This article was downloaded by [20137250]On 06 November 2013 At 0721Publisher Taylor amp FrancisInforma Ltd Registered in England and Wales Registered Number 1072954 Registered office Mortimer House37-41 Mortimer Street London W1T 3JH UK

Biofouling The Journal of Bioadhesion and BiofilmResearchPublication details including instructions for authors and subscription informationhttpwwwtandfonlinecomloigbif20

Identification of small molecules inhibiting diguanylatecyclases to control bacterial biofilm developmentKarthik Sambanthamoorthya Chunyuan Luoa Nagarajan Pattabiramanb Xiarong FengaBenjamin Koestlerc Christopher M Watersc amp Thomas J Palysa

a Wound Infections Walter Reed Army Institute of Research Silver Spring MD USAb Molbox Silver Spring MD USAc Department of Microbiology amp Molecular Genetics Michigan State University East LansingMI USAPublished online 11 Oct 2013

To cite this article Karthik Sambanthamoorthy Chunyuan Luo Nagarajan Pattabiraman Xiarong Feng Benjamin KoestlerChristopher M Waters amp Thomas J Palys Biofouling (2013) Identification of small molecules inhibiting diguanylate cyclasesto control bacterial biofilm development Biofouling The Journal of Bioadhesion and Biofilm Research

To link to this article httpdxdoiorg101080089270142013832224

PLEASE SCROLL DOWN FOR ARTICLE

Taylor amp Francis makes every effort to ensure the accuracy of all the information (the ldquoContentrdquo) containedin the publications on our platform However Taylor amp Francis our agents and our licensors make norepresentations or warranties whatsoever as to the accuracy completeness or suitability for any purpose of theContent Any opinions and views expressed in this publication are the opinions and views of the authors andare not the views of or endorsed by Taylor amp Francis The accuracy of the Content should not be relied upon andshould be independently verified with primary sources of information Taylor and Francis shall not be liable forany losses actions claims proceedings demands costs expenses damages and other liabilities whatsoeveror howsoever caused arising directly or indirectly in connection with in relation to or arising out of the use ofthe Content

This article may be used for research teaching and private study purposes Any substantial or systematicreproduction redistribution reselling loan sub-licensing systematic supply or distribution in anyform to anyone is expressly forbidden Terms amp Conditions of access and use can be found at httpwwwtandfonlinecompageterms-and-conditions

Identification of small molecules inhibiting diguanylate cyclases to control bacterial biofilmdevelopment

Karthik Sambanthamoorthya Chunyuan Luoa Nagarajan Pattabiramanb Xiarong Fenga Benjamin KoestlercChristopher M Watersc and Thomas J PalysaaWound Infections Walter Reed Army Institute of Research Silver Spring MD USA bMolbox Silver Spring MD USA cDepartmentof Microbiology amp Molecular Genetics Michigan State University East Lansing MI USA

(Received 1 May 2013 accepted 15 July 2013)

Biofilm formation by pathogenic bacteria is an important virulence factor in the development of numerous chronicinfections thereby causing a severe health burden Many of these infections cannot be resolved as bacteria in biofilmsare resistant to the hostrsquos immune defenses and antibiotic therapy An urgent need for new strategies to treat biofilm-based infections is critically needed Cyclic di-GMP (c-di-GMP) is a widely conserved second-messenger signal essentialfor biofilm formation The absence of this signalling system in higher eukaryotes makes it an attractive target for thedevelopment of new anti-biofilm agents In this study the results of an in silico pharmacophore-based screen to identifysmall-molecule inhibitors of diguanylate cyclase (DGC) enzymes that synthesize c-di-GMP are described Four smallmolecules LP 3134 LP 3145 LP 4010 and LP 1062 that antagonize these enzymes and inhibit biofilm formation byPseudomonas aeruginosa and Acinetobacter baumannii in a continuous-flow system are reported All four moleculesdispersed P aeruginosa biofilms and inhibited biofilm development on urinary catheters One molecule dispersedA baumannii biofilms Two molecules displayed no toxic effects on eukaryotic cells These molecules represent the firstcompounds identified from an in silico screen that are able to inhibit DGC activity to prevent biofilm formation

Keywords biofilm anti-infective small molecule antagonist Pseudomonas Acinetobacter c-di-GMP

Introduction

Biofilms are surface-associated bacterial conglomeratesthat according to the National Institutes of Health areassociated with 80 of infections (Hall-Stoodley et al2004) In the US alone biofilms have been blamed forcausing millions of infections and the associated coststo treat such infections exceed $1 billion in expenses(Wolcott et al 2010) The biofilm mode of growth isassociated with increased intrinsic antibiotic tolerancecompared to planktonic cells due to a number of factorsincluding the physical barrier of the matrix induction ofspecific genetic pathways and the increase in the preva-lence of persister cells (Costerton et al 1995 Anderlet al 2000) The matrix provides protection for thebiofilm from the host immune system by preventingantibody recognition and engulfment by phagocytic cells(Davies 2003 Mah et al 2003 Hall-Stoodley amp Stood-ley 2009)

Biofilms interfere with clinical therapy for chronicpersistent and wound-related infections on variousindwelling medical devices (Fux et al 2005 Hall-Stood-ley amp Stoodley 2009) Biofilms also trigger inflammationand impair the wound-healing process (Wolcott et al2010) Often the only effective treatment option forbiofilm-based chronic wound infections is to amputate

the infected limb (Jeys amp Grimer 2009) All of thesefactors pose significant challenges to clear infections andcompel the development of new methods designed toinhibit bacterial biofilm formation

Recently the second messenger molecule cyclicdi-GMP (c-di-GMP) has emerged as an importantsignal-controlling biofilm formation in a majority ofbacteria (Romling et al 2005 Jenal amp Malone 2006Ryan et al 2006 Cotter amp Stibitz 2007 Tamayo et al2007) Synthesis of c-di-GMP occurs via diguanylatecyclases (DGC) encoding of GGDEF domains whiledegradation of c-di-GMP occurs via phosphodiesterase(PDE) encoding either an EAL or HD-GYP (Ryjenkovet al 2005 Schmidt et al 2005 Dow et al 2006 Ryanet al 2006) Sequence analysis of bacterial genomesreveals that most prominent human pathogens encodeenzymes predicted to be involved in c-di-GMP signalinghighlighting the significance of this novel secondmessenger in bacteria (Galperin 2004) More importantlythe enzymatic mechanism of DGCs and PDEs is highlyconserved and the enzymes from different bacterial spe-cies are able to cross complement mutations in one anotheras demonstrated by complementation studies betweenSalmonella enterica and Yersinia pestis (Simm et al2005) For example the unrelated DGC hmsT from

Corresponding author Email thomaspalys1usarmymil

copy 2013 This Article is a collaborative workThe work as part of Karthik Sambanthamoorthy Chunyuan Luo Xiarong Feng and Thomas J Palysrsquos official duties as Federal Government Contractors is published bypermission of the Walter Reed Army Institute of Research under Contract Number(s) W81XWH-12-2-0033 The US Government retains for itself and others acting on itsbehalf a paid-up non-exclusive and irrevocable worldwide license in said article to reproduce prepare derivative works distribute copies to the public and performpublicly and display publicly by or on behalf of the GovernmentNagarajan Pattabiraman Benjamin Koestler and Christopher M Waters waive their own assertion of copyright but not their status as co-Authors

Biofouling 2013httpdxdoiorg101080089270142013832224

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

Y pestis was able to complement a mutation in the DGCadrA in Salmonella enterica (Simm et al 2005) despitesharing no homology outside of the DGC domain

Due to the highly conserved nature of c-di-GMPsignalling systems in bacteria and the mountingevidence for their role in modulating biofilm formationtargeting c-di-GMP signaling systems therefore pro-vides an attractive approach to abolish biofilm formation(Navarro et al 2009)

Because c-di-GMP is not necessary for bacterialgrowth small molecules that lower c-di-GMP would notselect for resistant organisms compared to traditionalantibiotics that are either bacteriostatic or bactericidal Inaddition since c-di-GMP molecules are not encoded inhigher eukaryotic organisms small molecules inhibitingthis signal would be predicted to be less toxic to theinfected host Only a few efforts to target c-di-GMPsignaling as a means to prevent formation of biofilmhave been described but these efforts do not directlyinterfere with DGC activity (Newell et al 2009 2011Antoniani et al 2010) Currently only two chemicalinhibitors have been identified that inhibit DGC activityreduce biofilm formation and significantly reduce theintracellular concentration of c-di-GMP in bacteria(Sambanthamoorthy et al 2012)

Here the authors to the repertoire of small moleculesinhibiting DGCs by reporting identification of four smallmolecules from a 3D pharmacophore-based in silicoscreening approach These four molecules inhibited DGCenzymes WspR and tDGC from Pseudomonas aerugin-osa and Thermotoga maritima and exhibited anti-biofilmactivity against A baumannii and P aeruginosa All fourmolecules were able to disperse preformed biofilms of Paeruginosa but only one was able to disperse Abaumannii biofilms significantly One compoundLP-3134 was able to affect the initial adherence of Paeruginosa to a silicone surface and significantly impairthe development of the biofilm of P aeruginosa in aurinary catheter

The four DGC inhibitors identified in this study willthereby serve as a foundation to develop efficacious andpotent inhibitors of DGC enzymes to abolish the bacter-ial biofilm development in both medical and industrialsettings

Materials and methods

Bacteria and media

The bacterial strains and plasmids used in this study arelisted in Table 1 Escherichia coli Thermotoga maritimaand Pseudomonas aeruginosa cells were grown at 37 degCwith constant aeration in Luria Bertani broth (LB)Acinetobacter baumannii cells were grown at 37 degC withconstant aeration in Brain Heart Infusion broth (BHI)For expression studies isopropyl β-D-1-thiogalactopyra-noside (IPTG) was used at concentrations of 100 μg mlminus1When necessary antibiotics were used at concentrationsof 50 or 100 μg mlminus1

In silico virtual screening for potential candidates ofselective DGC inhibitors

A 2D pharmacophore generated based on the interactionof guanine base with PleD from Caulobacter crescentusis shown in Figure 1a and a second pharmacophorecontaining two of the hydrogen bonds found in guaninebase and attached to a five-membered ring is shown inFigure 1b Using queries derived from these two 2Dphamacophores a focused library from the database ofcommercially available millions of compounds wasgenerated In silico screening of this focused library wasperformed using the amino acid residues in the activesite of the published crystal structure (Pubmed15569936) that are within 65 Aring from the GMP part ofbound c-di-GMP During the in silico screening the 3Dpharmacophore features of the active site such as the sizeof the active site and other potential as well as guanine-specific interactions were included The matching

Table 1 Strains and plasmids used in the study

Strain or plasmid Description Source

StrainsPseudomonas aeruginosa PA01 Wild type strain Stover et al (2000)Acinetobacter baumannii 5711 Wild type strain (wound isolate) Zurawski et al (2012)Thermotoga maritima Wild type strain Rao et al (2009)E coli 21 (DE3) Fminus ompT hsdSB(rB

minus mBminus) gal dck (DE3) Invitrogen

PlasmidspET21bWsp WspR purification plasmid This studypET21bTD tDGC purification plasmid This studyPrimerswspR_F GAAGGAGATATACATATGCACAACCCTCATG This studywspR_R GTGGTGGTGGTGCTCGAGGCCCGCCGGGGCCGGC This studytDGC_F GCCGCTATTTCTTCGAACTG This studytDGC_R AAATTCATCGCCACCATAGC This study

2 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

between features in the pharmacophore and the smallmolecule in the database is within a root-mean squaredeviation of 1 Aring The complex of PleD and the identifiedlead inhibitors were further refined and energyminimized to generate the final inhibitor-PleD complexAll calculations were carried out using the MOE(Molecular Operating Environment Chemical computinggroup Quebec Canada) software and the electrostaticinteractions were calculated using the lsquoR-Fieldrsquo option inMOE Based on the binding energy between eachcompound with the binding site of PleD and on thedifferences in the exposed solvent-accessible surfaceareas of bound and unbound conformation of eachcompound 500 top-ranking compounds were selectedChemoinformatics filters such as logP number ofrotatable bonds and visually checking the position andorientation of these 500 top-ranking compounds withrespect to those of the GTP bound to the active site ofPleD were used to select a list of compounds for biologi-cal assays

Protein production

T maritima DGC tDGC-R158A was amplified clonedand expressed in E coli BL21 (DE3) cells (InvitrogenCA USA) The full-length DNA sequence of tDGC wassynthesized and inserted into NdeI and XhoI sites of an

expression plasmid pET 21b (Genescript NJ USA)resulting in strain pET21bTD A 6times Histag was added atthe C-terminal of the protein to enable purificationE coli BL21 (DE3) carrying the expression plasmid(pET28b (+) with tDGC) was grown in LB mediumsupplemented with kanamycin (30 μg mlminus1) at 37 degCWhen the OD at 600 nm reached 08 08 mM IPTGwas added to induce protein expression at 25 degC for 4 hFor lysis the bacteria were pelleted by centrifuging at2000 rpm for 10 min The cell pellet was re-suspendedin 20 ml of lysis buffer containing 50 mM Tris-HCl (pH80) 300 mM NaCl 5 glycerol 1 mM β-mercap-toethanol and 1 mM phenylmethanesulfonylfluoride andthe cells were lysed by passage through a French pres-sure cell (three times 30 s) The suspension was clarifiedby centrifugation for 10 min at 5000 g The supernatantwas then further clarified by ultracentrifugation(100000 g 1 h) For purification using Hi Trap IMACFF column (GE Healthcare PA USA) the supernatantwas loaded onto Ni-NTA affinity resin washed with W1buffer (containing 50 mM Tris-HCl (pH 80) 300 mMNaCl 5 glycerol 1 mM β-mercaptoethanol and20 mM imidazole) and eluted with an imidazolegradient from 20 to 500 mM in 50 mM Tris-HCl (pH80) 300 mM NaCl 5 glycerol and 1 mM β-mercap-toethanol All protein purification steps were carried outat 4 degC

(a)

(b)

(c)

Figure 1 (a) represents the 2-D pharmacophore generated based on the interaction of guanine base with PleD (b) shows a secondpharmacophore based on the oroidin template containing some of the features of a guanine base (c) shows the binding site of thecompound LP 3134 (shown in ball-and-stick model with atom-based colour coding) in PleD (shown in stick model with atom-basedcolour coding) The dashed line represents a hydrogen bond

Biofouling 3

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

WspR a DGC from P aeruginosa was amplifiedcloned and expressed in E coli BL21 (DE3) cells(Invitrogen) The procedure followed that previouslyreported by De et al (2008) Specifically the full-lengthDNA sequence of WspR was synthesized and insertedinto NdeI and XhoI sites of an expression plasmid pET21b (Genescript) resulting in strain pET21bWsp A 6times-His tag was added at the C-terminal of the proteinTransformed E coli BL21 (DE3) cells were grownin LB medium supplemented with 100 μg mlminus1 ampicil-lin at 37degC At a cell density corresponding to anabsorbance of 10 at 600 nm the temperature wasreduced to 18degC and the protein production was inducedwith 1 mM IPTG for 12ndash16 h Cells were collected bycentrifugation and then re-suspended in 25 mM Tris-HClbuffer containing 500 mM NaCl 20 mM imidazole and5 mM 2-mercaptoethanol (pH 80) After cell lysis bysonication cell debris was removed by centrifugation at40000 g for 60 min at 4degC The enzyme was purifiedby Hi Trap IMAC FF column (GE Healthcare) byelution with 500 mM imidazole in the above bufferFurther purification used SEC column Superdex 200 HR2660 (GE Healthcare) by using 25 mM Tris-HCl100 mM NaCl and 1 mM DTT (pH 74) as equilibrationand running buffer Fractions containing WspR (MW39 k Da) were pooled and concentrated using centriconSpin column (30 k Da cutoff)

Measurement of in vitro DGC activity

The ability of compounds to inhibit DGC activity wasdetermined using the EnzChek Pyrophosphate Assay(Invitrogen) as previously described (Sambanthamoorthyet al 2012) to allow high-throughput measurements

Assessment of biofilm formation

Biofilm formation was measured under both static andflow conditions For the static condition a quantitativecrystal violet assay was used on polystyrene 96-well andMBEC plates (Biosurface Technologies MT USA) asdescribed previously (Harrison et al 2005 Sambantha-moorthy et al 2008) Three independent experimentswere performed for each of these assays For biofilmexperiments under flow conditions biofilms were grownin disposable flow cells (Stovall Life Science NC USA)as previously described (Sambanthamoorthy et al 2008)Biofilm formation on the flow cell was imaged bothmacroscopically and microscopically at 24 and 48 hThree sections of the flow cell chosen randomly wereimaged and representative images are shown Each sec-tion represents dimensions of 250 μm by 250 μm with aresolution of 512 by 512 pixels and shows the samedepth Cross sections of each section were performed at05ndash1 μm for different pathogens

Microscopy

For CLSM analysis of biofilms the medium flow wasstopped and the fluorescent dyes SYTO-9 and propidiumiodide (Molecular Probes OR USA) were injected intothe flow cell chamber and incubated for 30 min in thedark Confocal microscope images were acquired using aCarl Zeiss PASCAL Laser Scanning Microscope (CarlZeiss Jena Germany) equipped with a 63times14numerical aperture Plan-Apochromat objective TheSYTO-9 and propidium iodide fluorophores were excitedwith an argon laser at 488 nm and the emissionband-pass filters used for SYTO-9 and propidium iodidewere 515 plusmn 15 nm and 630 plusmn 15 nm respectivelyCLSM z-stack image analysis and processing wereperformed using Carl Zeiss LSM 5 PASCAL Software(Version 35 Carl Zeiss) Image stacks of biofilms wereacquired from at least three distinct regions on the flowcell Biofilm thickness was measured starting from thez-section at the interface of flow cellbiofilm to thez-section at the top of the biofilm surface containinglt5 of total biomass

Biofilm dispersal

For biofilm dispersal experiments overnight-growncultures of P aeruginosa were standardized to 01OD595 and 165 μl were transferred to the wells of aMBEC microtiter plate which was then covered by theMBEC lid Biofilms were grown on the MBEC pegsunder shaking conditions for 24 h The lid wasremoved and transferred to a new plate in which thewells had been filled with a 100 μM concentration ofcompounds LP 3134 and LP 3145 The pegs wereimmersed for 30 min and the lid was then transferredand gently washed twice with 200 μl of phosphate-buffered saline (PBS) to remove non-adherent cellsAdherent biofilms on the pegs were fixed with 200 μlof 100 ethanol prior to staining for 2 min with200 μl of 041 (wtvol) crystal violet in 12 ethanol(Biochemical Sciences NJ USA) The pegs werewashed several times with PBS to remove excessstain Quantitative assessment of biofilm formation wasobtained by immersing the pegs in a sterile polysty-rene microtiter plate containing 200 μl of 100 etha-nol incubating at room temperature for 10 min anddetermining the absorbance at 595 nm using a Spectra-Max M5 microplate spectrophotometer system (Molec-ular Devices CA USA) The results were interpretedby comparing the effects of compounds on treated bio-films with the untreated biofilms of P aeruginosaExperiments were performed in triplicates and threeindependent experiments were performed for each ofthese assays

4 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

WspR a DGC from P aeruginosa was amplifiedcloned and expressed in E coli BL21 (DE3) cells(Invitrogen) The procedure followed that previouslyreported by De et al (2008) Specifically the full-lengthDNA sequence of WspR was synthesized and insertedinto NdeI and XhoI sites of an expression plasmid pET21b (Genescript) resulting in strain pET21bWsp A 6times-His tag was added at the C-terminal of the proteinTransformed E coli BL21 (DE3) cells were grownin LB medium supplemented with 100 μg mlminus1 ampicil-lin at 37degC At a cell density corresponding to anabsorbance of 10 at 600 nm the temperature wasreduced to 18degC and the protein production was inducedwith 1 mM IPTG for 12ndash16 h Cells were collected bycentrifugation and then re-suspended in 25 mM Tris-HClbuffer containing 500 mM NaCl 20 mM imidazole and5 mM 2-mercaptoethanol (pH 80) After cell lysis bysonication cell debris was removed by centrifugation at40000 g for 60 min at 4degC The enzyme was purifiedby Hi Trap IMAC FF column (GE Healthcare) byelution with 500 mM imidazole in the above bufferFurther purification used SEC column Superdex 200 HR2660 (GE Healthcare) by using 25 mM Tris-HCl100 mM NaCl and 1 mM DTT (pH 74) as equilibrationand running buffer Fractions containing WspR (MW39 k Da) were pooled and concentrated using centriconSpin column (30 k Da cutoff)

Measurement of in vitro DGC activity

The ability of compounds to inhibit DGC activity wasdetermined using the EnzChek Pyrophosphate Assay(Invitrogen) as previously described (Sambanthamoorthyet al 2012) to allow high-throughput measurements

Assessment of biofilm formation

Biofilm formation was measured under both static andflow conditions For the static condition a quantitativecrystal violet assay was used on polystyrene 96-well andMBEC plates (Biosurface Technologies MT USA) asdescribed previously (Harrison et al 2005 Sambantha-moorthy et al 2008) Three independent experimentswere performed for each of these assays For biofilmexperiments under flow conditions biofilms were grownin disposable flow cells (Stovall Life Science NC USA)as previously described (Sambanthamoorthy et al 2008)Biofilm formation on the flow cell was imaged bothmacroscopically and microscopically at 24 and 48 hThree sections of the flow cell chosen randomly wereimaged and representative images are shown Each sec-tion represents dimensions of 250 μm by 250 μm with aresolution of 512 by 512 pixels and shows the samedepth Cross sections of each section were performed at05ndash1 μm for different pathogens

Microscopy

For CLSM analysis of biofilms the medium flow wasstopped and the fluorescent dyes SYTO-9 and propidiumiodide (Molecular Probes OR USA) were injected intothe flow cell chamber and incubated for 30 min in thedark Confocal microscope images were acquired using aCarl Zeiss PASCAL Laser Scanning Microscope (CarlZeiss Jena Germany) equipped with a 63times14numerical aperture Plan-Apochromat objective TheSYTO-9 and propidium iodide fluorophores were excitedwith an argon laser at 488 nm and the emissionband-pass filters used for SYTO-9 and propidium iodidewere 515 plusmn 15 nm and 630 plusmn 15 nm respectivelyCLSM z-stack image analysis and processing wereperformed using Carl Zeiss LSM 5 PASCAL Software(Version 35 Carl Zeiss) Image stacks of biofilms wereacquired from at least three distinct regions on the flowcell Biofilm thickness was measured starting from thez-section at the interface of flow cellbiofilm to thez-section at the top of the biofilm surface containinglt5 of total biomass

Biofilm dispersal

For biofilm dispersal experiments overnight-growncultures of P aeruginosa were standardized to 01OD595 and 165 μl were transferred to the wells of aMBEC microtiter plate which was then covered by theMBEC lid Biofilms were grown on the MBEC pegsunder shaking conditions for 24 h The lid wasremoved and transferred to a new plate in which thewells had been filled with a 100 μM concentration ofcompounds LP 3134 and LP 3145 The pegs wereimmersed for 30 min and the lid was then transferredand gently washed twice with 200 μl of phosphate-buffered saline (PBS) to remove non-adherent cellsAdherent biofilms on the pegs were fixed with 200 μlof 100 ethanol prior to staining for 2 min with200 μl of 041 (wtvol) crystal violet in 12 ethanol(Biochemical Sciences NJ USA) The pegs werewashed several times with PBS to remove excessstain Quantitative assessment of biofilm formation wasobtained by immersing the pegs in a sterile polysty-rene microtiter plate containing 200 μl of 100 etha-nol incubating at room temperature for 10 min anddetermining the absorbance at 595 nm using a Spectra-Max M5 microplate spectrophotometer system (Molec-ular Devices CA USA) The results were interpretedby comparing the effects of compounds on treated bio-films with the untreated biofilms of P aeruginosaExperiments were performed in triplicates and threeindependent experiments were performed for each ofthese assays

4 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

Assessment of molecules impacting adhesion incatheters

The adherence assay measures bacterial adherence to acatheter pre-coated with plasma This assay wasperformed as previously described (Sambanthamoorthyet al 2008) Briefly overnight-grown cultures ofP aeruginosa were standardized to an OD650 of 015cc 14 Fr silicone catheters (Bard GA USA) werecut to a length of 05 cm and pre-coated overnightwith human plasma (Sigma MO USA) The catheterswere transferred to appropriate P aeruginosa culturescultures in a 24-well plate and incubated at 37 degC for1 h either in the presence or absence of the DGCinhibitors The catheters were removed using sterileforceps and washed three times in sterile PBS Afterwashing the catheters were placed in 100 ethanolfor 10 min and stained with crystal violet for 2 minThe catheters were washed several times in PBSdestained by immersing in 100 ethanol and theabsorbance at 595 nm was determined using a Spectra-Max M5 microplate spectrophotometer system Threeindependent experiments were performed for each ofthese assays The mean and standard errors were cal-culated for the adherence of each strain

Assessment of biofilm formation in catheters

14-French Bard urinary catheters were cut into 1 cmpieces and placed in 24 well plates A standardizedovernight culture of P aeruginosa was inoculated intothe well and incubated overnight at 37 degC either inthe presence or absence of the DGC inhibitorsCultures were removed and catheters were gentlywashed twice with PBS to remove non-adherent cellsAdherent biofilms on the catheters were fixed with100 ethanol prior to staining for 10 min with 200 μlof 041 (wtvol) crystal violet in 12 ethanolCatheters were washed several times with PBS toremove excess stain Quantitative assessment of biofilmformation was obtained by moving the catheters to asterile polystyrene microtiter plate containing 200 μl of100 ethanol and incubating at room temperature for10 min to elute the stain The absorbance at 595 nmwas determined using a SpectraMax M5 microplatespectrophotometer system

Cell viability assay

HEK-293 (keratinocyes) and Raw2647 cells (obtainedfrom ATCC) were used in this study The cytotoxicityof compounds in Raw2647 cells was evaluated by aLactate dehydrogenase (LDH) cytotoxicity assay TheLDH cytotoxicity assay was performed according tothe manufacturerrsquos guidelines (CytoTox 96 Non-Radio-active Cytotoxicity Assay Promega WI USA)

Measurement of intracellular c-di-GMP concentrationin vivo

Lead compounds identified from the chemical screenwere evaluated for their ability to inhibit c-di-GMPproduction in vivo A high-performance liquid chroma-tography-mass spectrometry (LC-MS-MS) assay wasperformed to determine in vivo c-di-GMP inhibition aspreviously described (Bobrov et al 2011) Briefly bacte-ria were grown in 20 ml of LB medium either in theabsence or presence of the lead compounds from anovernight inoculum to an optical density of 10 at595 nm The cells were centrifuged at 12000 rpm for30 s and washed with 300 μl of methyl alcoholacetoni-trileformic acid buffer The cells were placed at minus20 degCfor 30 min and centrifuged at 15000 rpm for 5 min Thesupernatant was analysed by LC-MS-MS (WatersCorporation Massachusetts USA) All compounds wereanalysed in triplicate

Statistical analysis

Statistical significance was determined using a pairedone-tailed Studentrsquos t test based on the hypothesis thatthe lead compounds would lower the activity of DGCenzymes biofilm formation and bacterial adhesion

Results

Identification of DGC inhibitors from in silicoscreening

The number of selected compounds in the guanineoroi-din-moiety-based focused library was around 15000Docking of these compounds and scoring of the dockedligandndashprotein complexes led to the formation of 292compounds for biological assays (Table 2) Based onavailability 250 of these compounds were purchased forfurther analysis For experimental testing of inhibitorsthe DGC enzyme PleD from Caulobacter crescentus wasnot used due to a loss of activity following purificationTherefore the compounds were tested for the ability toinhibit DGC activity using the recombinant DGC tDGCfrom Thermotoga maritima in an in vitro enzyme assayBriefly the conversion of GTP to c-di-GMP by DGCsproduces pyrophosphate which was monitored using the

Table 2 Final results of in silico screening

Commercial library CompanyIdentifiedcompounds

Guanine-based libary ChemDiv 48Natural product library ChemDiv 100Natural product library Tim-Tech 50Synthetic compound library Tim-Tech 51Synthetic compound library Anamine 43Total 3 292

Biofouling 5

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

EnzCheck Pyrophosphate Assay (Invitrogen) The assaywas slightly modified to allow screening in ahigh-throughput manner and determined the percentageinhibition compared with untreated enzyme of eachcompound Four of the 250 test compounds namely LP3134 LP 3145 LP 4010 and LP 1062 significantlyreduced the activity of tDGC at concentrations rangingfrom 125 to 200 μM (Table 3)

Furthermore to test if the compounds functioned asgeneral DGC inhibitors and were not limited to inhibi-tion of tDGC the inhibition of the well-studied DGCWspR from P aeruginosa was examined This analysisrevealed that all four compounds reduced WspR activity(Table 3) suggesting that these four compounds are gen-eral inhibitors of DGC enzymes The four compoundsalso did not significantly deter bacterial growth (data notshown) The chemical structures and names of the inhibi-tors of DGC are indicated in Figure 2

The four inhibitors of DGC prevent biofilm formationby P aeruginosa

The four inhibitors of DGC were analysed for anti-biofilmactivity against P aeruginosa strain PAO1 using a staticMBEC biofilm assay All the four DGC inhibitorssignificantly inhibited biofilm formation ( p lt 00012) byP aeruginosa (Figure 3) Next the anti-biofilm activitiesof selected lead compounds under fluid flow wereexamined For these experiments compounds LP 3134and LP 3145 were chosen to be evaluated for anti-biofilmactivities in a continuous flow cell biofilm reactor In thisassay the biofilm development on a glass surface wasmonitored under a constant flow of fresh growth mediumsupplemented with or without the test compound Thismethod is more physiologically relevant as it closelymimics natural biofilms that might form in environmentalreservoirs or during infection of a human host Thebiofilm inhibition or reduction of PAO1 strain in theabsence and presence of 200 μM of LP 3134 and LP3145 was determined Representative images depictingthe coverage of the biofilm are shown in Figure 4 Theexperiment was repeated three times Both LP 3134 and

LP 3145 showed a significant reduction of biofilmformation in the flow cell system (Figure 4)

LP 3134 and LP 3145 reduces biofilm formation byA baumannii

To examine if the inhibitors of DGC can reduce biofilmformation in a different pathogen the inhibition of DGCactivity against A baumannii was evaluated This patho-gen is multi-drug resistant and chronically colonizes tis-sue wounds as biofilms (Dallo amp Weitao 2010 Murphyet al 2011) All four inhibitors of DGC were able to sig-nificantly reduce biofilm formation by A baumannii inthe MBEC biofilm formation assay (Figure 3) Similar tothe analysis of P aeruginosa the ability of LP 3134 andLP 3145 to inhibit biofilm of A baumannii under flowconditions was determined Both LP 3134 and LP 3145substantially reduced the biofilms of A baumannii com-pared to the untreated control (Figure 4)

DGC inhibitors disperse established P aeruginosa andA baumannii biofilms

For all the biofilm experiments described thus far theinhibitors were added concurrently with inoculation ofthe bacteria To determine if the lead compounds coulddisperse established biofilms P aeruginosa biofilmswere grown on MBEC pegs for 24 h The pegs wereremoved washed in PBS and transferred to new plateswith lead compounds at 100 μM in fresh medium for 1and 24 h The pegs were removed and the amount ofdispersal from the pegs was determined by quantifyingthe biofilm remaining on the pegs after treatment Allfour DGC inhibitors dispersed P aeruginosa biofilmswhen compared with the DMSO controls (Figure 5) Asimilar experiment was performed to determine if theDGC inhibitors could disperse preformed A baumanniibiofilms but surprisingly activity was only observedwith LP 3134 (Figure 5)

LP 3134 inhibits P aeruginosa adherence to a surface

The first step in biofilm development is primary adhesionof the bacteria to a surface An adhesion experiment wasdone to measure the ability of cells to attach to surfaces inthe presence of DGC inhibitors (Figure 6) This was doneby incubating the bacteria only in the presence of thesurface for 1 h and it was assumed that any surface-asso-ciated biological material during this short time frame wasdue to attachment rather than biofilm developmentSilicone surfaces were chosen to be examined due toextensive usage of silicone as a catheter material WhenP aeruginosa was grown in the presence of the four DGCinhibitors only compound LP 3134 interferedsignificantly in the initial adherence of P aeruginosa to

Table 3 Representative inhibition assays

Compound Inhibition oftDGC-R158A

IC50 (μM)for WspR

Confidenceinterval for WspR

(μM)

LP-3134 721 (at 100 μM) 449 335ndash562LP-3145 280 (at 50 μM) 7093 611ndash807LP-4010 205 (at 200 μM) 1024 917ndash1130LP-1062 268 (at 50 μM) 731 593ndash869

Notes The inhibition of the DGCs WspR from P aeruginosa andtDGC-R158A from T maritima at varying inhibitor concentrations isshown for all four molecules

6 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

surfaces In contrast no adhesion defect was observed forA baumannii when grown in the presence of the fourDGC inhibitors (data not shown)

LP 3134 and LP 3145 reduce the biofilm formation onurethral catheters

To test the effect of LP 3134 and LP 3145 on medicallyrelevant objects P aeruginosa was grown on 14-Frenchurethral catheters in the presence and absence of LP3134 and LP 3145 The biofilm formed by P aeruginosawas prevalent as thick patches along the growth surfaceBoth LP 3134 and LP 3145 reduced biofilm formationon the catheters (Figure 7) Given the importance of

P aeruginosa implicated in urinary tract infections andbiofilm development on urinary catheters these resultshave the potential for practical applications

LP 3134 exhibits druggable properties

Compound LP 3134 was examined for properties consid-ered advantageous for subsequent development as a drugcandidate Based on the chemical analysis of knownsmall molecule drugs Lipinski et al (1997) developed aset of rules known as Lipinskirsquos Rule of 5 that describethe most desirable properties for drug development Mol-ecules LP 3134 LP 3145 and LP 1062 only violate themolecular weight condition of the Lipinski rules as themolecular weights of these compounds are little more

LP 3134 LP 4010

LP3145 LP1062

Figure 2 The chemical names structure and molecular weights of the inhibitors of DGC LP 3134 = Nprime-((1E)-4-ethoxy-3-[(8-oxo-1568-tetrahydro-2H-15-methanopyrido[12-a][15]diazocin-3(4H)-yl)methyl]phenylmethylene)-345-trihydroxybenzohydrazideLP 3145 = 11prime66prime77prime-hexahydroxy-55prime-diisopropyl-33prime-dimethyl-22prime-binaphthalene-88prime-dicarbaldehyde LP 4010 = benzenesul-fonamide4-amino-N-methyl-N-[3-(3478-tetrahydro-24-dioxo-2H-thiopyrano[43-d]pyrimidin-1(5H)-yl)propyl LP 1062 = (E)-1-[6-[(3-acetyl-246-trihydroxy-5-methylphenyl)methyl]-57-dihydroxy-22-dimethyl-2H-1-benzopyran-8-yl]-3-phenyl-2-propen-1-one Themolecular weights of the four compounds are 51822 5185 40410 and 51654 kDa for LP 3134 LP 3145 LP 4010 and LP1062 respectively

Biofouling 7

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

than 500 Da Compound LP 4010 appeared to have noviolation of the Lipinski Rule of 5

Likewise the DGC inhibitors were tested to determineif they were toxic to eukaryotic cells Cell viability assayswere performed using keratinocytes and LDH to assessthe toxicity of compounds to eukaryotic cells Compoundswere administrated to cultured human keratinocytes andcytotoxicity assays were performed Only compounds LP3134 and LP 4010 demonstrated no cytotoxicity to kerati-nocytes (data not shown) In addition a non-radioactivecytotoxicity colorimetric assay was performed to quantita-tively measure LDH Again of the four compoundsLP 3134 displayed toxic effects only at 300 μM whereasLP 4010 showed slight toxic effects starting at a concen-tration of 200 μM Both LP 3145 and LP 1062 were toxicat all the concentrations tested (Figure 8)

Discussion

Here four novel small molecules that inhibit DGCenzymes are described It is now apparent that c-di-GMPis a central regulator of the prokaryote biofilm lifestyleand mounting evidence also links this molecule tovirulence factor expression Therefore c-di-GMP presentsa new target for the development of antimicrobial strate-gies

The results indicate that compound LP 3134 is themost promising candidate as it possesses broad-spectrumactivity inhibiting DGC activity from enzymes originat-ing from different bacteria It also inhibited the biofilm

development of both P aeruginosa and A baumanniiunder static and flow conditions This result is criticalbecause flow cell biofilm assays are generally thought tomore closely mimic physiologically relevant conditionsthan microtiter-based biofilm assays where the mediumis not replenished and the culture grows to stationaryphase ultimately using up all of the available nutrientresources leading to less reproducible results

Here the catalytic domain of DGC (residues286ndash454) of the published crystal structure of thefull-length DGC PleD from C crescentus was used for thein silico screening (PDB ID 1W25 httpwwwrcsborg)This domain is very specific to GMP In this crystal struc-ture a c-di-GMP molecule was bound to the active siteThe reason for the specificity of the guanine base is due tothe three hydrogen bonds (1) between the N3 of the guan-ine base with the NH2 of N335 (2) between the N2 andthe side chain carbonyl group of N335 and (3) betweenthe N1 of the base and oxygen of the side-chain carboxylgroup of D344 In addition one of the non-ester oxygenatoms of the phosphate group in the bound c-di-GMPforms a hydrogen bond with the backbone NH of G369 Itappears the active site has space for binding to one of theGMPs before and after the formation of a c-di-GMP mole-cule Since the mechanism of catalysis is not known at theatomic level and only one of the GMPs of c-di-GMP isbound to the active site for the development of a 3Dpharmacophore the authors focused on the specificity ofguanine base interactions with PleD as found in the crystalstructure Here a 3D pharmacophore-based in silicoscreeningdocking of a focused library containinglsquoguanine-likersquo small organic compounds was used foridentification of potential lead inhibitors against the GTPbinding site of DGC

Figure 1c shows the amino acid residues involved inthe binding of compound LP 3134 which makes fourhydrogen bonds with the PleD GTP binding site pre-dicted by the in silicodocking studies The three hydro-gen bonds from the six-membered ring containing threehydroxyl groups are similar to that of the three hydrogenbonds between GMP and PleD as discussed earlier Thefourth hydrogen bond is between the only oxygen of thefused rings and the backbone NndashH of R366 The hydro-phobic side chain of L337 interacts favorably with thesix-membered ring containing the three hydroxyl groupsIn the case of compound LP 4010 the linker atoms Nand the carbonyl group closer to the five-membered ringform hydrogen bonds with N335 The hydroxyl grouportho to the carbon connecting the rings and the hydro-xyl group ortho to the carbon containing a flexible Rgroup each form a hydrogen bond with the side chainNH2 and C=O of N335 respectively whereas in com-pound LP 3145 the oxygen atom of the carbonyl groupin the ring and the adjacent hydroxyl group in the same

Figure 3 The ability of the four inhibitors of DGC at a con-centration of 200 μM to reduce the formation of biofilm inP aeruginosa and A baumannii The treated cells were statisti-cally different from the DMSO controls This experiment wasrepeated three times for each treatment and the histogramdisplays the average biofilm biomass with the associated SD(p lt 005)

8 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

ring each form hydrogen bonds with the side chain NH2

and C=O of N335 respectivelyThe compounds LP 3145 LP 4010 and LP 1062

form only two hydrogen bonds with N335 of PleDrather than three hydrogen bonds as observed for theguanine base of GMP as well as compound LP 3134Thus the predicted positions and orientations of the fourchemically different lead inhibitors in the GTP bindingsite of PleD could help further for lead optimization ofthese compounds and develop into potent inhibitorsagainst PleD

The strain of P aeruginosa used in this study PAO1encodes over 30 distinct DGC enzymes Therefore it ishypothesized that these four compounds must be able toinhibit multiple DGC enzymes in the bacteriumAlthough the assays used in the initial steps of thescreening strategy do not directly detect concentrations

of intracellular c-di-GMP they can measure the activityof DGC which regulates biofilm formation Utilizing twodifferent DGCs (tDGC-R158A and WspR) in the pyro-phosphate assay was an additional asset since the aimwas to identify molecules that are active against morethan one specific DGC

An attempt was made to measure a reduction inthe intracellular concentration of c-di-GMP in A bau-mannii and P aeruginosa when exposed to the inhibi-tors but this was not successful in detecting c-di-GMPin the wild strains A lack of detection of c-di-GMPusing LC-MS-MS is not uncommon (Edmunds et al2013)

Regardless of whether or not the inhibitors of DGCsidentified here reduce intracellular c-di-GMP these com-pounds exhibited significant anti-biofilm properties LP3134 inhibited biofilm formation by P aeruginosa at

P aeruginosa LP 3134 LP 3145

A baumannii LP 3134 LP 3145

20 microm

20 microm

20 microm20 microm

20 microm 20 microm

Figure 4 CLSM images of the biofilm P aeruginosa and A baumannii grown in the presence and absence of 200 μM LP 3134and LP 3145 were imaged 48 h post inoculation of flow cells The panels on the left are an overlay of multiple slices and the sideframes of the panels on the right show the z-stack showing the thickness and the architecture of the biofilm The line in the z-stackindicates the level at which the photograph of the x-y plane was taken Photographs were taken at a magnification of times600

Biofouling 9

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

every step including inhibiting initial attachmentdevelopment of biofilm and promoting dispersion Thereis growing evidence demonstrating that reducedc-di-GMP levels promote dispersion from a biofilm Forexample exposure of P aeruginosa to starvationconditions triggers biofilm dispersal (Gjermansen et al

2005 Schleheck et al 2009) This dispersion requiredthe PDE DipA and a chemotaxis protein BdlA thatresponds to c-di-GMP (Morgan et al 2006) Further-more it has been shown that LapD a c-di-GMP effectorprotein in P fluorescens triggers dispersion from a sur-face under low levels of c-di-GMP by triggering proteol-ysis of LapA from the cell surface (Monds et al 2007Newell et al 2009) These results suggest that a decrease

Figure 5 The ability of the four inhibitors of DGC todisperse the formation of biofilm in P aeruginosa andA baumannii with and without inhibitors at a concentration of200 μM This experiment was repeated three times for eachtreatment and the histogram displays the average biofilmbiomass with the associated SD Indicates statisticallysignificant differences

Figure 6 The ability of LP 3134 to reduce initial adherenceof P aeruginosa on silicone catheters with and withoutinhibitors at a concentration of 200 μM The results representthe mean plusmn the SEM of three independent experiments TheStudentrsquos paired t test was used to compare the treated andnon-treated cells Denotes statistical significance of p lt 005

Figure 7 The ability of LP 3134 and LP 3145 to reduceP aeruginosa biofilms on silicone catheters with and withoutinhibitors at a concentration of 200 μM The results representthe mean plusmn SEM of three independent experiments The Stu-dentrsquos paired t test was used to compare the treated and non-treated catheters Denotes statistical significance of p lt 005

Figure 8 Toxicity testing of the four inhibitors of DGC inmammalian cells Raw2647 cells were treated as indicated andviability was measured at 24 h following the directions ofmanufacturer

10 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

in levels of c-di-GMP may be a signal for dispersion ofbiofilm Therefore it is not surprising that all four DGCinhibitors identified dispersed established biofilms of Paeruginosa

Recent studies demonstrating bacterial pathogenscapable of forming biofilms in the host organs andindwelling medical devices in vivo using relevant animalmodels have been reported thereby suggesting a role forthis mode of existence during human infections (Hall-Stoodley et al 2006 Sloan et al 2007 Stoodley et al2008 2010 Chauhan et al 2012) In addition formationof bacterial biofilm is also responsible for significantindustrial economic loss and high morbidity and mortal-ity in medical settings The present results show that LP3134 impacts the development of biofilm on silicone uri-nary catheters thereby opening the possibility of using itto modify materials for the construction of anti-biofilmcatheters and related implantable biomaterial Given itsbroad-spectrum activity against two different DGCs it isexpected that LP 3134 will exhibit anti-biofilm activityagainst catheter-related biofilm pathogens such as E coliand Klebsiella pneumoniae since they encode a signifi-cant number of GGDEF domains (Trautner amp Darouiche2004 Jacobsen et al 2008 Stahlhut et al 2012) Fur-thermore such compounds may also be used in thefuture to eradicate biofilms formed in the organs of themammalian host

Recently using a whole cell luminescence-basedscreen Sambanthamoorthy et al (2012) reported the firstever small molecule inhibitors of DGC that inhibited theformation of biofilm and decreased the intracellular lev-els of c-di-GMP by direct inhibition of DGC enzymesIn this report an in silico-based approach to identifyadditional novel and chemically different sets of smallmolecules from a focused library containing lsquoguanine-likersquo commercially available compounds was used thatcan reduce the formation of biofilm by directly inhibitingDGC enzymes Therefore these molecules broaden thenew class of anti-biofilm compounds that function byinhibiting the DGC enzymes

AcknowledgementsThe findings and opinions expressed herein belong to theauthors and do not necessarily reflect the official views of theWRAIR the US Army or the Department of Defense Thiswork was supported by a Military Infectious Diseases ResearchProgram (MIDRP) grant W0066_12_WR awarded to Dr CLwhich provided support for KS also and NIH grantsU19AI090872 and the MSU Foundation to CMW The authorswould like to thank Matthew Wise from the microscopy facilityat WRAIR for providing help with the imaging when neces-sary the Michigan State University Mass Spectrometry facilityfor assistance in quantifying c-di-GMP Dr IswarduthSoojhawon for helping with figures and Dr Matthew Parsekfor sharing P aeruginosa strains

ReferencesAnderl JN Franklin MJ Stewart PS 2000 Role of antibiotic

penetration limitation in Klebsiella pneumoniae biofilm resis-tance to ampicillin and ciprofloxacin Antimicrob AgentsChemother 441818ndash1824

Antoniani D Bocci P Maciag A Raffaelli N Landini P 2010Monitoring of di-guanylate cyclase activity and of cyclic-di-GMP biosynthesis by whole-cell assays suitable forhigh-throughput screening of biofilm inhibitors ApplMicrobiol Biotechnol 851095ndash1104

Bobrov AG Kirillina O Ryjenkov DA Waters CM Price PAFetherston JD Mack D Goldman WE Gomelsky M PerryRD 2011 Systematic analysis of cyclic di-GMP signallingenzymes and their role in biofilm formation and virulencein Yersinia pestis Mol Microbiol 79533ndash551

Chauhan A Lebeaux D Ghigo JM Beloin C 2012 Full andbroad-spectrum in vivo eradication of catheter-associatedbiofilms using gentamicin-EDTA antibiotic lock therapy An-timicrob Agents Chemother 566310ndash6318

Costerton JW Lewandowski Z Caldwell DE Korber DR Lappin-Scott HM 1995 Microbial biofilms Annu Rev Microbiol49711ndash745

Cotter PA Stibitz S 2007 c-di-GMP-mediated regulation ofvirulence and biofilm formation Curr Opin Microbiol1017ndash23

Dallo SF Weitao T 2010 Insights into Acinetobacter war-woundinfections biofilms and control Adv Skin Wound Care23169ndash174

Davies D 2003 Understanding biofilm resistance toantibacterial agents Nat Rev Drug Discovery 2114ndash122

De N Pirruccello M Krasteva PV Bae N Raghavan RVSondermann H 2008 Phosphorylation-independent regula-tion of the diguanylate cyclase WspR PLoS Biol 6 e67

Dow JM Fouhy Y Lucey JF Ryan RP 2006 The HD-GYPdomain cyclic di-GMP signaling and bacterial virulence toplants Mol Plant Microbe Interact 191378ndash1384

Edmunds AC Castiblanco LF Sundin GW Waters CM 2013Cyclic di-GMP modulates the disease progression ofErwinia amylovora J Bacteriol 1952155ndash2165

Fux CA Costerton JW Stewart PS Stoodley P 2005 Survivalstrategies of infectious biofilms Trends Microbiol1334ndash40

Galperin MY 2004 Bacterial signal transduction network in agenomic perspective Environ Microbiol 6552ndash567

Gjermansen M Ragas P Sternberg C Molin S Nielsen T 2005Characterization of starvation-induced dispersion Pseudomo-nas putida biofilms Environ Microbiol 7894ndash906

Hall-Stoodley L Costerton JW Stoodley P 2004 Bacterial bio-films from the natural environment to infectious diseasesNat Rev Microbiol 295ndash108

Hall-Stoodley L Hu FZ Gieseke A Nistico L Nguyen DHayes J Forbes M Greenberg DP Dice B Burrows Aet al 2006 Direct detection of bacterial biofilms on themiddle-ear mucosa of children with chronic otitis mediaJAMA 296202ndash211

Hall-Stoodley L Stoodley P 2009 Evolving concepts in bio-film infections Cell Microbiol 111034ndash1043

Harrison JJ Turner RJ Ceri H 2005 High-throughput metalsusceptibility testing of microbial biofilms BMC Micro-biol 553ndash64

Jacobsen SM Stickler DJ Mobley HL Shirtliff ME 2008Complicated catheter-associated urinary tract infections dueto Escherichia coli and Proteus mirabilis Clin MicrobiolRev 2126ndash59

Biofouling 11

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13

Jenal U Malone J 2006 Mechanisms of cyclic-di-GMP signal-ing in bacteria Annu Rev Genet 40385ndash407

Jeys L Grimer R 2009 The long-term risks of infection andamputation with limb salvage surgery using endoprosthe-ses Recent Results Cancer Res 17975ndash84

Lipinski CA Lombardo F Dominy BW Freeney PJ 1997Experimental and computational approaches to estimate sol-ubility and permeability in drug discovery and developmentsettings Adv Drug Delivery Rev 233ndash25

Mah TF Pitts B Pellock B Walker GC Stewart PS OrsquoToole GA2003 A genetic basis for Pseudomonas aeruginosa biofilm anti-biotic resistance Nature 426306ndash310

Monds RD Newell PD Gross RH OrsquoToole GA 2007 Phos-phate-dependent modulation of c-di-GMP levels Pseudomo-nas fluorescens Pf0-1 biofilm formation of the adhesinLapA Mol Microbiol 63656ndash679

Morgan R Kohn S Hwang SH Hassett DJ 2006 BdlA a che-motaxis regulator essential for biofilm dispersion Pseudomo-nas aeruginosa J Bacteriol 1887335ndash7343

Murphy RA Ronat JB Fakhri RM Herard P Blackwell NAbgrall S Anderson DJ 2011 Multidrug-resistant chronicosteomyelitis complicating war injury in Iraqi civilians JTrauma 71252ndash254

Navarro MV De N Bae N Wang Q Sondermann H 2009Structural analysis of the GGDEF-EAL domain-containingc-di-GMP receptor FimX Structure 171104ndash1116

Newell PD Monds RD OrsquoToole GA 2009 LapD is a bis-(3prime5prime)-cyclic dimeric GMP-binding protein that regulates surfaceattachment by Pseudomonas fluorescens Pf0-1 Proc Nat AcadSci USA 1063461ndash3466

Newell PD Yoshioka S Hvorecny KL Monds RD OrsquoTooleGA 2011 A systematic analysis of diguanylate cyclasesthat promote biofilm formation by Pseudomonasfluorescens Pf0-1 J Bacteriol 1934685ndash4698

Rao F Pasunooti S Ng Y Zhuo W Lim L Liu AW LiangZX 2009 Enzymatic synthesis of c-di-GMP using a ther-mophilic diguanylate cyclase Anal Biochem 389138ndash142

Romling U Gomelsky M Galperin MY 2005 C-di-GMP thedawning of a novel bacterial signalling system Mol Micro-biol 57629ndash639

Ryan RP Fouhy Y Lucey JF Dow JM 2006 Cyclic di-GMPsignaling in bacteria recent advances and new puzzles JBacteriol 1888327ndash8334

Ryjenkov DA Tarutina M Moskvin OV Gomelsky M 2005Cyclic diguanylate is a ubiquitous signaling molecule inbacteria insights into biochemistry of the GGDEF proteindomain J Bacteriol 1871792ndash1798

Sambanthamoorthy K Schwartz A Nagarajan V Elasri MO 2008The role of msa in Staphylococcus aureus biofilm formationBMCMicrobiol 8221ndash229

Sambanthamoorthy K Sloup RE Parashar V Smith JM Kim EESemmelhack MF Neiditch MB Waters CM 2012 Identifica-tion of small molecules that antagonize diguanylate cyclase

enzymes to inhibit biofilm formation Antimicrob Agents Che-mother 565202ndash5211

Schleheck D Barraud N Klebensberger J Webb JS McDoug-ald D Rice SA Kjelleberg S 2009 Pseudomonas aerugin-osa PAO1 preferentially grows as aggregates in liquidbatch cultures and disperses upon starvation PLoS ONE4e5513

Schmidt AJ Ryjenkov DA Gomelsky M 2005 The ubiquitousprotein domain EAL is a cyclic diguanylate-specific phos-phodiesterase enzymatically active and inactive EALdomains J Bacteriol 1874774ndash4781

Simm R Fetherston JD Kader A Romling U Perry RD 2005Phenotypic convergence mediated by GGDEF-domain-con-taining proteins J Bacteriol 1876816ndash6823

Sloan GP Love CF Sukumar N Mishra M Deora R 2007The Bordetella Bps polysaccharide is critical for biofilmdevelopment in the mouse respiratory tract J Bacteriol1898270ndash8276

Stahlhut SG Struve C Krogfelt KA Reisner A 2012 Biofilmformation of Klebsiella pneumoniae on urethral cathetersrequires either type 1 or type 3 fimbriae FEMS ImmunolMed Microbiol 65350ndash359

Stoodley P Braxton E Nistico L Hall-Stoodley L Johnson SQuigley M Post JC Ehrlich GD Kathju S 2010 Directdemonstration of Staphylococcus biofilm in an externalventricular drain in a patient with a history of recurrentventriculoperitoneal shunt failure Pediatr Neurosurg46127ndash132

Stoodley P Nistico L Johnson S Carabin LA Baratz M Gah-lot V Ehrlich GD Kathju S 2008 Direct demonstration ofviable Staphylococcus aureus biofilms in an infected totaljoint arthroplasty a case report J Bone Joint Surg Am901751ndash1758

Stover CK Pham XQ Erwin AL Mizoguchi SD Warrener PHickey MJ Brinkman FS Hufnagle WO Kowalik DJ LagrouM et al 2000 Complete genome sequence of Pseudomonasaeruginosa PAO1 an opportunistic pathogen Nature406959ndash964

Tamayo R Pratt JT Camilli A 2007 Role of cyclic diguany-late in the regulation of bacterial pathogenesis Annu RevMicrobiol 61131ndash148

Trautner BW Darouiche RO 2004 Role of biofilm in catheter-associated urinary tract infection Am J Infect Control32177ndash183

Wolcott RD Rhoads DD Bennett ME Wolcott BM GogokhiaL Costerton JW Dowd SE 2010 Chronic wounds and themedical biofilm paradigm J Wound Care 1945ndash46 48ndash50 52ndash53

Zurawski DV Thompson MG McQueary CN Matalka MNSahl JW Craft DW Rasko DA 2012 Genome sequencesof four divergent multidrug-resistant Acinetobacter bau-mannii strains isolated from patients with sepsis or osteo-myelitis J Bacteriol 1941619ndash1620

12 K Sambanthamoorthy et al

Dow

nloa

ded

by [

201

372

50]

at 0

721

06

Nov

embe

r 20

13