ORIGINAL ARTICLE

Maize csmd1 exhibits pre-meiotic somatic and post-meioticmicrospore and somatic defects but sustains anther growth

Dongxue Wang • David S. Skibbe • Virginia Walbot

Received: 29 December 2010 / Accepted: 18 March 2011 / Published online: 8 April 2011

� Springer-Verlag 2011

Abstract Maize male reproductive development is com-

plex and lengthy, and anther formation and pollen matu-

ration are precisely and spatiotemporally regulated. Here,

we document that callose, somatic, and microspore defect

1 (csmd1), a new male-sterile mutant, has both pre-meiotic

somatic and post-meiotic gametophyte and somatic defects.

Chromosome behavior and cell developmental events were

monitored by nuclear staining viewed by bright field

microscopy; cell dimensions were charted by Volocity

analysis of confocal microscopy images. Aniline blue

staining and quantitative assays were performed to record

callose deposition, and expression of three callose synthase

genes was measured by qRT-PCR. Despite numerous

defects and unlike other maize male-sterile mutants that

show growth arrest coincident with locular defects, csmd1

anther elongation is nearly normal. Pre-meiotically and

during prophase I, there is excess callose surrounding the

meiocytes. Post-meiotically csmd1 epidermal cells have

impaired elongation but excess longitudinal divisions, and

uninucleate microspores cease growth; the microspore

nucleoli degrade followed by cytoplasmic vacuolization

and haploid cell collapse. The single vascular bundle

within csmd1 anthers senesces precociously, coordinate

with microspore death. Although csmd1 anther locules

contain only epidermal and endothecial cells at maturity,

locules are oval rather than collapsed, indicating that these

two cell types suffice to maintain an open channel within

each locule. Our data indicate that csmd1 encodes a crucial

factor important for normal anther development in both

somatic and haploid cells, that excess callose deposition

does not cause meiotic arrest, and that developing pollen is

not required for continued maize anther growth.

Keywords csmd1 � Maize � Microspore �Post-meiosis � Pre-meiosis

Introduction

Male floral and gametophyte development is complex and in

maize requires 1 month (Ma et al. 2008; Bedinger and

Fowler 2009). Anther ontogeny begins with formation of

stamen primordia by a floral meristem, with subsequent cell

division and differentiation organized to form a stamen fil-

ament and anther (Goldberg et al. 1993). Anthers contain a

central vascular bundle, continuous with the vascular tissue

of the filament, and four locules within which pollen mother

cells (PMC) differentiate as competent for meiosis. The

PMC are distinguished by their round shape, central location

in each locule, and a coating of callose. In maize and most

angiosperms, the PMC are surrounded by four somatic tis-

sues, each just one cell layer wide: tapetum, middle layer,

endothecium, and epidermis. The PMC undergo meiosis to

produce tetrads of haploid cells, which are held together

by callose. Young microspores are released after callose

dissolution, which relies on enzymatic action by beta

1,3-glucanase (callase), a protein secreted by the tapetum.

Post-meiotic anther development involves substantial

growth and formation of specialized gametophyte structures

as well as remodeling of somatic locular cells, particularly

Communicated by Sheila McCormick.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00497-011-0167-y) contains supplementarymaterial, which is available to authorized users.

D. Wang (&) � D. S. Skibbe � V. Walbot

Department of Biology, Stanford University,

Stanford, CA 94305-5020, USA

e-mail: wangdx@stanford.edu

123

Sex Plant Reprod (2011) 24:297–306

DOI 10.1007/s00497-011-0167-y

the tapetum, for new functions. Young microspores acquire

an exine and intine, coatings secreted by tapetal and haploid

cells; within these coatings an annulus and germ pore form

(Bedinger and Fowler 2009). An asymmetric, haploid

mitotic division gives rise to a pollen grain containing two

cells: a larger vegetative cell and a smaller generative cell.

In maize, the generative cell within the young pollen divides

again to form two sperm cells, while in many other plant

species this second mitosis occurs only after pollen tube

germination (Bedinger and Fowler 2009).

Male-sterile mutants in flowering plants are conveniently

divided into three types—those that disrupt pre-meiotic

anther development, meiotic arrest mutants, or defective

pollen development cases. Over 50 maize male-sterile

mutants have been previously identified (Skibbe and

Schnable 2005). In maize, both somatic cell and PMC dif-

ferentiation abnormalities prior to meiosis cause failure of

PMC differentiation or meiotic arrest in prophase I in the

mutants analyzed thus far. Examples include msca1 in

which anther cells differentiate as leaf cell types (Chaubal

et al. 2003), mac1 which lacks a tapetum and middle layer

but has too many PMCs (Sheridan et al. 1996), ms23 and

ms32 (Chaubal et al. 2000) both of which have a double

layer ‘‘pre-tapetal’’ cell type that fails to support the PMCs,

and ms8, in which there are epidermal and tapetal defects

(Wang et al. 2010). In all of these cases of pre-meiotic

arrest, anthers growth ceases at about 2 mm, the length

typical of the early meiotic stage in fertile anthers. In con-

trast, post-meiotic mutants reach normal or nearly normal

length, but typically do not exert. Similarly in Arabidopsis,

pre-meiotic mutants cease growth while anthers with post-

meiotic defects typically continue to grow (Ma 2005).

In post-meiotic mutants in which microspores or pollen

collapse and then degrade, a second growth defect is

obvious: collapsed locules. Maize has an unusual

arrangement of pollen grains within each anther, because

maturing pollen is attached to the collapsed tapetal plus

middle layer walls in a single, helical layer (Kirpes et al.

1996). This peripheral organization with a hole in the

middle of each locule is unusual among angiosperms,

which typically have a jumble of pollen grains occupying

the entire central locular volume. After meiosis, both the

tapetal and middle layers of the locule collapse, therefore,

maintenance of locular shape has been inferred to require

either the tight packing of pollen against the remaining

endothecial and epidermal layers, to reinforce structure as

in maize or the occupancy of the central cavity by pollen to

maintain a smooth locular shape.

Callose is a linear 1,3-b-glucan polymer with some 1,6

branches; it is an important structural component in PMC,

and callose remodeling is required for gametophyte

development (Toller et al. 2008). Its deposition starts

before meiotic prophase in the PMC, reaches a peak at the

tetrad stage when the callose encloses the four microspores,

and is then dissolved by callase (1,3-b-glucanase) (Popova

et al. 2008). Previous studies in petunia, sorghum, tobacco,

and Arabidopsis showed that the timeliness of callose

deposit and degradation are crucial for normal pollen

development (Izhar and Frankel 1971; Warmke and

Overman 1972; Worrall et al. 1992; Hong et al. 2001;

Dong et al. 2005; Zhang et al. 2007; Toller et al. 2008; Zhu

et al. 2008). In maize, ms8 (male sterility 8) PMCs are

covered by excessive callose, one of several defects

thought to result in early meiotic failure.

Here, we analyzed csmd1 (callose, somatic, and micro-

spore defect 1), a maize mutant with excess callose pre-

meiotically, normal meiosis, and numerous post-meiotic

defects at the uninucleate microspore stage. csmd1 is

unusual in having abnormal development before meiosis

without exhibiting meiotic arrest, and csmd1 anthers are the

first example of a male-sterile mutant with a pre-meiotic

phenotype that maintains near normal anther elongation

and locular shape after early microspore abortion. csmd1

microspores fail at the uninucleate stage: nucleoli degrade,

the cytoplasm vacuolizes and then cells collapse and dis-

appear quickly. Somatic defects are also evident: epidermal

cells show poor elongation and vascular bundle tissue

senesces precociously. The current study summarizes csmd1

features comprehensively and in comparison with alleles of

ms10, a second post-meiotic mutant that maps close to

csmd1. Maize is a valuable crop, and historically male ste-

rility has been used in hybrid seed production to insure that

ear parents receive pollen from a second line (Duvick 2001).

Reliance on a single type of sterility in the 1960s resulted in

massive crop failure when a fungal pathogen Helmintho-

sporium maydis evolved to cause widespread disease in

Texas cytoplasm maize (Wise et al. 1999). Given the high

cost of producing hybrid corn by detasseling, however,

reintroduction of male sterility, if properly managed, could

be warranted. Maize also has notable advantages for inves-

tigation of male reproductive development, principally the

early carpel abortion and large cohorts of anthers maturing

in near synchrony on the tassel (Bedinger and Fowler 2009;

Wang et al. 2010). Analysis of male-sterile mutants that

disrupt normal somatic and haploid cell differentiation

should help pinpoint mechanisms underlying the normal

progression of developmental events, and could be used as

the future foundation for reliable hybrid seed production.

Materials and methods

Plant material

csmd1 was obtained in the ND101 inbred line from I.

Golubovskaya (University of California, Berkeley). It was

298 Sex Plant Reprod (2011) 24:297–306

123

maintained in 1:1 segregating families (csmd1//csmd1 9

csmd1//?) in summer fields at Stanford University or in

greenhouses equipped with lights to supply 50% of summer

solar fluence of visible wavelengths.

Morphological and microscopy assays

Sample dissection and bright-field microscopy followed a

published protocol (Wang et al. 2010). Anthers from the

upper floret were pooled from several spikelets after

careful developmental staging. Transverse sections were

prepared for bright field observation on a Zeiss/P.A.L.M.

Laser Dissecting Microscope (Wang et al. 2009). Aniline

blue (Sigma–Aldrich, http://www.sigmaaldrich.com)

staining and callose fluorimetric quantitative assay were

done as described previously (Kohle et al. 1985; Wang

et al. 2010). Four biological replicates were used from

fertile and csmd1 plants for callose fluorimetric quantita-

tive assay. Fifty upper floret anthers from each biological

replicates were pooled after developmental staging, then

callose was extracted for further quantitative assay, data

were averaged and analyzed in EXCEL (Microsoft,

http://www.microsoft.com). Chromosome behavior in

meiocytes and microspores was observed by hematoxylin-

iron-aceto-carmine staining (Chang and Neuffer 1989).

Propidium iodide (CalBiochem, now supplied by Merck

http://www.merck-chemicals.com) staining with Triton

treatment, which resulted in a nuclear stain for confocal

imaging (Leica TCS SP5, Leica Microsystem), was per-

formed as described previously (Kelliher and Walbot 2011;

Wang et al. 2010); cell and organ dimension measurements

were calculated with VOLOCITY software (PerkinElmer,

http://www.perkinelmer.com). For meiocytes and micro-

spores, anther locule wall and anther locule dimension

comparisons, four biological replicates were used from

fertile and csmd1 plants. Four upper floret anthers from

each biological replicates were examined for each stage of

morphometric analysis; all the data were averaged among

replicates and analyzed in EXCEL (Microsoft, http://www.

microsoft.com). Standard deviations are shown in all

figures.

qRT-PCR assay

Total RNA was extracted with TRIzol (Invitrogen,

http://www.invitrogen.com), and qRT-PCR conditions

followed published protocols (Ma et al. 2008). Primers

pairs for three callose synthase-like genes were designed

using Primer3 (http://frodo.wi.mit.edu/primer3) and

synthesized by Illumina (San Diego, CA, USA), for

TC290630, forward 50GGCTATTTGCACCCTTTCTG30

and reverse: 50TCCACTTCCCACCAAGATTC30; for

TC288066, forward 50TGAGTGGCAGAAGATTGTGG30

and reverse 50CTCCCAGCTTTTCTCTGGTG30; for

TC288068, forward 50TGAGTGGCAGAAGATTGTGG30

and reverse 50CTCCCAGCTTTTCTCTGGTG30.

Molecular mapping of csmd1 using bulked segregant

analysis

Equal amounts of genomic DNA from 22 male fertile or

from 17 male sterile individuals were used to make two

bulked DNA pools (Pedigree IG5272-2 self). The two

bulked DNA pools were screened against a panel of 192

co-dominant PCR markers derived from the ISU Maize

Mapping Project (Fu et al. 2006) for the initial placement

in the maize genome. The markers were evenly spaced

throughout the genome with an average and median dis-

tance between markers of 9.4 and 8.6, respectively. All

PCR reactions were performed using HiFi Platinum Taq

DNA Polymerase (Invitrogen, http://www.invitrogen.com)

at an annealing temperature of 60�C with 35 cycles at an

extension time of 1.5 min at a 72�C. Amplicons from the

reactions were resolved on a 2.0% (w/v) agarose/Tris–

Borate EDTA (pH = 8.3) gel, and scored for polymor-

phisms that distinguished fertile from sterile.

Results

csmd1 has a morphologically normal tassel and anthers

Observations of plant morphology were made in families

segregating 1:1 fertile (csmd1//?): sterile (csmd1//csmd1).

The fertile tassels of the ND101 inbred line average 20

branches (Fig. 1a), more branches compared to other inbred

lines (Wang, unpublished data); spikelets had pink glumes

and were densely packed along each branch (Fig. 1b).

Fertile anthers were yellow early in development, then

transitioned to pink, and became plum-colored by exertion

(Fig. 1b); fertile, plump anthers typically reached 6 mm in

length (Fig. 1c). Unlike other maize male-sterile mutants in

which tassels are often smaller and flat looking (Wang et al.

2010), csmd1 tassels were always morphologically normal

(Fig. 1d); they had 17 branches on average, arrayed with

normal-looking spikelets (Fig. 1d, data not shown). Their

only macro-defect is that no anthers exerted (Fig. 1d).

Glumes were pink (Fig. 1e, f), and mutant anthers acquired

pink pigmentation and grew to almost 6 mm (Fig. 1g). In

contrast to fertile, the mutant anthers remained pink and

were slightly slimmer and softer (Fig. 1c, g).

Extra callose deposition in csmd1 locules by prophase I

Maize anthers are staged by length (Ma et al. 2008), and

key developmental landmarks (Kelliher and Walbot 2011)

Sex Plant Reprod (2011) 24:297–306 299

123

as illustrated in Fig. 2. Anthers of csmd1 and sibling fertile

plants reached these landmarks at the same days post-

planting and anther lengths; there was no evidence for

developmental delay or acceleration in csmd1 anthers. By

cytological analysis, the PMCs had entered prophase I in

both csmd1 and normal siblings at the 1.5 mm length stage.

Although csmd1 anthers had a normal external appearance,

internally, the PMCs were more separated from each other

and extra callose accumulated around them at the 1.5 mm

stage (Fig. 3, comparing a, b with c, d). By quantitative

assay, the csmd1 mutant had about 3 times more callose at

prophase I (Fig. 3m). Based on qRT-PCR, each of the three

genes encoding callose synthase-like proteins had signifi-

cantly higher expression during prophase I in csmd1

anthers (Fig. 3n). Subsequently by mid-meiosis, the callose

amount and distribution microscopically were similar to

wild-type; both fertile and csmd1 meiocytes were separated

and packaged with moderate callose (Fig. 3e–l). Abnormal

callose during prophase I was predictive for the post-

meiotic arrest of csmd1 microspores.

Nucleolar degradation in csmd1 microspores

at the uninucleate stage and post-meiotic haploid cell

differentiation failure

csmd1 mutant meiocytes performed all steps in meiosis

normally (Figs. 2, 4a and Supplemental Fig. 1). Post-mei-

otically, in fertile anthers, young microspores initiated

differentiation soon after their release, vacuoles formed,

then exine and intine structures assembled during the uni-

nucleate stage (Fig. 4b, c). By the late uninucleate stage,

the germ pore and annulus were clearly visible (Fig. 4d).

Creases occur from the pressure of the cover slip on the

rigid, spherical pollen wall; this is a characteristic of nor-

mal microspores that is used to distinguish normal from

abnormal developing pollen in maize (Chang and Neuffer

1994). In contrast, although csmd1 free young microspores

started with a normal phenotype (Fig. 4f), the nuclei

migrated to the cell margin (Fig. 4g), and afterwards the

nucleoli disappeared (Fig. 4h) followed by extensive

cytoplasm vacuolization. No clear exine or intine was

formed by the mutant microspores (Fig. 4f–i). Besides

these developmental defects, the cell diameters were

abnormal in csmd1. Mutant cells had normal diameters

until the early uninucleate stage, but they ceased growing

Fig. 1 Morphological analysis of csmd1 and fertile tassels and

anthers. Fertile tassels in the ND101 background averaged 20

branches (a). csmd1 mutant tassels are similar to fertile sibs, with

about as many branches as normal (d). Normal anthers were covered

by a pink lemma; they became plum colored and reached *6 mm

before dehiscence (b, c); csmd1 spikelets shared most of these

features (e, f), and the anthers were as long as normal (g). csmd1anthers showed several subtle differences: slightly paler color,

slimmer, and softer than normal (g). Scale bars = 10 mm (a, b, e, dand f); scale bars = 1 mm (c and g)

sbiselitreF csmd1Pre-meiotic anthers (PMC maturing) 1 mm length

Entry into prophase I, 1.5 mm length

Mid-prophase I → Dyad, 2.0 mm length

Tetrad, 2.5 mm length

Free young microspore, 3.0 mm length

Early uni-nucleate stage 3.0 mm length 3.0 mm length Middle uni-nucleate stage 3.5 mm length 3.5 mm length Late uni-nucleate stage 3.8 mm length N/A Pollen mitosis 4.0 mm length N/A

Fig. 2 Overview of male gametophyte development and anther

length. Key stages during gametophyte development and correspond-

ing csmd1 and fertile sibs anther lengths are illustrated. csmd1 anthers

followed the normal anther progression, although the csmd1 young

microspores stop differentiating and collapsed before mitosis. Scalebars = 10 lm

300 Sex Plant Reprod (2011) 24:297–306

123

at half the final normal size, and subsequently they col-

lapsed (Fig. 4a). The post-meiotic defect in csmd1 occurs

at the transition to the middle uninucleate stage when

microspores cease growing, and there is a precipitous

decline in cellular structure.

Post-meiotic csmd1 anthers have both epidermal cell

division and locule area and shape defects

In term of the epidermis, the csmd1 cells were well orga-

nized pre-meiotically and post-meiotically with a normal

width (Fig. 5a–e, comparing b, c with d, e, respectively).

The epidermal cells are also normal in transverse sections

(Supplemental Fig. 2). Epidermal cells were defective in

cell elongation (Fig. 5f), a phenotype similar to ms8 but

occurring later in anther development (Wang et al. 2010).

For fertile anthers, both cell elongation and division con-

tribute to anther growth (Fig. 5f), however, csmd1 epider-

mal cells had more divisions and therefore, generated more

and smaller cells to sustain anther length increases, from

2 mm to almost 6 mm. Both the endothecium and tapetum

of csmd1 had normal dimensions (Fig. 5g) and cellular

phenotypes (Supplemental Fig. 2). It appears that the

excess cell divisions and abnormal elongation of epidermal

cells did not impact the sub-epidermal layers. Normal

anthers are composed of 4 round locules (Fig. 5h, i and

Supplemental Fig. 2a–e show cytology and Fig. 5 l is a

dimension comparison). The pollen mother cells, subse-

quently meiotic cells, and developing pollen are centrally

located in each locule. csmd1 anthers had similarly round

locules before and during meiosis (Fig. 5l), but their shape

changed to oval when the microspores degraded (Fig. 5l),

and then narrowed further when all microspores collapsed

(Fig. 5j–l). Dimensional comparisons clearly indicated that

one diameter of csmd1 reduced significantly, and the loc-

ular volume was about 50% of normal (Fig. 5l, m). It is

worth noting that only the y axis was reduced in csmd1; the

x axis was not affected (Fig. 5j–l). The central vascular

0

20

40

60

80

100

1.5 mm fertile anther

b

f

i j

c d

g h

k l

m

0

1

2

3

4

TC290630 TC288066 TC288068

n

ng c

allo

se p

er a

nthe

r

Fold

cha

nge

in tr

ansc

ript

ab

unda

nt o

f 1.

5 m

m a

nthe

r

1.5 mm csmd1 anther

1.5 mm fertile anther 1.5 mm csmd1 anther

2.0 mm fertile anther 2.0 mm csmd1 anther

2.5 mm fertile anther 2.5 mm csmd1 anther

a

e

Fig. 3 Light and fluorescence microscopic observation of callose in

fertile and csmd1 anthers. Panels a, c, e, g, i and k are bright field and

UV merged images; fluorescence in fertile (b, f and j), and csmd1(d, h and l) anthers under UV illumination is also shown. All images

were obtained on a Zeiss/P.A.L.M. Laser Dissecting Microscope. By

the beginning of meiosis (a–d), extra callose was deposited among

csmd1 meiocytes and separated them from each other; during meiosis,

the callose pattern was restored to normal presumably by degradation

(e–l). m Quantitative assay showed 1.5 mm csmd1 anthers with PMC

in prophase I of meiosis had threefold more callose than normal

anthers at prophase I of meiosis. Prophase I staging of csmd1 and

fertile anthers was performed by examination of chromosome staining

(data not shown). The y axis shows the callose amount based on

fluorescence intensity. n qRT-PCR showed that three callose

synthase-like genes (TC290630, TC288066, and TC288068) had

higher expression in 1.5 mm csmd1 anthers during the early meiotic

stage. Fold changes relative to fertile siblings are shown by bars.

Scale bars = 75 lm. Error bars: SD

Sex Plant Reprod (2011) 24:297–306 301

123

bundle tissue may strengthen locule shape in the region

adjacent to the connective tissue. Furthermore, epidermal

and endothecial cells suffice to maintain an oval shape.

csmd1 vascular bundle cells degrade precociously

Vascular bundle tissue derives from the L3 layer of the

meristem. Stamens contain a single vascular bundle that

proceeds up the filament into the anther; this vascular

tissue is surrounded by connective parenchyma tissue

(Fig. 6a–c), supplying nutrients and water to the anther

(Goldberg et al. 1993). Normally, the living vascular and

connective tissue cells persist throughout gametophyte

development, and they degenerate shortly before anther

dehiscence. At this late stage only, the cell wall outlines

were visible (Fig. 6a–c). The csmd1 vascular bundle and

connective tissue cells were alive when the microspores

were normal, because there was intense propidium iodide

staining of nuclei along the whole anther (Fig. 6d).

Degradation was contemporaneous with microspore

degeneration (Fig. 6e, f); no nuclei were detectable by

propidium iodide staining and only cell walls were visu-

alized (Fig. 6e, f). Multiple images were investigated to

search for nuclei, and only cell wall outlines were found

by confocal imaging. Moreover, normal vascular bundle

and connective tissue grew steadily (Fig. 6a–c), but for

csmd1, these tissues shrank after meiosis (Fig. 6d–f). One

hypothesis is that vascular degeneration in csmd1 limits

nutrient delivery, and this could explain microspore fail-

ure. Alternatively, microspore degeneration may trigger

precocious senescence of some anther tissues. Once the

vascular tissue begins to senescence, csmd1 anthers have

limited nutrient supplies, but they do sustain elongation to

a nearly normal length.

csmd1 is a new maize male sterile mutant

Bulked segregant analysis on male fertile and male-sterile

genomic DNA pools from a progeny segregating for csmd1

established that csmd1 is located in Bin 10.04, between

a

Early Uninucleate Middle Uninucleate Late Uninucleate Pollen Mitosis

Early Uninucleate Middle Uninucleate Late Uninucleate Pollen Mitosis

b c d e

f g h i

0

20

40

60

80

100 Fertile csmd1

Leptotene Pachytene Diakinesis Tetrad Free MSP

Early uninucleate

Late uninucleate

Pollen mitosis

Dia

met

er o

f ce

ntra

l cel

ls (

µm)

Maturing pollen

Fig. 4 Post-meiotic developmental comparison of csmd1 to fertile

siblings. Young microspores were extruded from dissected anthers

and then stained by hematoxylin-iron-aceto-carmine solution and

observed under bright field; plant fertility was scored at tassel

emergence. a Diameter comparison of meiocytes and microspores.

The y axis shows the diameter (lm) and the x axis shows the

developmental stages. The maturing pollen category represents three

stages: bi-nucleate (first bar), second mitosis (second bar), and

trinucleate (third bar). Just released csmd1 free young microspores

had normal cytoplasm (b, f), however, they did not grow in size

(compare c–g, d–h, and e–i), and no exine/intine or annulus formed

(compare c–e, and g–i). The csmd1 nucleoli degraded followed by

cytoplasm vacuolization and degeneration (compare d–e, and h–i).Meanwhile, normal young microspores grew gradually (a), and

developed a germ pore and annulus with a rigid spherical pollen wall

(d, e, arrows). Scale bars = 10 lm (b–i). Error bars: SD. MSPmicrospore

302 Sex Plant Reprod (2011) 24:297–306

123

295.29 and 295.90 of the IBM2 2008 Neighbors 10. Seven

other maize genes (ms10, ms11, ms24, ms29, ms49, and

ms52) are also located on chromosome 10. However, only

ms10, another post-meiotic mutant (Cheng et al. 1979,

Supplemental Fig. 3) with an estimated position at 264.00,

chromosome 10 on the IBM2 2008 Neighbors 10 map

(www.maizegdb.org) is located in the same bin. Because

both csmd1 and ms10 have developmental defects during

middle uninucleate stage, such as excess vacuoles, germ

pore/annulus developmental failure, and young microspore

degradation (Supplemental Fig. 3), reciprocal genetic

complementation tests were performed between csmd1 and

ms10. In all cases, complementation was observed, there-

fore, they are two separate genes (data not shown).

0 20 40 60 80

100 120 140

L W L W L W L W

Fertile csmd1

L W L W L W L W 0

10

20

30

40

50

60

300

200

100

0

80

60

40

20

0

Fertile csmd1

Pre-meiosis Meiosis Dyad Free MSP Binucleate Trinucleate

2.0 3.0 4.0 5.0

2.0 3.0 4.0 5.0

x diameter y diameter x diameter y diameter

Fertile csmd1

Width

Length

Pre-meiosis Meiosis Dyad Free MSP Pollen mitosis Binucleate Trinucleate

a b c d e

f

g

h i j k

l

m

Fertile csmd1

y

x y

x

400

Epi

derm

al c

ell d

imen

sion

(µ m

)

Anther length (mm)

Anther length (mm)

End

othe

cial

cel

l dim

ensi

on (

µm)

Loc

ule

diam

eter

(µm

)L

ocul

e ar

ea (

µm2 ×

103 )

pollen pollen

pollen pollen

Fig. 5 Dimensional

comparisons for anther cell

layers and locule area. The two

orientations illustrated in a were

measured for epidermal and

endothecial cell layers and the

entire locule. b and c are normal

epidermal cells when anthers

were 4 and 5 mm in length,

respectively; anthers grow in

both length and width (f). d and

e are csmd1 epidermal cells

when anthers were at the 4 and

5 mm stages; csmd1 epidermal

cells were normal looking (d, e),

and had a normal width

expansion (f), whereas there

was no apparent increase in cell

length (d–f). In term of

endothecial cells, csmd1 anthers

showed similar dimensions to

their fertile counterparts during

all developmental stages (g).

Fertile anther locules were

almost round in side view, filled

with meiocytes or microspores

(h, i). csmd1 locules also had a

round shape before and during

meiosis. They became oval

when young microspores were

degrading, and later became

very narrow when all young

microspores were degraded

(j, k). Two dimensions

demonstrated in i, and k were

investigated, and (l) shows their

comparison during the entire

developmental process.

Consistent with the csmd1locule shape, mutant dimension

patterns were normal at first,

then the y axis reduced

dramatically at the uninucleate

stage to only ‘‘half-length’’ (l).

Locule area was calculated by

Volocity software (m); fertile

locules kept on growing

whereas the csmd1 locule area

stopped expanding and only

reached 50% of the normal

volume. Scale bars = 50 lm.

Error bars: SD. L anther cell

length; W anther cell width;

MSP microspore

Sex Plant Reprod (2011) 24:297–306 303

123

Discussion

csmd1 is a newly investigated mutant with no previous

description. Interestingly, csmd1 anthers have a nearly

normal external appearance and reach nearly normal length

despite internal defects, which is quite different from other

maize mutants with detectable pre-meiotic phenotypes (Ma

et al. 2007; Vernoud et al. 2009; Wang et al. 2010). Typ-

ically, male-sterile mutant anthers stop growing when

meiocytes or young microspores fail and collapse. For

example, ms8 anthers and ms10-6001 anthers are shrunken

and only about 3 mm long (Wang et al. 2010; Wang

unpublished data). mac1, msca1, and ms23 are three

mutants with early defects, the mutant anthers also senesce

prematurely (Ma et al. 2007). OCL4 (outer cell layer 4)

encodes a HD-ZIP IV class family protein and influences

division and/or differentiation of the anther epidermal cell

layer (Vernoud et al. 2009). ocl4 anthers are both shorter

and slimmer than normal, an additional case of growth

arrest in mutant maize anthers (Vernoud et al. 2009).

Besides maize, many rice, and Arabidopsis anther mutants

have tiny anthers with growth failure, i.e., gamyb-4 (Liu

et al. 2010) and roxy1 roxy2 (Xing and Zachgo 2008).

Therefore, this analysis of csmd1 indicates that haploid

developmental defects do not necessarily cause somatic

cell layer growth failure although such arrest is typical of

other male-sterile mutants.

To date, only ms8 and csmd1 have detailed anther cell

and locule dimensional analyses. Both ms8 and csmd1

epidermal cells are deficient in longitudinal elongation,

ms8 anthers are dwarf, and this defect is present pre-

meiotically. csmd1 epidermal cells had extra divisions

post-meiotically to offset their elongation deficit, and

anthers reached an almost normal final length. Endothecial,

middle layer, and tapetal cells all appeared to be normal in

number (Fig. 5g; data not shown). Therefore, csmd1 con-

firms the conclusion reached in analysis of ms8 that the L1

derived epidermis is autonomous in growth regulation from

the L2-derived inner tissues (Goldberg et al. 1993; Wang

et al. 2010). Epidermal defects do not influence the inner

layers, even the adjacent endothecium, suggesting that

there is little communication between the L1 and the L2-

derived and L3-derived anther tissues.

csmd1 anthers have four oval locules, although all of

them lack developing pollen. In many other maize, male-

sterile mutants lacking meiocytes or microspores, the loc-

ule walls stick together and usually there is no empty locule

space, i.e., ms10-6001 and ms8 (Wang, unpublished data).

Rice mutants udt1 and tdr also illustrate complete locule

collapse (Jung et al. 2005; Li et al. 2006). Because the

empty locules of csmd1 retain an open space, it is clear that

the epidermal and endothecium layers are strong enough to

maintain this feature even after the normal senescence of

the tapetal and middle layers in the absence of developing

pollen. In contrast, microspore development is necessary to

sustain locule volume increases normally observed during

pollen maturation.

L3-derived vascular bundle tissue delivers nutrients and

the water supply; however, very few publications have

commented on the fate of these cells. Our study showed

that these cells contribute to girth growth of maize anthers

and that their senescence is very late, coordinate with final

pollen maturation and dehiscence. Although vascular

bundle tissue is not adjacent to the microspores, there

Fig. 6 By confocal imaging, the nuclei of csmd1 vascular bundle

cells degrade precociously. Imaging was performed after propidium

iodide staining (‘‘Materials and Methods’’) to visualize nuclei

(Kelliher and Walbot 2011). Individual anthers were scanned, and

the patterns were the same throughout the anther; typical images were

selected. Normal vascular bundle cells have nuclei during the free

young microspore (a), and pollen mitosis stages (b). Their nuclei

degrade when pollen matures (c); most cells retain only their walls at

pollen maturation (c). csmd1 vascular bundle cells looked normal

when young microspores were just released (d); their nuclei degrade

at the same stage when microspores collapse, and only cell outlines

are seen (e). The entire connective tissue shrank progressively (f),whereas the normal counterpart enlarged gradually from the uninu-

cleate stage (a–c). Scale bars 75 lm

304 Sex Plant Reprod (2011) 24:297–306

123

might be signals transmitted through the connective tissue

and locule wall layers from the sink tissues to the source

vascular tissue over the month-long developmental

span. Vascular bundle and connective tissues are both

L3-derived layers and neither has been well investigated.

Callose is a b-1,3-glucan, an insoluble polysaccharide

deposited prior to meiosis, peaking in abundance during

tetrad complex formation, then dissolved by b-1,3-glucan-

ase activity to release the uninucleate microspores (Popova

et al. 2008). In many plant species, defects in callose wall

build-up and dissolution impair fertility, i.e., petunia (Izhar

and Frankel 1971), sorghum (Warmke and Overman 1972),

tobacco (Worrall et al. 1992), and maize (Wang et al. 2010).

csmd1 locules accumulated more callose by prophase I,

which caused the PMCs to be more separated from each

other than normal; later, the callose abundance was normal.

ms8 anthers have persistent excessive callose around the

meiocytes and meiosis fails as is typical in other excess

callose cases. In Arabidopsis, 12 CalS (callous synthase)

genes have been identified (Hong et al. 2001); CalS5, GSL8,

and GSL10 (glucan synthase-like) exhibit specific devel-

opmental regulation and their loss-of-function mutants

displayed abnormal callose and impaired pollen develop-

ment (Dong et al. 2005; Toller et al. 2008). Likewise, TDF1

(Defective in Tapetal Development and Function 1) and

AtMYB103 are Arabidopsis thaliana genes involved in

callose dissolution, and their mutants showed altered cal-

lose dissolution and male sterility (Zhang et al. 2007; Zhu

et al. 2008). Based on the csmd1 phenotype, we propose that

appropriate callose deposition is necessary for maize pollen

fertility; even an early flaw that is corrected later can trigger

abnormal post-meiotic development.

Synthesis of lipidic components in anthers, such as those

found in the exine and intein of pollen, is vital for maize

pollen fertility, because these coatings are the major safe-

guard against diverse biological stresses (Zhang et al.

2010). Recently, several Arabidopsis genes were investi-

gated and shown to function in exine conformation, such as

ms1 (male sterile 1), ms2 (male sterile 2), dex1 (defective

exine 1), nef1 (no exine formation 1), flp1 (faceless

pollen-1), ACOS5 (Acyl-CoA Synthetase 5), CYP703A2,

and abcg26. Mutations in each of these genes disrupted

normal exine composition and/or pattern in young mi-

crospores and brought about male sterility (Aarts et al.

1997; Paxson–Sowders et al. 2001; Ariizumi et al. 2003,

2004; Morant et al. 2007; Yang et al. 2007; Souza et al.

2009; Quilichini et al. 2010). Apart from Arabidopsis,

some genes in crops also indicate the importance of the

lipidic pollen coat. WDA1 (Wax-Deficient Anther1),

cyp704B2 and OsC6 are three rice genes that participate in

long fatty acids synthesis or transportation in anthers.

Mutations in any of these genes caused pollen abortion and

exine defects (Jung et al. 2006; Li et al. 2010; Zhang et al.

2010). BnCYP704B1 is a member of the cytochrome P450

family in Brassica napus; two duplicate CYP704B1

homologous genes BnMs1 and BnMs2 are involved in exine

formation and are also necessary for tapetum development

and function (Yi et al. 2010). csmd1 young microspores

completely lack visible exine/intine deposition, and they

abort soon after. It is possible that csmd1 might participate

directly or indirectly in pollen coat construction. Given that

csmd1 anthers also exhibit a pre-meiotic callose remodeling

defect, our working hypothesis in that csmd1 is critical for

normal secretory function in the tapetum.

Acknowledgments This research was supported by the National

Science Foundation (Plant Genome Research Project 07-01880). We

are grateful to Inna Golubovskaya for recognizing the male-sterile

phenotype and giving us the csmd1 seeds that initiated this study;

heartfelt thanks to Lisa Helper for valuable suggestions. We appre-

ciate help with experiments and valuable discussions with members

of the Walbot group and W.Z. Cande’s laboratory at UC–Berkeley.

Special thanks to the Carnegie Institute of Washington, Department of

Plant Biology, for use of the Leica SP5 confocal microscope.

References

Aarts MMG, Hodge R, Kalantidis K, Florack D, Wilson ZA, Mulligan

BJ, Stiekema WJ, Scott R, Pereira A (1997) The ArabidopsisMALE STERILITY 2 protein shares similarity with reductases

in elongation/condensation complexes. Plant J 12:615–623

Ariizumi T, Hatakeyama K, Hinata K, Sato S, Kato T, Tabata S,

Toriyama K (2003) A novel male-sterile mutant of Arabidopsisthaliana, faceless pollen-1, produces pollen with a smooth

surface and an acetolysis-sensitive exine. Plant Mol Biol

53:107–116

Ariizumi T, Hatakeyama K, Hinata K, Inatsugi R, Nishida I, Sato S,

Kato T, Tabata S, Toriyama K (2004) Disruption of the novel

plant protein NEF1 affects lipid accumulation in the plastids of

the tapetum and exine formation of pollen, resulting in male

sterility in Arabidopsis thaliana. Plant J 39:170–181

Bedinger PA, Fowler JE (2009) The maize male gametophyte. In:

Bennetzen JL, Hake SC (eds) Handbook of maize: its biology.

Springer, New York, pp 57–77

Chang MT, Neuffer MG (1989) A simple method for staining nuclei

of mature and germinated maize pollen. Biotechnol Histochem

64:181–184

Chang MT, Neuffer MG (1994) Chromosomal behavior during

microsporogenesis. In: Freeling M, Walbot V (eds) The maize

handbook. Springer, New York, pp 460–467

Chaubal R, Zanella C, Trimnell MR, Fox TW, Albertsen MC,

Bedinger P (2000) Two male-sterile mutants of ZEA MAYS(poaceae) with an extra cell division in the anther wall. Am J Bot

87:1193–1201

Chaubal R, Anderson JR, Trimnell MR, Fox TW, Albertsen MC,

Bedinger P (2003) The transformation of anthers in the msca1mutant of maize. Planta 216:778–788

Cheng PC, Greyson RI, Walden DB (1979) Comparison of anther

development in genic male-sterile (ms10) and in male-fertile

corn (Zea mays) from light microscopy and scanning electron

microscopy. Can J Bot 57:578–596

Dong XY, Hong Z, Sivaramakrishnan M, Mahfouz M, Verma DPS

(2005) Callose synthase (CalS5) is required for exine formation

Sex Plant Reprod (2011) 24:297–306 305

123

during microgametogenesis and for pollen viability in Arabid-opsis. Plant J 42:315–328

Duvick DN (2001) Biotechnology in the 1930s: the development of

hybrid maize. Nat Genet 2:69–74

Fu Y, Wen TJ, Ronin YI, Chen HD, Guo L, Mester DI, Yang Y, Lee

M, Korol AB, Ashlock DA, Schnable PS (2006) Genetic

dissection of intermated recombinant inbred lines using a new

genetic map of maize. Genet 174:1671–1683

Goldberg RB, Beals TP, Sanders PM (1993) Anther development:

basic principles and practical applications. Plant Cell 5:1217–

1229

Hong Z, Zhang Z, Olson JM, Verma DPS (2001) A novel UDP-

Glucose transferase is part of the callose synthase complex and

interacts with phragmoplastin at the forming cell plate. Plant

Cell 13:769–779

Izhar S, Frankel R (1971) Mechanism of male sterility in Petunia: the

relationship between pH, callase activity in the anthers, and the

breakdown of the microsporogenesis. Theor Appl Genet

41:104–108

Jung KH, Han MJ, Lee YS, Kim YW, Hwang I, Kim MJ, Kim YK,

Nahm BH, An G (2005) Rice Undeveloped Tapetum1 is a major

regulator of early tapetum development. Plant Cell 17:2705–2722

Jung KH, Han MJ, Lee D, Lee YS, Schreiber L, Franke R, Faust A,

Yephremov A, Saedler H, Kim YW, Hwang I, An G (2006)

Wax-deficient anther1 is involved in cuticle and wax production

in rice anther walls and is required for pollen development. Plant

Cell 18:3015–3032

Kelliher T, Walbot V (2011) Emergence and patterning of the five

cell types of the Zea mays anther locule. Dev Biol 350:32–49

Kirpes CC, Clark LG, Lersten NR (1996) Systematic significance of

pollen arrangement in microsporangia of poaceae and cypera-

ceae: review and observations on representative taxa. Am J Bot

83:1609–1622

Kohle H, Jeblick W, Poten F, Blaschek W, Kauss H (1985) Chitosan-

elicited callose synthesis in soybean cells as a Ca2? -dependent

process. Plant Physiol 77:544–551

Li N, Zhang DS, Liu HS, Yin CS, Li X, Liang W, Yuan Z, Xu B, Chu

HW, Wang J, Wen TQ, Huang H, Luo D, Ma H, Zhang DB

(2006) The rice Tapetum Degeneration Retardation gene is

required for tapetum degradation and anther development. Plant

Cell 18:2999–3014

Li H, Pinot F, Sauveplane V, Werck-Reichhart D, Diehl P, Schreiber

L, Franke R, Zhang P, Chen L, Gao Y, Liang W, Zhang D (2010)

Cytochrome P450 family member CYP704B2 catalyzes the

x-hydroxylation of fatty acids and is required for anther cutin

biosynthesis and pollen exine formation in rice. Plant Cell

22:173–190

Liu Z, Bao W, Liang W, Yin J, Zhang D (2010) Identification of

gamyb-4 and analysis of the regulatory role of GAMYB in rice

anther development. J Integr Plant Biol 52:670–678

Ma H (2005) Molecular genetic analyses of microsporogenesis and

microgametogenesis in flowering plants. Annu Rev Plant Biol

56:393–434

Ma J, Duncan D, Morrow DJ, Fernandes J, Walbot V (2007)

Transcriptome profiling of maize anthers using genetic ablation

to analyze pre-meiotic and tapetal cell types. Plant J 50:637–648

Ma J, Skibbe DS, Fernandes J, Walbot V (2008) Male reproductive

development: gene expression profiling of maize anther and

pollen ontogeny. Genome Biol 9:R181

Morant M, Jorgenesen K, Schaller H, Pinot F, Moller BL, Wreck-

Reichhart D, Bak S (2007) CYP703 is an ancient cytochrome

P450 in land plants catalyzing in-chain hydroxylation of lauric

acid to provide building blocks for sporopollenin synthesis in

pollen. Plant Cell 19:1473–1487

Paxson–Sowders DM, Dodrill CH, Owen HA, Makaroff CA (2001)

DEX1, a novel plant protein, is required for exine pattern

formation during pollen development in Arabidopsis. Plant

Physiol 127:1739–1749

Popova AF, Ivanenko GF, Ustinova AY, Zaslavsky VA (2008)

Localization of callose in microspores and pollen grains in Siumlatifolium L. plants in different water regimes. Cytol Genet

42:363–368

Quilichini TD, Friedmann MC, Samuels AL, Douglas CJ (2010)

ATP-binding cassette transporter G26 (ABCG26) is required for

male fertility and pollen exine formation in Arabidopsisthaliana. Plant Physiol 154:678–690

Sheridan WF, Avalkina NA, Shamrov II, Batygina TB, Golubovskaya

IN (1996) The mac1 gene: controlling the commitment to the

meiotic pathway in maize. Genet 142:1009–1020

Skibbe DS, Schnable PS (2005) Male sterility in maize. Maydica

50:367–376

Souza CD, Kim SS, Koch S, Kienow L, Schneider K, Mckim SM,

Haughn GW, Kombrink E, Douglas CJ (2009) A novel fatty acyl-

CoA synthetase is required for pollen development and sporo-

pollenin biosynthesis in Arabidopsis. Plant Cell 21:507–525

Toller A, Brownfield L, Neu C, Twell D, Schulze-Lefert P (2008)

Dual function of Arabidopsis glucan synthase-like genes GSL8and GSL10 in male gametophyte development and plant growth.

Plant J 54:911–923

Vernoud V, Laigle G, Rozier F, Meeley RB, Perez P, Rogowsky PM

(2009) The HD-ZIP IV transcription factor OCL4 is necessary

for trichome patterning and anther development in maize. Plant J

59:883–894

Wang D, Li C, Zhao Q, Zhao L, Wang M, Zhu D, Ao G, Yu J (2009)

Zm401p10, encoded by an anther-specific gene with short open

reading frames, is essential for tapetum degeneration and anther

development in maize. Funct Plant Biol 36:73–85

Wang D, Oses-Prieto JA, Li KH, Fernandes JF, Burlingame AL,

Walbot V (2010) The male sterile 8 mutation of maize disrupts

the temporal progression of the transcriptome and results in the

misregulation of metabolic functions. Plant J 63:939–951

Warmke HE, Overman MA (1972) Cytoplasmic male sterility in

sorghum. I. Callose behavior in fertile and sterile anthers.

J Hered 63:103–108

Wise RP, Bronson CR, Schnable PS, Horner HT (1999) The genetics,

pathology and molecular biology of T-cytoplasm male sterility

in maize. Adv Agron 65:79–130

Worrall D, Hird DL, Hodge R, Paul W, Draper J, Scott R (1992)

Premature dissolution of the microsporocyte callose wall causes

male sterility in transgenic tobacco. Plant Cell 4:759–771

Xing S, Zachgo S (2008) ROXY1 and ROXY2, two Arabidopsisglutaredoxin genes, are required for anther development. Plant J

53:790–801

Yang CY, Vizcay-Barrena G, Conner K, Wilson ZA (2007) MALE

STERILITY1 is required for tapetal development and pollen

wall biosynthesis. Plant Cell 19:3530–3548

Yi B, Zeng F, Lei S, Chen Y, Yao X, Zhu Y, Wen J, Shen J, Ma C, Tu

J, Fu T (2010) Two duplicate CYP704B1-homologous genes

BnMs1 and BnMs2 are required for pollen exine formation and

tapetal development in Brassica napus. Plant J 63:925–938

Zhang ZB, Zhu J, Gao JF, Wang C, Li H, Li H, Zhang HQ, Zhang S,

Wang DM, Wang QX, Huang H, Xia HJ, Yang ZN (2007)

Transcription factor AtMYB103 is required for anther develop-

ment by regulating tapetum development, callose dissolution and

exine formation in Arabidopsis. Plant J 52:528–538

Zhang D, Liang W, Yin C, Zong J, Gu F, Zhang D (2010) OsC6,

encoding a lipid transfer protein (LTP), is required for postmei-

otic anther development in rice. Plant Physiol 154:149–162

Zhu J, Chen H, Li H, Gao JF, Jiang H, Wang C, Guan YF, Yang ZN

(2008) Defective in Tapetal Development and Function 1 is

essential for anther development and tapetal function for

microspores maturation in Arabidopsis. Plant Cell 55:266–277

306 Sex Plant Reprod (2011) 24:297–306

123