R E S E A R C H L E T T E R

Invivoanalysis ofYersinia enterocolitica infectionusing luxCDABEJanja Trcek, Katrin Berschl & Konrad Trulzsch

Max von Pettenkofer-Institut fur Hygiene und Medizinische Mikrobiologie, Ludwig Maximilans Universitat, Munich, Germany

Correspondence: Konrad Trulzsch, Max von

Pettenkofer-Institut fur Hygiene und

Medizinische Mikrobiologie, Ludwig

Maximilans Universitat, LMU Munchen,

Pettenkoferstr. 9a, 80336 Munich, Germany.

Tel.: 149 89 5160 5280; fax: 149 89 5160

5223; e-mail: truelzsch@mvp.

uni-muenchen.de

Received 3 February 2010; revised 22 March

2010; accepted 30 March 2010.

Final version published online 4 May 2010.

DOI:10.1111/j.1574-6968.2010.01983.x

Editor: Klaus Hantke

Keywords

Yersinia; luxCDABE; invasin; Peyer’s patch;

mouse model.

Abstract

Yersiniae expressing an L-arabinose-inducible luxCDABE reporter were used to

analyze the colonization of mice. Infection of live mice was followed over a period

of 6 days. These experiments revealed frequent colonization of cervical lymph

nodes after oral, but not intravenous infection. Furthermore, the well-known

colonization of the small intestine, Peyer’s patches (PPs) of the ileum, the cecal

lymph follicle, mesenteric lymph nodes, liver, and spleen was easily detectable.

Removal of the intestinal tract of mice revealed that the number of abscessed PPs

and other tissues can be easily quantified. Experiments with an invasin mutant

expressing luxCDABE revealed a significantly reduced number of abscessed PPs,

cecal lymph follicles, and lymph nodes in yersiniae lacking invasin.

Introduction

Yersinia enterocolitica is an enteropathogenic Gram-negative

bacterium, which is the third most common cause of

foodborne gastroenteritis in Europe (Bottone, 1997). Yersi-

nia enterocolitica can proliferate in food products at refrig-

erator temperatures, making it a major concern for public

health authorities. Yersiniosis may present as enteritis,

terminal ileitis, or mesenteric lymphadenitis (pseudoappen-

dicitis) with watery or sometimes bloody diarrhea. Patients

with iron overload states such as hemolytic anemia or

hemochromatosis can develop systemic disease with focal

abscess formation in the liver and spleen (Bockemuhl &

Roggentin, 2004). In the oral mouse infection model, a

similar disease results, with yersiniae replicating in the small

intestine, invading Peyer’s patches (PPs) of the distal ileum,

and disseminating to the liver and spleen. In these tissues

and organs, yersiniae replicate predominantly extracellularly

and form monoclonal microabscesses (Oellerich et al.,

2007). Yersiniae are believed to invade PPs of the ileum by

entering through specialized epithelial cells called M cells

(Schulte et al., 2000). This is made possible by the interac-

tion of the Yersinia invasin with b1 integrins (Isberg &

Leong, 1990), which are expressed on the luminal side of

M cells, but not enterocytes (Clark et al., 1998). Invasion of

PPs is made possible by the expression of several nonfim-

brial adhesins such as invasin (Inv) and possibly Yersinia

adhesin A (YadA), which can both potentially interact with

b1 integrins and could mediate the adherence and invasion

of M cells (Eitel & Dersch, 2002; Hudson et al., 2005).

Reporter systems such as green fluorescent protein (GFP)

and bacterial luciferase (LuxAB) have been used to study

Yersinia infection in mice (Kaniga et al., 1992; Oellerich

et al., 2007). The drawback of the GFP reporter is that it is

very stable, and thus its expression responds only slowly to

environmental changes. Furthermore, it can be toxic for cells

when expressed at high levels (Greer & Szalay, 2002; Rang

et al., 2003). LuxAB, which requires the addition of a

substrate for measuring enzyme activity, has been used for

monitoring yersiniae only in feces (Kaniga et al., 1992). In

contrast, luxCDABE codes not only for luciferase (LuxAB)

but also for the enzymes involved in substrate synthesis

(LuxCDE). Enzymes encoded by the luxCDABE operon of

Photorhabdus luminescens are stable at 37 1C and above

(Meighen, 1993). In contrast to the fluorescence of GFP,

the bioluminescence of LuxCDABE requires metabolically

active bacteria. Therefore, this method allows live noninva-

sive imaging of live bacteria. The luxCDABE reporter has

FEMS Microbiol Lett 307 (2010) 201–206 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

LET

TER

S

been used to study infection by a wide range of bacteria such

as Listeria, Staphylococcus aureus, Salmonella, and Escher-

ichia coli (Francis et al., 2000, 2001; Loessner et al., 2007;

Foucault et al., 2010). LuxCDABE, however, has not been

used to follow Yersinia infection of PPs, lymph nodes, or

spleen, even though the ability of yersiniae to form abscesses

in these organs predisposes yersiniosis to the study with this

reporter. To follow Yersinia infection in the mouse model,

we expressed luxCDABE under control of the L-arabinose-

inducible PBAD promoter, which has been shown to be

tightly regulated in vivo (Loessner et al., 2007).

Materials and methods

Bacterial strains and growth conditions

Deletion mutant WA-C(pYV<Cm) Dinv was constructed by

l red-mediated recombination replacing the promoter and

the entire coding region of inv with a spectinomycin

cassette. Mutagenesis was performed as described previously

(Trulzsch et al., 2004) using the forward primer: cgcatta

gattaatgcatcgtgaaaaatgcagagagtctattttatgagaagtggcggttttcatgg

cttg and the reverse primer: ggtcacgctaaaggtgccagtttgctggg

ccgcaagattggtatttagcacattatttgccgactaccttg. The luxCDABE

operon under the L-arabinose-inducible araBAD promoter

(PBAD) was integrated downstream of glmS in Y. enterocoli-

tica WA-C(pYV<Cm)Dinv and Y. enterocolitica WA-C

(pYV<Cm) by triplate mating. Escherichia coli strain

S17.1lpir harboring plasmid pHL289 (Loessner et al., 2007),

which harbors Tn7 mini-transposon and PBAD-luxCDABE,

and the helper plasmid pUX-BF13 (Bao et al., 1991), which

harbors a site-specific Tn7 transposase, were used for

conjugational transfer to Yersinia. All constructs were ver-

ified by PCR and DNA sequencing. Yersinia and E. coli were

routinely grown in Luria–Bertani broth (LB) at 27 and

37 1C, respectively. Chloramphenicol (20 mg mL�1), nalidixic

acid (60mg mL�1), and kanamycin (50mg mL�1) were used

as selective antibiotics. Escherichia coli DH-5a (Hanahan,

1983) was used as the primary host in cloning experiments;

E. coli S17.1 lpir (Simon et al., 1988) was used as a donor for

conjugation.

In vivo monitoring of Yersinia colonization

Bioluminescent yersiniae were grown in LB medium at

27 1C with shaking to the late exponential phase, washed

twice, and resuspended in an LB medium containing 15% of

glycerol. Bacteria were stored at � 80 1C and the CFU were

determined by plating serial dilutions. 6–8-week-old female

BALB/c mice were orally infected with 1� 109 CFU Yersinia

using a microliter pipette or intravenously into the lateral

tail vein with 1� 104 CFU. Infection was followed daily for

up to 6 days using the IVIS Lumina System (Xenogen). To

induce luminescence of yersiniae, mice were intraperitone-

ally injected with 120 mg L-arabinose in phosphate-buffered

saline as described previously (Loessner et al., 2007). Before

imaging, mice were anesthetized with isoflurane using the

Xenogen Gas Anesthesia System XGI-8. After live imaging,

mice were sacrificed by CO2 asphyxiation and the entire

intestinal tract was removed along with the liver, spleen,

mesenteric, and cervical lymph nodes and subjected to

analysis using the IVIS Lumina system. Statistical signifi-

cance of the data was determined using a two-tailed

Mann–Whitney test. P � 0.05 was considered significant.

Culturing yersiniae from different organs revealed 99%

stability of the luciferase construct for at least 5 days in the

mouse model.

Cryosections, immunohistochemical staining,and fluorescence microscopy

Small intestines with PPs, cervical lymph nodes, and spleen

were embedded in Tissue-Tek (Sakura Finetek) and shock

frozen in liquid nitrogen. Cryosections of 10 mm thickness

were prepared using a Leica Cryomicrotome CM3050 and

mounted on SuperFrostPlus slides. Cryosections were im-

munostained as described previously (Halle et al., 2007;

Oellerich et al., 2007). Yersiniae were stained by a primary

polyclonal rabbit antibody, followed by a goat anti-rabbit

Alexa Fluor 555 (Invitrogen)-coupled antibody (red).

T-cells were stained with a hamster anti-CD3e primary

antibody, followed by a goat anti-hamster Cy2 antibody

(green). B-cells were stained by a rat anti-B220 primary

antibody, followed by a goat anti-rat Alexa Fluor 647

(Invitrogen)-coupled antibody (pink). Granulocytes and

polymorphonuclear leukocytes were stained with a rat anti-

mouse Ly6C/G antibody, followed by goat anti-rat Alexa

Fluor 647 (Invitrogen) anti-rat antibody (pink). Primary

antibodies were obtained from Beckton Dickinson. Compo-

site images were automatically assembled using a motorized

Olympus BX61 fluorescence microscope with analysis soft-

ware (Olympus Soft Imaging System).

Results and discussion

Because yersiniae are known to grow in microcolonies in

mouse tissue, the L-arabinose-inducible luxCDABE reporter

should be a suitable method to visualize yersiniae in live

mice. We therefore orally (1� 109 CFU) or intravenously

(1� 104 CFU) infected Balb/c mice with Y. enterocolitica

Wa-314 harboring luxCDABE in its chromosome. Between 1

and 5 days after infection, mice received 120 mg L-arabinose

intraperitoneally (Loessner et al., 2007). The luminescence

of anesthesized mice was studied 2–5 h after L-arabinose

application using an IVIS camera. These experiments

revealed that starting 1 day after oral infection, the nasal

cavity and cervical lymph nodes of most mice began

luminescing strongly (Fig. 1a). This might be due to the

FEMS Microbiol Lett 307 (2010) 201–206c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

202 J. Trcek et al.

colonization of nasal-associated lymphoid tissue (NALT) of

mice (Heritage et al., 1997) by yersiniae. NALT could

represent the portal of entry for yersiniae disseminating to

cervical lymph nodes especially because dissemination of

yersiniae to cervical lymph nodes was not observed after an

intravenous injection. Three days after oral infection of

mice, gut colonization became apparent, with multiple PPs

luminescing in live mice (Fig. 1a). Colonization of the lungs

after intravenous infection was also very easily detectable,

which is very evident in a mouse that died 5 days postinfec-

tion (p.i.) from overwhelming pneumonia (Fig. 1a).

In order to analyze mouse infection in more detail, mice

were sacrificed on different days p.i. and all organs including

the entire gastrointestinal tract as well as the liver, spleen,

lungs, and lymph nodes were removed and analyzed using

the IVIS camera. These experiments revealed that multi-

ple PPs were luminescing strongly as expected (Fig. 1b).

Luminescence was visible starting 2 days p.i. and increased

to day 5. In addition to PPs, multiple abscesses were

luminescing in the cecum. Luminescence was first observed

2 days p.i. and also increased to day 5. Furthermore, multi-

ple smaller areas of less intense luminescence were seen

between PPs. These luminescing areas could represent

infected solitary intestinal lymph tissue (SILT), which has

been seen in mice infected by salmonellae and yersiniae

(Lorenz et al., 2003; Halle et al., 2007). Besides lymphoid

tissue of the gut, cervical lymph nodes as well as multiple

abscesses on the surface of spleens and livers were lumines-

cing strongly (Fig. 1c). Luminescence of cervical lymph

nodes was first observed 1 day p.i., whereas luminescence

of abscesses in the liver and spleen was not seen until day 5.

Infection of PPs, cervical lymph nodes, and spleen was

confirmed by immunohistological staining of cryosections.

Yersinia abscesses as well as B- and T-cell regions of the

Fig. 1. Live mice and extracted organs showing luminescing Yersinia abscesses in different organs. Mice were infected orally with 1� 109 CFU or

intravenously with 104 CFU luminescing yersiniae. (a) Anesthesized live mice are shown between days 1 and 5 p.i. The extracted gastrointestinal tract (b

and c) of orally infected mice showing luminescing abscesses in PPs and cecum (CM) as well as the cervical lymph nodes (CLN), spleen (S), and liver (L) 5

days p.i. Color bar: min., 6.475� 105; max., 1.295� 108.

FEMS Microbiol Lett 307 (2010) 201–206 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

203LuxCDABE for in vivo quantification of Yersinia abscesses

cervical lymph nodes, PPs, and spleen are easily visible (Fig. 2).

Furthermore, a massive influx of neutrophils colocalizing

with yersiniae can be seen in cervical lymph nodes (Fig. 2d)

and PPs (Fig. 2f). We were, however, not able to demon-

strate yersiniae in small B-cell follicles that were seen

throughout the small intestine (Fig. 2e).

It has been demonstrated previously that invasin plays a

major role in the early invasion of PPs by yersiniae in the

mouse infection model (Pepe & Miller, 1993; Pepe et al.,

1995; Marra & Isberg, 1996, 1997). PPs were, however,

shown to be eventually colonized by yersiniae at later

infection stages (Pepe & Miller, 1993). The spread of

yersiniae to the spleen and liver as well as LD50 were not

dependent on inv. The effect of invasin on the colonization

of individual PPs has, however, not been studied. We there-

fore quantified the colonization of individual PPs using

luminescing yersiniae on day 5 p.i. Fourteen mice were

infected with either the Dinv mutant or the wild-type strain.

Analysis of PPs with the IVIS camera revealed significantly

fewer luminescing PPs after oral infection with the Dinv

mutant than wild-type yersiniae (Fig. 3a). In fact, most PPs

did not show any luminescence at all. This was also the case

for mice infected for 6 or 7 days (results not shown).

Therefore, these experiments show that the inv deletion does

not lead to a delayed invasion phenotype, but rather to

invasion and abscessing of fewer PPs. Similarly, the number

of abscessed follicles in the cecum (Fig. 3b) as well as the

number of mice with abscessed cervical and mesenteric

lymph nodes (Fig. 3c and d) were significantly reduced.

The spleens and livers of mice infected with the Dinv mutant

were, however, more heavily colonized than spleens and

livers infected with wild-type yersiniae (Fig. 4). Although

Fig. 2. Immunostained cryosections of the

cervical lymph node (a–d), small intestine (e–f),

and spleen (g). Balb/c mice were infected orally

for 5 days with 109 CFU of Yersinia enterocolitica

WA-314. Yersiniae (red) were stained with a

polyclonal anti-Yersinia antibody. T-cells, B-cells,

and granulocytes were stained with CD3e, B220,

and Ly6G antibodies, respectively. In (a–c),

(e), and (g), B-cells are depicted in pink and T-cells

in green. In (d) and (f), granulocytes are depicted

in pink.

FEMS Microbiol Lett 307 (2010) 201–206c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

204 J. Trcek et al.

this effect was not statistically significant, it was very

reproducible in multiple experiments. Interestingly, it was

discovered recently that the presence of invasin in Yersinia

pseudotuberculosis inhibited colonization of the liver and

spleen after intravenous infection (Hudson & Bouton,

2006). In conclusion, these experiments demonstrate the

versatility of the luxCDABE reporter for analyzing and

quantifying Yersinia abscessed tissue in mice. Using this

method, we could show for the first time that cervical lymph

nodes are frequently abscessed by yersiniae and that the

absence of inv leads to a reduced number (rather than

delayed invasion) of abscessed PPs, cecal lymph follicles,

and cervical lymph nodes.

Acknowledgements

Holger Loessner is acknowledged for plasmids pHL289 and

pUX-BF13. This work was supported by DFG grant TR 740/

2-1.

References

Bao Y, Lies DP, Fu H & Roberts GP (1991) An improved Tn7-

based system for the single-copy insertion of cloned genes into

chromosomes of gram-negative bacteria. Gene 109: 167–168.

Bockemuhl J & Roggentin P (2004) Intestinal yersiniosis. Clinical

importance, epidemiology, diagnosis, and prevention.

Bundesgesundheitsblatt Gesundheitsforschung

Gesundheitsschutz 47: 685–691.

Bottone EJ (1997) Yersinia enterocolitica: the charisma continues.

Clin Microbiol Rev 10: 257–276.

Clark MA, Hirst BH & Jepson MA (1998) M-cell surface beta1

integrin expression and invasin-mediated targeting of Yersinia

pseudotuberculosis to mouse Peyer’s patch M cells. Infect

Immun 66: 1237–1243.

Eitel J & Dersch P (2002) The YadA protein of Yersinia

pseudotuberculosis mediates high-efficiency uptake into

human cells under environmental conditions in which invasin

is repressed. Infect Immun 70: 4880–4891.

Foucault ML, Thomas L, Goussard S, Branchini BR & Grillot-

Courvalin C (2010) In vivo bioluminescence imaging for the

study of intestinal colonization by Escherichia coli in mice.

Appl Environ Microb 76: 264–274.

Francis KP, Joh D, Bellinger-Kawahara C, Hawkinson MJ, Purchio

TF & Contag PR (2000) Monitoring bioluminescent

Fig. 4. The number of CFU detected in different organs of Balb/c mice 5

days after oral infection with 1�109 CFU yersiniae. Log 10 CFU yersiniae

is shown for each mouse. Horizontal bars represent the median for 10

mice analyzed. The examined organs are marked with liver (L), spleen (S),

PPs, and small intestine (SI). �Significant difference between wild type

and Dinv mutant (Po 0.05).

Fig. 3. Role of invasin on the colonization

of mice. The number of luminescing PPs (a),

cecal lymph follicles (b), % mice with infected

cervical (c), and mesenteric (d) lymph nodes was

detected using the IVIS Lumina System.�Significant difference between wild type and

Dinv mutant (Po 0.05).

FEMS Microbiol Lett 307 (2010) 201–206 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

205LuxCDABE for in vivo quantification of Yersinia abscesses

Staphylococcus aureus infections in living mice using a novel

luxABCDE construct. Infect Immun 68: 3594–3600.

Francis KP, Yu J, Bellinger-Kawahara C, Joh D, Hawkinson MJ,

Xiao G, Purchio TF, Caparon MG, Lipsitch M & Contag PR

(2001) Visualizing pneumococcal infections in the lungs of live

mice using bioluminescent Streptococcus pneumoniae

transformed with a novel gram-positive lux transposon. Infect

Immun 69: 3350–3358.

Greer LF III & Szalay AA (2002) Imaging of light emission from

the expression of luciferases in living cells and organisms: a

review. Luminescence 17: 43–74.

Halle S, Bumann D, Herbrand H, Willer Y, Dahne S, Forster R &

Pabst O (2007) Solitary intestinal lymphoid tissue provides a

productive port of entry for Salmonella enterica serovar

Typhimurium. Infect Immun 75: 1577–1585.

Hanahan D (1983) Studies on transformation of Escherichia coli

with plasmids. J Mol Biol 166: 557–580.

Heritage PL, Underdown BJ, Arsenault AL, Snider DP &

McDermott MR (1997) Comparison of murine nasal-

associated lymphoid tissue and Peyer’s patches. Am J Resp Crit

Care 156: 1256–1262.

Hudson KJ & Bouton AH (2006) Yersinia pseudotuberculosis

adhesins regulate tissue-specific colonization and immune cell

localization in a mouse model of systemic infection. Infect

Immun 74: 6487–6490.

Hudson KJ, Bliska JB & Bouton AH (2005) Distinct mechanisms

of integrin binding by Yersinia pseudotuberculosis adhesins

determine the phagocytic response of host macrophages. Cell

Microbiol 7: 1474–1489.

Isberg RR & Leong JM (1990) Multiple beta 1 chain integrins are

receptors for invasin, a protein that promotes bacterial

penetration into mammalian cells. Cell 60: 861–871.

Kaniga K, Sory MP, Delor I, Saegerman C, Limet JN &

Cornelis GR (1992) Monitoring of Yersinia enterocolitica in

murine and bovine feces on the basis of the chromosomally

integrated luxAB marker gene. Appl Environ Microb 58:

1024–1026.

Loessner H, Endmann A, Leschner S, Westphal K, Rohde M,

Miloud T, Hammerling G, Neuhaus K & Weiss S (2007)

Remote control of tumour-targeted Salmonella enterica

serovar Typhimurium by the use of L-arabinose as inducer

of bacterial gene expression in vivo. Cell Microbiol 9:

1529–1537.

Lorenz RG, Chaplin DD, McDonald KG, McDonough JS &

Newberry RD (2003) Isolated lymphoid follicle formation is

inducible and dependent upon lymphotoxin-sufficient B

lymphocytes, lymphotoxin beta receptor, and TNF receptor I

function. J Immunol 170: 5475–5482.

Marra A & Isberg RR (1996) Analysis of the role of invasin during

Yersinia pseudotuberculosis infection of mice. Ann NY Acad Sci

797: 290–292.

Marra A & Isberg RR (1997) Invasin-dependent and invasin-

independent pathways for translocation of Yersinia

pseudotuberculosis across the Peyer’s patch intestinal

epithelium. Infect Immun 65: 3412–3421.

Meighen EA (1993) Bacterial bioluminescence: organization,

regulation, and application of the lux genes. FASEB J 7:

1016–1022.

Oellerich MF, Jacobi CA, Freund S, Niedung K, Bach A,

Heesemann J & Trulzsch K (2007) Yersinia enterocolitica

infection of mice reveals clonal invasion and abscess

formation. Infect Immun 75: 3802–3811.

Pepe JC & Miller VL (1993) Yersinia enterocolitica invasin: a

primary role in the initiation of infection. P Natl Acad Sci USA

90: 6473–6477.

Pepe JC, Wachtel MR, Wagar E & Miller VL (1995) Pathogenesis

of defined invasion mutants of Yersinia enterocolitica in a

BALB/c mouse model of infection. Infect Immun 63:

4837–4848.

Rang C, Galen JE, Kaper JB & Chao L (2003) Fitness cost of the

green fluorescent protein in gastrointestinal bacteria. Can J

Microbiol 49: 531–537.

Schulte R, Kerneis S, Klinke S, Bartels H, Preger S, Kraehenbuhl

JP, Pringault E & Autenrieth IB (2000) Translocation of

Yersinia enterocolitica across reconstituted intestinal epithelial

monolayers is triggered by Yersinia invasin binding to beta1

integrins apically expressed on M-like cells. Cell Microbiol 2:

173–185.

Simon R, Priefer U & Puhler A (1983) A broad host range

mobilization system for in vivo genetic engineering:

transposon mutagenesis in Gram negative bacteria. Nat

Biotechnol 1: 784–791.

Trulzsch K, Sporleder T, Igwe EI, Russmann H & Heesemann J

(2004) Contribution of the major secreted yops of Yersinia

enterocolitica O:8 to pathogenicity in the mouse infection

model. Infect Immun 72: 5227–5234.

FEMS Microbiol Lett 307 (2010) 201–206c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

206 J. Trcek et al.