1

Investigating the mechanisms of threshold weight in the tobacco

hornworm, Manduca sexta

A Thesis by Zhou Wang

Faculty Advisor: Yuichiro Suzuki

Submitted in Partial Fulfillment

of the

Prerequisite for Honors

in Biological Sciences, Wellesley College

May 2016

© 2016 Zhou Wang and Yuichiro Suzuki

2

Acknowledgements

This thesis is dedicated to my grandmother and my parents, who have given me everything.

I want to thank the many people who made this thesis possible and encouraged me in this

incredible process. My thesis advisor, Yui Suzuki, not only provided his brilliant mind as a

scientist and professor, but also provided me with the inspiration and courage to be the best

scientist I can be. Thank you for everything you have done for me and all my words in this

short section cannot begin to describe how grateful I am to have you as a mentor. Thank you for

believing in me when I didn’t believe in myself.

I want to thank my thesis committee: Kimberly O’Donnell, Melissa Beers, and Sarah Wall-

Randell. I am grateful for your insightful feedback and comments on this project. Thank you for

keeping me on track and your wise words!

I would also like to thank the entire Suzuki lab for supporting my efforts in this thesis, whether

they provided words of encouragement or helped me with my lab experiments. This was such a

wonderful and supportive research community to have. In particular, I want to thank Victoria

Wang for showing me the YAS cat, Prioty Sarwar for providing me with her realness, and Mia

Accomando who was always willing to get coffee with me.

To my family at Wellesley: Beba Cibralic, Eloisa Cleveland, Houda Khaled, Anat Mano, Natalie

Oppenheimer, Shweta Patwardhan, Jordan Sessa, Rose Trilesskaya, and Helen Walsh. Thank

you for hearing me out and selflessly giving me your friendship when I needed it. Particularly, I

want to thank Rose and Houda for supporting me during some last minute technology troubles!

To my family back home, for their constant source of love and support in more ways than I can

imagine. I wouldn’t be at Wellesley without you guys, and I am so grateful for your belief in my

success.

Last but not least, I would like to thank the Department of Biological Sciences at Wellesley

College for its support in funding this project. Thanks for making this possible!

3

Table of Contents

Abstract ....................................................................................................................................................... 5

Introduction ............................................................................................................................................... 6

Insects and their development cycles ...........................................................................................6

Holometabolous insects and their growth ....................................................................................7

Endocrine processes that regulate holometabolous insect development ......................................7

Prothoracicotropic hormone (PTTH) .............................................................................................. 8

Juvenile hormone (JH) ....................................................................................................................... 8

Ecdysone ............................................................................................................................................. 9

Mechanisms of body size regulation ..........................................................................................10

Mechanisms regulating the decision to stop growth (critical weight)........................................11

Potential physical cues for sensing size .....................................................................................12

Mechanisms regulating growth rate ...........................................................................................12

Terminal growth period ..............................................................................................................12

Threshold weight ........................................................................................................................13

Genes known to influence instar number ...................................................................................15

Krüppel homolog 1 (kr-h1) ............................................................................................................. 15

Methoprene tolerant (Met) ............................................................................................................. 15

Ventral veins lacking (vvl) .............................................................................................................. 16

Investigating the characteristics of threshold weight ................................................................17

Materials and Methods .......................................................................................................................... 19

Animal rearing ............................................................................................................................19

Hypoxia treatment ......................................................................................................................19

RNA isolation .............................................................................................................................20

c-DNA synthesis ........................................................................................................................21

Quantitative RT-PCR .................................................................................................................21

Results ....................................................................................................................................................... 23

Hypoxia generates supernumerary larvae ..................................................................................23

Threshold weight and timing of decision to undergo a supernumerary molt .............................25

Threshold weight determination in JH-deficient black mutants ................................................28

4

Duration of instar correlates with the decision to enter the supernumerary stage .....................30

Manduca deficient in JH do not enter the supernumerary stage as often ...................................32

qPCR analysis of candidate genes correlated with threshold weight .........................................34

Discussion ................................................................................................................................................ 40

Hypoxia on threshold weight .....................................................................................................40

Timing of threshold weight decision ..........................................................................................41

The role of JH on threshold weight ............................................................................................42

Molecular correlates of the threshold weight .............................................................................43

Potential model for the specification of molt identity ................................................................44

References................................................................................................................................................. 47

5

ABSTRACT

How organisms grow to the correct adult size is one of the most puzzling and

interesting questions in developmental biology, yet one that is poorly understood. Two

main parameters determine the final adult size: the growth rate and the duration of

growth. In holometabolous insects, such as Manduca sexta, an organism widely used to

study insect physiology, the size attained at the final instar is the main determinant of

adult size after metamorphosis. A size threshold called the “threshold size” was first

identified when starvation during the penultimate instar led to a “supernumerary”

instar stage before entering the final instar. Despite its importance in lengthening the

duration of growth and hence the final adult size in Manduca, the mechanisms that

govern the developmental fate at the threshold size is not well understood. Here, I

show that hypoxia during the third instar can successfully generate supernumerary and

final instar larvae. In Manduca deficient in JH, however, few larvae entered the

supernumerary stage and had a prolonged fourth instar duration. This finding suggests

a potential role for JH titers in stimulating PTTH/ecdysteroid production in wildtype

Manduca to facilitate entry into the supernumerary stage. The expression levels of the

ventral veins lacking (vvl), krüppel homolog 1 (kr-h1) and Methoprene tolerant (Met) in the

brain were compared between animals under and above the threshold size. Met

expression did not differ, although kr-h1 expression was higher in supernumerary

animals. Higher kr-h1 expression may suggest more active JH signaling, which might be

associated with the development of a supernumerary instar. Vvl expression was also

elevated in larvae undergoing a supernumerary molt. A model is proposed to explain

how a supernumerary larva might arise.

6

INTRODUCTION

One of the fundamental questions of developmental biology is how organisms control

their growth to the right size. Body size is one of the key distinguishing features of a species, yet

very little is known about the mechanisms that regulate body size (Nijhout 2014). While size

variation is most obvious between species, variation in body size between individuals has

implications on life history traits; body size has been correlated with fecundity, survival, and

mate selection. For example, a strong positive correlation exists between adult female mass and

number of eggs or larvae reproduced (Honek 1993, Berger et al. 2008). In addition to increasing

reproductive capacity, the relationship between larger insects and longevity has also been shown

across several taxa (Calabi and Porter, 1989; Taylor et al. 1998).

Insects and their developmental cycles

Insects can be categorized into three groups based on how their morphology and

behaviors change during development. A small number of insect orders belong to the Ametabola,

which do not undergo metamorphosis. In this group, insects undergo three life history stages, the

egg, nymphs, and adult. The juvenile morphology does not differ from the adult body structure

other than size and sexual maturation of genitalia. Insects that undergo ametabolous development

are found in primitive insect orders, such as Archeognatha and Collembola, and are wingless.

Hemimetabola refers to insects that go through “incomplete metamorphosis” that differs from

ametabolous insects because hemimetabolous insects usually develop wings postembryonically,

and the nymph is the “juvenile” stage before the final adult. A range of insects are categorized in

this type of development, and include orders, such as Odonata (damselflies), Orthoptera

(grasshoppers), Hemiptera (stink bugs), Homoptera (aphids), and Mantodea (praying mantis).

7

The adult form typically resembles that of the nymphal stages with the exception of wing

structures. Holometabolous insects differ greatly from the other types of insects because they

undergo complete metamorphosis and have four stages of development: egg, larva, pupa, and

adult. Holometabolous insects are distinct from the other groups because the adult form differs

completely morphologically, behaviorally, and physiologically from the previous developmental

stage. The larval stages exhibit tremendous amount of growth for the taxing pupal stage later in

development. Holometabolous insects include orders Lepidoptera (butterflies and moths),

Diptera (flies), Hymenoptera (bees and ants), and Coleoptera (beetles).

Holometabolous insects and their growth

Many studies on regulation of body size have been conducted on holometabolous insects.

Larval growth stages determine the final adult size because the pupa does not feed and adult

insects are constrained by a hard exoskeleton after metamorphosis (Nijhout 2003); therefore,

growth occurs exclusively during the larval stages. After reaching the end of feeding, growth is

stopped. Much of the physiological aspects of body size variation have been studied in Manduca

sexta, which typically has five larval instars in standard laboratory conditions (Kingsolver 2007).

Larval growth in M. sexta is exponential; up to 90% of body mass is gained during the final

instar (D’Amico et al., 2001).

Endocrine processes that regulate holometabolous insect development

In holometabolous insects, ecdysteroids and juvenile hormone regulate numerous aspects of

physiology, such as the transition of life history stages, reproduction, and development

8

(Riddiford 1996, Nijhout 1994, Wyatt and Davey, 1996). These two classes of hormones can

interact to alter developmental timing and ultimately final body size.

PTTH

Molting is a crucial process that arthropods regularly go through in order to

accommodate body growth. The production of ecdysteroids initiates the molting process, which

is in turn regulated by prothoracicotropic hormone, or PTTH. PTTH was first found in the brains

of the silk moth Bombyx mori; its presence induced ecdysone biosynthesis in the prothoracic

gland (Kataoka et. al, 1991). PTTH is secreted from the brain and is received by the prothoracic

gland, which in turn initiates the production of ecdysone; therefore, the timing of PTTH secretion

affects when ecdysone is produced. During the larval stages of Manduca and Drosophila, pulses

of PTTH are produced at the end of each instar which in turn stimulates the production of

ecdysone, allowing the larvae to molt to the next instar (Henrich et al., 1999). In Drosophila,

PTTH is not necessary for molting or metamorphosis; however, the ablation of PTTH producing

cells results in delayed metamorphosis and larger body size through lengthening the feeding

period (McBrayer et al., 2007).

Juvenile hormone

Juvenile hormones are a class of acyclic sesquiterpenoids that is important in the

developmental regulation of insects. They are often nicknamed the “status quo hormone”,

because ectopic application of JH mimics suppresses metamorphosis in the final instar and

causes the larva to recapitulate the current life history stage when it molts again. The discovery

of JH as the status quo hormone came from parabiosis experiments of Rhodnius prolixus , or the

kissing bug (Wigglesworth 1964). The role of JH and metamorphic timing is interesting because

9

of the change in the interaction between JH and PTTH at the end of the penultimate instar stage.

In earlier instars, the production of PTTH is not inhibited by JH, which allows larvae to molt in

the presence of high JH titers. In the final instar, a switch in JH sensitivity occurs such that the

brain can no longer release PTTH in the presence of JH. Consequently, the production of

ecdysone and the onset of metamorphosis is delayed when ectopic JH is applied (figure 1).

Ecdysone

Production of ecdysteroids is needed to transition an organism from one molt to the next,

as the removal of ecdysteroids results in disrupted molting and metamorphosis (figure 1).

However, levels of JH determine the nature of the molt and whether the organism progresses

from its previous life history stage. At high levels of JH, production of ecdysteroids allows the

organism to molt into another larval instar; however, ecdysteroids in the absence of JH allow the

organism to transition from the larval instar to a pupa.

10

Figure 1. Hormone interactions and metamorphosis. Juvenile hormone (JH, purple) is

maintained at a high level throughout the larval stages. Prothoracicotropic hormone (PTTH,

orange) is produced to stimulate ecdysone production, which then allows the instar to molt into

the next instar. After the final instar has reached the critical weight, JH levels begin to decline.

This decline in JH allows PTTH to be produced and the final peak of ecdysone (blue) to initiate

pupation. Figure adapted from Truman and Riddiford (1999).

Mechanism of body size regulation

Mechanisms controlling body size must somehow assess size upstream of growth

mechanisms (Nijhout 2014), and the rate of growth and cessation of growth are the two key

aspects that determine size. Environmental and genetic conditions can influence molecular

mechanisms that regulate growth; many studies have shown how temperature, nutrition, and

competition affects body size (Conlon and Raff, 1999; Atkinson 1994; Chapman 1998). Genetic

variation can also result in intraspecific size variation (Davidowitz et al. 2003). Insects provide a

tractable model for studying the regulation of size as the majority of size physiology studies have

been conducted in Drosophila melanogaster and Manduca sexta (Chown and Gaston, 2010;

Nijhout 2014).

11

Although the mechanism underlying life history transitions in each taxa may be different,

the parameters that regulate these changes in developmental stages are similar. Various life

history parameters regulate body size and growth, which include a) the decision to stop growth,

b) the period between the decision to stop growth and when the body actually stops growing,

otherwise known as the terminal growth period (TCG), c) the time point when growth stops, and

d) the growth rate (Davidowitz and Helm, 2015). The first three deal with the duration of growth,

which requires knowledge of how organisms regulate the termination of growth. The growth rate

affects, but cannot alone explain for the attainment of final body size; slow growth rates can

achieve a bigger body size by elongating the growth period while fast growing animals can reach

a smaller size by shortening this period.

Mechanisms regulating the decision to stop growth (Critical weight)

The decision point to stop growth occurs first, which can be triggered endogenously or by

environmental factors. For many insects, the decision point is called the critical weight, the

weight at which starvation no longer delays metamorphosis (Nijhout and Williams, 1974a). The

attainment of this size threshold leads to a decline in juvenile hormone titers, which allows for

PTTH secretion and subsequent ecdysone synthesis needed to metamorphose. Although the

mechanism that regulates critical weight has not been elucidated, factors, such as nutrition and

genetic variation, have been found to shift the critical weight (Davidowitz et al., 2003).

The critical weight of Drosophila melanogaster is regulated differently. In this species,

JH plays minimal roles and the attainment of the critical weight is marked by a pulse of

ecdysteroid production (Koyama et al., 2014). This pulse of ecdysteroid is driven by nutrient-

12

based insulin/TOR signaling, which influences prothoracic gland size production (Mirth et al.

2005).

Potential physical cues for sensing size

Previous research has also suggested that a physical constraint can assist in sensing size;

for example, stretch receptors in Oncopeltus fasciatus sense size and can be artificially activated

using saline or air injections, resulting in precocious molting (Nijhout 1979). Additionally,

previous research has shown that hypoxic conditions cause smaller molt sizes (Callier and

Nijhout, 2011) and suggested that oxygen levels might act as a size sensing mechanism. They

proposed that because the tracheal system cannot grow during a larval instar, as the larva grows,

the concentration of oxygen delivered would decrease.

Mechanisms regulating growth rate

Food limitation and temperature, along with oxygen deprivation, can suppress the growth

rate (Blanckenthorn 1999, Atkinson 1994, Davidowitz 2004, Callier and Nijhout 2011) and

affect the final body size. However, by lengthening the duration of growth, organisms can reach

a bigger final body size despite being reared in lower temperatures (Atkinson 1994).

The Terminal Growth Period

Once the decision to stop somatic growth has been reached, the actual timing of when

somatic growth stops does not occur immediately. The delay period between the decision to stop

growing and the point of cessation of growth is called the terminal growth period or the interval

13

of cessation of growth (ICG), and lengthening or shortening this period can alter final body size.

The critical weight marks the onset of the clearing of juvenile hormone in M. sexta, and complete

clearance of JH in the final instar allows for the production of PTTH, and subsequent release of

ecdysteroids, which marks the end of the ICG. Factors, such as the rate of JH clearance, PTTH

photogate period, and temperature, affect the duration of the ICG. The rate of JH clearance is

dependent on levels of JH degradation enzymes, such as Juvenile hormone esterase (JHE). Once

JH is cleared, PTTH secretion is dependent on an eight hour photoperiod (Truman 1972, Truman

and Riddiford 1974); if JH clearance has not occurred during this 8 hour period, then PTTH is

not released until the next time window, lengthening the ICG and therefore increasing body size.

Increases in temperature increase the growth rate, but also increase the rate of the breakdown of

JH, resulting in a shorter ICG and smaller overall body size (Davidowitz et al., 2004; Davidowitz

et al., 2005). Once ecdysteroids are produced in Manduca, larvae stop feeding, gut purge, and

enter the wandering stage, characterized by a search for a pupation site (Chown and Gaston,

2010). During this period, the final size of the larvae is reached, and is a reliable predictor for

final body size as the pupal stage does not feed.

Threshold Weight

All of the above are events that occur in the final instar. However, there is in fact another

size assessment point, the threshold weight, which takes place during the earlier instar. The

threshold weight must be attained in order for a larva to enter the final larval instar; when a

penultimate instar larva fails to attain the threshold weight, it undergoes a supernumerary molt

and can subsequently molt into a very large final instar.

14

By starving larva at various sizes of the penultimate instar, a range of fifth instar sizes

can be generated (Nijhout 1975) based on head capsule size, which serves as a proxy for body

size. At the final instar, larvae with a head capsule size below 5.1mm molts to a supernumerary

instar, while those above that size proceed to the pupal stage. This experiment set the concept of

a “threshold size”: in order to progress from one developmental stage to the other, a decision

must be made to enter the final instar, regulated by a size limit (figure 2). Body weight can also

serve as a proxy for determining the threshold weight (Grunert et al., 2015). However, how does

the organism actually assess its size to make the switch from one developmental pathway to the

other? Because of the increased time to feed and grow, the threshold weight has profound effects

on the final body size, yet little is known about how it is sensed.

Figure 2. Threshold weight is an absolute weight minimum size needed to progress into the

final instar. Nijhout (1975) first identified the threshold weight by starving penultimate instar

larvae and found larvae under a weight molted into an additional “supernumerary” instar. Those

above the weight minimum progressed to the final instar and pupated. However, genes involved

in the nature of the subsequent molt are unknown.

15

Genes known to influence instar number

To date, only a handful of genes have been shown to alter the instar when the larva

initiates metamorphosis: Here, I focus on JH signaling and ventral veins lacking (vvl).

krüppel homolog 1 (kr-h1)

The transcription factor Kr-h1 has been shown to mediate JH signaling in Drosophila and

Tribolium castaneum (Minakuchi et al. 2007, Minakuchi et al. 2009). The expression of kr-h1 is

maintained during embryonic and larval stages, but begins to decline during the pre-pupal stage

and disappears in the adult stage, appearing briefly during reproduction (Minakuchi et al, 2007).

Knockdown of JH acid O-methyltransferase 3 (JHAMT3) in Tribolium results in decreased

expression of kr-h1, suggesting that the kr-h1 transcript level is dependent on JH biosynthesis

levels since TcJHAMT is the rate limiting enzyme for JH production (Minakuchi et al., 2007).

An important piece of evidence for Kr-h1 as a transcription factor of JH production came from

knockdown experiments of kr-h1, which resulted in precocious metamorphosis; furthermore,

addition of exogenous JH in combination with jhamt3 knockdown restored kr-h1expression and

prevented precocious metamorphosis (Minakuchi et al., 2009). This result suggested the role of

kr-h1 as a mediator of JH signaling.

Methoprene-tolerant (Met)

The gene Met encodes a transcription factor that has been thought to act as the receptor

for JH; a single ortholog of Met knocked down in Tribolium results in precocious metamorphosis

(Konopova and Jindra, 2007), which suggests that Met is involved in sensing JH levels to

prevent early metamorphosis until the organism has reached the correct size. In addition to the

results of Met knockdown leading to the expected phenotype of early metamorphosis, Met has

16

been found to have high affinity binding to JH (Shemshedini and Wilson 1990, Miura et al.,

2005).

Ventral Veins Lacking (vvl)

Vvl is a POU transcription factor that has been known to regulate timing of

metamorphosis in beetles. Vvl is expressed in several tissues, including the CNS in Tribolium.

Knockdown experiments of vvl in the penultimate instar of Tribolium resulted in precocious

metamorphosis without molting and failure to complete molt. Precocious metamorphosis as a

result of vvl knockdown suggests that JH signaling no longer maintains the juvenile stage when

vvl is absent. Comparing knockdowns of Met and vvl, Cheng et al. (2014) found no significant

difference between the two experimental treatments in rates of precocious metamorphosis, but in

both cases, larvae metamorphosed earlier than the controls. A difference between the Met and vvl

knockdown animals was that Met knockdown animals were able to complete a molt before

metamorphosis, while vvl knockdowns entered precocious metamorphosis without molting.

Furthermore, vvl knockdown of fifth instar larvae resulted in reduced JHAMT3 expression,

suggesting that vvl plays a role in regulating JH biosynthesis instead of JH sensitivity. POU

factors have also been shown to impact the timing of puberty in mammals. Thus, POU factors

may play critical roles in regulating the onset of metamorphic transitions in a variety of

organisms.

17

Figure 3. Genes involved in regulating the timing of metamorphosis. Vvl knockdown has

been shown to induce precocious metamorphosis, mediated via reduction of production of JH

and JH response gene kr-h1. Vvl knockdown also led to reduced ecdysteroid titers, suggesting its

role in ecdysone biosynthesis. Figure adapted from Cheng et al. (2014).

Investigating characteristics of the threshold weight

The objective of this study was to investigate characteristics of the threshold weight and

how it is regulated. Although previous experiments have shown starvation to be a successful

method in determining threshold weight, could nutrient independent methods generate larvae

below and above the threshold weight? Since a sensitivity switch in JH levels during the final

instar determines the nature of its molt, how does JH impact threshold weight? How would the

threshold weight differ in a black mutant strain deficient in JH levels? Finally, how are known

genes involved in metamorphic timing such as Met, kr-h1, and vvl expressed below and above

18

threshold weight? Investigating changes in expression levels of these candidate genes could

provide clues into the regulatory mechanism of threshold weight and body size.

19

MATERIALS AND METHODS

Animal rearing

Wildtype Manduca sexta were obtained from Carolina Biological Supply Company

(www.carolina.com). black mutant Manduca were obtained from Dr. H. Frederik Nijhout (

Department of Biological Sciences, Duke University, Durham, North Carolina). All larvae were

raised on an artificial diet (Kemirembe et al., 2012) unless noted otherwise. Each organism was

raised at 26.5ºCin a 1 oz. soufflé cup until the end of the 4th instar and a 5 oz. soufflé cup at the

beginning of the fifth instar.

Hypoxia treatment

On day 0 of the third instar, larvae entering head capsule slippage (HCS) - a sign of

initiation of molting - were placed in a sealed cell culture chamber in cups with tops that had

multiple holes. A 5% oxygen/carbon dioxide mixture was delivered into the oxygen chamber.

The oxygen concentration of the chamber was kept around 4+/-1% throughout the experiment.

Larvae were kept in hypoxic conditions until the end of the third instar when the head capsule

began to slip. Once taken out of the chamber, organisms were weighed, and new artificial diet

was given to each organism. The tops of the cups were replaced with ones that had just one or

two holes. Weight was recorded every day, and the duration of the instar was also determined.

The fate of the larvae, whether they entered the final instar or the supernumerary instar, was

determined by tracking the fate of the larvae that emerged after the molt at the end of the fourth

instar: those that gut purged were determined to have molted into a fifth (and final) instar; those

that initiated head capsule slippage again were determined to have molted into a supernumerary

fourth instar.

20

RNA isolation

The brain and the central nervous system (CNS) were dissected from wild type hypoxia-

treated larvae at the end of the fourth instar and on day zero after molting into either

supernumerary or final instar larvae. Two classes of larvae were identified: those that were

entering the supernumerary instar and those entering the final (fifth) instar. Tissues were

homogenized using 500 µL trizol reagent to isolate RNA. One hundred µl of chloroform was

added to the tissues and centrifuged at 11,500 rpm at 4 ºC for 15 min to separate RNA from the

rest of the organic matter. The top aqueous layer was then transferred in a separate RNAse-free

tube and suspended in 250 µL isopropanol to precipitate RNA. Centrifugation at 11,500 rpm at 4

ºC for 10 min allowed for RNA to form a pellet, and the supernatant was discarded. The pellet

was washed with 500 µL 80% ethanol/DEPC water with another round of centrifugation at 7400

rpm for 10 min at 4ºC. The supernatant was removed, and the pellet was allowed to fully dry

before resuspending in 13 µL DEPC water. The resulting solution was incubated at 60 ºC for 5

min to dissolve the pellet. Promega RQ1 RNAse-free DNAse kit was used to remove any DNA

from the RNA solution. Twenty µL of isopropanol and 2 µL of 3M sodium acetate (pH: 5.2) was

added to precipitate the remaining RNA, and the mixture was kept at -20ºC overnight.

Centrifugation at 14,000 rpm at 4ºC for 10 min allowed the RNA pellet to form. The supernatant

was discarded and the pellet was washed with 75% ethanol and centrifuged using the same

parameters as the previous step. Pellets were allowed to completely dry before resuspending in

10 µL DEPC water. Concentrations were recorded using a Nanodrop 2000 spectrophotometer.

Final RNA was stored in -80ºC until cDNA synthesis.

21

cDNA synthesis

cDNA was synthesized using 1 µg of RNA via reverse transcription using Thermo Fisher

cDNA synthesis kit. One µL of oligo dT primer was added to a volume totaling 1 µg RNA for

each sample, and total volume was brought up to 12 µL. The solution was heated at 65ºC for 5

min. Four µL of 5X reaction buffer, 2 µL of 10 mM dNTP mix, 1 µL of nuclease inhibitor, and 1

µL of reverse transcriptase enzyme was added, and the mix was incubated at 42ºC for 1 hour for

cDNA synthesis. All samples were then incubated at 70 ºC for 5 min to inactivate enzyme. Final

cDNA product was then stored at -20 ºC and used for quantitative real-time polymerase chain

reaction (qRT-PCR).

Quantitative RT-PCR

Hypoxia-treated larvae were classified as supernumerary-destined and final instar-

destined Manduca larvae based on the weight at time of fourth instar head capsule slippage

(HCS), the onset of a molt. RNA was isolated from these larvae at the fourth instar HCS and day

0 supernumerary or final instar. For the HCS larvae, the RNA were collected while the larval

head capsule was liquid filled, within the first half of the molt period. Ten brain samples were

collected for expression measurements, while three samples were collected for the central

nervous system. SsoAdvanced SYBR green supermix (Bio-rad) was used to qRT-PCR analyses.

To look at mechanisms of how threshold weight might be regulated, expressions of JH receptor

Met, JH response gene kr-h1, and vvl were measured. rpL17A was used as an internal control

gene, and a 1:5 fold dilution of cDNA was used to generate a standard curve. Primers used for

the qPCR are shown in Table 1.

22

Gene Forward (FW)/reverse (RV) Sequence (5’-3’)

Msvvl FW GCTCTACGGCAATGTGTTCT

RV CATGCGCTTCTCCTTCTGT

Mskrh-1 FW GCATCGTTCACAACCTACACC

RV TCCGAGTGGAAAGCGTCAA

Met FW ATAAGGAGGCAGAGGGTCAG

RV TCAAATGGCGAGTCCAATAC

MsrpL17A* FW TCCGCATCTCACTGGGTCT

RV CACGGCAATCACATACAGGTT

Table 1: Primer sequences used for qPCR. *Primer sequences obtained from Ono et al (2006).

23

RESULTS

Hypoxia generates supernumerary larvae

Starvation or providing diminished nutrition during the fourth instar has been shown to

generate supernumerary fourth instar Manduca larvae (Nijhout 1975). To determine whether

hypoxia could also generate supernumerary larvae, day 0 third instar larvae were subjected to

hypoxic conditions until the onset of the molt to the fourth instar when the larvae began to

undergo head capsule slippage. Weights were recorded every day until end of final instar or until

time of gut purge, an indication of the onset of metamorphosis. Larvae reared in hypoxic

conditions had two distinct fates at the end of the fourth instar: 43.2% of the larvae (n=16)

molted into a supernumerary fourth instar and the remaining larvae entered the final instar (n=21)

(Fig. 4 and 5).

24

Figure 4. Hypoxia generates two developmental trajectories for Manduca sexta. A) Average

growth trajectory of final instar destined larvae (blue) and supernumerary destined larvae (red)

until the end of the fourth instar. Larvae were subjected to hypoxic conditions from the

beginning to the end of the third instar. Weights were recorded at 3rd

HCS and every day after. B)

Individual growth trajectories averaged in A.

25

Threshold weight and timing of decision to undergo a supernumerary molt

To determine when the decision is made to enter the supernumerary stage, the fate of the

larva (final instar or supernumerary instar) was plotted against the fourth instar day 1 larval

weights. The fourth instar day 1 larval weights were also plotted against the third instar HCS

weights. Larvae that enter the supernumerary stage have weights that overlap with larvae that

enter the final instar stage (Fig. 5A), suggesting that the fourth day 1 weight does not explain the

decision to enter the supernumerary stage. Only the extremely small or extremely large fourth

instar day 1 sizes are predictive of the nature of the molt. This finding suggests that the decision

to enter the supernumerary stage is not made at day 1 of the fourth instar.

Instead, the differences in masses between supernumerary destined larvae and final instar

larvae treated with hypoxia at the fourth instar head capsule slip (HCS) suggested that the

decision to enter the supernumerary stage is made towards the end of the 4th instar. Weights at 4

HCS could clearly predict whether hypoxia treated larvae would enter the supernumerary or final

instar (Fig. 6A). Those that weighed below approximately 0.75 g at the fourth head capsule slip

underwent a supernumerary molt, while those that weighed above approximately 0.75 g at

molted into a final instar larva.

26

Figure 5. Weight at first day of the fourth instar is a poor predictor of nature of subsequent

molt. Larvae were subjected to hypoxic conditions during the third instar and were weighed at

day 1 of the 4th instar and then tracked for supernumerary molt/gut purge. Hypoxia-treated

supernumerary animals (green triangle) underwent two larval molts after entering the fourth

instar. Hypoxia-treated normal (red square) animals molted into the final instar at the end of the

fourth instar. Normoxia animals (blue diamond) were kept at normal oxygen levels throughout

the larval stage.

27

Figure 6. The decision to enter

supernumerary stage is made at the

end of the fourth instar. A) Manduca

were weighed at fourth instar HCS and

then tracked for supernumerary molt/gut

purge. Hypoxia-treated supernumerary

animals (green triangle) underwent

two larval molts after entering the

fourth instar. Hypoxia-treated normal

(red square) animals molted into the

final instar at the end of the fourth

instar. Normoxia animals (blue

diamond) were kept at normal oxygen

levels throughout the larval stage. B)

Fourth HCS weights plotted against

weight at third HCS.

28

Threshold weight determination in JH-deficient black mutants

Because juvenile hormone (JH) is ubiquitously present during the larval stages of

Manduca sexta until the fourth instar, we wondered whether a reduction in JH titers would affect

the threshold weight. To determine the role of JH and its effect on threshold weight, black

mutant larvae deficient in JH production were subjected to hypoxia during the entire third instar,

and then switched to normoxic conditions at the end of the third instar. Supernumerary instar-

destined larvae had a fourth HCS weight below around 0.5 g, ranging from 0.3 g to 0.51 g; final

instar-destined larvae had a fourth HCS weight above 0.8 g, with a range between 0.8 g and 1.23

g (Fig. 7A). Given that the threshold weight is 0.75 g in wild type animals, and given the broad

gap in fourth instar HCS weights between 0.51 g and 0.8 g, it is unclear whether JH plays a role

in shifting the threshold weight.

29

Figure 7. Threshold weight

determination in black mutant

Manduca. A) Graph of larvae

weights at 4th

HCS and nature of

molt. Black mutant larvae were

subjected to hypoxic conditions

during the third instar and tracked

until the second molt or gut purge.

Hypoxia-treated supernumerary

animals (green triangle) underwent

two larval molts after entering the

fourth instar. Hypoxia-treated

normal (red circle) animals molted

into the final instar at the end of

the fourth instar. Normoxia animals

(blue diamond) were kept at

normal oxygen levels throughout

the larval stage. A few of these

molted into supernumerary instars

(blue square). B) Plot of fourth

HCS weights against third HCS

weights.

30

Duration of instar correlates with the decision to enter the supernumerary stage

The growth trajectories of the supernumerary destined larvae and the final instar-destined

larvae show that one possible contributor to the differences in the final weight is the duration of

the feeding period. Thus, I determined whether supernumerary larvae have a shorter fourth instar

duration (Fig. 8). Larvae exposed to hypoxic condition during the third instar and entered the

final instar after the fourth molt had a feeding period of 2.91 days, similar to the average time of

normoxic control larvae, which took 2.90 days. Supernumerary-destined larvae had a

significantly reduced feeding period of 2.2 days before entering head capsule slippage (ANOVA,

p<0.0001). This finding suggests that a shorter feeding period prevents supernumerary larvae

from attaining the threshold weight. The extended duration of the fourth instar can compensate

for any size deficiencies at the onset of the fourth instar, hence explaining the lack of correlation

between the weight at the onset of the fourth instar and the nature of the fourth instar molt.

31

Figure 8. Fourth instar duration (mean± SE) in wildtype and black mutant Manduca.

Fourth instar larvae either treated with hypoxia or normoxia, and the developmental fate was

determined. Days were counted from day 0 of the fourth instar. Green=wildtype, gray=black

mutant. ANOVA, p<0.0001. Means not sharing the same letter are statistically significant

(Tukey HSD, P<0.05).

32

Manduca deficient in JH do not enter the supernumerary stage as often

The majority of black mutant larvae did not enter the supernumerary stage (Fig. 9). In the

wildtype larvae, 42.9% of the third instar HCS larvae weighing 0.12 - 0.17 g underwent a

supernumerary molt. In contrast, almost none (2.5%) of the black mutant larvae in this weight

range underwent a supernumerary molt. The duration of the fourth instar was 3.9 days in black

mutant larvae in normoxia conditions, longer than the wildtype larvae in normoxia conditions.

This finding suggests that JH deficiency somehow allows for a longer fourth instar duration,

during which smaller black mutant larvae may have extended feeding time to obtain the

unknown threshold weight needed to enter the final instar.

33

Figure 9. Wildtype larvae weighing 0.12-0.17 g at the third instar HCS enter the

supernumerary stage more frequently than black mutant larvae in the same weight

category. Shown are the percentages of wildtype and black mutant larvae that undergo a

supernumerary molt.

34

qPCR analysis of candidate genes correlated with threshold weight

Previous research has observed that when vvl is knocked down, Tribolium larvae undergo

precocious metamorphosis (Cheng et al., 2014). One explanation for this observation is that the

absence of vvl is associated with the onset of metamorphosis. In addition to vvl, I also looked at

the JH response gene kr-h1 and the JH receptor Met to determine whether JH signaling might be

involved in determining the threshold size. Since the size at HCS is correlated with the nature of

the molt, I investigated the expression of vvl, kr-h1, and Met in the brain and the CNS at HCS.

Larvae weighing less than 0.7 g, were identified as those undergoing a supernumerary molts, and

those weighing over 0.8 g were identified as undergoing a final molt. For each of these two

groups of larvae, the brains and the CNS were dissected and pooled.

The following were the general trends observed for qPCR based on one single replicate.

Met expression was found to be very slightly upregulated in the brain and CNS of supernumerary

destined animals at the end of the fourth instar although this within the margin of error seen in

qPCR data (Fig. 10). Therefore, we do not think that Met expression changes significantly

between the two samples.

35

Figure 10. Expression of Met in

final instar larvae and

supernumerary destined larvae. Ten Manduca were dissected for

brains and three for central nervous

systems (CNS). Larvae were weighed

prior to dissection to determine the

nature of the molt. Met expression

was quantified using qPCR using

rpL17A as an internal control. Each

bar represents the mean of triplicates

for one biological sample.

36

Kr-h1 was upregulated in the brain and the CNS at the end of the fourth instar larvae

undergoing a supernumerary molt, relative to those undergoing a final molt (Fig. 11). In addition,

the brain and CNS of the day 0 supernumerary fourth instar larvae also had upregulated kr-h1

expression. Upregulation of kr-h1 at the end of the fourth instar suggests that high JH signaling

at the end of the fourth instar may be correlated with a supernumerary molt.

37

Figure 11. Expression of kr-h1

in final instar larvae and

supernumerary destined larvae. Ten Manduca were dissected for

brains and three for central

nervous systems (CNS). Larvae

were weighed prior to dissection

to determine the nature of the

molt. kr-h1 expression was

quantified using qPCR using

rpL17A as an internal control.

Each bar represents the mean of

triplicates for one biological

sample.

38

Vvl was upregulated in the brain and the CNS in larvae undergoing a supernumerary

molt. Its increase in expression during the end of the fourth instar coincides with the decision to

enter the supernumerary stage (Fig. 12). Taken together, these results show that vvl expression is

increased during the decision to enter the supernumerary stage, and its expression may prevent

the larvae from entering the final instar when they are below the threshold weight. Although

these trends are interesting and suggestive, these qPCR results are based on one single biological

replicate; thus, these data should be considered preliminary.

39

Figure 12. Expression of vvl in

final instar larvae and

supernumerary destined larvae. Ten Manduca were dissected for

brains and three for central nervous

systems (CNS). Larvae were

weighed prior to dissection to

determine the nature of the molt. vvl

expression was quantified using

qPCR using rpL17A as an internal

control. Each bar represents the

mean of triplicates for one biological

sample.

40

DISCUSSION

In this study, we investigated several aspects of the threshold weight: whether alternative

methods could generate the supernumerary stage previously observed, when the decision to enter

the supernumerary stage is made, the role of JH in threshold weight determination, and candidate

genes that can possibly regulate threshold weight. By exposing larvae to hypoxic conditions, we

were able to generate supernumerary destined and final instar destined Manduca and determined

that the threshold weight is 0.75 g in wildtype Manduca, which corroborates previous findings

(Grunert et al., 2015; Nijhout 1975). In contrast, when JH titers were reduced, very few molted

into the supernumerary stage. The size at the end of the fourth instar determines the nature of the

molt. In addition, vvl and kr-h1 expression in supernumerary-destined larvae were found to be

elevated relative to the final instar-destined larvae. Although these expression changes in vvl and

kr-h1 were determined from one biological replicate and further research is needed to confirm

this expression trend, these expression differences between the two different types of larvae

could be a possible proximate mechanism of how threshold weight is regulated.

Hypoxia on threshold weight

Previous work has shown that oxygen can modify final adult size in Drosophila and

Manduca (Frazier et al., 2004; Klok and Harrison, 2009; Callier and Nijhout, 2011). Callier and

Nijhout (2011) found that the tracheal system only increased in area between each larval instar,

suggesting that as the body cavity grows within an instar, oxygen tissue delivery decreases as the

tracheal system fails to keep up with the growing volume of the larva. The authors suggested that

this reduction in oxygen delivery to surrounding tissues serves as a cue that the animal is big

enough to molt or initiate metamorphosis. Thus, Manduca subjected to hypoxic conditions on

average had reduced fourth and fifth instar body sizes (Callier and Nijhout, 2011). Similarly, the

41

final body size of Drosophila reared in hypoxic environmental conditions was significantly

reduced compared to those reared under normoxic conditions (Callier et al., 2013).

We reasoned that hypoxia would trigger a fourth instar molt at a smaller weight if third

instar larvae were reared under hypoxic conditions. These larvae would then molt at a smaller

fourth instar body size, generating larvae that molt into supernumerary instars. Hypoxia as a

treatment during the third instar successfully generated both supernumerary and final instar

animals (Fig. 4). The weight at the end of the third instar can only predict the nature of the fourth

instar molt (supernumerary destined and final instar destined larvae) if they fall outside the

normal size range of the third HCS instars. If the weights of larvae between 0.13-0.17g, the

nature of the fourth instar molt is not predictable. The fact that we can obtain both

supernumerary and final instar destined Manduca using the hypoxia treatment shows that this is

a useful way to generate supernumerary larvae that avoids having to use starvation and other

strategies that might add additional confounding variables.

Timing of threshold weight decision

Nijhout (1975) first discovered that threshold weight is an absolute size minimum

obtained in order to enter the final the instar. This finding suggested that rather than counting the

number of instars until hatching to enter metamorphosis, the size of the larvae is sufficient to

make this decision.

Under laboratory conditions, we observed that hypoxic conditions could generate

supernumerary fourth instar larvae when third instar larvae were exposed to hypoxic conditions.

On day 1 of the fourth instar, the weight serves as a poor predictor of the nature of the molt.

However, the weight at the fourth HCS does, supporting the notion that an absolute weight

governs the decision to enter the supernumerary stage. Additionally, we found that

42

supernumerary-destined larvae have a shorter instar duration relative to the final instar-destined

larvae (Fig. 8). Interestingly, black mutants have longer instar duration relative to the wildtype,

and this led to most of the larvae molting into final instar larvae.

These observations suggest that JH may play a critical role in the timing of molting, and

this in turn may underlie the differences between supernumerary and final instars and their

growth trajectories. Based on the black mutant data, we speculate that JH might promote the

earlier release of ecdysteroids, causing larvae to molt sooner.

The role of JH in threshold weight

In wild type Manduca, levels of JH are relatively high until the end of the fourth instar,

when JH levels decrease and rise again after ecdysis into the fifth instar (Fain and Riddiford,

1975). To understand how JH could affect the threshold weight, black mutant Manduca,

deficient in levels of JH, were subjected to the same hypoxic method shown to generate

supernumerary instars in the wildtype larvae. Surprisingly, fewer black mutant larvae entered the

supernumerary stage, suggesting that the reduced levels of JH prevent larvae from entering the

supernumerary stage (Fig.9). We propose that supernumerary-destined animals have higher

levels of JH compared to final instar-destined larvae, shortening the fourth instar duration by

releasing ecdysteroids relatively early. The most well-studied interaction between JH and

ecdysteroids occurs in the final instar when the presence of JH delays the production and

response to PTTH in Bombyx mori and in Manduca (Sakuri et al., 1989; Rountree and

Bollenbacher 1986). Although these findings highlight the role of JH suppressing PTTH

response and production in the feeding final instar larvae, it is possible that JH might have a

different role in earlier instars to stimulate PTTH production and enter the supernumerary stage.

43

In fact, JH appears to have stimulatory role on ecdysteroidogenesis during the prepupal period

(Gruetzmacher et al., 1984). Furthermore, previous experiments suggest that higher JH titers may

be correlated with reduced duration of earlier instars (Suzuki and Nijhout, 2008). However,

additional experiments are needed to test whether differences in JH levels during the penultimate

instar makes a difference in the nature of the molt.

Molecular correlates of the threshold weight

To begin to understand the molecular mechanisms that sense threshold weight and

mediate the decision to enter the threshold weight, we decided to look at differences in

expression of candidate genes, vvl, Met, and kr-h1, during the HCS and day 0 after ecdysis in

supernumerary and final instar destined wildtype Manduca. As expected, Met gene expression

did not dramatically differ between supernumerary and final instars during HCS and day 0

stages. Given that JH binding leads to changes in phosphorylation states (Cai et al., 2014,

Konopova and Jindra, 2008), it is not surprising that gene expression of Met did not change; it is

still possible that differences in Met reception during the two developmentally different larvae

can mediate downstream molecular mechanisms of threshold weight. Recent studies have also

suggested that JH may bind to a cell surface receptor instead of Met. Therefore, we cannot rule

out a difference in JH sensitivity based on our expression analysis.

qPCR results suggested that kr-h1 expression is elevated during the supernumerary

fourth stage, suggesting that higher levels of JH signaling may lead to a supernumerary molt

(Fig. 11). As we previously mentioned, the decision to undergo the supernumerary stage is made

at the end of the fourth HCS stage which correlates with increased kr-h1 expression in the brain

44

and the CNS. These observations suggest that elevated JH at the end of the fourth instar may be

associated with a supernumerary molt.

Our results also suggest that vvl expression is elevated in the CNS and the brain of the

fourth HCS of supernumerary-destined larvae. Since this is based on one biological replicate;

further replicates are needed to confirm this increase in expression. This increase in expression is

correlated with the timing of the decision to enter the supernumerary instar, along with elevated

JH signaling seen based on kr-h1 expression during the supernumerary stage.

Potential model for the specification of molt identity

Based on the findings, a potential model is proposed to explain how the distinct molt

fates are specified (Fig. 13). The sensitive period for specifying the nature of the molt occurs at

the end of the fourth instar. One possible difference between supernumerary and final instar

larvae is the relative levels of JH and ecdysteroids present at the time of ecdysis. In normoxia

larvae, JH levels are high at a constant level during the earlier larval stages, with the exception of

a dip in JH levels prior to the final instar (Fain and Riddiford, 1975). Given that black mutants

delay molting, JH likely acts to stimulate ecdysteroid production. Because supernumerary

destined Manduca molt at a reduced weight, it is possible that it has higher JH levels that

stimulate ecdysteroid production and initiate molting before JH levels fall during the fourth

instar. This early ecdysteroid production may lead to higher JH and ecdysteroid titers during the

sensitive period, leading to the specification of a supernumerary molt. This would be correlated

with a higher expression of JH response gene.

45

Figure 13. A proposed model for the decision to enter the supernumerary stage in Manduca. At the end of the fourth instar, a decrease in JH levels coincides with a peak in ecdysteroid

production during the sensitive period (shown in gray), allowing entry into the final instar.

Supernumerary destined larvae have high JH levels coinciding with an ecdysone peak from a

truncated fourth instar duration, during which kr-h1 and vvl expression is increased. At a low JH

level, the decrease in JH levels at the end of the fourth instar is much lower than the JH threshold

sensed to enter the supernumerary instar; therefore, the subsequent molt is final.

46

In contrast, larvae destined to undergo a final molt would have lower JH titers, delaying

the peak of ecdysteroid production until the next day. During the sensitive period at the end of

the instar, JH levels dip and along with the ecdysteroid peak, they may then downregulate gene

expression, such as kr-h1 and vvl .

This model suggests that JH may be a stimulator of PTTH/ecdysteroid production. The

findings of this study suggests that JH level differences during the sensitive period, along with

timing of the ecdysteroid peak, may be coordinated by genes such as kr-h1 and vvl which

ultimately regulate the mechanism that determines the nature of a molt. The threshold weight

then may be set by the relative amounts of JH and ecdysteroids circulating at the end of the

instar.

47

REFERENCES

Atkinson, D. 1994. Temperature and organism size: a biological law for ectotherms? Adv. Ecol.

Res. 25: 1-58.

Berger, D., Walter, R., and Gotthard, K. 2008. What limits insect fecundity? Body size- and

temperature-dependent egg maturation and oviposition in a butterfly. Funct Ecol 22: 523-529.

Blanckenhorn, W.U. 1999. Different growth responses to temperature and resource limitation in

three fly species with similar life histories. Evol Ecol 13: 395-409.

Calabi, P., and Porter, S.D. 1989. Worker longevity in the fire ant Solenopsis invicta: Ergonomic

considerations of correlations between temperature, size and metabolic rates. J Insect Physiol 35:

643-649.

Callier, V., and Nijhout, H.F. 2011. Control of body size by oxygen supply reveals size-

dependent and size-independent mechanisms of molting and metamorphosis. Proc Natl Acad Sci

108:14664-14669.

Callier, V., Shingleton, A.W., Brent, C.S., Ghosh, S.M., Kim, J., and Harrison, J.F. 2013. The

role of reduced oxygen in the developmental physiology of growth and metamorphosis initiation

in Drosophila melanogaster. J Exp Biol. 216(Pt 23):4334-4340.

Chapman, R.F. 1998. The Insects: Structure and Function. Cambridge University Press,

Cambridge.

Charles, J.P., Iwema, T., Epa, C., Takaki, E., Rynes, J., and Jindra, M. 2011. Ligand-binding

properties of a juvenile hormone receptor, Methoprene-tolerant. Proc Natl Acad Sci 108: 21128-

21133.

Cheng, C., Ko, A., Chaieb, L., Koyama, T., Sarwar, P., Mirth, C.K., Smith, W.A., and Suzuki, Y.

2014. The POU Factor Ventral Veins Lacking/Drifter Directs the Timing of Metamorphosis

through Ecdysteroid and Juvenile Hormone Signaling. PLoS Genet 10(6): e1004425.

Chown, S.L., and Gaston, K.J. 2010. Body size variation in insects: a macroecological

perspective. Biol Rev 85: 139-169.

48

Conlon, I., and Raff, M. 1999. Size control in animal development. Cell 96: 235-244.

D’Amico, L.J., Davidowitz, G., and Nijhout, H.F. 2001. The developmental and physiological

basis of body size evolution in an insect. P Roy Soc Lond B Bio 268:1589-1593.

Davidowitz, G., D’Amico, L.J., and Nijhout, H.F. 2003. Critical weight in the development of

insect body size. Evolution and Development 5: 188-197.

Davidowitz, G., and Nijhout, H.F. 2004. The Physiological Basis of Reaction Norms: The

Interaction among Growth Rate, the Duration of Growth and Body Size. Integr Comp Biol 44:

443-449.

Davidowitz, G., Roff, D.A., and Nijhout, H.F. 2005. A physiological perspective on the

response of body size and development time to simultaneous directional selection. Integr Comp

Biol 45:525-531.

Davidowitz, G., and Helm, B.R. 2015. A common framework for the regulation of growth and

size: stepping away from the trees to see the forest. Int Organismal Biol 1: 207-217.

Fain, M.J. and Riddiford, L.M. 1975. Juvenile hormone titers in the hemolymph during late

larval development of the tobacco hornworm, Manduca sexta (L.). Biol. Bull., 149: 506-521.

Frazier, M.R., Woods, H.A., and Harrison, J.F. 2001. Interactive Effects of Rearing Temperature

and Oxygen on the Development of Drosophila melanogaster. PHYSIOL BIOCHEM ZOOL 74:

641-650.

Gruetzmacher, M.C., Gilbert, L.I., Granger, N.A., Goodman, W., and Bollenbacher, W.E. 1984.

The effect of juvenile hormone on prothoracic gland function during the larval-pupal

development of Manduca sexta: An in situ and in vitro analysis. J. Insect Physiol 30: 331-340.

Grunert, L.W., Clarke, J.W., Ahuja, C., Eswaran, H., and Nijhout, H.F. 2015. A Quantitative

Analysis of Growth and Size Regulation in Manduca sexta: The Physiological Basis of Variation

in Size and Age at Metamorphosis. PLoS ONE 10(5): e0127988.

Henrich, V.C., Rybczynski, R., and Gilbert L.I. 1999. Peptide hormones, steroid hormones, and

puffs: mechanisms and models in insect development. Vitam Horm 55: 73-125.

49

Honek, A. 1993. Intraspecific Variation in Body Size and Fecundity in Insects: A General

Relationship. Oikos 66: 483-492.

Kataoka, H., Nagasawa, H., Isogai, A., Ishizaki, H., and Suzuki, A. 1991. Prothoracicotropic

Hormone of the Silkworm, Bombyx mori: Amino Acid Sequence and Dimeric Structure. Agr

Biol Chem Tokyo 55: 73-86.

Kingsolver, J.G. 2007. Variation in growth and instar number in field and laboratory Manduca

sexta. Proc. Biol. Sci. 274: 977-981.

Konopova, B., and Jindra, M. 2007. Juvenile hormone resistance gene Methoprene-tolerant

controls entry into metamorphosis in the beetle Tribolium castaneum. Proc Natl Acad Sci 104:

10488-10493.

Konopova, B., and Jindra, M. 2008. Broad-Complex acts downstream of Met in juvenile

hormone signaling to coordinate primitive holometabolan metamorphosis. Development 135:

559-568.

Koyama, T., Rodrigues, M.A., Athanasiadis, A., Shingleton, A.W., Mirth, K.W. 2014.

Nutritional control of body size through FoxO-Ultraspiracle mediated ecdysone biosynthesis.

eLIFE 3: 1-20.

Langelan, R.E., Fisher, J.E., Hiruma, K., Palli, S.R., and Riddiford, L.M. 2000. Patterns of

MHR3 Expression in the Epidermis during a Larval Molt of the Tobacco Hornworm Manduca

sexta. Developmental Biology 227: 481-494.

McBrayer, Z., Ono, H., Shimell, M., Parvy, J.P., Beckstead, R.B., Warren, J.T., Thummel C.S.,

Dauphin-Villemant, C., Gilbert, L.I., and O’Connor, M.B. 2007. Prothoracicotopic hormone

regulates developmental timing and body size in Drosophila. Dev Cell 13: 857-871.

Minakuchi, C., Zhou, X.F., and Riddiford, L.M. 2007. Krüppel homolog 1 (Kr-h1) mediates

juvenile hormone action during metamorphosis of Drosophila melanogaster. Mech Develop 125:

91-105.

50

Minakuchi, C., Zhou, X.F., and Riddiford, L.M. 2009. Krüppel homolog 1, an early juvenile

hormone-response gene downstream of Methoprene-tolerant, mediates its anti-metamorphic

action in the red flour beetle Tribolium castaneum. Dev Biol. 325: 341-350.

Mirth, C., Truman, J.W., and Riddiford, L.M. 2005. The role of the prothoracic gland in

determining critical weight for metamorphosis in Drosophila melanogaster. Curr Biol. 15: 1796-

1807.

Miura, K., Oda, M., Makita, S. and Chinzei, Y. (2005). Characterization of the Drosophila

Methoprene-tolerant gene product. Juvenile hormone binding and ligand-dependent gene

regulation. FEBS J. 272,1169 -1178.

Nijhout, H.F. and Williams, C.M. 1974a.Control of moulting and metamorphosis in the tobacco

hornworm, Manduca sexta (L.): Growth of the last-instar larva and the decision to pupate. J Exp

Biol 61: 481-491.

Nijhout, H.F. and Williams, C.M. 1974b. Control of moulting and metamorphosis in the tobacco

hornworm, Manduca sexta (L.): Cessation of juvenile hormone secretion as a trigger for pupation.

J Exp Biol 61: 493-501.

Nijhout, H. F. 1975. A Threshold Size for Metamorphosis in the Tobacco Hornworm, Manduca

sexta (L.). Biol Bull 149: 214–225.

Nijhout, H. F. 1979. Stretch-induced moulting in Oncopeltus fasciatus. J. Insect. Physiol. 25:

277-281.

Nijhout, H.F. 1994. Insect Hormones. Princeton University Press, Princeton, NJ.

Nijhout, H.F. 2003. The control of body size in insects. Dev Biol 261: 1-9.

Nijhout, H.F., Riddiford, L.M., Mirth, C., Shingleton, A.W., Suzuki, Y., and Callier, V.

2014.The developmental control size in insects. WIREs Dev Biol 3: 113-134.

Ono, H., Rewitz, K.F., Shinoda, T., Itoyama, K., Petryk, A., Rybczynski, R., Jarcho, M., Warren,

J.T., Marques, G., Shimell, M.J., Gilbert, L.I., and O’Connor, M.B. 2006 Spook and Spookier

code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev Biol

298: 555-570.

51

Riddiford, L.M. 1996. Juvenile hormone: the status of its `status quo' action. Arch Insect

Biochem 32: 271-286.

Rountree, D. B., and Bollenbacher, W.E. 1986. The release of the prothoracicotropic hormone in

the tobacco hornworm, Manduca sexta, is controlled intrinsically by juvenile hormone. J exp

Biol 120: 41-58.

Sakurai, S., Okuda, M., and Ohtaki, T. 1989. Juvenile hormone inhibits ecdysone secretion and

responsiveness to prothoracicotropic hormone in prothoracic glands of Bombyx mori. Gen Comp

Endocrinol 75: 222-230.

Shemshedini, L. and Wilson, T. G. (1990). Resistance to juvenile hormone and an insect growth

regulator in Drosophila is associated with an altered cytosolic juvenile hormone binding protein.

Proc. Natl. Acad. Sci. USA87,2072 -2076.

Stieper, B.C., Kupershtok, M., Driscoll, M.V., Shingleton, A.W. 2008. Imaginal discs regulate

developmental timing in Drosophila melanogaster. Dev. Biol. 321: 18-26.

Suzuki, Y. and Nijhout, H. F. 2008. Constraint and developmental dissociation of phenotypic

integration in a genetically accommodated trait. Evolution & Development, 10: 690–699.

Taylor, B.W., Anderson, C.R., and Peckarsky, B. L. 1998. Effects of size at metamorphosis on

stone¯y fecundity, longevity, and reproductive success. Oecologia 114: 494-502.

Truman, J. W. (1972). Physiology of insect rhythms. I. Circadian organization of the endocrine

events underlying the moulting cycle of larval tobacco hornworms. J. Exp. Biol. 57: 805-20.

Truman, J. W. and Riddiford, L. M. 1974. Physiology of insect rhythms. III. The temporal

organization of the endocrine events underlying pupation of the tobacco hornworm. J. Exp. Biol.

60: 371-382.

Truman, J.W., and Riddiford, L.M. 1999. The origins of insect metamorphosis. Nature 401: 447-

452.

Wigglesworth, V.B. 1964. The hormonal regulation of growth and reproduction in insects. Adv.

Insect Physiol. 2: 247-336.

52

Wyatt, G.R., and Davey, K.G. 1996. Cellular and molecular actions of juvenile hormone. II.

Roles of juvenile hormone in adult insects. Adv. Insect Physiol. 26, 1-155.