BP

MB

a

ARRA

KPL1MS

1

lowiLwc

fipWelMfietlci

h0

Carbohydrate Polymers 134 (2015) 761–766

Contents lists available at ScienceDirect

Carbohydrate Polymers

j ourna l ho me page: www.elsev ier .com/ locate /carbpol

iodegradation of cellulosic and lignocellulosic waste byseudoxanthomonas sp R-28

ohit Kumar ∗, K. Revathi, Sunil Khannaiotechnology and Bioinformatics, NIIT University, Neemrana, Rajasthan 301705, India

r t i c l e i n f o

rticle history:eceived 24 June 2015eceived in revised form 19 August 2015ccepted 22 August 2015

eywords:

a b s t r a c t

A microbial consortium, designated Con R, was established by successive sub-cultivation which candegrade 83% of filter paper after 15 days of incubation over control. Among the 14 bacterial isolatesobtained from Con R, only bacterial isolate (R-28) was capable of degrading filter paper. Based on 16SrRNA gene sequence, R-28 was identified as Pseudoxanthomonas sp R-28. After 5 days of incubation,degradation efficiencies of Pseudoxanthomonas sp R-28 on filter paper and pure cellulosic waste were

seudoxanthomonas sp R-28ignocellulose degradation6S rRNAodified logistic model

tructural modifications

96% and 95% respectively as compared to control. Pseudoxanthomonas sp R-28 also degraded 60% of non-pretreated rice straw after 7 days as compared to control. The degradation kinetics through a modifiedlogistic model showed high correlation coefficient (R2) of 0.965 and 0.665 for cellulosic and rice strawwaste degradation respectively. Micro scale structural analysis showed the development of fissures andgaps over time which further supported the degradation potential of Pseudoxanthomonas sp R-28.

© 2015 Elsevier Ltd. All rights reserved.

. Introduction

A key step in the global carbon cycle is the hydrolysis of the cellu-ose, which is the most abundant renewable natural organic mattern earth (Wilson, 2011). Annually, many billion tons of organicastes are produced worldwide as residues from agricultural activ-

ties, industrial food processing and municipal solid waste (Bayer,amed, & Himmel, 2007). Cellulose is the major component of thisaste accounting for 40–50% on dry weight basis. The half-life of

ellulose at neutral pH is estimated to be several million years.At present this waste is primarily disposed off either by land

lling or by composting. Though degradative environment of com-osting is well studied and efficient (Hansgate, Schloss, Hay, &alker, 2005), the uncontrollable landfill environment is often less

fficient (Bayer et al., 2007). Contamination of groundwater andandfills rapidly filling to its capacity are other major concerns.

oreover, mostly in Asian countries, burning of the waste in openelds causes the release of green house gases thus polluting thenvironment (Murali, Shrivastava, & Saxena, 2010). Consequently,he use of microorganisms in order to remove, reduce or ame-

iorate these potential polluting materials is a real environmentalhallenge, which could be solved by a focused research concern-ng efficient methods applied in biological degradation processes

∗ Corresponding author.E-mail address: kumarmohit@yahoo.com (M. Kumar).

ttp://dx.doi.org/10.1016/j.carbpol.2015.08.072144-8617/© 2015 Elsevier Ltd. All rights reserved.

(Annamalai, Rajeswari, Elayaraja, & Balasubramanian, 2013; Bayeret al., 2007; Petre, Zarnea, Adrian, & Gheorghiu, 1999).

Unique stable structure of cellulose makes it recalcitrant tomicrobial attack (Huang, Chen, Lin, Hsu, & Chen, 2010; Lei, Li, &Gu, 2012). Thus poor degradation efficiency is one of the majorbottlenecks associated with cellulosic waste biodegradation. Theanaerobic degradation of cellulosic wastes has been intensivelystudied particularly during composting and in rumen (Russell,Muck, & Weimer, 2009; Schloss, Hay, Wilson, Gossett, & Walker,2005). Aerobic degradation of cellulosic waste could be an attrac-tive strategy which is poorly understood so far. Only few aerobicbacteria have been reported which can degrade lignocellulosepoorly that underscores the need to characterize the more efficientaerobic system. Kinetic modeling offers a powerful tool to modelthe substrate utilization. Logisitc equation has been used to studythe growth kinetics or degradation studies of 2,4-D or anaerobicutilization of cellulose (Langner et al., 1998; Yu, Chen, Tong, Li, & Li,2012). Therefore, this study aims to characterize an aerobic micro-bial system which could have the potential to degrade organic solidwaste (rice straw). The performance of the biodegradation processhas been evaluated by taking into account both the reaction kineticsand morphological/structural changes.

2. Materials and methods

Whatman filter paper No. 1 was purchased from Schleicher& Schull, Whatman International Ltd., Maidstone, UK. Molecular

7 ate Po

boca

2

etr((cbaldlawtiAw

2d

scb2bd

2

iucctfloww1b(

2

dfi(TK1ppcd

62 M. Kumar et al. / Carbohydr

iology reagents were purchased from Thermo Scientific, USA. Allther chemicals and reagents were of analytical grade and pur-hased from HiMedia, India. Rice straw was procured from thegricultural field, Punjab.

.1. Development of aerobic consortium

Soil samples were collected from semi-desert soil of north-rn India as described previously (Kumar & Khanna, 2014) andhese soil samples were used to develop aerobic consortia byepeated enrichment technique at 37 ◦C in Bushnell Haas brothBHB) (Kumar, Joshi, Kashyap, & Khanna, 2011) containing 0.5%w/v) filter paper as the only added carbon source. The developedonsortia were screened for degradation of filter paper by incu-ating the inoculated flasks on a rotary shaker (150 rpm) at 37 ◦Cnd measuring cellular growth and analyzing filter paper (cellu-ose) degradation. At each time point, samples were withdrawn inuplicate to measure cellular growth and to analyze cellulose uti-

ization. Control flask included BHB + soil + filter paper, which wasutoclaved to determine the abiotic loss of cellulose. The processas repeated for another six week at an interval of 15 days each

o acclimatize the consortium. Developed consortium (Con R) wasnoculated at 6% (v/v) in BHB + FP (0.5%, w/v) and incubated at 37 ◦C.fter regular interval of time, growth and filter paper degradationas determined.

.2. Isolation and screening of bacterial strains for celluloseegradation

Bacterial strains were isolated from the developed aerobic con-ortium by dilution technique on basal agar plates containingarboxy methyl cellulose (CMC; 0.5% w/v) as sole source of car-on. Bacterial isolates were then picked, purified and grown in

ml BHB medium supplemented with CMC (0.5%; w/v). Selectedacteria were also inoculated into BHB + filter paper (0.5%; w/v) toetermine their ability to degrade filter paper.

.3. Estimation of growth and filter paper degradation

After regular interval of time, total protein was determined as anndicator of growth as described by Itzhaki and Gill (1964). Resid-al filter paper in each flask (both experimental and control) wasentrifuged (15 000 × g, 30 min at 4 ◦C) and acidified by addition ofoncentrated H2SO4 at each time point until the final concentra-ion of H2SO4 reached 70% (v/v) (Velichkov (1992). The acidifiedasks were kept at 30 ◦C for 1 h to complete the acid digestionf filter paper and an aliquot (50 �l) of the sample (in duplicate)as withdrawn and mixed with 3 ml of anthrone reagent (0.2%,/v). The tubes were then incubated in a boiling water bath for

0 min and immediately cooled to room temperature in an iceath. Absorbance was measured at 630 nm by spectrophotometerHitachi, Japan). Experiment was repeated three times.

.4. Molecular identification of cellulose degrading bacteria

Chromosomal DNA of the selected bacteria was extracted asescribed by Kumar and Khanna (2010). 16S rRNA gene was ampli-ed using genomic DNA as template with universal primers E8FAGAGTTTGATCCTGGCTCAG) and reverse primer E1492R (GGT-ACCTTGTTACGACTT) as described in literature (Bond, Hugenholtz,eller, & Blackall, 1995). The PCR reactions were prepared with0X buffer, 0.2 mM deoxynucleoside triphosphate (dNTP), 1 U Taq

olymerase (all from Life Technologies, India), and 0.5 �M for eachrimer (Sigma, India) to yield final volumes of 25 �l, using 35ycles of 94 ◦C (60 s), 55 ◦C (60 s), and 72 ◦C (60 s) with an initialenaturation at 94 ◦C (3 min) and a final extension at 72 ◦C (8 min).

lymers 134 (2015) 761–766

Sequencing was done by Amnion Biosciences, Bangalore, India andthen BLAST searched through the NCBI GenBank database. Phyloge-netic tree was constructed using molecular evolutionary geneticsanalysis (MEGA) software with 1000 bootstrap replicates (Tamura,Stecher, Peterson, Filpski, & Kumar, 2013).

2.5. Scanning electron microscope (SEM) analysis

SEM (Supra 55; Zeiss, Germany) was used to study the changesin the morphological characteristics of filter paper at differenttime intervals (Institute of Minerals and Materials Technology,Bhubaneswar). A thin layer of gold was coated to make the samplesconductive. The accelerating voltage of the microscope was kept inthe range 20–30 kV.

2.6. Biodegradation of cellulose waste and agro residue

Paper sheets (BILT Copy Power, BILT India) was used as cellulosicwaste paper. Characteristics of waste paper, as defined by manu-facturer were: 80GSM, brightness (93% Elerpho) and stiffness (2.6machine direction, 1.6 cross machine direction). Agro residue i.e.rice straw and waste paper were cut manually to achieve parti-cle size of 0.2–0.3 cm in length. Rice straw was further grinded instone grinder and sieved to collect particle size of 0.35–0.5 mm andcollected particles were washed 2–3 times in tap water to removethe soil particles. Sterilized BHB medium supplement with eitherwaste paper or rice straw as sole carbon source was inoculated withselected bacteria. Control flask was inoculated with killed bacte-ria. Flasks were incubated at 37 ◦C under shaking at 150 rpm. Afterregular interval of time, whole flask was used to determine thegrowth and utilization of cellulosic waste. Residual rice straw wasestimated as described by (Du et al., 2015). The degradation ratioof the rice straw was defined as the ratio of the weight of degradedrice straw compared to the weight of total rice straw added at timezero and calculated by the following formula:

= {1 − m(Residual Rice Straw)/m(Total Rice Straw)} × 100 (1)

where m is mass.

2.7. Kinetic modeling

A modified logistic equation (Zwietering, Jongenburger,Rombouts, & van’t Riet, 1990) was adopted to describe thedegradation kinetics:

S = S0{

1 − 1/{1 + exp[4Rm/S0(� − t) + 2]}}

(2)

where S is substrate concentration at time t (g/L), t is incubationtime (h), S0 is initial substrate concentration (g/L), � is lag time (d),Rm is maximum substrate degradation rate (g/L/h).

The rate of substrate degradation rs (g/L/h) was described as:

rs = −4Rm exp[4Rm/S0(� − t) + 2]/{1 + exp[4Rm/S0(� − t) + 2]}2

(3)

2.8. Nucleotide sequence submission

The nucleotide sequence of 16S rRNA of the bacterial strainreported in this study was deposited in the GenBank database withthe following accession number KP876051.

3. Results and discussion

3.1. Development of an aerobic consortium

Aerobic bacterial consortium (Con R) developed by enrich-ment technique was capable of growth on mineral salt medium

M. Kumar et al. / Carbohydrate Polymers 134 (2015) 761–766 763

Fcr

cottc(1ibtfiwdYmcWcl

Fti

Fig. 3. The evolutionary history was inferred using the Neighbor-Joining method.The percentage of replicate trees in which the associated taxa clustered together inthe bootstrap test (1000 replicates) is shown next to the branches. The tree is drawnto scale, with branch lengths in the same units as those of the evolutionary distancesused to infer the phylogenetic tree. The evolutionary distances were computed usingthe Maximum Composite Likelihood method and are in the units of the number ofbase substitutions per site. The analysis involved 6 nucleotide sequences of only

the increased synthesis of cellulase enzymes and this has led to con-siderable technological interest in producing industrial important

ig. 1. Biodegradation of filter paper as sole carbon source by developed bacterialonsortia R over time. Protein was estimated as an indicator of growth. The dataepresent the mean ± standard error of three independent assays.

ontaining filter paper (0.5%; w/v) as sole carbon source. After a lagf 24 h, Con R degraded 13% of filter paper after 3 days as comparedo control which increased to 57% after 7 days (Fig. 1). Aerobic bac-erial consortium (Con R) developed by enrichment technique wasapable of growth on mineral salt medium containing filter paper0.5%; w/v) as sole carbon source. After a lag of 24 h, Con R degraded3% of filter paper after 3 days as compared to control which

ncreased to 57% after 7 days (Fig. 1). Degradation of filter papery Con R was increased to 83% after 15 days as compared with con-rol. Growth of Con R concomitantly increased with degradation oflter paper (Fig. 1). Enrichment culture technique is a powerful toolhich was previously employed to obtain microbial consortium toegrade cellulosic material (Feng et al., 2011; Lv, Yang, Wang, &uan, 2008). Several anaerobic cellulose-degrading microbial com-unities developed through enrichment have been reported which

an degrade the filter paper in the range of 30–99% (Lv et al., 2008;

ang et al., 2011). However, anaerobic system faces technological

hallenges like maintenance of strict anaerobic environment andow cellular biomass due to low yield of ATP by fermentation of

ig. 2. Biodegradation of filter paper as sole carbon source by various pure bac-erial isolates after 5 days. The data represent the mean ± standard error of threendependent assays.

those Pseudoxanthomonas sp. including R-28 (shown in box) which are reported incellulose degradation.

byproducts of cellulose degradation In contrast, aerobic cellulolyticbacteria (either consortium or pure culture) produce higher cellyields characteristic of aerobic respiratory growth which supports

Fig. 4. Biodegradation of cellulosic waste paper and rice straw as sole carbonsource by Pseudoxanthomonas sp. R-28 over period of time. Protein was estimatedto determine the growth of Pseudoxanthomonas sp. R-28. Total residual carbohy-drate during degradation of rice straw was also determined. The data represent themean ± standard error of three independent assays.

764 M. Kumar et al. / Carbohydrate Polymers 134 (2015) 761–766

F by SEc the liq

cv

3

bnttcaticacict

stloed

ig. 5. Morphological changes in waste paper at various time interval determinedracks during the growth of Pseudoxanthomonas sp. R-28. 72 h sample also showed

hemicals and fuels from waste cellulosic biomass (Lynd, Weimer,an Zyl, & Pretorius, 2002).

.2. Screening and identification of bacteria

A total of 14 bacterial isolates were obtained from Con R on theasis of zone of clearance on mineral salt medium with CMC (dataot shown). All the 14 bacterial isolates were then screened forheir ability to degrade filter paper. After initial screening, amonghe 14 bacterial isolates, bacterial isolate (R-28) was the most effi-ient and degraded 96% of filter paper after 5 days of incubations compared to control (Fig. 2). It has been previously observedhat among the various members of the cellulolytic consortium,t may be only one isolate which has the capacity for crystallineellulose degradation. Kato, Haruta, Cui, Ishii, and Igarashi (2008)lso reported that only one of the members of the stable mixedulture is involved in microcrystalline cellulose degradation. Sim-larly, only 10% of the total microbial population of the rumen isellulolytic (Russell et al., 2009). Our results are in agreement withhese observations.

16S rRNA gene sequence of the most efficient cellulose degraderhowed 95–98% similarity with Pseudoxanthomonas species. Thushe present culture was named as Pseudoxanthomonas sp R-28. Phy-

ogeny of Pseudoxanthomonas sp R-28 constructed on the basisf the 16S rRNA gene similarity with already reported differ-nt Pseudoxanthomonas species which are involved with celluloseegradation showed that Pseudoxanthomonas sp R-28 formed a

M analysis: (a) 0 h, (b) 24 h, (c) 48 h and (d) 72 h. Arrow indicates the formation ofuefaction and formation of gaps as indicated by orange colored arrow.

distinct phylogenetic line among the other cellulolytic bacteria(Fig. 3). Evolutionary history showed that this could be a novelspecies of Pseudoxanthomonas sp capable of degrading the cellu-lose. Pseudoxanthomonas sp R-28 also showed degradation of othercarbohydrates like oat spelt xylan, birchwood xylan, Avicel PH101and �-cellulose powder (data not shown). Pure culture of Pseudox-anthomonas sp R-28 showed better degradation of filter than theCon R thus further experiments were done with pure culture.

3.3. Biodegradation of cellulosic waste by Pseudoxanthomonassp R-28

Biodegradation potential of Pseudoxanthomonas sp R-28 todegrade cellulosic waste as determined by providing cellulosicwaste as sole carbon source showed 50% degradation within 48 h ofincubation as compared to control which further increased to 97%at the end of incubation (Fig. 4a). Growth of Pseudoxanthomonas spR-28 also increased with time and coincided with the degradationof cellulosic waste. Modified logistic equation fitted to the exper-imental data showed a high correlation coefficient (R2) of 0.965suggesting that this model can be well used to describe the cellu-lose degradation by Pseudoxanthomonas sp R-28 (Fig. 6a). Similarly,

the real time degradation rate was calculated using Eq. (3) and thechange pattern was observed over time (Fig. 7). Maximum degra-dation rate of substrate (rs, absolute value) was observed at 48 h(0.052 g/L/h) which then decreased with time (Fig. 7).

M. Kumar et al. / Carbohydrate Pol

FR

t0lpielwsfibti

Fs

ig. 6. Regression fitting model of substrate degradation by Pseudoxanthomonas sp.-28: (a) waste paper; (b) rice straw.

Yu et al. (2012) reported maximum degradation of microcrys-alline cellulose by anaerobic consortium at 51.5 h with rs value of.14 g/L/h. Yu et al. (2012) used fresh cattle manure as an inocu-

um which is complex of many microbial species as compared toure Pseudoxanthomonas sp R-28. The difference in composition of

noculums could be attributed to higher rs value observed by Yut al. (2012). Morphological changes during the degradation of cel-ulose waste analyzed by SEM (Fig. 5) showed that at 0 h, surface

as smooth and free of trenches (Fig. 5a) whereas small fissurestarted appearing after 24 h of incubation (Fig. 5b). After 48 h, thesessures widened which then transformed into gaps at 72 h of incu-

ation (Fig. 5c and d). Also the liquefaction or amorphogenesis ofhe substrate was prominent which clearly indicated the reductionn the crystallinity index of the cellulose (Fig. 5d).

ig. 7. Comparative kinetic model of substrate degradation by Pseudoxanthomonasp. R-28. Substrate consumption rate was given in absolute value.

ymers 134 (2015) 761–766 765

3.4. Biodegradation of lignocellulosic waste byPseudoxanthomonas sp R-28

In recent years, more attention has been given to natural lig-nocellulose waste such as straws which are more recalcitrant tomicrobial degradation (Hui et al., 2013). Inoue, Yano, Endo, Sakaki,and Sawayama (2008) showed that digestibility of eucalyptusimproved with ball milling without using any chemicals. Similarpretreatment strategy (without toxic chemicals) was employed inthe current study to reduce the environmental pollution. Rice strawwas manually cut into pieces which was further grinded to obtainnear powdered sized substrate. Biodegradability of rice straw byPseudoxanthomonas sp R-28 was determined by measuring thegrowth, decrease in biomass weight (Eq. (1)) as well as total residualcarbohydrates (Fig. 4b). Maximum reduction of 49% by weight inrice straw was observed at 3rd day of incubation which increased to60% after 7 days as compared to control (Fig. 4b). After that only 8%reduction was observed between 7 and 15 days. Total carbohydratecontent decreased continuously over time and 60% was consumedafter 15 days. Growth of Pseudoxanthomonas sp R-28 concomitantlyincreased with degradation of rice straw (Fig. 4b). Hui et al. (2013)also reported that maximum degradation of rice straw (40%) wasobserved within the first six days by microbial consortium XDC-2.Similarly, Wang et al. (2011) reported 81% degradation of rice strawby a microbial consortium (WCS-6). Thus bioconversion yield ofun-pretreated rice straw (theoretical total carbohydrate 55–65%)of Pseudoxanthomonas sp R-28 was comparable to other reportedmicrobial communities. Lower correlation coefficient (R2) of 0.665was obtained for lignocellulosic waster as compared to pure cellu-losic waste degradation (Fig. 6b). Similarly, maximum degradationrate of rice straw (rs) was found to be less (0.025 g/L/h as com-pared to pure cellulose (0.052 g/L/h) however the trend remainssame in both cases (Fig. 7). This could be explained on the basis ofstructural differences between cellulose (cellulosic waste) and nat-ural lignocellulose (rice straw). Native cellulose (lignocellulose) isembedded deep into lignin and hemicellulose as compared to filterpaper, which may slow down the microbial attack on biomass (Pan,Gilkes, & Sadler, 2006; Shao, Lynd, Wyman, & Baker, 2009).

4. Conclusion

Technological challenges faced by the anaerobic system in termsof lower energy yield during the cellulose degradation processand requirement of strict anaerobic environment, underscore theurgency to develop a more efficient aerobic system. An aerobic bac-terial consortium was enriched which degraded more than 80%filter paper. Based on 16S rRNA, novel Pseudoxanthomonas sp R-28was identified which can degrade 95% of cellulosic waste and 60%of untreated lignocellulosic waste at lab scale. Kinetic model wasused to evaluate the degradation potential of Pseudoxanthomonassp R-28. Further experiments are needed to explore the potentialof Pseudoxanthomonas sp R-28 at industrial scale.

Acknowledgements

This research was supported by grants from the Science andEngineering Research Board (SERB), Department of Science Tech-nology, New Delhi, India. The funders had no role in study design,data collection and analysis, decision to publish, or preparation ofthe manuscript.

References

Annamalai, N., Rajeswari, M. V., Elayaraja, S., & Balasubramanian, T. (2013).Thermostable, haloalkaline cellulase from Bacillus halodurans CAS 1 byconversion of lignocellulosic wastes. Carbohydrate Polymers, 94(1), 409–415.http://dx.doi.org/10.1016/j.carbpol.2013.01.066

7 ate Po

B

B

D

F

H

H

H

I

I

K

K

K

K

L

66 M. Kumar et al. / Carbohydr

ayer, E. A., Lamed, R., & Himmel, M. E. (2007). The potential of cellulases andcellulosomes for cellulosic waste management. Current Opinion inBiotechnology, 18(3), 237–245. http://dx.doi.org/10.1016/j.copbio.2007.04.004

ond, P., Hugenholtz, P., Keller, J., & Blackall, L. (1995). Bacterial communitystructures of phosphate-removing and non-phosphate-removing activatedsludges from sequencing batch reactors. Applied and EnvironmentalMicrobiology, 61(5), 1910–1916.

u, R., Yan, J., Li, S., Zhang, L., Zhang, S., Li, J., et al. (2015). Cellulosic ethanolproduction by natural bacterial consortia is enhanced by Pseudoxanthomonastaiwanensis. Biotechnology for Biofuels, 8(1), 10. http://dx.doi.org/10.1186/s13068-014-0186-7

eng, Y., Yu, Y., Wang, X., Qu, Y., Li, D., He, W., et al. (2011). Degradation of raw cornstover powder (RCSP) by an enriched microbial consortium and its communitystructure. Bioresource Technology, 102(2), 742–747. http://dx.doi.org/10.1016/j.biortech.2010.08.074

ansgate, A. M., Schloss, P. D., Hay, A. G., & Walker, L. P. (2005). Molecularcharacterization of fungal community dynamics in the initial stages ofcomposting. FEMS Microbiology Ecology, 51(2), 209–214. http://dx.doi.org/10.1016/j.femsec.2004.08.009

uang, H.-C., Chen, L.-C., Lin, S.-B., Hsu, C.-P., & Chen, H.-H. (2010). In situmodification of bacterial cellulose network structure by adding interferingsubstances during fermentation. Bioresource Technology, 101(15), 6084–6091.http://dx.doi.org/10.1016/j.biortech.2010.03.031

ui, W., Jiajia, L., Yucai, L., Peng, G., Xiaofen, W., Kazuhiro, M., et al. (2013).Bioconversion of un-pretreated lignocellulosic materials by a microbialconsortium XDC-2. Bioresource Technology, 136, 481–487. http://dx.doi.org/10.1016/j.biortech.2013.03.015

noue, H., Yano, S., Endo, T., Sakaki, T., & Sawayama, S. (2008). Combininghot-compressed water and ball milling pretreatments to improve theefficiency of the enzymatic hydrolysis of eucalyptus. Biotechnology for Biofuels,1(1), 2. http://dx.doi.org/10.1186/1754-6834-1-2

tzhaki, R. F., & Gill, D. M. (1964). A micro-biuret method for estimating proteins.Analytical Biochemistry, 9, 401–410.

ato, S., Haruta, S., Cui, Z. J., Ishii, M., & Igarashi, Y. (2008). Network relationships ofbacteria in a stable mixed culture. Microbial Ecology, 56(3), 403–411. http://dx.doi.org/10.1007/s00248-007-9357-4

umar, M., Joshi, A., Kashyap, R., & Khanna, S. (2011). Production of xylanase byPromicromonospora sp MARS with rice straw under non sterile conditions.Process Biochemistry, 46(8), 1614–1618. http://dx.doi.org/10.1016/j.procbio.2011.05.003

umar, M., & Khanna, S. (2010). Diversity of 16S rRNA and dioxygenase genesdetected in coal-tar-contaminated site undergoing active bioremediation.Journal of Applied Microbiology, 108(4), 1252–1262. http://dx.doi.org/10.1111/j.1365-2672.2009.04523.x

umar, M., & Khanna, S. (2014). Shift in microbial population in response tocrystalline cellulose degradation during enrichment with a semi-desert soil.International Biodeterioration & Biodegradation, 88, 134–141. http://dx.doi.org/

10.1016/j.ibiod.2013.10.025

angner, H. W., Inskeep, W. P., Gaber, H. M., Jones, W. L., Das, B. S., & Wraith, J. M.(1998). Pore water velocity and residence time effects on the degradation of2,4-D during transport. Environmental Science & Technology, 32(9), 1308–1315.http://dx.doi.org/10.1021/es970834q

lymers 134 (2015) 761–766

Lei, L., Li, S., & Gu, Y. (2012). Cellulose synthase complexes: Composition andregulation. Frontiers in Plant Science, 3, 75. http://dx.doi.org/10.3389/fpls.2012.00075

Lv, Z., Yang, J., Wang, E., & Yuan, H. (2008). Characterization of extracellular andsubstrate-bound cellulases from a mesophilic sugarcane bagasse-degradingmicrobial community. Process Biochemistry, 43(12), 1467–1472. http://dx.doi.org/10.1016/j.procbio.2008.08.001

Lynd, L. R., Weimer, P. J., van Zyl, W. H., & Pretorius, I. S. (2002). Microbial celluloseutilization: fundamentals and biotechnology. Microbiology and MolecularBiology Reviews, 66(3), 506–577.

Murali, S., Shrivastava, R., & Saxena, M. (2010). Green house gas emissions fromopen field burning of agricultural residues in India. Journal of EnvironmentalScience & Engineering, 52(4), 277–284.

Pan, X., Gilkes, N., & Saddler, J. N. (2006). Effect of acetyl groups on enzymatichydrolysis of cellulosic substrates. Holzforschung, 60(4.) http://dx.doi.org/10.1515/HF.2006.062

Petre, M., Zarnea, G., Adrian, P., & Gheorghiu, E. (1999). Biodegradation andbioconversion of cellulose wastes using bacterial and fungal cells immobilizedin radiopolymerized hydrogels. Resources, Conservation and Recycling, 27(4),309–332. http://dx.doi.org/10.1016/S0921-3449(99)00028-2

Russell, J. B., Muck, R. E., & Weimer, P. J. (2009). Quantitative analysis of cellulosedegradation and growth of cellulolytic bacteria in the rumen. FEMSMicrobiology Ecology, 67(2), 183–197. http://dx.doi.org/10.1111/j.1574-6941.2008.00633.x

Schloss, P. D., Hay, A. G., Wilson, D. B., Gossett, J. M., & Walker, L. P. (2005).Quantifying bacterial population dynamics in compost using 16S rRNA geneprobes. Applied Microbiology and Biotechnology, 66(4), 457–463. http://dx.doi.org/10.1007/s00253-004-1727-y

Shao, X., Lynd, L., Wyman, C., & Bakker, A. (2009). Kinetic modeling of cellulosicbiomass to ethanol via simultaneous saccharification and fermentation: Part I.Accommodation of intermittent feeding and analysis of staged reactors.Biotechnology and Bioengineering, 102(1), 59–65. http://dx.doi.org/10.1002/bit.22048

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology andEvolution, 30(12), 2725–2729. http://dx.doi.org/10.1093/molbev/mst197

Velichkov, A. D. (1992). A simple procedure for dissolving fungal cell wallpreparations for the analysis of neutral sugars. World Journal of Microbiology &Biotechnology, 8(5), 527–528. http://dx.doi.org/10.1007/BF01201953

Wang, W., Yan, L., Cui, Z., Gao, Y., Wang, Y., & Jing, R. (2011). Characterization of amicrobial consortium capable of degrading lignocellulose. BioresourceTechnology, 102(19), 9321–9324. http://dx.doi.org/10.1016/j.biortech.2011.07.065

Wilson, D. B. (2011). Microbial diversity of cellulose hydrolysis. Current Opinion inMicrobiology, 14(3), 259–263. http://dx.doi.org/10.1016/j.mib.2011.04.004

Yu, L., Chen, Z.-X., Tong, X., Li, K., & Li, W.-W. (2012). Anaerobic degradation ofmicrocrystalline cellulose: Kinetics and micro-scale structure evolution.

Chemosphere, 86(4), 348–353. http://dx.doi.org/10.1016/j.chemosphere.2011.09.049

Zwietering, M. H., Jongenburger, I., Rombouts, F. M., & van’t Riet, K. (1990).Modeling of the bacterial growth curve. Applied and EnvironmentalMicrobiology, 56(6), 1875–1881.