Phytochemistry 70 (2009) 1009–1016

Contents lists available at ScienceDirect

Phytochemistry

journal homepage: www.elsevier .com/locate /phytochem

Metabolite and target transcript analyses during Crocus sativus stigma development

Ángela Rubio Moraga a, José Luis Rambla b, Oussama Ahrazem a, Antonio Granell b, Lourdes Gómez-Gómez a,*

a Departamento de Ciencia y Tecnología Agroforestal y Genética, ETSIA, Universidad de Castilla-La Mancha, Campus Universitario s/n, 02071 Albacete, Spainb Instituto de Biología Molecular y Celular de Plantas, Consejo Superior de Investigaciones Científicas, Universidad Politécnica de Valencia, Camino de Vera s/n, 46022 Valencia, Spain

a r t i c l e i n f o

Article history:Received 19 December 2008Received in revised form 10 March 2009Available online 25 May 2009

Keywords:Crocus sativusIridaceaeSaffronStigmaVolatilesApocarotenoidsCrocetinTerpenoidsGene expression

0031-9422/$ - see front matter � 2009 Elsevier Ltd. Adoi:10.1016/j.phytochem.2009.04.022

* Corresponding author. Tel.: +34 967599200x2854E-mail address: marialourdes.gomez@uclm.es (L. G

a b s t r a c t

Saffron, the desiccated stigmas of Crocus sativus, is highly appreciated for its peculiar colour, flavour andaroma. Several studies have been conducted with the spice, but little is known about the evolution of vol-atile and non-volatile compounds generated during the development of the stigma. In this study, we havefollowed these compounds, with special attention to those of isoprenoid origin (carotenoids and mono-terpenes), which are responsible for the organoleptic properties of saffron. The main compounds thataccumulated throughout stigma development in C. sativus were crocetin, its glucoside derivatives andpicrocrocin, all of which increased as stigmas reached a fully developed stage. The volatile compositionof C. sativus stigmas changed notably as stigmas developed with each developmental stage being charac-terized by a different volatile combination. In red stigmas, b-cyclocitral, the 7,8 cleavage product of b-car-otene, was highly produced, suggesting the implication of both b-carotene and zeaxanthin in crocetinformation. As stigmas matured, hydroxy-b-ionone and b-ionone were produced while safranal, the mosttypical aroma compound of the processed spice, was only detected at low levels. However, a safranal-related compound 2,2,2-trimethyl-2-cyclohexene-1,4-dione (4-oxoisophorone) increased rapidly at theanthesis stage and also in senescent stigmas. Monoterpenes were mainly emitted at the time of anthesisand the emission patterns followed the expression patterns of two putative terpene synthases CsTS1 andCsTS2. Fatty acid derivates, which predominated at the earlier developmental stages, were observed atlow levels in later stages.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

Crocus sativus L. is an autumn-flowering geophyte extensivelygrown in the Mediterranean basin and Near East since the LateBronze Age (Negbi, 1999). Saffron, the dried red stigmas of C. sati-vus, has been used as a flavouring and colouring agent since thenand is currently considered the world’s most expensive spice. Saf-fron is made up of a complex mixture of volatile and non-volatilecompounds that contribute to its overall aroma and flavour (Taran-tilis and Polissiou, 1997). The major components of saffron are theapocarotenoids cis- and trans-crocins, picrocrocin (b-D-glucopy-ranoside of hydroxyl-b-cyclocitral), and its degradation product,the odour-active safranal (Kanakis et al., 2004) (Fig. 1A). However,recent studies reveal a different volatile composition in unpro-cessed stigma tissues (Rubio et al., 2008), suggesting that degrada-tion processes are responsible for the organoleptic properties ofsaffron from preformed apocarotenoid compounds (Dauria et al.,2006) as has also been observed in other spices (Mookherjeeet al., 1990). Apocarotenoids have been extensively studied dueto their high concentration in the stigma tissue and because of

ll rights reserved.

; fax: +34 967599238.ómez-Gómez).

their organoleptic properties (Pfander and Wittwer, 1975; Tarantil-is et al., 1995). It has been proposed that the biogenesis of the maincolour principles, crocins, and the odour active compound, safr-anal, is derived by bio-oxidative cleavage of zeaxanthin (Pfanderand Schurtenberger, 1982) by a 7,8(70,80) cleavage reaction. How-ever, the ability to synthesize crocetin is not restricted to C. sativusand other related species, but is also present in the flower extractof Buddleja (Liao et al., 1999), in Jacquinia angustifolia (Eugster et al.,1969), in Coleus forskolii (Tandon et al., 1979), in the fruits of Gar-denia (Pfister et al., 1996), and even in the cyanobacterium Micro-cystis which produces crocetin by cleavage of zeaxanthin andb-carotene at 7,8(70,80) positions (Jütner and Höflacher, 1985).

Studies concerning components in saffron stigma other thanthose mentioned above are scarce (Tarantilis et al., 1995; Straubin-ger et al., 1997, 1998; Carmona et al., 2007), or the compoundshave only been analysed with some detail in petals (Nørb�ket al., 2002). The majority of the studies performed with C. sativusconcentrate on the spice, and little is known about the synthesisand accumulation of these compounds during stigmadevelopment.

In the present study, we have used a combination of approachesto study the accumulation of colour and aroma compounds ofC. sativus during stigma development, and also to determinewhether this accumulation could be paralleled by changes in the

0102030405060708090

μmol

ar/fr

esh

wei

ght (

mg)

μmol

ar/fr

esh

wei

ght (

mg)

A

B

C

COOH

HOOC

CrocetinCHO

O

CHO

Glucosyl esters of crocetin, crocins:C5-R1= three Beta-D-glucosyl R2= Beta-D-gentiobiosylC4-R1= R2= Beta-D-gentiobiosylC3-R1= Beta-D-gentiobiosyl, R2= Beta-D-glucosylC2-R1= R2= Beta-D-glucosylC1-R1= Beta-D-glucosyl, R2= H

Picrocrocin

Safranal

Beta-D-Glucosyl

Beta-D-Gentiobiosyl

O

O

O

R1 R2O

0102030405060708090

crocetinpicrocrocincrocins

C5C4C3C2C1crocetinpicrocrocin

da yellow orange red -3da +2da

da yellow orange red -3da +2da

COOH

HOOC

CrocetinCHO

O

CHO

Glucosyl esters of crocetin, crocins:C5-R1= three Beta-D-glucosyl R2= Beta-D-gentiobiosylC4-R1= R2= Beta-D-gentiobiosylC3-R1= Beta-D-gentiobiosyl, R2= Beta-D-glucosylC2-R1= R2= Beta-D-glucosylC1-R1= Beta-D-glucosyl, R2= H

Picrocrocin

Safranal

Beta-D-Glucosyl

Beta-D-Gentiobiosyl

O

O

O

R1 R2O

COOH

HOOC

CrocetinCHO

O

CHO

Glucosyl esters of crocetin, crocins:C5-R1= three Beta-D-glucosyl R2= Beta-D-gentiobiosylC4-R1= R2= Beta-D-gentiobiosylC3-R1= Beta-D-gentiobiosyl, R2= Beta-D-glucosylC2-R1= R2= Beta-D-glucosylC1-R1= Beta-D-glucosyl, R2= H

Picrocrocin

Safranal

Beta-D-Glucosyl

Beta-D-Gentiobiosyl

O

O

O

R1 R2O

crocetinpicrocrocincrocins

C5C4C3C2C1crocetinpicrocrocin

C5C4C3C2C1crocetinpicrocrocin

Stage of stigma development

Stage of stigma development

Fig. 1. Structures of C. sativus apocarotenoids and their evolution during stigmadevelopment. (A) Structures of the main non volatile apocarotenoid componentsdetected in C. sativus stigma tissue. (B) Levels of each apocarotenoid compound,crocin C5, C4, C3, C2, C1, crocetin and picrocrocin during stigma development. (C)Levels of crocetin, picrocrocin and total crocins (C1–C5) during stigma develop-ment. Yellow (y), orange (o), red (r), three days before anthesis (�3da), day ofanthesis (da), and two days after anthesis (+2da).

1010 Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016

level of expression of candidate genes of the metabolic pathwaysinvolved.

2. Results and discussion

2.1. Analysis of apocarotenoids during stigma development of Crocussativus

Reports describing the contents of apocarotenoids in C. sativusare restricted to dry and processed material and the informationon fresh stigmas is scarce. The pattern of accumulation of the apoc-arotenoid crocetin, picrocrocin and the different crocins in devel-oping saffron stigmas was investigated by extracting stigmascorresponding to six different developmental stages as previouslydescribed (Castillo et al., 2005), and analysing the extracts by re-verse-phase HPLC. Young yellow stigmas contained very low levels

of crocetin, crocins, and picrocrocin (Fig. 1B and C), and mainly re-vealed unidentified compounds with maximum wavelengthsaround 250 nm that reached the highest levels in the orange stage(data not shown). The apocarotenoid picrocrocin and crocins weredetected early in the orange stage and increased rapidly during thefollowing stages of stigma development (Fig. 1B and C). The highestlevel of crocetin was detected in the red stage (Fig. 1C), in additionto crocins C1 (crocetin b-D-glucosyl ester) and C2 (crocetin b-D-gentibiosyl ester or di-(Beta-D-glucosyl) ester) (Fig. 1B). However,in the scarlet stages (�3da to +2da), the crocins with the major glu-cosylation level, C3 (crocetin b-D-gentibiosyl-b-D-glucosyl ester),C4 (crocetin di-(b-D-gentibiosyl) ester) and C5 (crocetin three-(b-D-glucosyl)-b-D-gentibiosyl) ester) reached the highest levels(Fig. 1B). The accumulation of crocins of higher glucose contentagrees with the expression patterns observed for UGTCs2, a gluco-syltransferase enzyme involved in crocin and crocetin glucosyla-tion in C. sativus stigmas (Rubio et al., 2004). The levels ofpicrocrocin began increasing during the orange stage and reachedthe highest levels at anthesis (Fig. 1B and C), the stage of flowerdevelopment when stigmas are collected for saffron preparationand which is characterized by high levels of the volatile safranal(Carmona et al., 2007).

2.2. Volatile analysis of stigmas in different developmental stages

Among the estimated 150 volatile compounds of saffron,approximately 40–50 constituents have been identified (Winter-halter and Straubinger, 2000). Many of these volatiles are not re-garded as original volatiles of C. sativus stigmas, but formedduring saffron processing from degradation of volatile and non-volatile precursor compounds. In contrast, the flavour compoundsin fresh stigma tissue have not yet been extensively analysed, andnothing is known about the volatiles emitted during stigma devel-opment. Volatiles were already emitted from stigmas at the mostimmature stage (Supplemental Table S1), and the production ofvolatiles increased throughout development, reaching the highestlevels when flowers were fully open (Fig. 2A). Generally, flowerbuds do not have a scent and the characteristic fragrance of a flow-er appears during anthesis (Matile and Altenburger, 1998), thussuggesting that the final biosynthetic reactions are developmen-tally regulated and only occur as the flowers begin to open. Theproduction of these volatiles is related with their possible functionin attracting and guiding pollinators, or in protecting these valu-able reproductive parts of the plant from their enemies (Schwabet al., 2008).

Plants need to, and often do, vary the floral scent they emit dur-ing the life span of the flower, both in total output and in specificcomposition. These changes occur in relation to flower age (Picher-sky et al., 1994; Wang et al., 1997; Dudareva et al., 1998, 2000) andpollination status (Tollsten, 1993; Negre et al., 2003; Theis and Ra-guso, 2005). In C. sativus, different and characteristic profiles of vol-atile compounds were obtained for each developmental stage,(Supplemental Table S1, and Fig. S1, Fig. 2B, C, and D). In the yellowstage, low levels of volatiles were produced and the fatty acidderivatives predominated (Fig. 2B). In the orange stage, carotenoidderivatives were detected in addition to the fatty acid derivatives(Fig. 2B and C). In the red stage, the volatiles derived from carote-noids accumulated to high levels, and b-cyclocitral, generated bythe cleavage of b-carotene at the 7,8 (70,80) positions, reached itsmaximum levels (Fig. 2C), suggesting that b-carotene contributesin this stage to the pool of crocin and crocetin. At the scarlet stage,right before anthesis, the volatile propanoic acid, 2-methyl-2,2-di-methyl-1-(2-hydroxy-1-methylethyl) propyl ester accumulated athigh levels, but their levels decreased at anthesis, when monoter-penes and carotenoids reached their maximum levels (Fig. 2B, C,and D). Carotenoid-derived aromas are also present at high levels

A

B

C

D

y o r -3da da +2da

y o r -3da da +2da

y o r -3da da +2da

0

10

20

30

40

50

60 methyltetradecanoatepropanoic acid*tetradecanalheptane*unknown 17C11H24

90

0

10

20

30

40

50

60

70

806-methyl-5-hepten-2-onesafranalβ-cyclocitraldihydro-β-iononegeranylacetoneβ-ionone4-oxoisophoroneunknown 8acetophenonemegastigma-4,6,8-triene

0

20

40

60

80

100

120α-pinenelimonenelinaloolunknown 13

Rel

ativ

e ab

unda

nce/

fresh

wei

gth

(mg)

/stig

ma

(x10

6 )

050

100150200250300350400450500

yellow orange red -3da da +2daStage of stigma development

methyltetradecanoatepropanoic acid*tetradecanalheptane*unknown 17C11H24

methyltetradecanoatepropanoic acid*tetradecanalheptane*unknown 17C11H24

0

10

20

30

40

50

60

70

806-methyl-5-hepten-2-onesafranalβ-cyclocitraldihydro-β-iononegeranylacetoneβ-ionone4-oxoisophoroneunknown 8acetophenonemegastigma-4,6,8-triene

6-methyl-5-hepten-2-onesafranalβ-cyclocitraldihydro-β-iononegeranylacetoneβ-ionone4-oxoisophoroneunknown 8acetophenonemegastigma-4,6,8-triene

α-pinenelimonenelinaloolunknown 13

α-pinenelimonenelinaloolunknown 13

Rel

ativ

e ab

unda

nce/

fresh

wei

gth

(mg)

/stig

ma

(x10

6 )R

elat

ive

abun

danc

e/fre

shw

eigt

h (m

g)/s

tigm

a (x

106 )

Rel

ativ

e ab

unda

nce/

fresh

wei

gth

(mg)

/stig

ma

(x10

6 )

Fig. 2. Volatiles emitted by C. sativus stigmas at six different developmental stagesand the corresponding biochemical groups. (A) Total volatiles. (B) Fatty acidderivatives. (C) Carotenoid derivatives. (D) Terpenoids. The values of relativeabundance for each compound shown in diagrams B, C, and D can be found in Table1. Yellow (y), orange (o), red (r), three days before anthesis (�3da), day of anthesis(da), and two days after anthesis (+2da). Propanoic acid* refers to propanoic acid, 2-methyl-2,2-dimethyl-1-(2-hydroxy-1-methylethyl) propyl ester, and heptane* toheptane-2,2,4,6,6-pentamethyl.

Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016 1011

in Osmanthus fragrans, which by far shows the highest diversity ofcarotenoid-derived constituents (Kaiser and Lamparsky, 1980); inBoronia megastigma, which is especially rich in ß-ionone that dom-inates volatiles emitted from the stigma (87%) (McTavish et al.,2000); and in some orchids, among others (Kaiser, 2002). Thecarotenoid derivatives hydroxy-b-ionone and b-ionone were pro-duced throughout the development of the stigmas and the safr-anal-related compound 2,2,2-trimethyl-2-cyclohexene-1,4-dione(4-oxoisophorone) increased rapidly reaching its maximum levelsat the anthesis and senescent stages. Interestingly, safranal wasnot among the main volatiles generated in the fresh tissue wherehigh levels of picrocrocin were observed. In contrast, safranal hasbeen considered as the major aroma component in saffron, com-prising as much as 60 to 70% of the essential oil content (Alonsoet al., 1995; Tarantilis and Polissiou, 1997), suggesting that thiscompound is most probably generated by picrocrocin degradationduring the dehydration process of the stigma (Raina et al., 1996).Among the monoterpenes, linalool was emitted at high levels atanthesis, and is commonly described as responsible for fresh andfloral odours (Dobson, 1993; Knudsen et al., 1993). The develop-mentally regulated emission of monoterpenes have also been re-ported in Anthirrinum majus and Clarkia breweri, whose floralscents are rich in monoterpenes (Pichersky et al., 1994; Dudarevaet al., 2003). In addition, C. breweri linalool synthase activity instigmas was first detected in late buds, with activity levels peakingduring the first 2 days after the flower opens (Pichersky et al., 1994).

Terpenoids can be considered as markers of anthesis in C. sati-vus (Fig. 2D). In the postanthesis stage, the fatty acid derived vola-tiles became the main volatile compounds (Fig. 2B) together withthe degradation product 4-oxoisophorone, suggesting that prod-ucts of senescence may differ from those actively produced in ma-ture stigmas, which would help to make the flowers less attractivefor pollinators. This reduced attractiveness is hypothesized toguide pollinators to the unpollinated and mature flowers, and thusincrease the reproductive success of the plant (Negre et al., 2003;Theis and Raguso, 2005).

2.3. In silico search of C. sativus cDNAs encoding candidate enzymesfor volatile biosynthesis

In C. sativus volatile compounds are generally derived fromthree main classes of secondary metabolites. Mono- and sesquiter-penes are derived from the isoprenoid biosynthesis pathway. Phe-nylpropanoids and benzenoid fragrances are derived from theshikimic acid aromatic amino acid biosynthesis pathway, and thethird class of aroma compounds are derived from the enzymaticconversion of acyl lipids through b-oxidation and oxylipin/lipoxy-genase pathways to form short branched-chain aldehydes, alco-hols, esters and ketones (Dudareva et al., 2004). In addition,many volatile compounds are produced through the shorteningof a carbon skeleton often followed by further modifications, orsimply by modification of the existing carbon skeleton. The major-ity of these modifications involve the reduction or removal of car-boxyl groups, the addition of hydroxyl groups, and the formation ofesters and ethers. These modifications involve the participation ofcytochrome P450 enzymes, dehydrogenases, methylases and acy-lases (Pichersky et al., 2006). We employed in silico screening ofa large stigma cDNA EST database (http://www.saffrongenes.org/)(D’Agostino et al., 2007) as the method for identification of candi-date genes encoding enzymes involved in volatile biosynthesis in C.sativus. Plant genome and large EST databases have proven a veryuseful resource for the mining of genes of secondary metabolism(Gang et al., 2001; Aubourg et al., 2002; Dudareva et al., 2003;Hsiao et al., 2006). For this screening we used 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) (Enjuto et al., 1994),

Table 1In silico analysis of enzymes involved in volatile biosynthesis. Identified ESTs and primers used.

Enzyme GeneBank Accession nos. Best known mach Mach Primers

TS1 EX148009.1 Q8L5K3 limonene synthase (Citrus limon) 6.0E-55 F:50ATCAAGGTGGTGGAGCAATC30

R:50AATTGCTTCTGCATCCCATC30

CtP450 EX143831.1 AAL38987 cytochrome P450-1 (Musa acuminata). 4.0E-112 F:50ATCAGGATAGAGGCGCAGAA30

R:50TCGTTTTGGGTGGTATGTCA30

TS2 EX143259.1 ABR24417 nerolidol/linalool synthase 1 (Antirrhinum majus). 3.0E-78 F:50AGGAAGTGTTCCCATTGCTG30

R:50GGCACGAGGCAAGAACTAAG30

HMGR CAC95134 AAC15476 3-hydroxy-3-methylglutaryl coenzyme A reductase (Tagetes erecta) 3.0E-14 F:50GATATGTAGATCTTTGCCATC30

R:50CTGACATGGAAGTCATTAGCA30

SAMT EX143774.1 CAI05934 SAM dependent carboxyl methyltransferase (Hoya carnosa) 5.0E-37 F:50CTCTTCGGGTCCAAACACAT30

R:50ACATACGGCACAACCTCCTC30

DXS EX147054.1 AAS99588 1-deoxylulose-5-phosphate synthase (Elaeis guineensis) 3.0E-85 F:50AGAGAGGTGGAAAGCACGAA30

R:50CGGCGAAGGAAGTAGTTGAG30

ADH2 EX146969.1 AAO74898 alcohol dehydrogenase 2 (Petunia x hybrida). 5.0E-27 F:50TTGGGAACTTGAAGCCTAGC30

R:50CTTCACCTCCAGGCATCACT30

HMGR

DXS

TS2

TS1

CsPSY

CsPDS

ADH2

SAMT

P450

RPS18

y o r -3da da +2daA

MVA MEPAcetyl-CoA Pyruvate +GA-3P

HMG-CoA 1-Deoxy-D-xylulose 5-P

Mevalonate 2-C-methyl-D-erythritol 4-P

DMAPP IPP IPP DMAPP

CYTOSOL PLASTID

DXS

DXRHMGR

GGPPPSY

PhytoenePDS

ζ-Carotene

Carotenoids

Apocarotenoids

HMGR

DXS

TS2

TS1

CsPSY

CsPDS

ADH2

SAMT

P450

RPS18

Acetyl-CoA Pyruvate +GA-3P

HMG-CoA 1-Deoxy-D-xylulose 5-P

Mevalonate 2-C-methyl-D-erythritol 4-P

DMAPP IPP IPP DMAPP

CYTOSOL PLASTID

DXS

DXRHMGR

B

GGPPPSY

PhytoenePDS

ζ-Carotene

Carotenoids

Apocarotenoids

Fig. 3. Location and expression of the selected candidate genes and products in the isoprenoid pathway. (A) Mevalonic acid (MVA) pathway is localized in the cytosol andendoplasmic reticulum to supply IPP for the synthesis of cytosolic and mitochondrial isoprenoids. The 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway is localized inplastids. In all three compartments, IPP (C5) is utilized by prenyltransferases to produce a variety of linear allylic prenyl diphosphates of increasing size. Geranylgeranyldiphosphate (C20) is a key intermediate for the synthesis of the wide range of end products derived from the isoprenoid pathway. Apocarotenoids are generated by theoxidative cleavage of carotenoids by cytosolic and plastid localized carotenoid cleavage dioxygenases. (B) Expression analysis of selected genes involved in volatilemetabolism during stigma development by RT-PCR. Equal amounts of total RNA were used in each reaction. The levels of constitutively expressed ribosomal protein S18,RPS18, coding gene were assayed as controls. The PCR products were separated by 2% (w/v) agarose gel electrophoresis and visualized by ethidium bromide staining.

1012 Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016

1-deoxy-D-xylulose-5-phosphate synthase (DXS) (Muñoz-Bertomeuet al., 2006), terpene synthase nucleotide and amino sequences(Bohlmann et al., 1998; Aubourg et al., 2002), S-adenosyl-l-methi-onine-dependent methyltransferases (Effmert et al., 2005), alcoholdehydrogenase (ADH) (Speirs et al., 1998; Prestage et al., 1999),cytochrome P450 and acyl transferase enzymes (Dudareva et al.,2004), and candidates for all of them were obtained (Table 1). Oligoprimers were designed and used with cDNA preparations fromstigmas at six stages of development, for PCR amplification.

In higher plants, the five-carbon building blocks of all terpe-noids, isopentenyl diphosphate (IPP) and dimethylallyl diphos-phate, are derived from two independent pathways localized indifferent cellular compartments (Fig. 3A). The methylerythritolphosphate (MEP or nonmevalonate) pathway, localized in the plas-

tids, and the cytosol-localized mevalonate pathway (MVA). TheMEP pathway furnishes the monoterpene-, diterpene- and carote-noids (Lichtenthaler et al., 1997; Rohmer, 1999), and in snapdragonflowers supports both monoterpene and sesquiterpene formation(Dudareva et al., 2005). During the development of C. sativus stig-mas, the 1-deoxylulose-5-phosphate synthase, DXS, the first en-zyme specific to the MEP pathway (Fig. 3A) is highly expressedin all developmental stages (Fig. 3B), whereas the 3-hydroxy-3-methylglutaryl CoA reductase, HMGR, the enzyme that catalysedthe third step of the MVA pathway (Fig. 3A), is expressed at lowlevels (Fig. 3B). These results prove that DXS plays an importantrole in the control of isoprenoid biosynthesis in the stigma tissue,characterized by high levels of carotenoid derivatives (Castilloet al., 2005).

Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016 1013

The first committed step in the formation of monoterpenes isthe transformation of the prenyl diphosphate precursor, geranyldiphosphate, by monoterpene synthases. Two putative terpenesynthase clones were identified in the EST collection, and eachshowed a different expression pattern during stigma development(Fig. 3B). The TS1 transcript was detected in all developmentalstages, and slightly increased as the stigma developed and re-mained high during the latest stages (�3da to +2da). The expres-sion pattern observed for TS1 followed the evolution of limoneneand a-pinene levels during stigma development (Fig. 2D). Perhapsthe coding enzyme could be involved in the formation of either oneof the two compounds (Lücker et al., 2002). The transcript level ofTS2, which showed high similarity to the nerolidol/linalool syn-thase 1 from Antirrhinum majus (Table 1), was undetectable duringthe earlier stages of stigma development, reaching a peak at pre-anthesis and anthesis, and then decreasing in the final stage(+2da) (Fig. 3B). This expression pattern parallels the increase ofthe unidentified terpenoid, compound 13, and linalool during stig-ma development (Supplemental Table S1 and Fig. 2D). Linalool isproduced in a one-step reaction from geranyl pyrophosphate(GPP), a ubiquitous intermediate in the biosynthesis of a varietyof terpenoids, in a reaction catalyzed by the monomeric enzymeS-linalool synthase (Pichersky et al., 1995).

Several important volatiles were believed to derive fromcarotenoids, the apocarotenoid volatiles, by the action of caroten-oid cleavage enzymes (CCDs) (Winterhalter and Rouseff, 2002).The first definitive link between apocarotenoid volatiles and CCDswas the identification of the Arabidopsis CCD1 (Schwartz et al.,2001). AtCCD1 loss-of-function mutants have increased caroten-oid content in their mature seeds, indicating a role for CCD1 incarotenoid catabolism (Auldridge et al., 2006). Recent studies inC. sativus have shown that the carotenoid cleavage dioxygenases,CsCCD1a/b and CsCCD4a/b, can cleave b-carotene at the9,10(90,100), positions generating ß-ionone and the expression lev-els of CsCCD4a/b parallel the emission of ß-ionone (Rubio et al.,2008). These enzymes can be responsible as well for the genera-tion of 6-methyl-5-hepten-2-one (MHO), geranylacetone andpseudoionone. However, in addition to these apocarotenoids, b-cyclocitral and 4-oxoisophorone have also been detected amongthe volatiles emitted by the stigmas. The production of all thesevolatiles derived from carotenoids by 7,8(70,80) cleavage suggestsan active participation of 7,8(70,80) CCDs enzymes in the earlyand late stages of stigma development. In addition, these en-zymes are also responsible for the formation of crocetin andpicrocrocin. While four different CCDs genes have been identifiedin C. sativus showing 9,10(90,100) activity, no 7,8(70,80) CCDs in C.sativus have been identified so far (Rubio et al., 2008).. Due tothe presence of all these apocarotenoid compounds during stigmadevelopment, we analysed the transcript levels of key biosyn-thetic enzymes of the carotenoid pathway, the phytoene synthase(CsPSY) and phytoene desaturase gene (CsPDS) (Fig. 3A). Bothtranscripts were detected in all the developmental stages, buttheir levels increased at the red stage and remained high duringthe next stage (Fig. 3B). High levels of crocetin, crocins and picro-crocin were detected in the red stage, and the levels of crocinsand picrocrocin remained high in the following stages (Fig. 1C).In the case of apocarotenoid volatiles, three peaks of emissionwere observed (Supplemental Table S1 and Fig. 2C): b-cyclocitralemission peaked in the red stage, b-ionone and dihydro-b-iononedid so at anthesis, and 4-oxoisophorone and acetophenone in thepostanthesis stage. Although carotenoid accumulation and com-position during stigma development of C. sativus is highly regu-lated by the coordinated transcriptional activation of carotenoidbiosynthetic genes (Castillo et al., 2005), the expression levels ob-served did not parallel the accumulation of the apocarotenoidcompounds, suggesting that the formation of these compounds

is controlled at a different level, such as carotenoid cleavage diox-ygenase expression (Rubio et al., 2008).

Deshydrogenase enzymes have been implicated in the intercon-version of volatile alcohols and aldehydes. The ADH2 tomato en-zyme has been implicated in the interconversion of the aldehydeand alcohol forms of flavour volatiles (Speirs et al., 1998; Prestageet al., 1999). We have analysed here the expression patterns ofCsADH2, which showed high expression levels during stigma devel-opment (Fig. 3B). However, we could not find a correlation be-tween CsADH2 transcript levels and the production of aldehydes(Supplemental Table S1 and Fig. 3B). This could be due to theinvolvement of this gene in other metabolic processes (Conleyet al., 1999) or to the participation of additional ADHs. It has alsobeen proposed that precursors of floral scent, in particular alde-hydes and alcohols, are formed in leaves and transported throughthe phloem to flowers (Ackemann et al., 1989) which could be thecase for the fatty acid derivates emitted by C. sativus stigmas, andgenerated by leaf lipoxygenases and ADH enzymes.

Cytochrome P450 can act as a hydroperoxide lyase andcatalyze the cleavage of lipoxygenase products (fatty acid hydro-peroxides), forming omega-oxoacids and volatile C6- and C9-alde-hydes and alcohols (Noordermeer et al., 2001). The expressionlevels of a cytochrome P450 with similarity to cytochromes in-volved in fruit senescence (Table 1) was found to increase withthe C. sativus stigma developmental stage (Fig. 3B). Althoughnot many methylated volatiles were identified, the expressionlevels of a putative SAM dependent carboxyl methyltransferasewere studied during stigma development. During the yellowand orange stages, the transcript levels were low but increasedand remained constant from the red to the post anthesis stage(Fig. 3B). Because methyltransferases act on a wide array of com-pounds, it is difficult to establish a direct correlation between theemission of methylated volatiles and methyltransferase expres-sion patterns.

3. Concluding remarks

In the present study, we have used a combination of approachesto study the accumulation of colour and aroma compounds of C.sativus during stigma development, and in order to determinewhether this accumulation could be paralleled by changes in thelevel of expression of candidate genes of the metabolic pathwaysinvolved. The pattern of expression of several candidate genes dur-ing stigma development showed a correlation with the volatileproduction in this tissue. We analysed the contribution of thetwo alternative pathways known to produce IPP in plant cells,the MEP and the MVA pathway, to carotenoid and monoterpenebiosynthesis. In C. sativus stigmas the MEP pathway plays a keyrole in the biosynthesis of both compounds, detected throughoutstigma development. The main non volatile components of thestigmas are the apocarotenoid crocetin, crocins and picrocrocin,which accumulate as stigmas develop. Crocetin and its glucosylat-ed forms, crocins, are probably generated from b-carotene and zea-xanthin by a 7,8(70,80) oxidative cleavage activity. The volatileprofile was characteristic for each developmental stage from theimmature yellow stigmas to the fully developed and mature stig-mas, indicating an important production of carotenoid-derivativevolatiles.

Except for abscisic acid, the biological roles of carotenoid-de-rived metabolites are not very well known in plants. The progres-sive accumulation of the apocarotenoids studied here could act orbe used as visual cues to attract pollinators to the flower at theright moment. In addition to these visual cues, the apocarotenoidvolatiles emitted by the stigmas together with the monoterpenesreleased at the time of anthesis may act synergistically in attract-ing pollinators in Crocus.

1014 Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016

4. Experimental

4.1. Plant material

Plant tissues and stigmas from C. sativus grown under field con-ditions in Tarazona de la Mancha, Spain, were used throughout theexperiments. Stigmas were collected at different developmentalstages as previously described (Rubio et al., 2008) and were de-fined as follows: yellow stigma, closed bud inside the perianthtubes (around 0.3 cm in length); orange stigma, closed bud insidethe perianth tubes (around 0.4 cm in length); red stigma, closedbud inside the perianth tubes (0.8 cm in length); �3da, three daysbefore anthesis, dark red stigma in closed bud outside the perianthtubes (3 cm); da, day of anthesis, dark red stigma (3 cm); +2da, twodays post anthesis, dark red stigma. For RNA extraction all tissueswere frozen in liquid nitrogen and stored at �80 �C until required.

4.2. Estimation of transcript levels for candidate genes to be involvedin volatile production

Total RNA was extracted from stigmas by grinding the tissue inliquid nitrogen to a fine powder and extracting in 1 ml of TRIzol re-agent (Invitrogen Corporation) per 100 mg of fresh tissue, accord-ing to the manufacturer’s protocol. DNA contamination wasremoved with RQ1 RNase-free DNase (Promega, Madison, WI,USA). Various initial concentrations of treated RNA, ranging overa 10 fold difference, were used to demonstrate the differentialaccumulation of the RNA in the tissues analysed in the RT-PCRexperiments. Total RNA samples were reverse transcribed with afirst-strand cDNA synthesis kit (Amersham Biosciences) and ran-dom primers (Promega, Madison, WI, USA). The gene expressionlevels were evaluated using specific primer pairs for each gene (Ta-ble 1) that were designed from the EST sequence of genes availablefrom http://www.saffrongenes.org/ or NCBI (http://www.ncbi.nlm.nih.gov/) using the Primer3 (v. 0.4.0) program.Primers for CsPSY and CsPDS amplification have been previouslydescribed (Castillo et al., 2005). The primer specificity for each gi-ven gene was confirmed by sequencing of RT-PCR fragments usingan automated DNA sequencer (ABI prism 310, Perkin Elmer). Com-puter analysis of the DNA sequences were carried out using theWU-BLAST program (http://www.expasy.ch). PCR was subse-quently performed in 25 ll of a reaction mix containing 50 pmolof each gene-specific primer pair, 0.25 ll of first strand synthesiscDNA and 1 U of Taq DNA polymerase (Promega, Madison WI,USA). As an internal control, the mRNA level of the constitutivelyexpressed ribosomal protein S18 (RPS18) was used (Rubio et al.,2004), and genomic DNA from C. sativus was used as the positivePCR control (Note that the ADH, HMGR, DXS, and TS primers spanan intron). A PTC-200 Programmable Thermal Cycler (controller)(MJ Research, Watertown, MA, USA) was used with an initial dena-turation step of 94 �C for 3 min, followed by 30 cycles of 94 �C for60 s, 60 �C 20 s, 72 �C for 40 s. The RT-PCR products were electro-phoresed on a 1.5% agarose gel containing ethidium bromide andvisualized under UV light. RT-PCR analysis was performed in dupli-cate using RNA from two different sets of plants. Results of the tworeplicates were similar, and therefore only one replicate is shownin the corresponding figures. The second RT-PCR was performedusing the same reagents as those used for the first PCR except thatthe RNA was isolated from stigmas from different plants.

4.3. Extraction and analysis of apocarotenoid compounds by HPLC

Apocarotenoids from Crocus stigmas, at six developmentalstages, were extracted in a 2 ml microcentrifuge tube by grinding0.5 mg of material with a micropestle in 700 ll Tris-HCl (50 mM,pH 7.5) (containing 1 M NaCl), and incubated for 10 min on ice. Chlo-

roform was then added (700 ll), mixed and the extract incubated onice for an additional 10 min. The phases were separated by centrifu-gation at 3000 g for 5 min at 4 �C. The lower chloroform phase wasevaporated and the dried residues were stored together with theupper aqueous phases at�80 �C until high-performance liquid chro-matography analysis. The assays were performed in triplicate.

Apocarotenoids were analysed by reverse-phase HPLC as previ-ously described (Rubio et al., 2004) using a Hewlett Packard 1100HPLC (Palo Alto, CA) equipped with a Sugerlabor Inertsil ODS-2.5-lm C18 column (250 � 4.6 mm) and connected on line to aphotodiode array detector, with a dynamic range from ultravioletto visible region (190–700 nm). The different carotenoid deriva-tives were identified on the basis of HPLC retention times andUV–visible light spectra (Tarantilis et al., 1995; Rubio et al.,2004), and their concentrations calculated as previously described(Himeno and Sano, 1987).

4.4. Capture of volatiles from fresh stigma tissue and analysis by GC–MS

An HS-SPME extraction protocol was used: 10 mg of fresh C. sat-ivus stigma from different stages were introduced in a 22 ml crimpcap vial, together with 10 ll of a 1 ppm methylsalicylate solutionas an internal standard. Then a 65 lm PDMS/DVB fibre (poly-dimethylsiloxane/divinylbenzene) (Supelco, Pennsylvania, USA)was exposed to the headspace for 1 h at 30 �C, while being shakenat 300 rpm. After sampling, the fibre was immediately desorbed inthe GC injector. A desorption time of 1 min at 250 �C was used inthe splitless mode. Before sampling, each fibre was reconditionedfor 5 min in a GC injector port at 250 �C. Triplicate analyses wereperformed at each stage.

Volatile organic compounds were analysed by GC/MS using aClarus 600 gas chromatograph from Perkin Elmer (Shelton,USA), equipped with a ZB-5 ms capillary column (30 m,0.25 mm, 0.25 lm) (Phenomenex, Torrance, CA, USA). Oven pro-gramming conditions were 40 �C for 2 min, 5 �C/min ramp until180 �C; 15 �C/min ramp until 250 �C, then 5 min at 250 �C. Heliumwas used as the carrier gas at a constant pressure of 19.5 psi.Detection was performed by a Perkin Elmer Clarus 600T massspectrometer in the EI mode (ionization energy, 70 eV; sourcetemperature, 150 �C). The acquisition was made in scan mode(m/z range 35–250). Volatiles were identified by comparing reten-tion indices with those of reference compounds run under identi-cal conditions (Sigma, St. Louis, USA), and by matching theirfragmentation pattern in mass spectra with those of the NIST05library, except for megastigma-4,6,8-triene, 4-oxoisophorone,propanoic acid-2-methyl-,2,2-dimethyl-1-(2-hidroxy-1-methyl-ethyl)propyl ester, heptane-2,2,4,6,6-pentamethyl-tetradecanaland methyltetradecanoate, which were identified only by com-parison of their mass spectra with those in the NIST05 library.Quantification of the compounds was performed by utilizing thearea of an ion specific of each compound and comparing to thatof the internal standard.

Acknowledgments

We thank K.A. Walsh (Escuela Técnica Superior de IngenierosAgrónomos. Universidad de Castilla-La Mancha, Albacete, Spain)for language revision. This work was supported by the Ministeriode Educación y Ciencia [BIO2006/00841] and the Consejería deEducación y Ciencia [PAI08-0211-6481].

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.phytochem.2009.04.022.

Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016 1015

References

Ackemann, I.E., Vanthorpe, V., Fordham, W.D., Kinder, J.P., Poots, I., 1989. D-Glucosides of aroma components from petals of Rosa species: assay, occurrenceand biosynthetic implications. J. Plant Physiol. 134, 567–572.

Alonso, G.L., Salinas, M.R., Esteban-Infantes, F.J., Sanchez-Fernandez, M.A., 1995.Determination of safranal from saffron (Crocus sativus L.) by thermaldesorption-gas chromatography. Agric. Food Chem. 44, 185–188.

Aubourg, S., Lecharny, A., Bohlmann, J., 2002. Genomic analysis of the terpenoidsynthase (AtTPS) gene family of Arabidopsis thaliana. Mol. Genet. Genomics 267,730–745.

Auldridge, M.E., Block, A., Vogel, J.T., Dabney-Smith, C., Mila, I., Bouzayen, M.,Magallanes-Lundback, M., DellaPenna, D., McCarty, D.R., Klee, H.J., 2006.Characterization of three members of the Arabidopsis carotenoid cleavagedioxygenase family demonstrates the divergent roles of this multifunctionalenzyme family. Plant J. 45, 982–993.

Bohlmann, J., Crock, J., Jetter, R., Croteau, R., 1998. Terpenoid-based defenses inconifers: cDNA cloning, characterization, and functional expression of wound-inducible (E)-alpha-bisabolene synthase from grand fir (Abies grandis). Proc.Natl. Acad. Sci. USA. 95, 6756–6761.

Carmona, M., Zalacain, A., Salinas, M.R., Alonso, G., 2007a. A new approach to saffronaroma. Crit. Rev. Food Sci. Nutr. 47, 145–159.

Carmona, M., Sánchez, A.M., Ferreres, F., Zalacain, A., Tomás-Barberán, F., Alonso, G.,2007b. Identification of the flavonoid fraction in saffron spice by LC/DAD/MS/MS: comparative study of samples from different geographical origins. FoodChem. 100, 445–450.

Castillo, R., Fernandez, J.A., Gomez-Gomez, L., 2005. Implications of carotenoidbiosynthetic genes in apocarotenoid formation during the stigma developmentof Crocus sativus and its closer relatives. Plant Physiol. 139, 674–689.

Conley, T.R., Peng, H.P., Shih, M.C., 1999. Mutations affecting induction of glycolyticand fermentative genes during germination and environmental stresses inArabidopsis. Plant Physiol. 119, 599–608.

D’Agostino, N., Pizzichini, D., Chiusano, M.L., Giuliano, G., 2007. An EST databasefrom saffron stigmas. BMC Plant Biol. 7, 53.

Dauria, M., Mauriello, G., Racioppi, R., Rana, G.L., 2006. Use of SPME-GC–MS in thestudy of time evolution of the constituents of saffron aroma: modifications ofthe composition during storage. J. Chromatogr. Sci. 44, 18–21.

Dobson, H.E.M., 1993. Floral volatiles in insect biology. In: Bernays, E. (Ed.), Insect-Plant Interactions, vol. 5. CRC Press, Boca Raton, Florida, pp. 47–81.

Dudareva, N., Raguso, R.A., Wang, J., Ross, J.R., Pichersky, E., 1998. Floral scentproduction in Clarkia breweri. III. Enzymatic synthesis and emission ofbenzenoid esters. Plant Physiol. 116, 599–604.

Dudareva, N., Murfitt, L.M., Mann, C.J., Gorenstein, N., Kolosova, N., Kish, C.M.,Bonham, C., Wood, K., 2000. Developmental regulation of methyl benzoatebiosynthesis and emission in snapdragon flowers. Plant Cell 12, 949–961.

Dudareva, N., Martin, D., Kish, C.M., Kolosova, N., Gorenstein, N., Fäldt, J., Miller, B.,Bohlmann, J., 2003. (E)-beta-ocimene and myrcene synthase genes of floralscent biosynthesis in snapdragon: function and expression of three terpenesynthase genes of a new terpene synthase subfamily. Plant Cell 15, 1227–1241.

Dudareva, N., Pichersky, E., Gershenzon, J., 2004. Biochemistry of plant volatiles.Plant Physiol. 135, 1893–1902.

Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M., Rhodes, D., Boland, W.,Gershenzon, J., 2005. The nonmevalonate pathway supports both monoterpeneand sesquiterpene formation in snapdragon flowers. Proc. Natl. Acad. Sci. U.S.A.102, 933–938.

Effmert, U., Saschenbrecker, S., Ross, J., Negre, F., Fraser, C.M., Noel, J.P., Dudareva, N.,Piechulla, B., 2005. Floral benzenoid carboxyl methyltransferases: from in vitroto in planta function. Phytochemistry 66, 1211–1230.

Enjuto, M., Balcells, L., Campos, N., Caelles, C., Arró, M., Boronat, A., 1994. Arabidopsisthaliana contains two differentially expressed 3-hydroxy-3-methylglutaryl-CoAreductase genes, which encode microsomal forms of the enzyme. Proc. Natl.Acad. Sci. U.S.A. 91, 927–931.

Eugster, C.H., Hurlimann, H., Leuenberger, H.J., 1969. Crocetindyaldehyd undcrocetinhaldaldehyb als blutenfarbstoffe von Jacquinia angustifolia. Helv.Chim. Acta 52, 89–90.

Gang, D.R., Wang, J., Dudareva, N., Nam, K.H., Simon, J.E., Lewinsohn, E., Pichersky,E., 2001. An investigation of the storage and biosynthesis of phenylpropenes insweet basil. Plant Physiol. 125, 539–555.

Himeno, H., Sano, K., 1987. Synthesis of crocin, picrocrocin and safranal by saffronstigma-like structures proliferated in vitro. Agric. Biol. Chem. 51, 2395–2400.

Hsiao, Y.Y., Tsai, W.C., Kuoh, C.S., Huang, T.H., Wang, H.C., Wu, T.S., Leu, Y.L., Chen,W.H., Chen, H.H., 2006. Comparison of transcripts in Phalaenopsis bellina andPhalaenopsis equestris (Orchidaceae) flowers to deduce monoterpenebiosynthesis pathway. BMC Plant Biol. 6, 14.

Jütner, F., Höflacher, B., 1985. Evidence of b-carotene 7, 8(7, 8) oxygenase (b-cyclocitral, crocetindial generating) in Microcystis. Arch. Microbiol. 141, 337–343.

Kaiser, R., 2002. Carotenoid-derived aroma compounds in flower scents. In:Winterhalter, P., Rouseff, R.L. (Eds.), Carotenoid-derived aroma compounds.American Chemical Society, Washington, DC, pp. 160–182.

Kaiser, R., Lamparsky, D., 1980. Volatile constituents of Osmanthus absolute. In:Mookheijee, B.D., Mussinan, C.J. (Eds.), Essential Oils. Allured Publishing,Wheaton, IL, pp. 159–192.

Kanakis, C.D., Daferera, D.J., Tarantilis, P.A., Polissiou, M.G., 2004. Qualitativedetermination of volatile compounds and quantitative evaluation of safranal

and 4-hydroxy-2, 6, 6-trimethyl-1-cyclohexene-1-carboxaldehyde (HTCC) inGreek saffron. J. Agric. Food Chem. 52, 4515–4521.

Knudsen, J.T., Tollsten, L., Bergstrom, G., 1993. Floral scents: a check list of volatilecompounds isolated by headspace techniques. Phytochemistry 33, 253–280.

Liao, Y.H., Houghton, P.J., Hoult, J.R., 1999. Novel and known constituents fromBuddleja species and their activity against leukocyte eicosanoid generation. J.Nat. Prod. 62, 1241–1245.

Lichtenthaler, H.K., Schwendler, J., Disch, A., Rohmer, M., 1997. Biosynthesis ofisoprenoids in higher plant chloroplasts proceeds via a mevalonate-independent pathway. FEBS Lett. 400, 271–274.

Lücker, J., Tamer, M.K., Schwab, W., Verstappen, F.W., van der Plas, L.H.,Bouwmeester, H.J., Verhoeven, H.A., 2002. Monoterpene biosynthesis inlemon (Citrus limon) cDNA isolation and functional analysis of fourmonoterpene synthases. Eur. J. Biochem. 269, 3160–3171.

Matile, P., Altenburger, R., 1998. Rhythms of fragrance emission in flowers. Planta174, 242–247.

McTavish, H.S., Davies, N.W., Menary, R.C., 2000. Emission of volatiles from brownBoronia flowers: some comparative observations. Ann. Bot. 86, 347–354.

Mookherjee, B.D., Trenkle, R.W., Wilson, R.A., 1990. The chemistry of flowers, fruitsand spices: live vs. Dead a new dimension in fragance research. Pure Appl.Chem. 62, 1357–1364.

Muñoz-Bertomeu, J., Arrillaga, I., Ros, R., Segura, J., 2006. Up-regulation of 1-deoxy-D-xylulose-5-phosphate synthase enhances production of essential oils intransgenic spike lavender. Plant Physiol. 142, 890–900.

Negbi, M., 1999. Saffron cultivation: past present and future prospects. In: Negbi, M.(Ed.), Saffron Crocus sativus L.. Harwood Academic Publishers, Australia, pp. 1–18.

Negre, F., Kish, C.M., Boatright, J., Underwood, B., Shibuya, K., Wagner, C., Clark, D.G.,Dudareva, N., 2003. Regulation of methylbenzoate emission after pollination insnapdragon and petunia flowers. Plant Cell 15, 2992–3006.

Noordermeer, M.A., Veldink, G.A., Vliegenthart, J.F., 2001. Fatty acid hydroperoxidelyase: a plant cytochrome p450 enzyme involved in wound healing and pestresistance. Chem. Biochem. 2, 494–504.

Nørb�k, R., Brandta, K., Nielsen, J.K., Ørgaardc, M., Jacobsen, N., 2002. Flowerpigment composition of Crocus species and cultivars used for achemotaxonomic investigation. Biochem. System. Ecol. 30, 763–791.

Pfander, H., Schurtenberger, H., 1982. Biosynthesis of C20-carotenoids in Crocussativus. Phytochemistry 21, 1039–1042.

Pfander, H., Wittwer, F., 1975. Carotenoid-glycosides Investigation of carotenoid-composition of saffron. Helv. Chim. Acta 58, 1608–1620.

Pfister, S., Meyer, P., Steck, A., Pfander, H., 1996. Isolation and structure elucidationof carotenoid glycoslyesters on gardenia fruits (Gardenia jasminoides) andsaffron (Crocus sativus). J. Agric. Food Chem. 44, 2612–2615.

Pichersky, E., Raguso, R.A., Lewinsohn, E., Croteau, R., 1994. Floral scent productionin Clarkia (Onagraceae) (I. Localization and developmental modulation ofmonoterpene emission and linalool synthase activity). Plant Physiol. 106, 1533–1540.

Pichersky, E., Lewinsohn, E., Croteau, R., 1995. Purification and characterization of S-linalool synthase, an enzyme involved in the production of floral scent in Clarkiabreweri. Arch. Biochem. Biophys. 316, 803–807.

Pichersky, E., Noel, J.P., Dudareva, N., 2006. Biosynthesis of plant volatiles: nature’sdiversity and ingenuity. Science 311, 808–811.

Prestage, S., Linforth, R.S.T., Taylor, A.J., Lee, E., Speirs, J., Schuch, W., 1999. Volatileproduction in tomato fruit with modified alcohol dehydrogenase activity. J. Sci.Food Agric. 79, 131–136.

Raina, B., Agarwal, S., Bhatia, A., Gaur, G., 1996. Changes in pigments and volatiles ofsaffron (Crocus sativus L) during processing and storage. J. Sci. Food Agric. Sci.71, 27–32.

Rohmer, M., 1999. The discovery of a mevalonate-independent pathway forisoprenoid biosynthesis in bacteria, algae and higher plants. Nat. Prod. Rep.16, 565–574.

Rubio, A., Nohales, P.F., Pérez, J.A., Gómez-Gómez, L., 2004. Glucosylation of thesaffron apocarotenoid crocetin by a glucosyltransferase isolated from Crocussativus stigmas. Planta 219, 955–966.

Rubio, A., Rambla, J.L., Santaella, M., Gomez, M.D., Orzaez, D., Granell, A., Gómez-Gómez, L., 2008. Cytosolic and plastoglobule targeted carotenoid dioxygenasesfrom Crocus sativus are both involved in beta-ionone-release. J. Biol. Chem. 283,24816–24825.

Schwab, W., Davidovich-Rikanati, R., Lewinsohn, E., 2008. Biosynthesis of plant-derived flavor compounds. Plant J. 54, 712–732.

Schwartz, S.H., Qin, X., Zeevaart, J.A., 2001. Characterization of a novel carotenoidcleavage dioxygenase from plants. J. Biol. Chem. 276, 25208–25211.

Speirs, J., Lee, E., Holt, K., Yong-Duk, K., Scott, N., Loveys, B., Schuch, W., 1998.Genetic manipulation of alcohol dehydrogenase levels in ripening tomato fruitaffects the balance of some flavor aldehydes and alcohols. Plant Physiol. 117,1047–1058.

Straubinger, M., Jezussek, M., Waibel, R., Winterhalter, P., 1997. Novel glycosidicconstituents from saffron. J. Agric. Food Chem. 45, 1678–1681.

Straubinger, M., Bau, B., Eckestein, S., Fink, M., Winterhalter, P., 1998. Identificationof novel glycosidic aroma precursors in saffron (Crocus sativus L.). J. Agric. FoodChem 46, 3238–3242.

Tandon, J.S., Katti, S.B., Rüedi, P., Eugster, C.H., 1979. Crocetin-dialdehyde fromColeus forskolii Briq., Labiatae. Helv. Chim. Acta 274, 2706–2707.

Tarantilis, P.A., Polissiou, M., 1997. Isolation and identification of the aromaconstituents of saffron (Crocus sativa). J. Agric. Food Chem. 45, 459–462.

Tarantilis, P.A., Tsoupras, G., Polissiou, M.G., 1995. Determination of saffron (Crocussativus L.) components in crude plant extract using high-performance liquid

1016 Á.R. Moraga et al. / Phytochemistry 70 (2009) 1009–1016

chromatography–UV–visible photodiode-array detection-mass spectrometry. J.Chromatogr. 699, 107–118.

Theis, N., Raguso, R.A., 2005. The effect of pollination on floral fragrance in thistles. J.Chem. Ecol. 31, 2581–2600.

Tollsten, L., 1993. A multivariate approach to post-pollination changes in the floralscent of Platanthera bifolia (Orchidaceae). Nord. J. Bot. 13, 495–499.

Wang, J., Dudareva, N., Bhakta, S., Raguso, R.A., Pichersky, E., 1997. Floral scentproduction in Clarkia breweri (Onagraceae) II. Localization and developmental

modulation of the enzyme S-adenosyl-l-methionine:(iso)eugenol O-methyltransferase and phenylpropanoid emission. Plant Physiol. 114, 213–221.

Winterhalter, P., Rouseff, R.L., 2002. Carotenoid-Derived Aroma Compounds.American Chemical Society, Washington, DC.

Winterhalter, P., Straubinger, M., 2000. Saffron: renewed interest in an ancientspice. Food Rev. Int. 16, 39–59.