Intestinal expression of genes involved in iron absorption in humans

Intestinal expression of genes involved in iron absorption in humans

Andreas Rolfs1,2, Herbert L. Bonkovsky2,4, James G. Kohlroser2,3, Kristina McNeal2, Ashish

Sharma2, Urs, V. Berger1, Matthias A. Hediger1,4

1Membrane Biology Program and Renal Division, Brigham and Women’s Hospital, Harvard

Medical School, Boston, MA

2Department of Medicine, Medical School, University of Massachusetts, Worcester, MA

3Current address: Division of Gastroenterology, Albany Medical College, Albany, NY

Keywords:

HFE, DCT1, DMT1, Nramp2, IREG1, MTP1, ferroportin1, Intestinal Iron Absorption, Human

Biopsies

Abbreviations:

divalent cation transporter (DCT1), hereditary hemochromatosis (HHC), iron-responsive element

(IRE), transferrin receptor (TfR), transferrin saturation (TfS)

4 Corresponding Author Address:

M.A.Hediger H.L. Bonkovsky Membrane Biology Program The Liver-Biliary-Pancreatic Center Brigham & Women’s Hospital University of Massachusetts Medical School Harvard Medical School Rm S6-737 HIM bldg., rm. 570 55 Lake Ave., North Ave. Louis Pasteur 77 Worcester, MA 01651 Boston, MA 02115 Phone: (617) 525-5820 (508) 856 3068 Fax: (617) 525-5821 (508) 856 3981 email: [email protected] [email protected]

Copyright 2001 by the American Physiological Society.

AJP-GI Articles in PresS. Published on October 31, 2001 as DOI 10.1152/ajpgi.00371.2001

Rolfs et al 10/29/2001

1

ABSTRACT

Hereditary hemochromatosis (HHC) is one of the most frequent genetic disorders in

humans. It is caused by a missense mutation (C282Y) in the HFE gene which triggers excessive

intestinal iron absorption, followed by toxic accumulation of iron in the liver and other organs. In

healthy individuals, the absorption of iron in the intestine is tightly regulated by the cells with

highest iron demand, in particular erythroid precursors. The cloning of the intestinal iron

transporter proteins, DCT1 and IREG1/hephaestin, provided new insight into the mechanisms

and regulation of intestinal iron absorption. The aim of this study was to assess whether, in man,

the two transporters are regulated in an iron dependent manner, and whether this regulation is

disturbed in HHC. Using quantitative PCR, we measured the RNA expression of DCT1, IREG,

and hephaestin mRNA expression in duodenal biopsy samples of individuals with normal iron

levels, iron deficiency anemia, or iron overload due to liver disease or hereditary

hemochromatosis. In control subjects, we found inverse relationships between the DCT1 splice

form containing an iron-responsive element (IRE), and blood hemoglobin, serum transferrin

saturation, or ferritin. Subjects with iron-deficiency anemia show a significant increase in

expression of DCT1(IRE) mRNA when compared with controls. Similarly in subjects

homozygous for the C282Y HFE mutation, the DCT1(IRE) expression levels remained high,

despite high serum iron saturation. In HHC, we found a significantly increased IREG1

expression, compared with controls. Hephaestin did not exhibit a similar iron dependent

regulation. In conclusion, our data show that the expression of the human DCT1 mRNAs is

regulated in an iron-dependent manner, similar to other mammals, while the mRNA of

hephaestin is not affected. In HHC patients, the mRNA expression levels of DCT1 and IREG1

remain high despite elevated serum transferrin saturation and ferritin levels. The lack of


2

appropriate down regulation of the apical and basolateral iron transporter in duodenum leads to

excessive iron absorption in persons with HHC.


3

INTRODUCTION

Hereditary hemochromatosis (HHC) is one of the most prevalent inherited disorders in

man. It is caused by excessive intestinal iron absorption that may lead to damage of various

organs, especially liver, pancreas, heart, and pituitary gland. As reported by Feder et al. in 1996,

it is primarily caused by a missense mutation within the HFE gene (mostly cysteine 282 to

tyrosine) (12). In HFE, this mutation leads to iron accumulation in the body, and may cause liver

cirrhosis or heart disease, and eventually death, if not treated by phlebotomy (5,14). The HFE

protein neither binds nor transports iron, but, rather, physically interacts with the transferrin

receptor (TfR) (13,21,30,45). Some investigators propose that the HFE protein competes with

diferric transferrin for the transferrin receptor (22), and thereby reduces the overall uptake of iron

into cells, maintaining low, but sufficient intracellular levels of iron (35,38). However, it has also

been reported that HFE protein can facilitate the uptake of transferrin-bound iron into certain

cells (26).

In the mammalian body, iron absorption is tightly regulated by the demand of iron for

erythropoiesis, and occurs only in the small intestine, in particular in the duodenum (18). Iron

uptake is mediated in two steps, as revealed by studies of naturally occurring mutations in

animals (3), and the characterization of recently cloned transporter genes (19,24). At the apices

of intestinal villi, enterocytes express the transporter DCT1 (also known as DMT1 or Nramp2)

that is essential for cellular uptake of iron from the intestinal lumen (15,19). The transport from

enterocytes into the serum, at the basolateral side of enterocytes, is accomplished by the

coordinated action of the transporter IREG1 (also known as MTP1 or ferroportin1 (1,11,24)),

and the multi-copper ferrroxidase hephaestin (44). For both transporters, DCT1 and IREG1, the

mRNA’s contain sequences resembling iron-responsive elements (IRE’s) previously found in the

mRNA’s of ferritin and TfR, that presumably regulate their expression by intracellular iron in a


4

cell specific manner (for review see refs. 34 and 41). DCT1 and IREG1 mRNA and protein have

been reported to be upregulated in response to chronic iron deficiency in the intestine

(1,19,24,43). Abboud and Haile isolated IREG1 (which they call MTP1) by the ability of its

RNA to bind the iron responsive element binding protein-1 (IRP1), immobilized on a column.

Likewise, binding of IRP1 to the mRNA of DCT1, has been reported recently (46).

Interestingly, intestinal absorption of iron, which is mediated by DCT1 and IREG1,

occurs in duodenal villi (1,8,24), whereas the “modulator of iron homeostasis”, HFE, is normally

expressed in crypt cells (7,31). How HFE, which is presumed to act as a modulator of the affinity

of TfR for transferrin, can regulate iron absorption in villus cells is still not completely

understood. Recently, it was shown that the lack of expression of hepcidin, a peptide synthesized

in liver, leads to iron overload in mice, similar to HFE or β2-microglobulin knock-out mice

(28,33). Whether this peptide acts as a regulator of genes involved in iron absorption, and how

this regulation occurs, remains to be determined.

A model proposed by Conrad et al. in 1964 (10) provides a possible mechanism for

regulation of iron absorption mediated by the amount of iron absorbed by crypt cells in the

intestine. This body iron “sensing mechanism” in crypt cells would be expected to be disturbed

in HHC, leading to imbalances in intestinal iron absorption in villus cells (37). The observed iron

dependent regulation of the two iron transporters, DCT1 and IREG/MTP1, raises the question of

a possible dysregulation of these transporters in HHC. In two previous studies, carefully selected

HHC patients homozygous for C282Y were compared with control subjects, subjects with

secondary iron overload, and iron deficient subjects for their expression level of total DCT1 and

IREG1. DCT1 and IREG1 were found to be increased in HHC. However, this study did not

differentiate between the two DCT1 splice forms (with and without an IRE) (47,48), and the

expression of hephaestin was not examined.


5

Recently two rare forms of hereditary hemochromatosis not related to mutations in the

HFE gene have been described. One of them is caused by a missense mutation in the IREG1

gene (29) and the other one by a defect in the recently identified second transferrin receptor

isoform, called TfR2 (36). These findings highlight the importance of iron transport in

controlling body iron homeostasis.

In the present study we investigated the expression of the mRNA’s of both the apical and

basolateral iron transporters in human upper intestinal biopsies in subjects with iron-deficiency

anemia, normal iron, and iron-overload. We compared the data from patients with homozygous

hereditary hemochromatosis (HHC) subjects with and without the major (C282Y) and minor

(H63D) mutations of HFE associated with HHC at different levels of serum ferritin and

transferrin saturation (TfS). We found that, in HHC patients without liver disease, DCT1(IRE)

and IREG1 are significantly upregulated in comparison with control individuals, whereas no

changes were detected for hephaestin. We also assessed the portion of DCT1 upregulation that is

attributable to HHC, by studying the regulation of DCT1 in normal individuals as a function of

blood hemoglobin, serum iron, and ferritin levels. The “normal” regulation of DCT1 in human

intestine by differentiating the two splice forms has not been reported heretofore.


6

MATERIALS and METHODS

Proximal duodenal biopsy samples (from the 2nd portion within 5cm of the duodenal

bulb) were obtained from 9 patients with classical hereditary hemochromatosis (C282Y +/+,

H63D -/-), and 27 patients with wild type genotype (C282Y -/-, H63D -/-). Patients were

recruited from the Clinic or the endoscopy suite of U Mass Memorial Healthcare. One patient

with phenotypic hemochromatosis volunteered to undergo endoscopy for study purposes. All

other patients volunteered for duodenal biopsies during medically indicated upper GI

endoscopies. In all cases, upper GI endoscopies were performed in subjects who were ingesting

diets that were not limited or supplemented with iron and after an overnight fast of at least 12

hours. The study protocol and consent form were approved by the Human Subjects’ Committee

of U Mass. All patients were older than 18 years and gave their written, informed consents.

At the time of endoscopy, blood was obtained for hematocrit, hemoglobin, serum ferritin,

serum iron binding capacity, transferrin, and HFE mutational analysis. The duodenal biopsies

were obtained with standard mucosal biopsy forceps inserted through standard gastrofiberscopes

(Olympus Corp. GIF140, Tokyo, Japan). They were immediately placed into 300 µl of Ultraspec

Total RNA Isolation Reagent (Biotecx, Houston, TX). Typically a total of six biopsies, each

about 5 mg wet weight, were placed into three 1.5 ml micro-centrifuge tubes, two specimens per

tube. A seventh biopsy was also collected, immediately placed into a cryovial, and snap frozen in

liquid N2 for histochemical studies. Tissue in Ultraspec was treated following the manufacturer’s

instructions, RNA’s were stored at -20oC under isopropanol, and prior to 1st strand synthesis

centrifuged, washed in ethanol and dissolved in 20 µl water.

Random primed 1st strand cDNA was synthesized from each biopsy sample with an

AMV-RT kit, following the manufacturer’s instructions (Roche, Indianapolis, IN), and using 1

µg total RNA as a template (OD260). Genomic sequences for IREG1 and hephaestin were


7

obtained from the ‘htgs’ sequence library of GenBank (IREG1 acc. no AC012488; hephaestin

acc. no AC020739). For β-actin and DCT1, the earlier published genomic sequences (23,27)

were used to design oligonucleotide primers.

The PCR-primers synthesized were as follows: β-actin (GenBank M10277)

2282gggaaatcgtgcgtgacatt2301 and 2583cacgaaactaccttcaactcc2603, exons3 to 4; IREG1 (GenBank

AC012488) 224tgctatctccagttccttgc205 and 160203tgtcttctcctgcaacaaca160184, exons1 to 5; hephaestin

(GenBank AC020739) 79303tataccatccaccctcatgg79284 and 63319gcatcctattgctctcctga63338, exons2 to

4; DCT1(nonIRE) (GenBank AF064481 andAF064483) 1535cccatcctcacatttacgag1554,

953atcccagagtccaagacaca934, exons14 to17; DCT1(IRE) (GenBank AF064481 and AF064482)

1535cccatcctcacatttacgag1554, 921ccctaatccagttctaag904 exons14 to 16a (IRE 3' end), respectively.

Quantitative-PCR amplification was performed with the Lightcycler device/software and

the SYBRgreen DNA master kit following the manufacturer’s instructions (Roche, Indianapolis,

IN). After initial denaturation at 95oC for 30sec, each gene was independently amplified and

detected using the following cycles (usually 40 cycles): β-actin: 95oC 0sec, 62oC 4sec, 72oC

5sec, 82oC 2sec (fluorescent detection, gain: 20); IREG1: 95oC 0sec, 58oC 8sec, 72oC 18sec,

82oC 3sec (fluorescent detection, gain: 15); hephaestin: 95oC 0sec, 53oC 10sec, 72oC 15sec, 82oC

2sec (fluorescent detection, gain: 30); DCT1(IRE): 95oC 0sec, 57oC 5sec, 72oC 12sec, 82oC 1sec

(fluorescent detection, gain: 20); DCT1(nonIRE): 95oC 0sec, 53oC 10sec, 72oC 15sec, 82oC 2sec

(fluorescent detection, gain: 30). Each PCR amplification was followed by a melting curve

analysis (97oC 5sec, 65oC 15sec, followed by 0.1oC ramping by continuous fluorescent

measurement to 99oC) to control for specific amplification products. Each sample was analyzed

at least twice; in some cases additional analysis of a second set of specimens was performed to

examine intra-individual variations. Data obtained for DCT1, IREG1 and hephaestin were


8

normalized by comparison with β-actin expression, therefore, the results might be called semi-

quantitative.

Non-radioactive in situ hybridization was performed as described previously (19), using a

digoxigenin (DIG)-labeled cRNA probe that contained 800 bases of DCT1(IRE) 3' untranslated

sequence (nucleotides 1719-2423, AB004857). Frozen sections (8µm) were cut from the

intestinal biopsies in a cryostat and captured onto Superfrost plus microscope slides (Fisher

Scientific, Pittsburgh, PA). The sections were fixed and acetylated, and then hybridized at 68°C

for 36 hours to the DCT1(IRE) probe (approximate concentration 100 ng/ml). Hybridized probe

was visualized using alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche,

Indianapolis, IN) and 5-bromo-4-chloro-3-indolyl-phosphate/Nitro blue tetrazolium (BCIP/NBT)

substrate (Kierkegard and Perry Laboratories, Gaithersburg, MD). Sections were rinsed several

times in 100 mM Tris, 150 mM NaCl, 20 mM EDTA pH 9.5, and coverslipped with glycerol

gelatin (Sigma, St. Louis, MO). Control sections were incubated in an identical concentration of

the sense probe transcript.

Statistical and regression analyses were performed using the computer software Prism

(GraphPad Software, Inc., San Diego, CA). Linear regression was calculated by the least square

method, and “r2" and “p” values are shown in the graphs to indicate the significance of the linear

regression analyses. Significance was determined using the unpaired t-test method.


9

RESULTS

We studied a total of 36 subjects (see Table 1 for details) of whom 27 were HFE normal,

(having neither the C282Y nor the H63D mutation; individuals with prefix WT [wild type], and

in the following called ‘controls’), and 9 of whom were homozygous for C282Y (i.e. have

classical HHC; individuals with prefix HHC). We divided the two groups further into 5 different

categories: Controls without liver disease (WT-LD), controls with iron deficiency anemia

without liver disease (WT-Fe), controls with liver disease (WT+LD) and HHC patients with or

without liver disease (HHC+/-LD). The reason for subdividing individuals with liver disease is

the observation that liver diseases can result in extensive iron accumulation. This division should

avoid mixing of two different effects influencing body iron homeostasis.

The genomic organizations of the human hephaestin and IREG1 genes were assembled

from sequences published by the human genome project. The primers for quantitative PCR of

DCT1, IREG1, and hephaestin were designed to amplify mRNA sequences spanning over at

least one intron, to rule out amplification of genomic DNA (Figure 1), which was excluded by

melting curve analysis using the Lightcycler software, and by agarose gel electrophoresis (not

shown).

As expected, subjects with iron deficiency anemia exhibited significantly lower mean

serum TfS values (p<0.0001) than controls (Figure 2a, WT-Fe). Furthermore, they had

significantly higher mean values for DCT1(IRE) mRNA expression (p=0.0078) than non-iron

deficient controls (WT-LD), with a mean value about 10 times higher for anemic subjects than

for subjects without anemia (Figure 2b). This increase was also detectable by in situ

hybridization analysis on sections of frozen intestinal biopsies (Figure 3). Between these two

groups no significant difference for DCT1(nonIRE) expression (Figure 2c) or hephaestin (not

shown) was observed. With respect to IREG1 mRNA expression, a modest, though statistically


10

not significant, increase of expression in the group with anemia was observed in contrast to an

earlier publication (48). We failed to detect an effect of age or gender on DCT1 mRNA

expression in this study (data not shown). Control subjects with normal iron status exhibited a

scattering for both, DCT1(IRE) and DCT1(nonIRE) expression within roughly one order of

magnitude (after normalization to β-actin (Figure 2a), in agreement with an earlier publication

which measured the total DCT1 content (46). Normalized mean values for DCT1(IRE) were

about 10-fold higher than DCT1(nonIRE), a difference also observed for intestinal DCT1

expression in other mammals (Rolfs, Hediger, unpublished observations).

When we compared the control group (WT-LD) with the HHC-LD group (n=5, subjects

HHC35 to HHC39 in Table1), we not only observed significant differences in TfS (p=0.0001,

Figure 2a), with HHC-LD having about three times higher values, but we also saw a significantly

higher DCT1(IRE) expression in the HHC-LD group (p=0.013, Figure 2b). In addition,

expression of IREG1 in the HHC-LD group was increased compared with controls (p=0.04,

Figure 2d). No differences in DCT1(nonIRE) (Figure 2c) or hephaestin (not shown) mRNA

expression could be detected between these groups. The expression level of DCT1(IRE) (Figure

2b) in the HHC-LD group was the same as for the group with iron deficiency anemia (WT-Fe),

despite markedly different serum iron data (Table1, Figure 2a). This suggests that, in contrast to

iron deficiency anemia, in HFE C282Y+/+ homozygous patients, expression of IREG1 and

DCT1(IRE) are not correlated with or dependent upon serum iron values. This lack of correlation

may be due to the disturbance of iron homeostatic signaling in homozygous C282Y HFE

subjects, analogous to the recently described alterations of hepcidin in mice (28,33).

We failed to observe statistically significant differences for DCT1 (with or without IRE),

IREG1, or hephaestin mRNA expression between WT-LD and WT+LD. The number of liver

disease patients, or their diversity, might make it difficult to derive any conclusive data, since the


11

etiology and stage of liver disease may influence expression of these genes. Indeed, in the

controls, expression levels of hephaestin mRNA were within one order of magnitude, regardless

of serum TfS or ferritin. In contrast, WT09, who has chronic hepatitis C (Table 1), had modestly

elevated hephaestin mRNA levels (not shown). The liver disease in this patient may have

influenced the expression of the hephaestin gene in an iron independent manner.

Among controls, we found inverse relationships of DCT1(IRE) mRNA expression and

serum TfS (Figure 4a; r2=0.49, p=0.016), serum ferritin (Figure 4b; r2=0.65, p=0.005), and blood

hemoglobin (Figure 4c; r2=0.46, p=0.015). Our data indicate that, in man, the IRE-containing

form of DCT1 mRNA is regulated in the same way in response to iron deprivation as in rat and

mouse (8, 19). We did not observe significant correlations among duodenal IREG1 (Figure 6a),

DCT1(nonIRE), or hephaestin mRNA expression and any of the blood data studied in the WT-

LD group.

With respect to patients with HHC without liver disease (HHC-LD) who, as already

described, exhibited high DCT1(IRE) mRNA expression despite elevated TfS values (Figure 2a

and b), no inverse relationship between DCT1(IRE) and serum ferritin or transferrin saturation

was detectable (Figure 5a, r2=0.26, p=0.4, and b, r2=0.67, p=0.08, respectively). For comparison,

linear regression lines of controls from Figure 4 are shown in Figure 5. When correlating with

blood hemoglobin we found an inverse linear relationship which did not differ significantly from

that of the WT-LD group (Figure 5c), presumably because hemoglobin synthesis is not affected

in HHC. In contrast to this, IREG1 mRNA expression and serum TfS exhibited a linear

relationship for the HHC-LD group (Figure 6b; r2=0.878, p=0.02, n=5), which was not paralleled

by a similar relationship in WT-LD subjects (Figure 6a). These findings demonstrate that the

correlation between serum iron levels and intestinal iron absorption is disturbed in HFE

C282Y+/+ homozygous patients.


12

DISCUSSION

Numerous advances in iron metabolism have been made in the last 5 years, ushered in by

cloning and characterization of the HFE gene and its mutations in HHC. In addition, several

proteins responsible for the intestinal absorption of iron have been identified, including DCT1,

IREG1 and hephaestin. Relations among these transporters have not yet been the subject of in

depth analysis in humans. The data described here, revealing an inverse correlation between

DCT1(IRE) mRNA expression and serum transferrin saturation, serum ferritin, and blood

hemoglobin (Figures 4a to c), emphasize the relationship of iron absorption and body iron

homeostasis. The upregulation of DCT1 mRNA in iron deficiency is consistent with studies in

rats (19) and mice (16) kept on diets low in iron, although in our patients, blood loss rather than

iron-deficient diets, was the cause of iron deficiency. The increase in DCT1 mRNA levels is

most probably due to increased stability of the splice form of DCT1 which contains an IRE in its

3'UTR, since the other splice form without the IRE did not exhibit a similar regulation.

In contrast, in HFE C282Y+/+ homozygous patients an inverse relationship for

DCT1(IRE) and transferrin saturation was not observed, and, expression of DCT1(IRE) mRNA

was higher than anticipated by the serum transferrin saturation. HHC-LD patients, despite high

serum transferrin saturations, exhibit elevations of DCT1- IRE mRNA expression to the same

degree as controls with iron-deficient anemia. Moreover, duodenal DCT1(IRE) mRNA

expression in these individual seems less closely correlated to serum ferritin levels, since

untreated patients having similar serum ferritin levels (hh32 and hh33), had different serum

transferrin saturation (Table 1) and DCT1(IRE) expressions.

Our observations on HFE C282Y+/+ homozygous patients are in agreement with studies

of DCT1(IRE) regulation in homozygous mice with a gene disruption of HFE (16). More recent

studies (9,17, 40) suggest that HFE-regulated iron absorption involves additional, yet to be


13

determined factors. In one study comparing normal and β2-microglobulin knock-out mice (9), no

significant difference in duodenal DCT1 protein amount was observed. In another recent report

of HFE knock-out mice (17) a strong influence of the genetic background on the level of iron

accumulation was observed in three different inbred mouse strains, suggesting that additional

heritable factors influence the phenotype, and might account for the differences in expression

and regulation of DCT1 reported from different laboratories (9,16, 40). It has also been reported

that, in the duodenums of HHC patients and in HFE knockout mice, IRP binding affinity is

increased, leading to increased TfR expression (2,32). These findings support the model of a

defect in iron sensing in crypt cells of the small intestine of HHC subjects, leading to

inappropriately high levels of expression of genes involved in iron metabolism and transport in

differentiating villus cells (37), as if these iron replete subjects had iron deficiency anemia.

However, how mutation or disruption of the HFE gene results in altered signaling that makes

maturing villus cells behave as if the body had iron-deficiency remains unknown. Recent results

in mice suggest that the oligopeptide hepcidin (also referred to as LEAP-1) may be a molecule

that reports the status of tissue (especially liver) iron stores to duodenal crypt cells (28,33). In

normal subjects, such signaling aids in appropriate regulation of mucosal uptake and transport of

iron by modulation of expression of DCT1(IRE) and IREG1. It is possible that patients with

HHC or mice with HFE gene disruption lack the ability to transduce the hepcidin signal to their

duodenal enterocytes. However, it is currently unknown whether the HFE/TfR complex interacts

with hepcidin, and whether such an interaction triggers a specific response in enterocytes and

macrophages.

With respect to the expression of IREG1 mRNA, our HHC-LD patients exhibited a

significant upregulation compared with controls, in agreement with recent findings (47,48).

IREG1 mRNA, which contains a 5'UTR IRE, may also be regulated at the transcriptional level


14

(Figure 2d and 6a), as described for ferritin or the erythroid form of 5-aminolevulinate synthase

(20,25,34,39,41,42). It should be noted that the observed linear correlation for IREG1 with

serum transferrin saturation in HHC-LD occurs at a level of iron loading not normally seen in

healthy individuals. Further studies with a larger number of patients are required to investigate

the observed upregulation in hemochromatosis. In contrast, no iron-dependent regulation of the

hephaestin gene expression was observed.

It has been known for many years that iron overload occurs in liver cirrhosis, and recent

results indicate that the great majority of patients with end-stage chronic liver disease and iron

overload do not have HHC (i.e., are not C282Y +/+) (4,6). Although our data do not show

evidence for upregulation of intestinal iron transport in cirrhosis, this possibility cannot be ruled

out at this point, since none of our liver disease patients actually had iron overload, as shown by

liver biopsies (data not shown) and results in Table 1. Therefore, how and why patients with end-

stage liver disease develop iron overload remains to be elucidated. Additional studies in patients

with chronic liver diseases are currently in progress.


15

ACKNOWLEDGMENTS

We thank the nursing and clinical staff of the University of Massachusetts Memorial

Gastrointestinal Endoscopy Unit for their help in performing duodenal mucosal biopsies and care

of patients studied.

Supported by grants RO1 DK 57782 to M.A.H., RO1 DK 38825 to H.L.B., and contract NO1

DK 92326 to H.L.B. from NIH, and by a grant from American College of Gastroenterology to

J.G.K & H.L.B.


16

References

1. Abboud, S, and Haile, DJ. A novel mammalian iron-regulated protein involved in

intracellular iron metabolism. J Biol Chem 275: 19906-19912, 2000.

2. Bahram, S, Gilfillan, S, Kuhn, LC, Moret, R, Schulze, JB, Lebeau, A, and Schumann, K.

Experimental hemochromatosis due to MHC class I HFE deficiency: immune status and

iron metabolism. Proc Natl Acad Sci U S A 96: 13312-13317, 1999.

3. Bannerman, RM. Genetic defects of iron transport. Fed Proc 35: 2281-2285, 1976.

4. Bonkovsky HL, and Lambrecht, RW. Iron-induced liver injury. Clin Liver Dis 4: 409-429,

2000.

5. Bonkovsky, HL. Iron and the liver. Am J Med Sci 301: 32-43, 1991.

6. Bonkovsky, HL, and Obando, JV. Role of HFE gene mutations in liver diseases other than

hereditary hemochromatosis. Curr Gastroenterol Rep 1: 30-37, 1999.

7. Byrnes, V, Ryan, E, O'Keane, C, and Crowe, J. Immunohistochemistry of the Hfe protein

in patients with hereditary hemochromatosis, iron deficiency anemia, and normal controls.

Blood Cells Mol Dis 26: 2-8, 2000.

8. Canonne-Hergaux, F, Gruenheid, S, Ponka, P, and Gros, P. Cellular and subcellular

localization of the Nramp2 iron transporter in the intestinal brush border and regulation by

dietary iron. Blood 93: 4406-4417, 1999.

9. Canonne-Hergaux, F, Levy, JE, Fleming, MD, Montross, LK, Andrews, NC, and Gros, P.

Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron

overload disorders. Blood 97: 1138-1140, 2001.

10. Conrad, ME, Weintraub, LR, and Crosby, WH. The role of the intestine in iron kinetics. J

Clin Invest 43: 963-974, 1964.


17

11. Donovan, A, Brownlie, A, Zhou, Y, Shepard, J, Pratt, SJ, Moynihan, J, Paw, BH, Drejer,

A, Barut, B, Zapata, A, Law, TC, Brugnara, C, Lux, SE, Pinkus, GS, Pinkus, JL, Kingsley,

PD, Palis, J, Fleming, MD, Andrews, NC, and Zon, LI. Positional cloning of zebrafish

ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403: 776-781, 2000.

12. Feder, JN, Gnirke, A, Thomas, W, Tsuchihashi, Z, Ruddy, DA, Basava, A, Dormishian, F,

Domingo, R Jr., Ellis, MC, Fullan, A, Hinton, LM, Jones, NL, Kimmel, BE, Kronmal, GS,

Lauer, P, Lee, VK, Loeb, DB, Mapa, FA, McClelland, E, Meyer, NC, Mintier, GA,

Moeller, N, Moore, T, Morikang, E, Prass, E, Quintana, L, Starnes, S, Schatzman, R,

Brunke, K, Drayna, D, Risch, N, Bacon, B, and Wolff, RK. A novel MHC class I-like gene

is mutated in patients with hereditary haemochromatosis. Nat Genet 13: 399-408, 1996.

13. Feder, JN, Penny, DM, Irrinki, A, Lee, VK, Lebron, JA, Watson, N, Tsuchihashi, Z, Sigal,

E, Bjorkman, PJ, and Schatzman, RC. The hemochromatosis gene product complexes with

the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci U S A

95: 1472-1477, 1998.

14. Feder, JN. The hereditary hemochromatosis gene (HFE): a MHC class I-like gene that

functions in the regulation of iron homeostasis. Immunol Res 20: 175-185, 1999.

15. Fleming, MD, Trenor, CC, Su, MA, Foernzler, D, Beier, DR, Dietrich, WF, and Andrews,

NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter

gene. Nat Genet 16: 383-386, 1997.

16. Fleming, RE, Migas, MC, Zhou, X, Jiang, J, Britton, RS, Brunt, EM, Tomatsu, S, Waheed,

A, Bacon, BR, and Sly, WS. Mechanism of increased iron absorption in murine model of

hereditary hemochromatosis: Increased duodenal expression of the iron transporter DMT1.

Proc Natl Acad Sci U S A 96: 3143-3148, 1999.


18

17. Fleming, RE, Holden, CC, Tomatsu, S, Waheed, A, Brunt, EM, Britton, RS, Bacon, BR,

Roopenian, DC, and Sly, WS. Mouse strain differences determine severity of iron

accumulation in Hfe knockout model of hereditary hemochromatosis. Proc Natl Acad Sci

U S A 98: 2707-2711, 2001.

18. Green, R, Charlton, R, Seftel, H, Bothwell, T, Mayet, F, Adams, B, Finch, C, and Layrisse,

M. Body iron excretion in man: a collaborative study. Am J Med 45: 336-353, 1968.

19. Gunshin, H, Mackenzie, B, Berger, UV, Gunshin, Y, Romero, MF, Boron, WF,

Nussberger, S, Gollan, JL, and Hediger, MA. Cloning and characterization of a mammalian

proton-coupled metal-ion transporter. Nature 388: 482-488, 1997.

20. Hentze, MW, and Kuhn, LC. Molecular control of vertebrate iron metabolism: mRNA-

based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl

Acad Sci U S A 93: 8175-8182, 1996.

21. Lebron, JA, Bennett, MJ, Vaughn, DE, Chirino, AJ, Snow, PM, Mintier, GA, Feder, JN,

and Bjorkman, PJ. Crystal structure of the hemochromatosis protein HFE and

characterization of its interaction with transferrin receptor. Cell 93: 111-123, 1998.

22. Lebron, JA, West, AP Jr., and Bjorkman, PJ. The hemochromatosis protein HFE competes

with transferrin for binding to the transferrin receptor. J Mol Biol 294: 239-245, 1999.

23. Lee, PL, Gelbart, T, West, C, Halloran, C, and Beutler, E. The human Nramp2 gene -

Characterization of the gene structure, alternative splicing, promoter region and

polymorphisms. Blood Cells Mol Dis 24: 199-215, 1998.

24. McKie, AT, Marciani, P, Rolfs, A, Brennan, K, Wehr, K, Barrow, D, Miret, S, Bomford,

A, Peters, TJ, Farzaneh, F, Hediger, MA, Hentze, MW, and Simpson, RJ. A novel

duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to

the circulation. Mol Cell 5: 299-309, 2000.


19

25. Menotti, E, Henderson, BR, and Kuhn, LC. Translational regulation of mRNAs with

distinct IRE sequences by iron regulatory proteins 1 and 2. J Biol Chem 273: 1821-1824,

1998.

26. Montosi, G, Paglia, P, Garuti, C, Guzman, CA, Bastin, JM, Colombo, MP, and Pietrangelo,

A. Wild-type HFE protein normalizes transferrin iron accumulation in macrophages from

subjects with hereditary hemochromatosis. Blood 96: 1125-1129, 2000.

27. Nakajima-Iijima, S, Hamada, H, Reddy, P, and Kakunaga, T. Molecular structure of the

human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns.


28. Nicolas, G, Bennoun, M, Devaux, I, Beaumont, C, Grandchamp, B, Kahn, A, and Vaulont,

S. Lack of hepcidin gene expression and severe tissue iron overload in upstream

stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A 98: 8780-8785,

2001.

29. Njajou, OT, Vaessen, N, Joosse, M, Berghuis, B, van Dongen, JW, Breuning, MH,

Snijders, PJ, Rutten, WP, Sandkuijl, LA, Oostra, BA, van Duijn, CM, and Heutink, P. A

mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nat Genet

28: 213-214, 2001.

30. Parkkila, S, Waheed, A, Britton, RS, Bacon, BR, Zhou, XY, Tomatsu, S, Fleming, RE, and

Sly, WS. Association of the transferrin receptor in human placenta with HFE, the protein

defective in hereditary hemochromatosis. Proc Natl Acad Sci U S A 94: 13198-13202,

1997.

31. Parkkila, S, Waheed, A, Britton, RS, Feder, JN, Tsuchihashi, Z, Schatzman, RC, Bacon,

BR, and Sly, WS. Immunohistochemistry of HLA-H, the protein defective in patients with


20

hereditary hemochromatosis, reveals unique pattern of expression in gastrointestinal tract.


32. Pietrangelo, A, Casalgrandi, G, Quaglino, D, Gualdi, R, Conte, D, Milani, S, Montosi, G,

Cesarini, L, Ventura, E, and Cairo, G. Duodenal ferritin synthesis in genetic

hemochromatosis. Gastroenterology 108: 208-217, 1995.

33. Pigeon, C, Ilyin, G, Courselaud, B, Leroyer, P, Turlin, B, Brissot, P, and Loreal, O. A new

mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide

hepcidin, is overexpressed during iron overload. J Biol Chem 276: 7811-7819, 2001.

34. Richardson, DR, and Ponka, P. The molecular mechanisms of the metabolism and transport

of iron in normal and neoplastic cells. Biochim Biophys Acta 1331: 1-40, 1997.

35. Riedel, HD, Muckenthaler, MU, Gehrke, SG, Mohr, I, Brennan, K, Herrmann, T, Fitscher,

BA, Hentze, MW, and Stremmel, W. HFE downregulates iron uptake from transferrin and

induces iron- regulatory protein activity in stably transfected cells. Blood 94: 3915-3921,

1999.

36. Roetto, A, Totaro, A, Piperno, A, Piga, A, Longo, F, Garozzo, G, Cali, A, De Gobbi, M,

Gasparini, P, and Camaschella, C. New mutations inactivating transferrin receptor 2 in

hemochromatosis type 3. Blood 97: 2555-2560, 2001.

37. Rolfs, A, and Hediger, MA. Metal ion transporters in mammals: structure, function and

pathological implications. J Physiol 518: 1-12, 1999.

38. Roy, CN, Penny, DM, Feder, JN, and Enns, CA. The hereditary hemochromatosis protein,

HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem

274: 9022-9028, 1999.


21

39. Schumann, K, Moret, R, Kunzle, H, and Kuhn LC. Iron regulatory protein as an

endogenous sensor of iron in rat intestinal mucosa. Possible implications for the regulation

of iron absorption. Eur J Biochem 260: 362-372, 1999.

40. Sproule, TJ, Jazwinska, EC, Britton, RS, Bacon, BR, Fleming, RE, Sly, WS, and

Roopenian, DC. Naturally variant autosomal and sex-linked loci determine the severity of

iron overload in beta 2-microglobulin-deficient mice. Proc Natl Acad Sci U S A 98: 5170-

5174, 2001.

41. Theil, E. C., McKenzie, RA, and Sierzputowska-Gracz, H.. Structure and function of IREs,

the noncoding mRNA sequences regulating synthesis of ferritin, transferrin receptor and

(erythroid) 5-aminolevulinate synthase. Adv Exp Med Biol 356: 111-118, 1994.

42. Theil, EC. The iron responsive element (IRE) family of mRNA regulators. Regulation of

iron transport and uptake compared in animals, plants, and microorganisms. Met Ions Biol

Syst 35: 403-434, 1998.

43. Trinder, D, Oates, PS, Thomas, C, Sadleir, J, and Morgan, EH. Localisation of divalent

metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in

iron deficiency, but to hepatocytes in iron overload. Gut 46: 270-276, 2000.

44. Vulpe, CD, Kuo, YM, Murphy, TL, Cowley, L, Askwith, C, Libina, N, Gitschier, J, and

Anderson, G J. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron

transport, is defective in the sla mouse. Nat Genet 21: 195-199, 1999.

45. Waheed, A, Parkkila, S, Saarnio, J, Fleming, RE, Zhou, XY, Tomatsu, S, Britton, RS,

Bacon, BR, and Sly, WS. Association of HFE protein with transferrin receptor in crypt

enterocytes of human duodenum. Proc Natl Acad Sci U S A 96: 1579-1584, 1999.


22

46. Wardrop, SL, and Richardson, DR. The effect of intracellular iron concentration and

nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake. Eur J

Biochem 263: 41-49, 1999.

47. Zoller, H, Pietrangelo, A, Vogel, W, and Weiss, G. Duodenal metal-transporter (DMT-1,

NRAMP-2) expression in patients with hereditary haemochromatosis. Lancet 353: 2120-

2123, 1999.

48. Zoller, H, Koch, RO, Theurl, I, Obrist, P, Pietrangelo, A, Montosi, G, Haile, DJ, Vogel, W,

and Weiss, G. Expression of the duodenal iron transporters divalent-metal transporter 1 and

ferroportin 1 in iron deficiency and iron overload. Gastroenterology 120: 1412-1419, 2001.


23

Figure Legends

Figure 1

Positions of PCR primers and regions amplified within genes studied. For DCT1, the exon-intron

structures are based on the published sequences, and for IREG1 and hephaestin on sequences

derived from the ‘htgs’ part of GenBank (see Materials for details). The exons are shown as

black rectangles, except for the two different exons (16, 16a) of DCT1, which are shown as gray.

Figure 2

Levels of serum transferrin saturation (a), and mRNA levels of DCT1(IRE) (b), DCT1(nonIRE)

(c), and IREG1 (d) mRNA in subjects studied. All results are shown as mean values+SD. Values

that differ significantly from control values are marked with symbols.

(a) Serum transferrin saturation; øless than control, p<0.0001; # greater than control, p=0.0001.=

(b) DCT1(IRE) mRNA expression; øø greater than control, p=0.0078; ## greater than control,

p=0.013.

(c) DCT1(nonIRE) mRNA expression; All groups had similar values, which did not differ

statistically one from the other.

(d) IREG1 expression; øøøsignificantly greater than control, p=0.04.

Figure 3

In situ expression of mRNA of DCT1(IRE) in duodenal biopsies from controls (no HFE

mutations) with, and without iron deficiency anemia.


24

Figure 4

Inverse relationships of DCT1(IRE) mRNA expression in WT-LD (no HFE mutations, no liver

disease), with and without anemia, with serum transferrin saturation (a), serum ferritin levels (b),

and blood hemoglobin (c). The values for expression of DCT1(IRE) mRNA were normalized to

β-actin mRNA expression level, which is not regulated by iron. The dotted lines indicate the

95% confidence interval for the linear regressions.

Figure 5

DCT1(IRE) mRNA expression in HHC-LD as a function of with serum transferrin saturation (a),

serum ferritin levels (b), and blood hemoglobin (c). The values for expression of DCT1(IRE)

mRNA were normalized to β-actin mRNA expression level. Note that five data points were used

for each analysis; two points at ~75% saturation and ~log DCT1 3.0 are overlapping in figure a.

For comparison the linear regression lines for controls from figures 4a and b are included. The

dotted lines in (c) indicate the 95% confidence interval for the linear regression.

Figure 6

Relationship of IREG1 mRNA expression in duodenal mucosa as a function of serum TfS in

WT-LD (a), and HHC-LD (b). The values for expression of IREG1 mRNA were normalized

to=β-actin mRNA expression levels. In controls IREG1 mRNA expression did not correlate with

TfS. Note that five data points were used for linear regression analysis of the HHC-LD group

and that two points at ~75% saturation and ~log IREG 1.8 are overlapping. The dotted lines

indicate the 95% confidence interval for the linear regression.

Table 1: Selected demographic, laboratory, and clinical data on subjects studied

NAME AGE M/F Hgb MCV

TF

SAT’N Ferritin

HFE

genotype

Liver

Disease Major Diagnoses

(g/dl) (fl) (%) (ng/ml) C282Y H63D (Yes/No)

WT01 26 F 13.5 87 27 27 -/- -/- N GERD

WT02 49 M 13.2 83 23 865 -/- -/- N GERD, chronic anemia, chronic elevated ferritin

WT03 31 M 16 83 32 284 -/- -/- N Irritable bowel syndrome

WT04 47 M 11.6 93 28 286 -/- -/- Y CHC, cirrhosis, alcoholism, HCC

WT05 50 M 15 99 51 129 -/- -/- Y CHC, cirrhosis

WT06 50 F 9.9 67 6 4 -/- -/- N Iron deficiency anemia, ulcerative colitis

WT07 50 M 14.8 85 26 246 -/- -/- N GERD

WT08 61 M 9.1 78 12 11 -/- -/- Y Ulcerative colitis, colon cancer, iron deficiency anemia

WT09 51 M 12.6 80 12 9 -/- -/- N CHC, iron deficiency anemia

WT10 54 M 13.8 91 12 247 -/- -/- Y Lymphoma, anemia, cirrhosis

WT11 61 M 12.1 65 23 27 -/- -/- N CHC, thalassemia minor, iron-reduced

WT12 76 M 13.1 91 24 111 -/- -/- Y Alcoholic cirrhosis, diabetes, portal hypertension

WT13 81 F 9.1 83 5 8 -/- -/- Y Primary biliary cirrhosis, iron deficiency anemia

WT14 65 F 13.1 93 38 140 -/- -/- Y Cryptogenic cirrhosis, portal hypertension

WT15 63 F 12.4 91 22 N/A -/- -/- N GERD

WT16 42 F 11.4 84 19 58 -/- -/- Y sarcoidosis

WT17 49 M 14.7 92 49 123 -/- -/- Y CHC, cirrhosis,diabetes milletus

WT18 34 M 14.8 94 24 180 -/- -/- N GERD, esophagitis

WT19 80 F 11.1 88 N/A 336 -/- -/- N cholecystitis

WT20 46 M 14.3 89 35 120 -/- -/- Y CHC, cirrhosis

WT21 62 F 11.9 87 38 89 -/- -/- Y CHC, cirrhosis

WT22 59 F 13.4 89 23 33 -/- -/- Y severe NASH, CHC, cirrhosis

WT23 42 M 14.9 92 N/A N/A -/- -/- Y NASH, obesity, cirrhosis

WT24 46 M 15.8 91 N/A 342 -/- -/- Y CHC, obesity, cirrhosis

WT25 62 F 11.9 87 38 89 -/- -/- Y CHC, cirrhosis

WT26 49 F 13.3 94 21 81 -/- -/- Y alcoholic cirrhosis

WT27 50 F 12.1 95 31 133 -/- -/- N CHC

HHC31 29 M 11.4 78 10 21 +/+ -/- Y HHC*, cirrhosis, seizure disorder

HHC32 42 M 13.7 95 73 782 +/+ -/- Y HHC, CHC, alcoholism, drug abuse

HHC33 50 M 11.2 99 N/A 594 +/+ -/- Y HHC, CHC, cirrhosis, ulcerative colitis

HHC34 50 M 14.1 102 61 179 +/+ -/- Y HHC*, primary sclerosing cholangitis, cirrhosis

HHC35 27 F 13.2 97 43 24 +/+ -/- N HHC*, iron depleted not deficient, no liver disease

HHC36 51 M 15.1 97 79 75 +/+ -/- N HHC*, antral gastritis, undergoing phlebotomy

HHC37 52 M 12.3 97 80 789 +/+ -/- N HHC, GERD

HHC38 55 F 10.6 91 80 8 +/+ -/- N *HHC

HHC39 58 M 11.6 102 101 1692 +/+ -/- N HHC

Ref. Range - -

F:12-16

82-101 20-50

F:12-150 -/- -/- N

M:14-18 M:12-

250 * Fully treated by therapeutic phlebotomy; no iron overload present at the time of the study. Abbreviations used: CHC, chronic hepatitis C; ESLD, end stage liver disease; GERD, gastro-esophageal reflux disease; HCC, hepatocellular carcinoma; HHC, hereditary hemochromatosis N/A, not available

hephaestin

IREG1/MTP1

DCT1/Nramp2

Exon 1 2 3 4 5 6 7 8

Exon 1 2 3 4 5 6 7 8 9 10 11 12 131415 16 / 16a 17

Exon 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

1 6 a

IRE

nonIRE

Figure 1

Figure 2 WT-LD

WT-Fe

HHC+LD

WT+LD

HHC-LDa to d:

a

Seru

mT

ransfe

rrin

Satu

ration

(%)

100

75

50

25

0

�

#

b

log[D

CT

1(I

RE

)/b

eta

-actin]

4

3

2

1

0

��##

log[D

CT

1(n

onIR

E)

/beta

-actin]

4

3

2

1

0

-1

-2

c d

log[IR

EG

1/b

eta

-actin]

3

2

1

0

��

Figure 4:

b

log[D

CT

1(I

RE

)/beta

-actin]

4

3

2

1

0

r =0.65p=0.005

2

0 100 200 300 400

Serum Ferritin (ng/ml)

a

r =0.49p=0.016

2

Serum Transferrin Saturation (%)

0 10 20 30 40

log[D

CT

1(I

RE

)/beta

-actin]

4

3

2

1

0

c

log[D

CT

1(I

RE

)/beta

-actin]

4

3

2

1

0

r =0.46p=0.015

2

Blood Hemoglobin (g/dl)

10 11 12 13 14 15 16 17 18

Figure 5

a


0 25 50 75 100 125

log[D

C1(I

RE

)/beta

-actin] 5

4

3

2

1

0

c

Blood Hemoglobin (g/dl)

10 11 12 13 14 15 16 17

log[D

CT

1(I

RE

)/beta

-actin]

5

3

2

1

0

4

r =0.55p=0.15

2

5

4

3

2

1

0log[D

C1(I

RE

)/beta

-actin]

0 500 1000 1500 2000

Serum Ferritin (ng/ml)

b

Figure 6


0 25 50 75 100 125

log[IR

EG

1/b

eta

-actin] 4

3

2

1

0

-1

a

b

r =0.878p=0.019

2


0 25 50 75 100 125

log[IR

EG

1/b

eta

-actin] 4

3

2

1

0

-1

Intestinal expression of genes involved in iron absorption in humans

Documents

Transcript of Intestinal expression of genes involved in iron absorption in humans