscano1 and A Stigliano1,2

1Endocrinology II Faculty of Medicine, University ‘La Sapienza’, Rome, Italy2Research Center and 3Radiation Oncology Unit, S Pietro Hospital, Rome, Italy

(Correspondence should be addressed to A Stigliano, “Sapienza” University of Rome Via di Grottarossa, 1035, 00189 Rome, Italy;

Email: [email protected])

Abstract

Mitotane, 1,1-dichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane (o,p0-DDD) is an agent withadrenotoxic effect, which is able to block cortisol synthesis. This drug and radiotherapy are used alsoin adrenal cancer treatment even if their biological action in this neoplasia remains unknown. Weinvestigated the effects of o,p0-DDD and ionizing radiations (IR) on cell growth inhibition and cell cycleperturbation in H295R and SW13 adrenocortical cancer cells. Both cell lines were irradiated at a 6 Gydose and were treated with o,p0-DDD 10K5 M separately and with IR/o,p0-DDD in combination. Thiscombination treatment induced an irreversible inhibition of cell growth in both adrenocortical cancercells. Cell cycle analysis showed that IR alone and IR/o,p0-DDD in combination induced the cellaccumulation in the G2 phase. At 120 h after IR, the cells were able to recover the IR-induced G2 blockwhile cells treated with IR/o,p0-DDD were still arrested in G2 phase. In order to study the molecularmechanism involved in the G2 irreversible arrest, we have considered the H295R cell line showing thehighest inhibition of cell proliferation associated with a noteworthy G2 arrest. In these cells, cyclin B1and Cdk2 proteins were examined by western blot and Cdk2 kinase activity measured by assay kit.The H295R cells treated with IR/o,p0-DDD shared an increase in cyclin B1 amount as thecoimmunoprecipitation of Cdc2–cyclin B1 complex. The kinase activity also shows an increase in thetreated cells with combination therapy. Moreover, in these cells, sequence analysis of p53 revealed alarge deletion of exons 8 and 9. The same irreversible block on G2 phase, induced by IR/o,p0-DDDtreatment, happened inH295Rcells with restored wild-typep53 suggesting that thismechanism isnotmediated by p53 pathway.


Introduction

Sporadic adrenocortical carcinoma (ACC) is an

uncommon tumour that rarely occurs with synchronous

bilateral adrenal involvement (Venkatesh et al. 1989).

In advanced disease, highly individualized treatment

includes surgical mass reduction, control of endocrine

activity and alleviation of symptoms from local tumour

growth (Schteingart 1992).

Mitotane, 1,1-dichloro-2-(o-chlorophenyl)-2-(p-

chlorophenyl)ethane (o,p 0-DDD) is able to block

cortisol synthesis by inhibiting 11b-hydroxylation


1351–0088/08/015–623 q 2008 Society for Endocrinology Printed in Great

and cholesterol chain cleavage, thus representing an

effective agent in the treatment of the functional ACC

(Trainer & Besser 1994, Beauregard et al. 2002).

Nevertheless, the toxicity of o,p 0-DDD has been a

major limit to its suitability in the treatment of ACC

patients (Schteingart et al. 1993). Some authors have

described an excellent response to adjuvant radio-

therapy in patients with ACC (Percarpio & Knowlton

1976, Markoe et al. 1991), while another study

seems to suggest its use only as palliation in metastatic

ACC (Nader et al. 1983). Furthermore, few data are

Britain

DOI: 10.1677/erc.1.1315

Online version via http://www.endocrinology-journals.org

http://dx.doi.org/10.1677/erc.1.1315

L Cerquetti et al.: Mitotane/IR effects on cancer cells

available due to the paucity of patients with different

tumour stages (Bodie et al. 1989).

The p53 tumour suppressor gene has a crucial role in

DNA repair and recognition of DNA lesions (Kastan

et al. 1991, Di Leonardo et al. 1994). Its loss of function

may lead to aberrant cell kinetics and tumour growth

(Hollstein et al. 1991). Some authors demonstrated

allelic losses at chromosome 17p containing p53 gene

locus and at chromosome 13q containing RB gene locus

in human ACC (Yano et al. 1989). Moreover, p53 gene

mutations were also found in some ACC (Ohgaki et al.

1993, Hollstein et al. 1994, Reincke et al. 1994).

Aim of this study was to evaluate the antineoplastic

effects of both radiotherapy and o,p 0-DDD used

individually or in combination either in H295R

functional orSW13non-functional adrenocortical cancer

cells, derived from human ACC. The negative control

was represented to Hs792(C).M, a human normal

fibroblast cell line derived by similar embryologic sheet

of adrenal cortical areas. We demonstrated that radio-

therapy and o,p0-DDD in combination exert a significant

antiproliferative effect on adrenocortical human cell

lines, characterized by cell cycle arrest in G2 phase with

an overexpression of cyclin B1 and a high Cdc2 kinase

activity in the H295R cells. These results may suggest

interesting implications in the treatment of ACC.

Materials and methods

Cell culture and treatment

Cell lineswere supplied from theAmerican TypeCulture

Collection (Rockville, MD, USA). The H295R steroid-

synthesizing cells were cultured in Dulbecco’s modified

Eagle’smedium/Ham’smedium(DMEM/HAM’SF-12),

medium supplemented with penicillin/streptomycin

50 U/ml and enriched with a mixture of a insulin/trans-

ferrin/selenium and 10% NuSerum-I. The SW13 cells

were grown in Leibovitz’s L-15 medium supplemented

with 10% bovine serum and the Hs792(C).M cells in

D-MEM supplemented with 1.5 g/l sodium bicarbonate

and 10% bovine serum. All cell lines were irradiated by a

Varian Clinac 600c/d 6MV photon beam. Scanditronix

FC65G farmer ionization chamber was used to evaluate

the beam properties in water and polymethylmetha-

crylate phantom.Thecells irradiationwasbasedon single

irradiation doses of 6 Gy/min and analysed from 24 to

120 h. All experiments were repeated at least thrice and

each experimental sample was seeded in triplicate.

Radiation treatment was given 24 h post-seeding and

then the cells were treated with o,p 0-DDD 10 mM(Sigma–Aldrich). The viable cells were counted using

a haemocytometer by trypan blue exclusion.

624

The H295R cells were exposed to hydrocortisone

(100 nM; Calabria et al. 2006) replacement after the

combined treatment. Proliferation rate was performed

until 120 h.

Cortisol secretion

Cortisol was determined in the H295R cell supernatant

at different times after the treatment by radioimmuno-

metric assay (Bayer Corp).

Cell cycle analysis

Cell cycle was studied using both bromodeoxyuridine

incorporation (BrdU; Sigma Chemical Co.) and propi-

dium iodide (PI) staining. Both BrdU pulse-labelling and

continuous-labelling experiments were carried out. The

pulse-labelling experiments were performed by adding

10 ml BrdU to the medium during the last 30 min before

analysis. For BrdUrd continuous-labelling experiments,

the cells were continuously exposed for 50 h before

analysis. After 30 min and after 50 h, the cells were

harvested, washed once in PBS, fixed in 70% ethanol and

stored at 4 8C before analysis. Then, the samples were

incubated with mouse monoclonal antibody anti-BrdU

(Roche Diagnostics) in a complete medium containing

20% fetal calf serum (FCS) and 0.06% Tween 20

(Calbiochem, SanDiego, CA, USA) at room temperature

for 1 h. After washing in PBS, cells were incubated with

FITC-conjugated rabbit anti-mouse IgG (DAKO,

Glostrup, Denmark) in PBS for 1 h. Finally, cells were

stained with a solution containing 5 mg/ml PI and

75 KU/ml RNase in PBS for 3 h. The top line of the

cytograms represents BrdUrd-positive cells. In order to

performPI staining, treated and untreated cells were fixed

in 70% ethanol and stained with a solution containing

50 mg/ml PI (Sigma Chemical) and 75 KU/ml RNase

(Sigma Chemical) in PBS for 30 min at room tempera-

ture. For both experiments, 20 000 events per sample

were acquired using a FACScan cytofluorimeter (Becton

Dickinson, Sunnyvale, CA, USA).

Western blotting

Cellular lysates were sonicated on ice, clarified by

centrifugation at 20 000 g and stored atK80 8C.Analiquot

of the cell lysates was used to evaluate the protein content

bycolorimetricassay.Thesubcellular fractions, nuclearand

cytoplasmic proteins were prepared using the procedure of

the Nuclear/Cytosol fractionation Kit (MBL international

corporation Woburn, MA, USA). Seventy micrograms of

each of the subcellular fractions were electrophoresed on

10% polyacrylamide gel in the presence of SDS and

transferred onto a nitrocellulose membrane. Blots were

www.endocrinology-journals.org


blocked for 1 h at room temperature with 5% non-fat dry

milk and were then incubated with anti-cyclin B1 (Santa

Cruz Biotechnology, Santa Cruz, CA, USA) and anti-Cdc2

(SC-54 Santa Cruz Biotechnology).

The cytoplasmic and nuclear fraction normalization

were performed with anti-a tubulin (TU-02 Santa Cruz

Biotechnology) and anti-histone 1 (AE4-Santa Cruz

Biotechnology) respectively.

The treated and untreated H295R cells were

incubated with the anti-p53 (DO-1, Santa Cruz

Biotechnology) and anti-p53 (C-19, Santa Cruz

Biotechnology) at the same concentration of 1:500.

The visualization of the antigens was performed by

enhanced chemiluminescent detection reagents.

Coimmunoprecipitation

The H295R cell pellets were resuspended in cell lysis

solution at a low stringency (NP40 1%, leupeptin

1 mg/ml, pepstatin 1 mg/ml, aprotinin 2 mg/ml, phenyl-

methylsulphonylfluoride 0. 2 mM, sodium fluoride

10 mM) and a protease inhibitor. Then, the samples

were sonicated for 10 s (Branson sonifier 150). Preclear-

ing of the lysates was done by adding protein A to the

extracts andmixing for 1 h at 4 8C. After preclearing, the

supernatant was again incubated with the protein A and

with cyclin B1 at 4 8C overnight. Immunocomplex were

washed thrice in lysis solution at low stringency, resolved

by SDS-PAGE. Proteins transferred to the filter were

detected by Cdc2 horseradish peroxidase-linked second-

ary antibody and visualized by enhanced chemi-

luminescence reagent. The anti-cyclin B1 was used to

normalize the immunocomplex.

Cyclin B1 kinase dependent assay

To measure the kinase activity of cyclin B1–Cdc2 in

H295R cell lysate, CycLex Cdc2–cyclin B1 Kinase

Assay Kit (CycLex Co. Ltd, Ina Nagano, Japan) was

used. Phospho-specific monoclonal antibody used in this

assay kit was able to recognize the phospho-threonine

376 residue in human Cdc7 that is phosphorylated only

by Cdc2–cyclin B1 kinase. Quantitative measurement of

Cdc2–cyclin B activity involved the incubation ofCdc2–

cyclin B sample with substrate, either a natural or

synthetic polypeptide in the presence of Mg2- and32P-

labelled ATP. Filter papers were then washed to remove

unincorporated radiolabel and the radioactivity counted

by absorbance value.

PCR and sequence analysis of p53 gene

Total RNA was extracted from 1!106 H295R cells

cultured in 100 mm dishes with 1 ml TRIZOL reagent


and 200 ml chloroform/ml TRIZOL were used. The

samples were centrifuged and then the isopropanol/ml

TRIZOL was added to aqueous phase and incubated at

room temperature for 10 min. Pellet was washed with

Et-OH/ml TRIZOL and finally was dissolved in 20 mldiethylpyrocarbonate (DEPC) water.

Genomic DNA ofH295R cells was extracted byDNA

isolation kit (Gentra System Qiagen, Chatsworth, CA,

USA). PCR was performed in a total volume of 20 ml.The following primers of the p53 were used for PCR:

Ex5–Ex6 For 542

CTGCTCAGATAGCAATGGTCTG

Ex7 Rev 704

TTGTAGTGGATGGTGGTACAGTCA

Ex11 Rev 1183.

DNA was sequenced using the Big Dye Terminator

Cycle Sequence Ready Reaction kit on an ABI PRISM

310 Genetic Analyzer (Applied Biosystems, Foster City,

CA, USA) according to the manufacture’s protocol.

Transient transfection of H295R cells

In H295R cell line, a transient transfection of the p53

plasmide construct was performed. Cells (3!105 in

100 mm dishes) were cotransfected the day after

seeding with 4 mg pINDp53 and 2 mg pCMVEGFP-

spectrin plasmids, mixed in Opti-MEM containing 25 mlLipofectAMINE reagent (Invitrogen) and incubated for

7 h according to the manufacturer’s instructions. After-

wards, the transfected cells were maintained in fresh

growing medium for 24 h, exposed to single ionizing

radiations (IR) dose (6 Gy), o,p0-DDD alone and in

combination. After 72 h of treatment, the samples were

processed for cell cycle analysis, as described below.

Results

Effects of IR and o,p0-DDD treatment in H295R and

in SW13 cells

Kinetic characteristics of adrenocortical H295R and

SW13 cells were investigated using BrdU incorporation

and bivariate BrdU/DNA flow cytometric analysis

(FCM). After 30-min pulse chase, the percentage of

cells with active DNA replication detected by BrdU

positive cellswas about 45% inboth cell lines.Cellswere

checked for 50 h in order to label the entire cell cycle

population.As observed in Fig. 1, all cellular populations

were completely labelled by BrdU. In fact, more than

90% of cells were BrdU-positive in both cell lines,

indicating that all cells were in the S phase. This interval

625

Figure 1 Representative cell cycle analysis after BrdUrdincorporation in the H295R and SW13 cells. Both cell lineswere labelled with a 10 mM BrdU pulse of 30 min (a and c) andcontinuously labelled with BrdU for 50 h (b and d). Cells wereconsidered BrdU-positive when detected above the line; thepercentage of such cells is provided on the left. Representativeof three different experiments with similar results.

Figure 2 Four different doses of ionizing radiations were testedon cell growth. No differences between 1 and 3 Gy doses on cellgrowth were detected. After 72 h of irradiation at 6 Gy dose,there was a 30% proliferation inhibition to (A) H295R cells anda 27% to (B) SW13 cells, the 10 Gy dose was toxic for thecell viability.


of time allowed us to define 50 h as their potential

doubling time (Tpot) in which DNA replication, mitosis

and cell division were completed.

We exposed both adrenocortical cells to different

radiation doses, 1-3-6-10 Gy, and examined the effects

produced by the treatment on cell growth and cell cycle

at different times after radiation exposure (24, 48, 72, 96

and 120 h). At each time, cells were harvested and

counted using the trypan blue dye exclusion test.

Figure 2A and B respectively show growth prolifer-

ation curves of H295R and SW13 cells treated with

1-3-6-10 IRGy. IR doses of 1 and 3 Gy did not exert any

significant antiproliferative effect within 120 h after

treatment in both cell lines (about 7% respectively),

whereas we observed a cell growth inhibition of about

70% at 72 h after 10 Gy exposure in both cell lines too.

This antiproliferative effect persisted 120 h after

treatment, but it was associated with an elevated toxicity

(70%) as evaluated by the exclusion trypan blue dye test

(data not shown). It suggests that this IR treatment was

unsuitable even though there was a significant anti-

neoplastic effect. When cells were treated with 6 Gy

dose, we observed about 30 and 27% of cell growth

inhibition after 72 h in H295R cells and SW13 cells

respectively, associated with a moderate cytotoxicity.

This effect was partially lost during the following hours

decreasing up to 13% in H295R cells and 20% in SW13

cells after 120 h.

626

These data showed a significant and persistent

inhibition of cell growth at the highest radiation dose

(10 Gy). Conversely, at lower dose of 6 Gy, a fraction of

the cell population seemed to be able to recover from the

radiation-induced DNA damage. Non-toxic 6 Gy dose

was selected to perform the experiments. Schteingart

et al. (1993) reported that o,p0-DDD at 10 mM dose

inhibits cortisol secretion with minimal effect on cell

viability; therefore, we used this dose to evaluate the

o,p0-DDD sensitivity on adrenocortical cells.

Proliferation of cells exposed to 6 Gy and adrenolytic

o,p0-DDD in combination was inhibited to a greater

extent than that observed after 6 Gy alone. This

inhibitory effect was present in both cell lines. In

particular, in H295R cells, it was about 70% after 72 h

and continued 120 h after treatment (P!0.01; Fig. 3A).

In SW13 cells, it was about 55% at 120 h after treatment

(P!0.01; Fig. 3B), suggesting that cells were unable to

recover from the IR-induced damage.

No relevant changes in cell growth were observed in

o,p0-DDD-treated cell lines from 24 h until 120 h from

treatment (Fig. 3A and B). Moreover, no significant

effects were detected in the H295R cells treated with IR


Figure 3 The cells were analysed after 6 Gy ionizing radiations, after o,p 0-DDD 10 mM treatment and finally after 6 Gy ionizingradiation and o,p 0-DDD 10 mM in combination. In the combined treatment, the cell proliferation was affected and cell growth arrestcontinued 120 h after treatment (P!0.01). o,p 0-DDD and 6 Gy dose alone have shown minor effects on cell proliferation.

Figure 4 Effects of different treatments on cortisol secretion inH295R cells. After different treatments, equal amounts ofsupernatant were tested. From 24 to 96 h, there was a 57%hormone secretion reduction in both 6 Gy/o,p0-DDD com-bination and o,p 0-DDD treatment. Ionizing radiations did notinterfere with the production of the cortisol hormone.


and o,p0-DDD after hydrocortisone replacement in

culture medium (data not shown).

Finally, the same experiments performed on

Hs792(C).M control cells did not affect their prolifer-

ation rate (Fig. 3C).

Steroid inhibition on H295R cells

H295R cells are able to secrete different steroid

hormones (i.e. glucocorticoids, mineralocorticoids and

adrenal androgens). To verify drug efficiency on

inhibition of cortisol secretion, we measured their

concentration in the culture medium. o,p 0-DDD alone

or in combinationwith 6 Gy inhibited hormone secretion

of about 60% at 120 h after treatment (P!0.01). No

significant difference was observed in cortisol level in

samples treated by 6 Gy alone (Fig. 4).

IR and o,p 0-DDD in combination treatment induce

arrest in G2 phase in H295R and SW13 cells

PI staining and FCMwere employed to evaluate whether

the o,p0-DDD alone or in combination with IR treatment

induced cell cycle perturbations. The relative number of

cells in each phase of the cell cycle was estimated from

DNAcontent by cellQuest software analysis (Columbus,

OH, USA).

As shown in Table 1, IR exposure induced an

accumulation of the H295R cells in the G2 phase of cell

cycle when compared with untreated cells and then

evaluated 24 h after treatment (the G2 phase was 60 and

17% in 6 Gy treated and untreated H295R cells

respectively; P!0.05).

After 6 Gy exposure, in H295R-treated cells, the G2-

phase percentage progressively decreased to 16%within

120 h from IR treatment and the G1 phase increased

(69%). This analysis showed that the characteristic G2

block produced by IR treatment was completely

recovered 120 h after treatment. IR and o,p0-DDD in

combination induced a similar G2 accumulation (50 vs

17% in the control; P!0.05) evaluated 24 h after


treatment. However, a significant difference between

two treatments was observed during the progression

through the cell cycle phases (P!0.05). It suggests that

the cells were not able to recover the IR/o,p0-DDD-

induced G2 block.

Also in SW13 cells, after 6 Gy exposure occurred a

temporary G2 accumulation. Similar irreversible G2

arrest was observed in these cells when treated with

6 Gy/o,p0-DDD in combination. In fact, it induced a G2

arrest at 24 h (30 vs 7% in the control) and in the

following times (P!0.05; Table 2).

Adrenocortical cancer cells treated in combination

were still blocked in the G2 phase after 120 h from

treatment compared with IR exposure alone (67 vs 16%

in H295R, P!0.05; 27 vs 14% in SW13, P!0.05),

suggesting that prolonged G2 block could be responsible

for increased IR sensitivity. No cell cycle perturbation

was observed in both cell lines exposed to o,p0-DDD

alone.

Similar results were obtained in Hs792(C).M control

cells (data not shown) according to the data reported by

Ceraline et al. (1997).

627

Table 1 Flow cytometric analysis of H295R cells

24 h 48 h 72 h 96 h 120 h

G1% S% G2% G1% S% G2% G1% S% G2% G1% S% G2% G1% S% G2%

Control 56G0.4 27G1.4 17G1.2 61G0.1 24G1.3 15G1.1 66G0.2 20G1.3 14G1.1 70G1.5 18G0.3 12G1.8 72G0.1 16G0.2 12G2.4

o,p 0-DDD 55G1.1 22G0.3 23G0.9 65G1.4 21G0.3 14G1.1 65G1.5 22G0.9 13G1.9 69G1.2 18G0.6 13G1.5 71G1.4 13G0.4 16G1.3

6 Gy 15G2.1 25G0.3 60G1.4 45G1.6 22G0.4 33G1.1 55G1.7 22G1.9 23G1.2 67G0.4 19G1.1 14G2.1 69G0.4 15G1.4 16G1.5

6 GyCo,p 0-DDD 38G1.5 12G1.3 50G0.3 19G1.1 23G0.6 58G0.5 12G121 22G1.1 66G1.6 11G1.5 22G0.1 67G1.6 13G0.7 20G1.1 67G1.6

Cell cycle analysis after PI staining was performed at 24, 48, 72, 96 and 120 h from treatments. A 6 Gy dose induced a cell accumulation in the G2 phase of cell cycle after 24 h (60 vs17% in control cells; P!0.05). In treated cells, G2 phase progressively decreased to the percentage of 16% within 120 h from IR treatment with progressive increase in the G1 phase(69%). IR and o,p 0-DDD in combination induced a similar G2 accumulation (50%) evaluated 24 h after treatment and the cells were not able to recover the IR-induced G2 block until as120 h (P!0.05). No significant variation in cell cycle was observed in the cells treated with o,p 0-DDD alone.

Table 2 Flow cytometric analysis of SW13 cells

24 h 48 h 72 h 96 h 120 h

G1% S% G2% G1% S% G2% G1% S% G2% G1% S% G2% G1% S% G2%

Control 70G1.1 23G0.1 7G0.7 74G1.2 15G0.9 11G1.3 75G1.2 15G0.9 10G2.1 76G0.6 12G1.1 12G0.8 77G1.1 10G1.2 13G1.3

o,p 0-DDD 68G0.1 20G1.2 12G1.8 74G0.7 12G1.3 14G1.4 74G0.5 13G1.2 13G0.9 75G1.9 11G1.3 14G1.5 76G0.7 10G1.2 14G2.3

6 Gy 41G2.0 23G1.7 36G0.9 58G0.6 10G0.5 32G1.4 60G0.1 16G0.9 24G0.8 66G1.1 14G2.1 20G2.2 74G0.6 12G1.3 14G0.7

6 GyCo,p 0-DDD 55G0.1 15G0.9 30G1.3 51G1.1 16G0.9 33G1.9 51G1.1 16G1.2 33G0.6 54G1.7 16G1.1 30G1.9 55G1.7 18G1.1 27G1.8

Cell cycle analysis after PI staining was performed at 24, 48, 72, 96 and 120 h from treatment. A 6 Gy dose induced a cell accumulation in the G2 phase of cell cycle after 24 h (36 vs 7%in control cells; P!0.05). In treated cells, G2 phase progressively decreased to the percentage of 14% within 120 h from IR treatment with progressive increase in the G1 phase (74%).IR and o,p 0-DDD in combination induced a similar G2 accumulation (30%) evaluated 24 h after treatment and the cells were not able to recover the IR-induced G2 block until as 120 h(P!0.05). No significant variation in cell cycle was observed in the cells treated with o,p 0-DDD alone.

LCerquetti

etal.:

Mito

tane/IR

effe

cts

oncancercells

ww

w.e

ndocrin

olo

gy-jo

urn

als

.org

628

Figure 5 (A) Whole cells lysates were tested for expression of the cyclin B1 protein in H295R cell line. Cells treated with the 6 Gyionizing radiations and in association with the o,p 0-DDD shared a protein increase at 24 h (lanes 2, 4 respectively) and at 48 and 72 hin combination treatment (lanes 8, 12). (B) Coimmunoprecipation and normalization of Cdc2–cyclin B1 complex tested at 24, 48 and72 h. (C) Densitometric histogram relative to Cdc2–cyclin B1 expression protein in coimmunoprecipitation experiment.


Cyclin B1 increased level after IR and o,p 0-DDD

combined treatment in H295R cells

H295R cells showing the highest inhibition of cell

proliferation after IR/o,p0-DDD in combination were

chosen in order to study the molecular mechanism

involving the G2 irreversible arrest. Therefore, we

analysed the expression of cyclin B1 in these cells.

Western blot analysis of cyclin B1 was performed 24, 48

and 72 h after treatment. Cyclin B1 level increased

significantly after IR and o,p 0-DDD in combination

compared with control cells, with a further increase of

1.5-fold after 24 h and 6.0-fold after 72 h of treatment. It

was consistent with a marked G2-phase accumulation

(66%). When 6 Gy IR was given to cells, a similar

cyclin B1 increase of about 2.5-fold was observed after

24 h (Fig. 5A).

However, the cyclin B1 levels was decreased by

about 1.5-fold at 72 h (Fig. 5A), and this reduction was

associated with a marked G2 depletion (23%; Table 1).

Cdk1–cyclin B1 kinase activity in H295R cells

Since recent reports indicate that cells arrested in G2 can

contain high levels of cyclin B1–Cdk1 associated kinase

activity (Jin et al. 1996, Minemoto et al. 2003), we

evaluated kinase activity by ELISA assay in H295R

cells. First, we verified the formation of immunocom-

plex between cyclin B1 and Cdc2 proteins and found

that cyclin B1 was able to bind Cdc2 protein as shown in


Fig. 5B. A persistent increase of Cdk1-associated kinase

activity (40% after 72 h) in combination treatment

compared with control cells was detected after 24, 48

and 72 h according to Jin et al. (1996).

These results suggest that mitosis did not occur

despite the apparent presence of abundant Cdk1 activity

(Fig. 6). To confirm these data, we tested the

localization of cyclin B1 in cellular compartments.

As shown in Fig. 7, there was a 1.5-fold cytoplasmic

accumulation after 72 h of cyclin B1 protein only in

cells treated with 6 Gy IR and o,p0-DDD in com-

bination. These results demonstrated that the G2 block

may be attributable to delayed progression of M phase

with high Cdk1 activity, due to accumulation of the

cyclin B1 protein preventing G2/M transition.

Role of the p53 on the G2/M transition in

H295R cells

Since recently the role of p53 in G2 arrest has been

reported (Jin et al. 1996, Minemoto et al. 2003), we

characterized genomic sequence of p53 gene by direct

sequencing of PCR-amplified products in H295R cells.

As shown in Fig. 8A, electropherogram performed on

forward and reverse sense revealed a homozygous

deletion of exons 8–9 of the p53 gene. This region

includes carboxyl terminus of p53 protein, one of the

hallmarks ofwild-typep53 for recognition andbindingof

damaged DNA (Reed et al. 1995, Zotchev et al. 2000).

629

Figure 6 Kinase activity Cdc2–cyclin B1 dependent in H295Rcell line. The highest kinase activity (45% compared withcontrol) was detectable at 72 h in cells treated with the ionizingradiation and o,p 0-DDD in combination. The o,p 0-DDD treatmentand the IR alone did not influence significantly the activity of thecomplex cyclin B1–Cdc2 in these cells.

Figure 7 (A) Cyclin B1 nuclear and cytosolic localization wasanalysed by western blotting in H295R cells. Cytosolic andnuclear marker used to control the purity of enriched fractionswas represented by b-actin and phospho-histone H1 respec-tively. (B) Densitometric histogram relative to cyclin B1expression protein in cytoplasm (upper panel) and nucleus(lower panel). Computer-assisted densitometric analysisshowed a 1.5-fold cytoplasmic accumulation of cyclin B1 at 72 honly in cells treated with 6 Gy and o,p 0-DDD in combination(lower panel).


In order to confirm the sequencing analysis data, a

western blot experiment was performed. Extracts from

whole untreated cells were tested using an antibody

raised against amino acidsmapping at C-terminus of p53

protein and an antibody against N-terminus of the

protein. h-Panc, a cell line carrying a p53 point mutation,

was used as positive control (Butz et al. 2003). The

presence of domain at N-terminus of p53 protein was

detected in both cell lines (Fig. 8B). The p53 carboxy

terminus expression was found in h-Panc cells, whereas

no specific signal was detected in H295R cells (Fig. 8C).

Absence of signal in H295R cell line may explain large

deletion occurring in these cells.

Finally, in order to directly address the role of p53 in

the G2 arrest induced by IR/o,p0-DDD in combination,

we sought to determine the effects of these treatments in

the H295R adrenocortical cell line wild-type p53

restored. The p53 expression vector was transiently

cotransfected with the green fluorescent protein (GFP)-

spectrin expression plasmid inH295R cells and theDNA

content profile of transfected cells was analysed by two-

colour flow cytometry (Fig. 9). Gating out GFP-positive

cells and analysing the cell cycle distribution of this

population 72 h after 6 Gy IR and o,p 0-DDD treatment

used alone or in combination, we showed a similar G2

arrest (60%; Fig. 9, l) compared with the H295R p53

mutant cells (66%; Table 1) strongly suggesting that this

mechanism is not mediated by p53 pathway.

Discussion

In this study, we evaluated different treatments on two

types of adrenocortical cancer cell lines derived from

humanACC in order to determine which one was able to

induce an antineoplastic effect. We used IR at dose 6 Gy

and o,p0-DDD at concentration of 10 mM alone or in

combination. There is evidence supporting that radiation

630

therapy is effective in the treatment of solid tumours, such

as breast, prostate and ovarian cancers (Morton &

Thomas 1994, Einhorn et al. 1999, Van der Steene

et al. 2000). Moreover, in many types of cancer, it has

been observed that adjuvant radiotherapy is associated

with a long-term survival (De Crevoisier et al. 2004,

Ragaz et al. 2005). All eukaryotic cells show cell cycle

delay after the exposure to DNA-damaging agents

(Concin et al. 2003, Marekova et al. 2003, Shimamura


Figure 8 Electropherogram of the p53 cDNA of the untreated H295R cells. Aliquots of the PCR-purified template DNA weresequenced by transcriptional sequencing. As shown, the deletion of exons 8 and 9 was detected (A) Western blot analysis of p53protein derived from untreated cells H295R and h-Panc used as control for protein expression. Different antibodies were used todetect the protein in both cells lines: the p-53 N-terminal protein was detected in both cell lines (B) and p-53 C-terminal was detectedonly for the cell line h-Panc. It was absent in the H295R cell line (C).


et al. 2005). IR antiproliferative effects were studied in

some cell lines. In fact, ovary and breast carcinoma cells

and pituitary adenoma human cell lines have been

described to respond to DNA damaging through cell

cycle arrest inducing DNA repair pathways, or apoptotic

process by activating effectors molecules of death (Kao

et al. 2001, Iliakis et al. 2003, Nome et al. 2005).

Nevertheless, few data are available concerning radio-

therapy inACC.Someof themare representedbyclinical

reports indicating that radiotherapy is of great benefit to

Figure 9Cotransfection analysis of the wild-type p53 expression vecplasmid in H295R cells. The transfected cells were exposed to singanalysis of positive cells after 6 Gy IR and o,p 0-DDD treatments influorescence intensity; FL2-H, red height fluorescence intensity.


ACC. In a recent paper, Allolio & Fassnacht (2006)

affirm that radiotherapy might play a role as adjuvant

therapy after surgery in patients with high risk of local

recurrence. Actually, o,p0-DDD represents the main

adrenolytic compound employed in the treatment of

patients affected by ACC (Hahner & Fassnacht 2005). It

is administered especially in order to reduce symptoms

and clinical signs due to steroid excess. Unfortunately, its

use is limited because of its toxicity and biochemical side

effects on patients (Schteingart et al. 1993).

tor with the green fluorescent protein (GFP)-spectrin expressionle IR dose (6 Gy) and o,p 0-DDD alone and in combination. Thecombination showed a G2 arrest. FL1-H, green height

631


In view of these data, we examined the different

antineoplastic effects on adrenocortical cancer cells

using IR and o,p0-DDD alone or in combination. In this

report, o,p 0-DDD compound did not significantly

influence cell growth and no perturbation of cell cycle

was detected by FACS analysis in both cell lines.

Moreover, in H295R adrenocortical functional cells,

o,p0-DDD was able to inhibit cortisol secretion at a

concentration of 10 mM (Fig. 4), as reported by several

authors (Trainer &Besser 1994, Beauregard et al. 2002).

The 6 Gy IR determined, in both cellular models, a

significant growth inhibition in treated cells with respect

to control (P!0.01). This inhibitory effect was partially

lost during the following hours decreasing to 13% in

H295R cells and to 20% in SW13 cells after 120 h.

Nevertheless, when IR and o,p0-DDD were used in

combination in both adrenocortical cancer cells, a lasting

growth arrest of 70% at 120 h after treatment occurred in

H295R and 55% at 120 h after treatment in SW13 cells.

Thesedata for thefirst time support the effectiveness of

radiotherapy on growth inhibition in adrenocortical

cancer cells and strongly suggest the adjuvant role of

mitotane in inducing a persistent cell cycleG2 block. The

mechanism of action of mitotane drug in this combina-

tory effect is still unclear. It appears adrenocortical

cancer cells specific. Indeed, the effects demonstrated on

H295R and SW13 cell lines are completely discordant

with those observed in Hs792(C).M control cells.

Moreover, it seems not to be cortisol related. In fact,

the replacement of hydrocortisone inH295Rcells culture

medium did not exert a significant modification in cell

proliferation. These data suggest that this drug inhibits

the steroidogenic process in synthesizing adrenocortical

cancer cell (H295R) and induces an irreversible G2 arrest

in radiotherapy-combined treatment in both functional

(H295R) and non-functional (SW13) adrenocortical

cancer models. Several hypotheses could explain the

persistent cell arrest atG2/M transition. The presence of a

mechanism that is able to prevent the degradation of

cyclin B1, involving an increase of Cdk1–cyclin B1

stability complex, cannot to be excluded. Another

possibility is the presence of a different cell cycle

checkpoint mechanism that might control mitotic

entry/exit. Finally, M-phase delay may be due to the

inhibition of the ubiquitin–proteasome pathway

mechanism for protein turnover and cell cycle control

(Ciechanover 1994, Sudakin et al. 1995, Hochstrasser

1996, Varshavsky 1997). The G2-phase accumulation

after 6 Gy IR and o,p0-DDD in combination, observed in

H295R cell line, was characterized by overexpression of

cyclin B1. It was associated with high Cdk1 kinase

activity according to Jin et al. (1996) who showed a

632

significant G2 delay associated with high Cdk1-associ-

ated kinase activity. Moreover, the cytoplasmic cyclin

B1 increase occurred only after the treatmentwith IR and

o,p0-DDD in combination. These data are in good

agreement with the report by Smeets et al. (1994). It

suggests a higher cytoplasmic amount of cyclin B1 in

cells arrested in G2 by DNA damage.

Minemoto et al. (2003) reported an overexpression of

cyclin B1 and high kinase activity in the lung

adenocarcinoma cells subjected to genotoxic stress.

This can be correlated to a ‘p53-dependent mechanism’,

as p53 protein is up-regulated by genome stress and

maintains genomic stability through the induction of cell

cycle arrest. Furthermore, just as cyclinB1 andCdk1, p53

negatively regulates the activity of genes that control the

onsetofmitosis (Krause etal. 2000,Dan&Yamori 2001).

Cells with normal p53 levels arrest in G1 and G2, whereas

cells that have lost p53 activity as a result of mutation

arrest exclusively in G2 (Di Leonardo et al. 1994).

H295R cells showed a whole deletion of exons 8 and 9,

localized in the proximity of the carboxy-terminal region,

which includes nuclear export signal (NES), Oligo

(tetramerization domain that includes a NES) and nuclear

localization signal of p53 protein. Loss of these regions

confers functional inactivity to theprotein (Reed et al. 1995,

Zotchev et al. 2000). In this cell line, G2 arrest, induced by

IRando,p0-DDD, is notmediated by p53pathway since the

G2 block persists when restoring wild-type p53.

In summary, these results show that IR and o,p0-DDD

in combination inhibit cell growth and induce an

irreversible block of the cell cycle in G2 phase in

functional (H295R) and in non-functional (SW13)

adrenocortical cancer cells. This block is supported by a

characteristic perturbation of G2-checkpoint mechanism,

involving Cdk1–cyclin B complex and Cdk1-increased

activity in H295R cell line with abolished p53 function.

These findings indicate that o,p0-DDD increases the

antitumoural effect of radiotherapy and suggest that IR

and o,p0-DDD in combination could be considered as a

promising therapeutic approach in the treatment forACC.

Acknowledgements

The authors declare that there is no conflict of interest that

would prejudice the impartiality of this scientific work.

References

Allolio B & Fassnacht M 2006 Clinical review: adrenocortical

carcinoma: clinical update. Journal of Clinical Endo-

crinology and Metabolism 91 2027–2037.



Beauregard C, Dickstein G & Lacroix A 2002 Classic and

recent etiologist of Cushing’s syndromes diagnosis and

therapy. Treatments in Endocrinology 1 79–94.

Bodie B, Novick AC, Pontes JE, Straffon RA, Montie JE,

Babiak T, Sheeler L & Schumacher P 1989 The Cleveland

clinic experience with adrenal cortical carcinoma.

Journal of Urology 141 257–260.

Butz J, Wickstrom E & Edwards J 2003 Characterization of

mutations and loss of heterozygosity of p53 and K-ras2 in

pancreatic cancer cell lines by immobilized polymerase

chain reaction. BMC Biotechnology 23 3–11.

Calabria AR, Weidenfeller C, Jones AR, de Vries HE &

Shusta EV 2006 Puromycin-purified rat brain microvas-

cular endothelial cell cultures exhibit improved barrier

properties in response to glucocorticoid induction.

Journal of Neurochemistry 97 922–933.

Ceraline J, Deplanque G, Duclos B, Limacher JM, Vincent F,

Goldblum S & Bergerat JP 1997 Relationship between p53

induction, cell cycle arrest and survival of normal human

fibroblasts following DNA damage. Bulletin du Cancer 84

1007–1016.

Ciechanover A 1994 The ubiquitin-proteasome proteolytic

pathway. Cell 79 13–21.

ConcinN,StimpflM,ZeillingerC,WolffU,Hefler L, Sedlak J,

Leodolter S & Zeillinger R 2003 Role of p53 in G2/M cell

cycle arrest and apoptosis in response to g radiation in

ovarian carcinoma cell lines. International Journal of

Oncology 22 51–57.

De Crevoisier R, Baudin E, Bachelot A, Laboulleux S,

Travagli JP, Caillou B & Schlumberger M 2004 Combined

treatment of anaplastic thyroid carcinoma with surgery,

chemotherapy, and hyperfractionated accelerated external

radiotherapy. International Journal of Radiation Oncology,

Biology, Physics 15 1137–1143.

Dan S & Yamori T 2001 Repression of cyclin B1 expression

after treatment with adriamycin, but not cisplatin in human

lung cancer A549 cells. Biochemical and Biophysical

Research Communications 26 861–867.

Einhorn N, Lundell M, Nilsson B, Ragnarsson-Olding B &

Sjovall K 1999 Is there place for radiotherapy in the

treatment of advanced ovarian cancer? Radiotherapy and


Hahner S & Fassnacht M 2005 Mitotane for adrenocortical

carcinoma treatment. Current Opinion in Investigational

Drugs 6 386–394.

Hochstrasser M 1996 Ubiquitin-dependent protein

degradation. Annual Review of Genetics 30 405–439.

Hollstein M, Sidransky D, Vogelstein B&Harris CC 1991 p53

mutations in human cancers. Science 253 49–53.

Hollstein M, Rice K, Greenblatt MS, Soussi T, Fuchs R,

Sorlie T, Hovig E, Smith-Sorensen B, Montesano R &

Harris CC 1994 Database of p53 gene somatic mutations

in human tumors and cell lines. Nucleic Acids Research 22

3551–3555.


Iliakis G, Wang YA, Guan J & Wang H 2003 DNA damage

checkpoint control in cells exposed to ionizing radiation.

Oncogene 22 5834–5847.

Jin P, Gu Y & Morgan DO 1996 Role of inhibitory CDC2

phosphorilation in radiation induced G2 arrest in human

cells. Journal of Cell Biology 134 963–970.

Kao GD, McKenna WG & Yen TJ 2001 Detection of repair

activity during the DNA damage, induced G2 arrest in

human cancer cells. Oncogene 27 3486–3496.

Kastan MB, Onyekwere O, Sidransky D, Vogelstein B &

Craig RW 1991 Participation of p53 protein in the cellular

response to DNA damage. Cancer Research 51

6304–6311.

Krause K, Wasner M, Reinhard W, Haugwitz U, Dohna CL,

Mossner J & Engeland K 2000 The tumour suppressor

protein p53 can suppress transcription of cyclin B. Nucleid

Acids Research 28 4410–4418.

Di Leonardo A, Linke SP, Clarkin K & Wahl GM 1994 DNA

damage triggers a prolonged p53-dependent G1 arrest and

long-term induction of CIP1 in normal human fibroblast.

Genes and Development 8 2540–2551.

Marekova M, Cap J, Vokurkova D, Vavrova J & Cerman J

2003 Effect of therapeutic doses of ionising radiation on the

somatomammotroph pituitary cell line, GH3. Endocrine

Journal 50 621–628.

MarkoeAM,SerberW,MicailyB&BradyLW1991Radiation

therapy for adjunctive treatment of adrenalcortical carci-

noma. American Journal of Clinical Oncology 14 170–174.

Minemoto Y, Uchida S, Ohtsubo M, Shimura M, Sasagawa T,

Hirata M, Nakagama H, Ishizaka Y & Yamashita K 2003

Loss of p53 induces M-phase retardation following G2

DNA damage checkpoint abrogation. Archives of Bio-

chemistry and Biophysics 412 13–19.

Morton G & Thomas GM 1994 Role of radiotherapy in the

treatment of the cancer of the ovary. Seminars in Surgical


Nader S, Hickey RC, Sellin RV & Samaan NA 1983 Adrenal

cortical carcinoma.A studyof77 cases.Cancer52707–711.

Nome RV, Bratland A, Harman G, Fodstad O, Anderson Y &

Ree AH 2005 Cell cycle checkpoint signalling involved in

histone deacytalse inhibition and radiation induced cell

death. Molecular Cancer Therapeutics 8 1231–1238.

Ohgaki H, Kleihues P & Heitz PU 1993 p53 mutations in

sporadic adrenocortical tumors. International Journal of

Cancer 54 408–410.

Percarpio B & Knowlton AH 1976 Radiation therapy of

adrenal cortical carcinoma. Acta Radiological: Therapy,

Physics, Biology 15 288–292.

Ragaz J, Olivotto IA, Spinelli JJ, Phillips N, Jackson SM,

WilsonKS, KnowlingMA, Coppin CM,Weir L, GelmonK

et al. 2005 Locoregional radiation therapy in patient with

high-risk breast cancer receiving adjuvant chemotherapy:

20-year results of the British Columbia randomized trial.

Journal of the National Cancer Institute 97 116 –126.

633


Reed M, Woelker B, Wang P, Wang Y, Anderson ME &

Tegtmeyer P 1995 The C-terminal domain of p53

recognizes DNA damaged by ionizing radiation. PNAS 92

9455–9459.

Reincke M, Karl M, Travis WH, Mastorakos G, Allolio B,

Linehan HM&Chrousos GP 1994 p53 mutations in human

adrenocortical neoplasm: immunohistochemical and mol-

ecular studies. Journal of Clinical Endocrinology and

Metabolism 78 790–794.

Schteingart DE 1992 Treating adrenal cancer. Endocrinologist

2 149–157.

Schteingart DE, Sinsheimer JE, Counsell RE, Abrams GD,

McClellan N, Djanegara T, Hines J, Ruangwises N,

Benitez R & Wotring LL 1993 Comparison of the

adrenalityc activity of mitotane and a methylated homolg

on normal adrenal cortex and adrenal cortical carcinoma.

Cancer Chemotherapy and Pharmacology 31 459–466.

ShimamuraH, SunamuraM,TsuchiharaK,EgawaS, TakedaK

& Matsuno S 2005 Irradiated pancreatic cancer cells

undergo both apoptosis and necrosis, and could be

phagocytized by dendritic cells. European Surgical

Research 37 228–234.

SmeetsMF,MoorenEH&BeggAC1994The effect of radiation

on G2 blocks, cyclin B expression and cdc2 expression in

human squamous carcinoma cell lines with different radio-

sensitivities. Radiotherapy and Oncology 33 217–227.

634

Van der Steene J, Soete G & Storme G 2000 Adjuvant

radiotherapy for breast cancer significantly improves

overall survival. Radiotherapy and Oncology 55

263–272.

Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca

FC, Ruderman JV & Hershko A 1995 The cyclosome a

large complex containing cyclin-selective ubiquitin

ligase activity, targets cyclins for destruction at the

end of mitosis. Molecular Biology of the Cell 6

185–197.

Trainer P & Besser M 1994 Cushing’s syndrome. Therapy

directed at the adrenal glands. Endocrinology and

Metabolism Clinics of North America 23 571–584.

Varshavsky A 1997 The ubiquitin system. Trends in

Biochemical Sciences 22 383–387.

Venkatesh S, Hickey RC, Sellin RV, Fernandez JF &

Samaan NA 1989 Adrenal cortical carcinoma. Cancer

64 765–769.

Yano T, LinechanM, Anglard P, LermanMI, Daniel LN, Stein

CA, Robertson CN, LaRocca R & Zbar B 1989 Genetic

changes in human adrenocortical carcinoma. Journal of the

National Cancer Institute 81 518–523.

Zotchev SB, Protopopova M & Selivanova G 2000 p53

C-terminal interaction with DNA ends and gaps has

opposing effect on specific DNA binding by the core.

Nucleic Acids Research 28 4005–4012.


Mitotane increases the radiotherapy inhibitory effect and induces G2-arrest in combined treatment on...

Documents

Transcript of Mitotane increases the radiotherapy inhibitory effect and induces G2-arrest in combined treatment on...