JOURNAL OF VIROLOGY, Sept. 2010, p. 8712–8720 Vol. 84, No. 170022-538X/10/$12.00 doi:10.1128/JVI.00523-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Hit-and-Run Stimulation: a Novel Concept To Reactivate LatentHIV-1 Infection without Cytokine Gene Induction�

Frank Wolschendorf,1 Alexandra Duverger,1 Jennifer Jones,1 Frederic H. Wagner,1 Jason Huff,2William H. Benjamin,3 Michael S. Saag,1 Michael Niederweis,2 and Olaf Kutsch1*

Department of Medicine,1 Division of Infectious Diseases, Department of Microbiology,2 and Department ofLaboratory Medicine,3 The University of Alabama at Birmingham, Birmingham, Alabama

Received 9 March 2010/Accepted 1 June 2010

Current antiretroviral therapy (ART) efficiently controls HIV-1 replication but fails to eradicate the virus.Even after years of successful ART, HIV-1 can conceal itself in a latent state in long-lived CD4� memory Tcells. From this latent reservoir, HIV-1 rebounds during treatment interruptions. Attempts to therapeuticallyeradicate this viral reservoir have yielded disappointing results. A major problem with previously utilizedactivating agents is that at the concentrations required for efficient HIV-1 reactivation, these stimuli triggerhigh-level cytokine gene expression (hypercytokinemia). Therapeutically relevant HIV-1-reactivating agentswill have to trigger HIV-1 reactivation without the induction of cytokine expression. We present here aproof-of-principle study showing that this is a possibility. In a high-throughput screening effort, we identifiedan HIV-1-reactivating protein factor (HRF) secreted by the nonpathogenic bacterium Massilia timonae. Inprimary T cells and T-cell lines, HRF triggered a high but nonsustained peak of nuclear factor kappa B(NF-�B) activity. While this short NF-�B peak potently reactivated latent HIV-1 infection, it failed to inducegene expression of several proinflammatory NF-�B-dependent cellular genes, such as those for tumor necrosisfactor alpha (TNF-�), interleukin-8 (IL-8), and gamma interferon (IFN-�). Dissociation of cellular and viralgene induction was achievable, as minimum amounts of Tat protein, synthesized following application of ashort NF-�B pulse, triggered HIV-1 transactivation and subsequent self-perpetuated HIV-1 expression. In theabsence of such a positive feedback mechanism, cellular gene expression was not sustained, suggesting thatstrategies modulating the NF-�B activity profile could be used to selectively trigger HIV-1 reactivation.

Antiretroviral therapy (ART) quickly suppresses HIV-1 rep-lication in patients, to nondetectable levels. However, evenafter years of effective ART, cessation of therapy results in theimmediate rebound of viremia. This is attributed to a long-lived reservoir of latently HIV-1-infected memory CD4� Tcells (2–4). As a result of the long life span of memory T cellsthat serve as cellular hosts to latent HIV-1 infection, the latentHIV-1 reservoir is extremely stable. Natural eradication in theabsence of any replenishment of the reservoir by de novo in-fection events is predicted to take about 70 years (26). Sincenatural depletion of the latent reservoir is unlikely to beachievable, HIV-1 latency is believed to represent the principalobstacle to curative AIDS therapy (2–9). Strategies to purgethis viral reservoir will have to be included in any HIV-1 ther-apy with curative intent.

Based on the molecular understanding of HIV-1 latency,several attempts to therapeutically deplete the latent HIV-1reservoir by activating the integrated but transcriptionally si-lent viral promoter have previously been made. This was ini-tially attempted using strategies that would increase NF-�Bactivity levels in latently infected T cells. With NF-�B being themajor activating transcription factor for HIV-1, this wasthought to promote HIV-1 reactivation (6, 18, 21). Patients onART were thus treated with interleukin-2 (IL-2) or the anti-

CD3 monoclonal antibody (MAb) OKT3, two known inducersof NF-�B activity in T cells (2–9). Later, histone deacetylase(HDAC) inhibitors (valproic acid) were applied therapeuti-cally, as it had been proposed that similar to the case forinactive but inducible cellular genes, a restrictive histone codewould govern HIV-1 latency. HDAC inhibitors were thoughtto trigger changes in the histone composition at the viral pro-moter to favor viral transcription in the absence of cellularactivation. To date, all clinical HIV-1 reactivation protocolshave failed to reduce the latent reservoir, or the clinical sig-nificance of reported reductions has been disputed (27, 28).

This situation is further complicated by a recent report thatlatent HIV-1 infection events in vivo are found integratedpredominantly into actively expressed host genes (12). Whilesome have voiced concerns that the detected integration eventswere likely to be functionally inactive, we recently confirmedthis idea in an unbiased cellular model of HIV-1 latency es-tablishment (10). In this system, we found that all of the ana-lyzed latently infected cell clones carried the HIV-1 genome inactively expressed host genes. However, actively expressedgenes are an unlikely environment for the establishment of arestrictive histone code. In this setting, HIV-1 latency could becontrolled by transcriptional interference of the host gene pro-moter by the integrated viral long terminal repeat (LTR) (10,13, 22). These findings favor the development of reactivationstrategies that would aim to directly transcriptionally activatethe latent HIV-1 promoter by stimulating the host cell. How-ever, if HIV-1 reactivation should be achieved by direct LTRactivation, then in order to prevent the induction of a cytokinestorm, therapeutics would have to be developed that, unlike

* Corresponding author. Mailing address: University of Alabama atBirmingham, Department of Medicine, BBRB, Room 510, 845 19thStreet South, Birmingham, AL 35294. Phone: (205) 934-1547. Fax:(205) 934-1580. E-mail: okutsch@uab.edu.

� Published ahead of print on 10 June 2010.

8712

anti-CD3 MAbs or IL-2, dissociate cellular gene activationfrom HIV-1 reactivation. Here we present proof-of-conceptdata showing that this can be achieved.

In this study, we report that a protein activity secreted by thenonpathogenic bacterium Massilia timonae, termed HIV-1-re-activating factor (HRF), efficiently reactivated latent HIV-1infection without inducing cellular gene expression. HRF pro-duced a strong but short burst of NF-�B activity. This type ofhit-and-run activation was sufficient to trigger initial HIV-1 Tatproduction, which then induced self-perpetuation of HIV-1expression. Since cellular gene expression is not regulated bytrans-acting positive feedback mechanisms, no sustainablegene expression was established, despite the strong initial trig-ger. These findings suggest that the control of both the ampli-tude and the duration of NF-�B activity can be used to selec-tively trigger latent HIV-1 expression without induction ofcellular genes.

MATERIALS AND METHODS

Cell culture and reagents. All T-cell lines, as well as latently HIV-1-infectedmonocytic THP89GFP cells, were maintained in RPMI 1640 supplemented with2 mM L-glutamine, 100 U/ml penicillin, 100 �g/ml streptomycin, and 10% heat-inactivated fetal bovine serum (FBS). FBS was obtained from HyClone (Logan,UT) and was tested on a panel of latently infected cells to ensure that the utilizedFBS batch did not spontaneously trigger HIV-1 reactivation (16, 19). The phor-bol ester 13-phorbol-12-myristate acetate (PMA), lipopolysaccharide (LPS), andpolymyxin B-agarose beads were purchased from Sigma, whereas recombinanthuman tumor necrosis factor alpha (TNF-�) was obtained from R&D. Theutilized enhanced green fluorescent protein (EGFP) reporter virus, HIV-1NLENG1-IRES, has been described elsewhere (19, 23). The reporter plasmidpNF-�B-d2EGFP was purchased from Clontech. The LTR-GFP construct andthe IL-8 reporter construct have been described previously (1). The TNF pro-moter construct was generated by cloning the human TNF-� promoter elementdefined by primer pair 5�-BglII (5�-GGCGCGGAGATCTTAACGAAGACAGGGCCATGT) and 3�-AgeI (5�-GCCAATACCGGTGTGTCCTTTCCAGGGGAGAG) into pd2EGFP (Clontech). MSCV-GFP was generated by cloning theEGFP gene into the retroviral pMSCV-puro vector (Clontech).

Flow cytometry. Infection levels in the cell cultures were monitored by flowcytometric analysis of EGFP expression. Flow cytometric analysis was performedon a Guava EasyCyte (Guava Technologies, Inc.) or LSRII (Becton Dickinson)flow cytometer. Data were analyzed using either CytoSoft or CellQuest software.

Expression of cytokines and viral proteins. Following stimulation of periph-eral blood mononuclear cells (PBMCs) with phytohemagglutinin L (PHA-L) orHRF, supernatant samples were collected at time points between 12 h and 48 hpoststimulation. Preliminary analysis revealed that peak cytokine secretion wasseen at around 24 h. Therefore, cytokine levels in culture supernatant samplesfrom all donors were determined at the 24-h time point, using a customizedMilliplex mAP kit for the simultaneous analysis of six human cytokines (IL-2,IL-4, IL-6, IL-8, TNF-�, and gamma interferon [IFN-�]). BioPlex analysis wasperformed on a Luminex 100 machine (Bio-Rad). HIV-1 Gag p24 enzyme-linkedimmunosorbent assay (ELISA) kits were purchased from Perkin Elmer, and p24levels in the cell culture supernatants were determined according to the manu-facturer’s instructions. To determine mRNA levels in primary T cells induced byHRF or anti-CD3/CD28 stimulation, mRNA was isolated at various time pointsafter stimulation. cDNA was generated using �MACS one-step cDNA kits.Specific mRNAs for IL-2, TNF-�, and IFN-� were amplified by use of thefollowing primers: 5�-IL-2 (AGAAGGCCACAGAACTGAAACATC), 3�-IL-2(TGCTGATTAAGTCCCTGGGTCTTA), 5�-TNF (AGGCGGTGCTTGTTCCTCAG), 3�-TNF (TGGGCCAGAGGGCTGATTAG), 5� IFN (GGCTTTTCAGCTCTGCATCG), and 3�-IFN (TTCCATTATCCGCTACATCTGAATG).

Direct quantification of NF-�B activity. NF-�B activity in nuclear extracts wasquantified using a TransAM NF-�B family ELISA kit (Active Motive) accordingto the manufacturer’s instructions. Oligonucleotides reflecting the NF-�B ele-ment of HIV-1 NL43 were used in cold competition experiments to ensure thatthe detected NF-�B composition would also bind to the NL43 NF-�B element(agctttctacaaGGGACTTTCCgctgGGGACTTTCCagggaggtgt; uppercase lettersrepresent the consensus NF-�B binding sequences). A scrambled oligonucleo-

tide provided by the manufacturer was used to demonstrate the overall specificityof the observed NF-�B binding.

Bacterial isolation and identification. Following several rounds of cloning onblood agar plates, chromosomal DNAs from cultured bacteria derived fromisolated colonies were isolated using phenol extraction. Briefly, cells were pel-leted by centrifugation, resuspended in chloroform-methanol (3:1), and vor-texed. The same volume of Tris-buffered phenol-chloroform-isoamyl alcohol wasadded, and the mixture was vortexed before the addition of GTC buffer. Afterbeing mixed, the sample was vortexed and centrifuged at 9,000 � g for 20 min.The upper phase was carefully removed, and DNA was precipitated by isopro-panol, washed with 70% ethanol, dried in a vacuum centrifuge for 15 min, andresuspended in 100 �l purified water. The 16S rRNA gene was amplifiedusing the primer pair 16SrRNAfor (5�-AGAGTTTGATCCTGGCTCAG) and16SrRNArev (5�-ACGGCTACCTTGTTACGACTT). These and the followingprimers were used to sequence the 16S rRNA: Mass16sF#2 (5�-CCCTAAACGATGTCTACTAGTTGT), MassRNA5 (5�-TTCGGGCACAACCAAATCTCTTCG), and MassRNA4 (5�-GGCTCAACCTCCCAATTGCGATG). Based onthe 16S rRNA sequence, the bacterial isolate was identified as Massilia timonae(NIH BLAST). Except for 3 nucleotides, the 16S rRNA gene of the isolatedHRF-producing Massilia strain matched the sequences of Massilia timonaeATCC BAA-701 and ATCC BAA-703 (14, 15), which correspond to the genesequences under GenBank accession numbers AY157759 and AY157761, re-spectively.

Bacterial growth. Bacteria from various sources were isolated on Trypticasesoy agar II (TSA II) plates containing 5% sheep blood. Bacterial isolates werethen grown in RPMI 1640 medium supplemented with 10% FBS. Unless other-wise indicated, Massilia timonae was grown in RPMI 1640 medium supplementedwith 10% FBS. Typically, medium was inoculated with Massilia timonae fromfrozen stocks to an optical density at 600 nm (OD600) of 0.01. After 72 h at 37°C,the culture was centrifuged at 3,200 � g to separate bacteria from the culturemedium. The supernatant was then sterilized by passage through a 0.2-�mpolyvinylidene difluoride (PVDF) filter with a low protein-binding capacity.HRF activity was determined by the ability to reactivate latent HIV-1 infectionin CA5 cells (14, 15). Only supernatants for which 6 �l reactivated infection in atleast 60% of CA5 cells were used to study HRF properties. For control exper-iments, a clinical Pseudomonas aeruginosa clone isolate was directly transferredfrom an LB agar plate into 10 ml of RPMI 1640 supplemented with 10% FBSand grown to density overnight. Culture supernatants were centrifuged andsterile filtered. For Escherichia coli coculture experiments, E. coli DH5� culturedin LB medium was pelleted by centrifugation, resuspended in RPMI 1640,counted, and used for the RPMI 1640 medium-based coculture experiment withlatently HIV-1-infected CA5 reporter T cells.

HRF characterization. To determine the chemical nature of HRF, 100 �l ofHRF-containing culture filtrate was treated with different amounts of proteinaseK, trypsin, DNase, or RNase for 15 min at 37°C. The enzymes were inactivatedat 95°C for 5 min. HRF was concentrated by ammonium sulfate precipitation,using standard protocols. Briefly, the optimal concentration for HRF precipita-tion was determined by adding ammonium sulfate to final concentrations of 20%,40%, 60%, and 80% (wt/vol). After 14 h at 4°C, the precipitated proteins wereretrieved by centrifugation for 40 min at 16,000 � g. The pellet was reconstitutedin phosphate-buffered saline (PBS). Ammonium sulfate from supernatants andprecipitated proteins was removed by passage through a 3-kDa-molecular-size-cutoff (MWCO) membrane (Microcon; Millipore) according to the manufactur-er’s recommendations. Fresh, ice-cold PBS was added when 75% of the samplevolume had passed through the filter. This procedure was repeated four times.Latently HIV-1-infected CA5 T cells tolerate ammonium sulfate concentrationsof up to 5% (wt/vol) in the cell culture medium without any signs of HIV-1reactivation. As a result of the MWCO filtration procedure, the highest possibleammonium sulfate concentration in cell culture was 0.3%, as filtration andwashing result in 256-fold dilution. Proteins were precipitated from 10 ml ofbacterial culture filtrate by use of 60% (wt/vol) ammonium sulfate. The pelletwas resuspended in 250 �l PBS. Ammonium sulfate was removed by MWCOfiltration as described above. Protein concentration was determined using abicinchoninic acid (BCA) protein assay kit (ThermoFisher) according to themanufacturer’s recommendations. A total of 1.5 �g of protein was then sepa-rated in a 10% polyacrylamide gel according to standard protocols. Separatedproteins were visualized by silver staining.

RESULTS AND DISCUSSION

Identification of a bacterium secreting an HIV-1-reactivat-ing protein activity. As part of an ongoing screening effort to

VOL. 84, 2010 HIV-1 REACTIVATION BY HIT-AND-RUN STIMULATION 8713

identify substances with HIV-1-reactivating ability, we discov-ered a potent HIV-1-reactivating activity in the cell culturesupernatant of an initially unidentified bacterium. Upon addi-tion of this culture supernatant to latently HIV-1-infected re-porter T-cell lines in which GFP expression serves as a directand quantitative marker of HIV-1 expression, high levels ofHIV-1 reactivation were observed (10). Flow cytometric for-ward scatter (FSC)/side scatter (SSC) analysis demonstrated

that cell viability was not affected (Fig. 1A to D). The bacte-rium was isolated on blood agar plates but did not grow inLuria-Bertani, Hartman DeBond, or brain heart infusion me-dium. The 16S rRNA sequence identified the bacterium asMassilia timonae (�99.9% sequence identity over 1,400 bp[data not shown]). M. timonae is a Gram-negative bacteriumwhich was initially isolated, in the context of opportunisticinfection, from a severely immunocompromised human patient

FIG. 1. Culture supernatants from Massilia timonae reactivate latent HIV-1 infection. Latently HIV-1-infected CA5 reporter T cells weretreated with 10 �l of Massilia timonae cell culture supernatant (HRF). Untreated control cells and HRF-treated cells were subjected to flowcytometric analysis. (A and C) FSC/SSC dot plots were used to determine cell viability as a function of changes in the FSC (cell size) and SSC(granularity) phenotypes of the cells. (B and D) EGFP expression was used as a direct and quantitative marker of HIV-1 expression at 24 hpoststimulation. (E) To demonstrate the reproducibility of the observed effect, we tested three independent preparations of HRF (M. timonae #1to #3) on four different latently infected T-cell lines (5F3, 8E12, CA5, and 12D4). The percentages of EGFP-positive cells following stimulationare depicted as histograms. Cell culture supernatants of Pseudomonas aeruginosa cultures grown under similar conditions were used as a specificitycontrol. (F) CA5 cells were stimulated with either PMA, TNF-�, or HRF, and HIV-1 Gag p24 levels were determined by ELISA to demonstrateviral protein production following HRF stimulation of CA5 T cells. C, control. (G) HRF-mediated reactivation is not the result of pyrogenicactivity. Since Massilia timonae is a Gram-negative bacterium, we tested whether HIV-1 reactivation could be triggered by endotoxin-like activities.To remove endotoxins from the HRF preparations, we incubated the Massilia timonae culture supernatants with polymyxin B-agarose prior tostimulation of the latently HIV-1-infected CA5 reporter T cells with increasing doses of the HRF preparations. Levels of HIV-1 reactivation weredetermined as the percentage of EGFP-positive cells by flow cytometric analysis at 48 h poststimulation. (H) Latently HIV-1-infected CA5 reporterT cells were treated with increasing concentrations of HRF or LPS. The functionality of LPS was demonstrated by stimulating latentlyHIV-1-infected monocytic THP89GFP cells with increasing amounts of LPS and then measuring the level of LPS-mediated HIV-1 reactivation.For all conditions, levels of HIV-1 reactivation were determined as the percentage of EGFP-positive cells at 48 h poststimulation, using flowcytometric analysis.

8714 WOLSCHENDORF ET AL. J. VIROL.

(20, 24). M. timonae is considered nonpathogenic and fre-quently appears in samples originating from soil, air, anddrinking water sources (11, 29, 30). Several of the M. timonaestrains deposited at the American Type Culture Collection(ATCC) showed either no or much lower HIV-1-reactivatingcapacities, which seemed to correlate with the overall dimin-ished secretory activities of these strains (data not shown).

HRF could be removed from the supernatants by chloro-form and acetonitrile precipitation. HRF activity precipitatedin �40% ammonium sulfate solutions, and the activity couldbe reconstituted fully in watery solutions. HRF activity wassensitive to trypsin and proteinase K digestion. Treatment ofthe supernatants with DNase or RNase did not impair theHIV-1-reactivating ability of HRF. Taken together, these datasuggest that HRF is a protein with a molecular mass in therange of 50 to 100 kDa, as determined by gel-filtration high-performance liquid chromatography and molecular size exclu-sion filtration (data no shown).

Initial characterization of HRF effect on latent HIV-1 infec-tion. HRF was found to efficiently reactivate latent HIV-1infection in four latently infected reporter T-cell lines devel-oped in our laboratory (Fig. 1E) (10, 16, 19). Culture super-natants from the Gram-negative bacterium Pseudomonasaeruginosa, used as a control, had no reactivating effect onthese cell lines. To confirm that EGFP would serve as a directand quantitative marker of HIV-1 protein expression, we dem-onstrated that HRF also induced HIV-1 Gag p24 expression(Fig. 1F). Reactivation occurred in a concentration-dependentmanner and was not triggered by any endotoxin contamination,as demonstrated by treatment of the bacterial culture filtratewith polymyxin B or by endotoxin removal on polymyxin B-agarose columns (Fig. 1G). Also, while HRF reactivatedHIV-1 expression in latently infected reporter T-cell lines anda monocytic reporter cell line (THP89GFP) (19), lipopolysac-charide, a prototypic endotoxin, reactivated HIV-1 infectiononly in the latently HIV-1-infected monocytic THP89GFP cells(Fig. 1H), lending further support to the idea that HRF has nopyrogenic activity.

The isolated Massilia timonae strain, in contrast to otherbacteria (e.g., Pseudomonas aeruginosa), did not overgrow theT-cell cultures, possibly due to its low growth rate. In cocul-ture, a bacterium/T-cell ratio of �1:10 was sufficient to triggermaximum HIV-1 reactivation (Fig. 2A and B), whereas a 25-fold excess of bacteria still did not impair viability of the T-cellculture (Fig. 2C and D). Cocultures with E. coli did not triggerHIV-1 reactivation (Fig. 2E and F), but E. coli overgrew theculture within 24 h, which resulted in massive cytotoxicity atlater time points.

HRF triggers a nonsustained NF-�B activity spike. HRFactivated latent HIV-1 provirus with a comparable potency tothose of TNF-� and PMA, two of the strongest HIV-1-reacti-vating agents known. Reactivation kinetics were similar tothose of TNF-� and less rapid than reactivation kinetics seenfollowing PMA stimulation (Fig. 3A). However, in contrast tothese nontherapeutic agents, HRF was far less cytotoxic in cellculture and showed an in vitro therapeutic index of �300.Higher concentrations of HRF could not be tested for techni-cal reasons.

Since the NF-�B pathway has been recognized as vital toHIV-1 activation (32), we investigated the ability of HRF to

induce NF-�B activity. We initially determined the ability ofHRF to stimulate Tat-independent activation of a stably inte-grated HIV-1 LTR–GFP construct in NOMI reporter T cells(17, 25). In the absence of HIV-1 Tat, LTR-driven EGFPexpression is a direct function of NF-�B activity. In these cells,both TNF-� and PMA stimulated Tat-independent activationof the stably integrated LTR-EGFP construct at concentra-tions that correlated with those required to trigger efficientHIV-1 reactivation in latently infected cells. In contrast, HRFproduced only a modest increase in EGFP expression, whichwas seen at HRF concentrations that greatly exceeded theconcentrations required to trigger HIV-1 reactivation in la-tently infected T cells (Fig. 3B). In addition, HRF induced only

FIG. 2. HIV-1 reactivation in CA5 T cells triggered by coculturewith Massilia timonae. Mixtures of M. timonae or E. coli and a constantnumber of latently HIV-1-infected CA5 reporter T cells (1 � 106 cells)were cocultured at different ratios for 24 h. (A, C, and E) Using alogarithmic representation of the FSC/SSC analysis, it was possible tovisualize M. timonae, E. coli, and the T cells in the same FSC/SSC dotplot, using flow cytometric analysis. (B, D, and F) By gating on theT-cell population, we could determine the level of HIV-1 reactivationin latently HIV-1-infected CA5 T cells as a function of the number ofbacteria. M. timonae cocultures with T cells were started with a verysmall (A and B) and a very large (C and D) number of bacteria, bothof which provided full HIV-1 reactivation at the population level. (Eand F) E. coli cocultures with CA5 T cells were started at the same lowbacterium/T-cell ratio as that used for M. timonae cocultures in panelA, but they did not reactivate the latent HIV-1 virus. FSC/SSC plotswere used to determine any changes in cell numbers, cell morphology,or viability. The surface of the E. coli dot plot demonstrates massivebacterial growth. EGFP fluorescence was determined as a directmarker of HIV-1 expression. RFP, secondary fluorescence.

VOL. 84, 2010 HIV-1 REACTIVATION BY HIT-AND-RUN STIMULATION 8715

very weak EGFP expression from constructs that harbored theNF-�B-responsive IL-8 or TNF-� promoter, an HIV-1 LTR–EGFP construct, and a GFP construct under the control ofthree consensus NF-�B sites transfected into 293T cells (1, 25).As a control, all promoters were efficiently induced by TNF-�.Neither TNF-� nor HRF influenced EGFP expression of aconstruct under the control of the murine stem cell virus LTR,which lacks an NF-�B-responsive element (Fig. 3C).

In stark contrast to these functional results, we found that atthe molecular level, HRF potently induced NF-�B p50 and p65activation, with fast kinetics. HRF-mediated NF-�B activationin Jurkat cells exhibited an 3-fold-increased amplitude forp50 and p65 relative to PMA-induced NF-�B activity. As ex-pected, the PMA-mediated NF-�B activation exhibited an os-cillating kinetic profile, with an overall increase in NF-�Bactivity 8 h after stimulation (14, 15, 31). In contrast, HRF-induced NF-�B activity showed no oscillating profile andquickly returned to near-baseline levels (Fig. 4A and B). Whilerelative NF-�B p50 and p65 activities were quantified using aconsensus NF-�B oligonucleotide, competition experimentsusing an oligonucleotide representing the HIV-1 NL43 NF-�Bsite demonstrated that active NF-�B would also bind to theNF-�B element in the HIV-1 LTR (Fig. 4E and F).

In a series of independent experiments, we demonstratedthat HRF triggers an I�B activity profile that kinetically differsfrom the profile of classical NF-�B activators, such as PMA

and TNF-� (Fig. 5). Initial I�B reconstitution was generallyachieved faster in TNF-�-stimulated cells than following HRFstimulation. The delay in I�B reconstitution for HRF-stimu-lated cells correlates with the high initial NF-�B activity peakseen in HRF-stimulated cells. Downstream of the 2-h timepoint, the time resolution of our experiments was not highenough to determine the exact phase and amplitude of theoscillation patterns, but it is clear that the I�B oscillation forHRF continued for at least 8 h, but the phase remained shiftedrelative to the TNF-�-induced I�B oscillation pattern. Whilethe I�B expression pattern can explain the initial high NF-�Bpeak seen after HRF stimulation, the data suggest that otherfactors of the I�B/NF-�B module are likely involved to sup-press NF-�B oscillation following HRF stimulation.

Since sustained NF-�B activation is required for efficientgene expression, a lack thereof could explain why cellular pro-moters and Tat-independent HIV-1 LTR activity in NOMIcells were only weakly induced by HRF (Fig. 3B). However,such low-level LTR activity would be sufficient to initiateHIV-1 Tat expression in latently infected cells. As a conse-quence of low-level Tat production, Tat transactivation couldthen promote HIV-1 expression in a self-perpetuating manner.Since Tat has been reported to stimulate NF-�B activity, thisshould also lead to a sustained high NF-�B activity, which wasearlier defined as a prerequisite for efficient HIV-1 reactiva-tion (32). Indeed, the kinetic NF-�B activity profile in latently

FIG. 3. HRF triggers suboptimal functional induction of NF-�B-dependent gene expression. (A) The HIV-1-reactivating kinetics of HRFrelative to those of known HIV-1-reactivating agents that signal through the NF-�B pathway were determined by stimulating CA5 T cells withoptimal concentrations of HRF, PMA, and TNF-� and analyzing HIV-1 reactivation as a function of EGFP expression over a period of 48 h.Reactivation data for all agents are depicted as percentages of EGFP-positive cells. (B) To test the ability of HRF to mediate Tat-independentactivation of the HIV-1 LTR, NOMI cells were stimulated with increasing concentrations of PMA (0.01 to 10 ng/ml), TNF-� (0.003 to 30 ng/ml),and HRF supernatant (0.3 to 100 �l). The level of induction of the stably integrated HIV-1 LTR reporter construct was then measured as theEGFP mean channel fluorescence (MCF) detectable after 24 h, as determined by flow cytometric analysis. Arrows indicate the concentrations atwhich the respective stimuli would have triggered full HIV-1 reactivation in the latently HIV-1-infected CA5 T-cell line. (C) 293T cells weretransfected with several NF-�B-dependent promoter constructs and then stimulated with either TNF-� (10 ng/ml) or HRF (25 �l). Promoterinduction was measured as total EGFP expression. NF-�B, pNF-�B-d2EGFP; LTR, HIV-1 LTR–GFP; IL-8, pIL-8 GFP; TNF, pTNF-GFP;MSCV, murine stem cell virus LTR-driven GFP (no NF-�B-responsive elements).

8716 WOLSCHENDORF ET AL. J. VIROL.

infected CA5 T cells following HRF stimulation was identicalto that seen in the parental Jurkat cells only during the first 4 h.Thereafter, unlike in the parental Jurkat T cells, HRF-inducedNF-�B p50 and p65 activities stabilized at an elevated level inCA5 cells (Fig. 4A to D), which suggests the inception of asecond activating mechanism, such as Tat protein expression.

HRF stimulates NF-�B activity in PBMCs without promot-ing cytokine production. Any previously tested stimulatory ap-proach to reactivate latent HIV-1 infection in PBMCs has beenassociated with the induction of cytokine expression, which is amajor problem because this can lead to a fatal cytokine storm.To represent an advancement over such existing strategies,HRF would have to induce an NF-�B peak in PBMCs withouttriggering high-level cytokine expression. To test this, we ini-

tially determined that HRF stimulation would induce the sameprofile of NF-�B activity in PBMCs as that observed in JurkatT cells. Compared to anti-CD3/CD28 MAb stimulation, a stim-ulus that is commonly used to activate primary T-cell cultures,HRF induced a very high, but short-lived, NF-�B p50 and p65activity peak (Fig. 6A) that was comparable to that seen inJurkat T cells (Fig. 4). The HRF-induced NF-�B peak did notrender PBMCs susceptible to infection with HIV-1 (Fig. 6B,left panel). HRF stimulation also did not significantly increaseHIV-1 replication in PBMCs over a 5-day infection culture,which is consistent with the idea that a short, nonsustainedNF-�B pulse does not alter the course of an ongoing activeinfection (Fig. 6B, right panel).

While HRF stimulation of PBMCs induced NF-�B activity,

FIG. 4. Kinetics of HRF-mediated induction of NF-�B activity. Jurkat T cells or latently HIV-1-infected CA5 T cells were stimulated withoptimal concentrations of PMA or HRF, and cells were harvested at the indicated time points. Nuclear extracts were generated, and NF-�B p50activity (A and C) and NF-�B p65 activity (B and D) were determined for the indicated time points, using a TransAM NF-�B family ELISA kit.To demonstrate specificity and that active NF-�B complexes would also bind to the HIV-1 NF-�B element, we performed cold competitionexperiments, using an NF-�B consensus oligonucleotide (NF-�B), an oligonucleotide representing the HIV-1 NL43 NF-�B element (NL43), anda scrambled oligonucleotide sequence (Scr). Data for NF-�B p50 are depicted in panel E, and those for NF-�B p65 are depicted in panel F.

VOL. 84, 2010 HIV-1 REACTIVATION BY HIT-AND-RUN STIMULATION 8717

HRF did not induce meaningful levels of proinflammatorycytokine protein secretion (IL-2 and TNF-� data are shown inFig. 7A; data for IL-8, IFN-�, IL-4, and IL-6 are not shown).The lack of cytokine protein secretion correlated with thefailure of HRF to induce relevant levels of cytokine-specificmRNAs relative to anti-CD3/CD28 MAb activation (Fig. 7B).The depicted PCRs are representative of three independent

experiments. While we observed some donor variations, forexample, for one donor some induction of IL-2-specific mRNAwas observed at the 6-h time point after HRF stimulation, theoverall levels of TNF-�-, IFN-�-, and IL-2-specific mRNAsinduced by HRF remained at or under the level of detectionwith this PCR strategy. These data are consistent with ourresults for a collection of several promoter constructs (Fig. 3C)

FIG. 5. Altered kinetic I�B regulation following HRF stimulation. (A) Jurkat T cells were stimulated with either TNF-� or HRF and harvestedat the indicated time points. Western blots were performed to determine the kinetics of changes in I�B� expression levels. (B) For the first 2 h,the time resolution was sufficiently high to exactly determine the oscillation of I�B� expression (solid lines). After this time point, changes in I�B�expression for both stimuli were fitted to the determined I�B� expression levels at the 4-h and 6-h time points by assuming similar oscillationamplitudes and frequencies for both stimuli (dotted lines). Anti-tubulin antibodies were used to confirm equal preparation qualities and properloading.

FIG. 6. Effects of HRF stimulation of primary T cells on NF-�B activation and susceptibility to HIV-1 infection. (A) PBMCs were activatedwith optimal concentrations of either PHA-L or HRF. Cells were harvested at the indicated time points. Nuclear extracts were generated, andNF-�B p50 activity and NF-�B p65 activity were determined using a TransAM NF-�B family ELISA kit. (B) PBMCs from four different healthydonors were stimulated with an anti-CD3/CD28 antibody combination and infected with an EGFP reporter virus on day 4 poststimulation. HIV-1replication was monitored in the absence (control) or presence of HRF for 5 days, and the achieved HIV-1 infection levels were determined byflow cytometric analysis of the percentage of EGFP-positive cells. All infections were normalized to the infection level in the untreated culture,and the histogram presents the mean infection level obtained for 4 donor cultures the standard deviation (left panel). PBMCs isolated fromhealthy donors were left unstimulated (C), stimulated with an anti-CD3/CD28 MAb combination, or treated with HRF and infected with an EFGPreporter virus. HIV-1 infection levels were determined as the percentage of EGFP-positive cells on day 2 postinfection (right panel).

8718 WOLSCHENDORF ET AL. J. VIROL.

and suggest that HRF stimulation results in only minimal cel-lular promoter activation.

In conclusion, the presented data open up novel avenues ofhow to improve current attempts to trigger reactivation of thelatent HIV-1 reservoir in patients, with the goal to therapeu-tically eliminate HIV-1. Our findings indicate that controllingthe duration and amplitude of a therapeutically inducedNF-�B activity peak could be used as a tool to attain HIV-1reactivation without induction of cellular genes. This idea is anextension of the concept of an I�B/NF-�B signaling module,which suggests that control of the NF-�B activity profile cangenerate specificity in gene expression (14, 15). In the case ofHRF-mediated HIV-1 reactivation, it also involves spatial andtemporal separation of events governing gene regulation,which is possible by the unique viral feature of self-perpetuat-ing HIV-1 Tat transactivation.

At this time, this concept is of a theoretical nature, as wehave no agents that can serve as leads toward the developmentof therapeutically relevant drugs with HRF-like characteristics.The development of HRF as a therapeutic agent is pending itsmolecular identification. Even then, its protein nature compli-cates drug development, as the humoral immune response willlikely develop neutralizing antibodies to HRF. The importanceof this discovery is that it provides proof of concept that NF-�B-mediated HIV-1 reactivation of latent HIV-1 infection canbe dissociated from NF-�B-mediated activation of cellulargene expression. However, future elucidation of the HRF re-ceptor and signaling pathway may pave the way for the discov-ery of new compound-based therapeutic strategies to purge thelatent HIV-1 reservoir.

ACKNOWLEDGMENTS

This work was funded in part by NIH grants R01AI077457 andR01AI064012 and by a grant from the Bill & Melinda Gates Founda-tion to O.K. Parts of the work were performed in the UAB CFARBSL-3 facilities and by the UAB CFAR Flow Cytometry Core, whichare funded in part by NIH/NIAID grant P30 AI27767.

We thank Julie Decker (University of Alabama at Birmingham) forperforming HIV-1 p24 ELISA analysis.

REFERENCES

1. Choi, C., O. Kutsch, J. Park, T. Zhou, D. W. Seol, and E. N. Benveniste.2002. Tumor necrosis factor-related apoptosis-inducing ligand inducescaspase-dependent interleukin-8 expression and apoptosis in human astro-glioma cells. Mol. Cell. Biol. 22:724–736.

2. Chun, T. W., L. Carruth, D. Finzi, X. Shen, J. A. DiGiuseppe, H. Taylor, M.Hermankova, K. Chadwick, J. Margolick, T. C. Quinn, Y. H. Kuo, R. Brook-meyer, M. A. Zeiger, P. Barditch-Crovo, and R. F. Siliciano. 1997. Quanti-fication of latent tissue reservoirs and total body viral load in HIV-1 infec-tion. Nature 387:183–188.

3. Chun, T. W., R. T. Davey, Jr., M. Ostrowski, J. S. Justement, D. Engel, J. I.Mullins, and A. S. Fauci. 2000. Relationship between pre-existing viralreservoirs and the re-emergence of plasma viremia after discontinuation ofhighly active anti-retroviral therapy. Nat. Med. 6:757–761.

4. Chun, T. W., D. Engel, M. M. Berrey, T. Shea, L. Corey, and A. S. Fauci.1998. Early establishment of a pool of latently infected, resting CD4(�) Tcells during primary HIV-1 infection. Proc. Natl. Acad. Sci. U. S. A. 95:8869–8873.

5. Chun, T. W., D. Engel, S. B. Mizell, L. A. Ehler, and A. S. Fauci. 1998.Induction of HIV-1 replication in latently infected CD4� T cells using acombination of cytokines. J. Exp. Med. 188:83–91.

6. Chun, T. W., D. Engel, S. B. Mizell, C. W. Hallahan, M. Fischette, S. Park,R. T. Davey, Jr., M. Dybul, J. A. Kovacs, J. A. Metcalf, J. M. Mican, M. M.Berrey, L. Corey, H. C. Lane, and A. S. Fauci. 1999. Effect of interleukin-2on the pool of latently infected, resting CD4� T cells in HIV-1-infectedpatients receiving highly active anti-retroviral therapy. Nat. Med. 5:651–655.

7. Chun, T. W., and A. S. Fauci. 1999. Latent reservoirs of HIV: obstacles to theeradication of virus. Proc. Natl. Acad. Sci. U. S. A. 96:10958–10961.

8. Chun, T. W., D. Finzi, J. Margolick, K. Chadwick, D. Schwartz, and R. F.Siliciano. 1995. In vivo fate of HIV-1-infected T cells: quantitative analysis ofthe transition to stable latency. Nat. Med. 1:1284–1290.

9. Chun, T. W., L. Stuyver, S. B. Mizell, L. A. Ehler, J. A. Mican, M. Baseler,A. L. Lloyd, M. A. Nowak, and A. S. Fauci. 1997. Presence of an inducibleHIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl.Acad. Sci. U. S. A. 94:13193–13197.

10. Duverger, A., J. Jones, J. May, F. Bibollet-Ruche, F. A. Wagner, R. Q. Cron,and O. Kutsch. 2009. Determinants of the establishment of human immu-nodeficiency virus type 1 latency. J. Virol. 83:3078–3093.

11. Gallego, V., C. Sanchez-Porro, M. T. Garcia, and A. Ventosa. 2006. Massiliaaurea sp. nov., isolated from drinking water. Int. J. Syst. Evol. Microbiol.56:2449–2453.

12. Han, Y., K. Lassen, D. Monie, A. R. Sedaghat, S. Shimoji, X. Liu, T. C.Pierson, J. B. Margolick, R. F. Siliciano, and J. D. Siliciano. 2004. RestingCD4� T cells from human immunodeficiency virus type 1 (HIV-1)-infectedindividuals carry integrated HIV-1 genomes within actively transcribed hostgenes. J. Virol. 78:6122–6133.

13. Han, Y., Y. B. Lin, W. An, J. Xu, H. C. Yang, K. O’Connell, D. Dordai, J. D.Boeke, J. D. Siliciano, and R. F. Siliciano. 2008. Orientation-dependentregulation of integrated HIV-1 expression by host gene transcriptionalreadthrough. Cell Host Microbe 4:134–146.

14. Hoffmann, A., and D. Baltimore. 2006. Circuitry of nuclear factor kappaBsignaling. Immunol. Rev. 210:171–186.

15. Hoffmann, A., A. Levchenko, M. L. Scott, and D. Baltimore. 2002. The

FIG. 7. Effects of HRF stimulation on cytokine expression in PBMCs. (A) PBMCs from four different healthy donors were left unstimulated(C), stimulated with an anti-CD3/CD28 MAb combination as a positive control, or stimulated with a concentration of HRF that would triggermaximum HIV-1 reactivation in CA5 T cells. Culture supernatants were collected after 24 h, and the concentrations of a panel of cytokines weredetermined by BioPlex analysis. Concentrations of the proinflammatory cytokines TNF-� and IL-2 are presented for four individual donors. (B) Totest whether the lack of cytokine production at the protein level was correlated with low-level mRNA transcription, PBMCs that were stimulatedwith either an anti-CD3/CD28 MAb combination or HRF were harvested at the indicated time points. mRNAs were isolated and used to generatecDNAs. Specific primer pairs for IL-2 and TNF-� were used to demonstrate the presence or absence of cytokine-specific mRNA at the indicatedtime points. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were used to control for cDNA quality. The depicted PCRs arerepresentative of three independent experiments using PBMCs from three different healthy donors.

VOL. 84, 2010 HIV-1 REACTIVATION BY HIT-AND-RUN STIMULATION 8719

IkappaB-NF-kappaB signaling module: temporal control and selective geneactivation. Science 298:1241–1245.

16. Jones, J., J. Rodgers, M. Heil, J. May, L. White, J. A. Maddry, T. M. FletcherIII, G. M. Shaw, J. L. T. Hartman, and O. Kutsch. 2007. High throughputdrug screening for human immunodeficiency virus type 1 reactivating com-pounds. Assay Drug Dev. Technol. 5:181–189.

17. Jones, J., W. Whitford, F. Wagner, and O. Kutsch. 2007. Optimization ofHIV-1 infectivity assays. Biotechniques 43:589–594.

18. Kulkosky, J., G. Nunnari, M. Otero, S. Calarota, G. Dornadula, H. Zhang,A. Malin, J. Sullivan, Y. Xu, J. DeSimone, T. Babinchak, J. Stern, W. Cavert,A. Haase, and R. J. Pomerantz. 2002. Intensification and stimulation therapyfor human immunodeficiency virus type 1 reservoirs in infected personsreceiving virally suppressive highly active antiretroviral therapy. J. Infect.Dis. 186:1403–1411.

19. Kutsch, O., E. N. Benveniste, G. M. Shaw, and D. N. Levy. 2002. Direct andquantitative single-cell analysis of human immunodeficiency virus type 1reactivation from latency. J. Virol. 76:8776–8786.

20. La Scola, B., R. J. Birtles, M. N. Mallet, and D. Raoult. 1998. Massiliatimonae gen. nov., sp. nov., isolated from blood of an immunocompromisedpatient with cerebellar lesions. J. Clin. Microbiol. 36:2847–2852.

21. Lehrman, G., I. B. Hogue, S. Palmer, C. Jennings, C. A. Spina, A. Wiegand,A. L. Landay, R. W. Coombs, D. D. Richman, J. W. Mellors, J. M. Coffin,R. J. Bosch, and D. M. Margolis. 2005. Depletion of latent HIV-1 infectionin vivo: a proof-of-concept study. Lancet 366:549–555.

22. Lenasi, T., X. Contreras, and B. M. Peterlin. 2008. Transcriptional interfer-ence antagonizes proviral gene expression to promote HIV latency. CellHost Microbe 4:123–133.

23. Levy, D. N., G. M. Aldrovandi, O. Kutsch, and G. M. Shaw. 2004. Dynamicsof HIV-1 recombination in its natural target cells. Proc. Nat. Acad. Sci.U. S. A. 101:4204–4209.

24. Lindquist, D., D. Murrill, W. P. Burran, G. Winans, J. M. Janda, and W.Probert. 2003. Characteristics of Massilia timonae and Massilia timonae-likeisolates from human patients, with an emended description of the species.J. Clin. Microbiol. 41:192–196.

25. Ochsenbauer-Jambor, C., J. Jones, M. Heil, K. P. Zammit, and O. Kutsch.2006. T-cell line for HIV drug screening using EGFP as a quantitativemarker of HIV-1 replication. Biotechniques 40:91–100.

26. Siliciano, J. D., J. Kajdas, D. Finzi, T. C. Quinn, K. Chadwick, J. B. Mar-golick, C. Kovacs, S. J. Gange, and R. F. Siliciano. 2003. Long-term fol-low-up studies confirm the stability of the latent reservoir for HIV-1 inresting CD4� T cells. Nat. Med. 9:727–728.

27. Siliciano, J. M., and R. F. Siliciano. 2005. Targeting HIV reservoirs withvalproic acid. Hopkins HIV Rep. 17:8–9.

28. Smith, S. M. 2005. Valproic acid and HIV-1 latency: beyond the sound bite.Retrovirology 2:56.

29. Weon, H. Y., B. Y. Kim, J. A. Son, H. B. Jang, S. K. Hong, S. J. Go, and S. W.Kwon. 2008. Massilia aerilata sp. nov., isolated from an air sample. Int. J.Syst. Evol. Microbiol. 58:1422–1425.

30. Weon, H. Y., S. H. Yoo, S. J. Kim, Y. S. Kim, R. Anandham, and S. W. Kwon.25 September 2009, posting date. Massilia jejuensis sp. nov. and Naxibactersuwonensis sp. nov., isolated from air samples. Int. J. Syst. Evol. Microbiol.[Epub ahead of print.] doi:10.1099/ijs.0.015479-0.

31. Werner, S. L., J. D. Kearns, V. Zadorozhnaya, C. Lynch, E. O’Dea, M. P.Boldin, A. Ma, D. Baltimore, and A. Hoffmann. 2008. Encoding NF-kappaBtemporal control in response to TNF: distinct roles for the negative regula-tors IkappaBalpha and A20. Genes Dev. 22:2093–2101.

32. Williams, S. A., H. Kwon, L. F. Chen, and W. C. Greene. 2007. Sustainedinduction of NF-kappa B is required for efficient expression of latent humanimmunodeficiency virus type 1. J. Virol. 81:6043–6056.

8720 WOLSCHENDORF ET AL. J. VIROL.