Higher expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR/SF2) during follicular...

MOLECULAR REPRODUCTION AND DEVELOPMENT 75:429–438 (2008)

Higher Expression of Hyaluronan BindingProtein 1 (HABP1/p32/gC1qR/SF2) DuringFollicular Development and CumulusOocyte Complex Maturation in RatSONU CHAND THAKUR AND KASTURI DATTA*

Biochemistry Laboratory, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, India

ABSTRACT Ovulation is a complex process ofreleasing a fertilizable oocyte and depends on theproper formation of an extracellular hyaluronan richmatrix by the cumulus oocyte complex (COC). Theformation of a HA rich matrix is dependent on thesynthesis and organization of HA in the presence ofseveral biomolecules that mediate its crosslinking. Togain an insight into the follicular maturation and COCexpansion, we have studied the expression of hyalur-onan binding protein 1 (HABP1), which is knownto interact specifically with hyaluronan. The level ofHABP1 increased markedly during ovulation aftergonadotropin stimulation, and the overexpressionwas seen in mural granulosa cells, expanding cumuluscells and follicular fluid. However, HABP1 could not bedetected in the luteal cells of corpus luteum afterovulation. Such increased expression of HABP1 wasobserved both during in vivo and in vitro conditions ofCOC expansion. The level of HABP1 transcript wasupregulated up to fivefold after COC expansion ascompared to compact COC. Immunofluorescenceanalysis showed HABP1 to be localized in thecytoplasm and extracellular matrix, suggesting itsrole in ECM organization. The cultured expandedCOC treated with hyaluronidase for different timeperiods showed the gradual dispersion of COC, whichcoincide with the loss of HABP1 from the matrixsuggesting that HABP1 is bound to hyaluronan. Theseresults indicate that HABP1 expressed in rat COCsduring maturation may facilitate the formation of theHA matrix in the extracellular space around the oocytewith cumulus expansion during maturation. Mol.Reprod. Dev. 75: 429–438, 2008.� 2007 Wiley-Liss, Inc.

Key Words: HABP1; p32; follicles; granulosa cells;cumulus oocyte complex; follicular fluid

INTRODUCTION

In most mammals, oocytes in fully grown follicles aretightly surrounded by compact layers of specializedgranulosa cells called cumulus cells that form thecumulus oocyte complex (COC). Upon ovulatory stimu-

lation, the compact organization of the COC expandswith the production of a mucoelastic extracellularmatrix (ECM) that surrounds the cumulus cells. Thisprocess, referred to as expansion or mucification,requires synthesis of hyaluronan (HA) by cumulus cells(Yudin et al., 1988; Salustri et al., 1989; Chen et al.,1990). The amount of HA synthesized is closelycorrelated with the degree of cumulus expansion. Thesecreted HA interacts with specific matrix componentsthereby forming a network of highly hydrated andviscoelastic matrices in the extracellular space, whichresults in an �20 fold increase in volume of the COC(Chen et al., 1992, 1994; Camaioni et al., 1993).Expansion of the COC facilitates the detachment ofthe COC from the follicle wall, its extrusion at ovulation(Chen et al., 1993; Hess et al., 1999; Tsafriri, 1995), itscapture by oviductal fimbria (Larsen et al., 1996) andfinally its fertilization. The preovulatory LH surgetriggers the cumulus expansion of preovulatory folliclesin vivo, while cumulus cells can undergo expansion inresponse to FSH in vitro (Epigg, 1979). Serum andfollicular fluid contain some factors that stimulate thesynthesis ofHAandalso stabilize the organization ofHArich matrix of the cumulus extracellular matrix (Epigg,1980; Yoshida et al., 1992; Daen et al., 1994). Severalhyaluronanbinding proteins are crucial for expansion ofthe COC and for HA organization in the ECM. HAsynthesis by cumulus cells is regulated by the enzymehyaluronan synthase at the transcriptional level, andthe HA synthesized is secreted into the ECM. Unlikeother glycosaminoglycan, HA is neither sulfated norlinked to a core protein. Hence, HA needs bindingproteins, referred to as hyaladherins, an important

� 2007 WILEY-LISS, INC.

Sonu Chand Thakur’s present address is Centre for InterdisciplinaryResearch in Basic Sciences, Jamia Millia Islamia, Jamia Nagar,New Delhi 110025, India.

*Correspondence to: Kasturi Datta, Biochemistry Laboratory, Schoolof Environmental Sciences, Jawaharlal Nehru University, New Delhi110067, India. E-mail: [email protected]

Received 28 December 2006; Accepted 17 April 2007Published online 11 June 2007 in Wiley InterScience(www.interscience.wiley.com).DOI 10.1002/mrd.20775

subset of proteins, which share homologous sequencesfor HA binding, to form the extracellular HA-richmatrices (Lauret and Fraser, 1992).

Another critical component of thismatrix is the serumderived factor inter-a-trypsin inhibitor (IaI), which bycovalent cross-linking of its heavy chains to HA func-tions to stabilize the cumulus cell matrix (Chen et al.,1992, 1994). Several studies have shown that thisextracellular matrix is crucial for female fertility.TNF-a-stimulated gene 6 (TSG-6), another hyaladherinthat is involved in the expansion process has beendetected in the cumulus matrix, both as a free proteinand covalently complexed with inter-a-trypsin inhibitor(IaI). Deletion of the TSG-6 gene in mice leads toimpaired cumulus mucification and female sterility(Fulop et al., 2003). Pentaxin-3, a multimeric proteinimplicated in COC expansion, forms complexes withTNF-alpha-induced protein 6 (TNFIP-6), which act asfoci for the attachment of multiple HA chains thatstrengthens the expanding ECM (Varani et al., 2002;Salustri et al., 2004). Thus a concept has been generatedthat HA is associated with the ECM proteins thatinteract with it thereby allowing COCs to expand andregulate oocyte ovulation.

For the last few years, we have studied a novelhyaluronan binding protein 1 (HABP1) that interactsspecifically with hyaluronan and facilitates some of theHA mediated processes including cell adhesion (Guptaand Datta, 1991), and its role in fertilization (Ranga-nathan et al., 1994), stage specific expression duringspermatogenesis (Bharadwaj et al., 2002) and in finallysperm oocyte interaction (Ghosh and Datta, 2002) wasreported earlier. Sequence analysis of cDNA encodingHABP1 (Deb and Datta, 1996) revealed its multifunc-tional nature, as it is identical with p32, a protein co-purified with splicing factor SF2 (Krainer et al., 1991)and is a synonym of gC1qR, receptor for globular headcomponent factor C1q (Ghebrehiwet et al., 1994). Itslocalization is confirmed onhuman chromosome17p12–13 (Majumdar andDatta, 1998). A unique characteristicof the gene encodingHABP1 is that it is synthesized as aproprotein of 282 amino acids, which is processed byproteolytic cleavage of the first 73 amino acids contain-ing the mitochondria signal to generate its mature form(Honore et al., 1993). Another interesting feature of thisprotein is its diverse localization in different cell typesunder different physiological conditions in differentcellular compartments including mitochondria andnucleus. It is also on cell surfaces and secreted into theextracellular matrix. Further the role of HABP1 incellular signaling is postulated as its phosphorylatedform is reported to be a MAP kinase substrate(Majumdar et al., 2002). Though several other hyalad-herins participate during COC expansion, nothing isknown regarding HABP1.

Therefore in the present study, to gain an insight intothe role of HABP1 during follicle development and COCmaturation, we examined the expression of HABP1 inmaturing ovaries and in expanded COCs during in vivoand in vitro conditions.

MATERIALS AND METHODS

Chemicals

Pregnant mare serum gonadotropin (PMSG), humanchorionic gonadotropin (hCG), follicle stimulating hor-mone (FSH), luteinizing hormone (LH), anti-rabbit cy3conjugate secondary antibody, alkaline phosphataseconjugated secondary antibody, Hoechst 33342, med-ium-199, mineral oil were purchased from Sigma-Aldrich Co., St. Louis. Anti-actin polyclonal antibodywas purchased from Santa Cruz Biotechnology (SantaCruz, CA).

Purification of HABP1 andGeneration of Antibodies

HABP1 was purified to homogeneity using an ionexchange column coupled to a Pharmacia FPLCTM

system as reported earlier (Jha et al., 2002). Polyclonalanti-rHABPl antibodieswere raised against the purifiedrecombinant HABP1 (rHABPl) in rabbit as described byDeb and Datta (1996).

Animals

Immature 22–24-day-old female Wistar rats were ip-injected with 15 IU PMSG in 0.1 ml physiological salineand 48 hr later, were either killed or injected with 15 IUHCG to induce ovulation. The animals were killed inaccordance with the protocol approved by the Institu-tional Animal Ethics Committee.

Isolation of Expanded COCs andMural Granulosa Cells

For in vivo studies, PMSG-primed rats were injectedwith HCG and after 16 hr of HCG stimulation, theexcised ampullae of the oviduct were collected in PBS.Expanded (Matured) COCs were released by gentlysqueezing the ampullae. The COCs were then aspiratedwith a capillary under a binocular microscope and werewashed three times in freshly filtered PBS.

To obtain mural granulosa cells, after follicle punc-ture, COCs were removed and the remaining granulosacells were harvested by further repeated puncture of thefollicles. Granulosa cells were centrifuged at 300g for10 min and cells were collected (Russell et al., 2003).

In Vitro Maturation of COCs

For in vitro studies, ovaries were isolated from rats,48 hr after PMSG injection, and placed in medium199,withEarle’s salt and L-glutamine and containing 2.2mg/ml sodium bicarbonate, 0.1 mg/ml sodium pyruvate, 25mM HEPES, 1% BSA, 100 IU/ml penicillin and 100 mg/ml streptomycin. Compact COCs were immediatelyreleased by puncturing large ovarian follicles with a26-gauge needle. Groups of 20COCswere transferred toa 20 ml drop of basal culturemedium supplementedwithor without FSH (10 mg/ml), LH (100 ng) and 10% FBS.The drops were covered with mineral oil to preventevaporation. The cultures were incubated at 378C with5% CO2 in humidified air for the times specified in thetext. To ascertain whether HABP1 exists in association

Molecular Reproduction and Development. DOI 10.1002/mrd

430 S.C. THAKUR AND K. DATTA

withhyaluronic acid, the cellswere treatedwith70U/mlhyaluronidase (Streptomyces) for 15 min at roomtemperature. The digested cells were centrifuged at300g for 5 min to separate the matrix extract from thecell pellet. Reducing Laemmli buffer was then added tothe supernatant and boiled for 4 min.

Isolation of Follicular Fluid

Follicular fluid was isolated as described elsewhere(Tempel et al., 2000). Twelve hours after HCG stimula-tion, rat ovaries were excised and punctured in serumfreemedium.Themediumwas collected and centrifugedfor 5 min (1,000 rpm), and the supernatant wascollected.

Immunohistochemistry

For immunohistochemical study, the organs werefixed in 4% (w/v) paraformaldehyde in 0.1 M PBS. Afterpassing through a series of graded alcohol and xylenesolutions, the tissues were embedded in paraffin bystandard procedures. Five micrometer thick sectionswere taken on glass slides for immunostaining. Thesections of rat ovary were deparaffinised, rehydratedand blocked with 3% (w/v) BSA in Tris buffered saline(TBS, 0.05 M Tris–Cl, pH 7.6; 0.15 M NaCl). Afterwashing with 0.05% Tween-20 supplemented TBS(TBST), the sections were incubated with polyclonalanti-rHABPl antibody (1:200). After incubation withgoat anti-rabbit IgG conjugated to AP (1:500), FastRedTM substrate (DAKO, Carpinteria, CA) was used todevelop color according to the manufacturer’s protocol.The counter-stainingwas doneusinghaematoxylin, andsections were mounted in glycerol.

Lysate Preparation

For immunodetection, lysates of ovaries were pre-paredbyhomogenization, followedby immediate boilingin Laemmli buffer for 15 min (31), containing Tris–glycerol with 5% b-mercaptoethanol, 2% SDS and100 mM PMSF (phenyl methyl sulfonyl fluoride).Subsequently, the ovarian lysates were centrifuged at14,000 rpm for 15 min at room temperature, and thesupernatants containing the total protein were used.The protein contents of the preparations were deter-mined by the method of Bradford (1976) using BSA asthe standard.

SDS-PAGE and Western Blot Analysis

Ovarian and COC proteins were resolved by SDS-PAGE on 12.5% gels under denaturing conditions (31).Resolved proteins were electroblotted onto a nitrocellu-lose membrane, and the membranes were blocked for1 hr in Tris buffered saline (TBS) with 3% BSA andincubated for 1 hr with a 1:500 dilution of polyclonalanti-rHABP1 antibody (1: 5,000). After incubation withgoat anti-rabbit IgG conjugated to alkaline phosphatase(AP), the immunoreactive bands were detected withnitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phos-phate (NBT/BCIP, USB, Cleveland, OH) system. In all

experiments, some strips were incubated with non-immune rabbit IgG as a negative control.

Semi-Quantitative RT-PCR

TotalRNAwas isolated from the compact and expand-edCOCsof animalsusingTRIZOLreagent (LifeTechno-logies, Scottland, UK) according to the manufacturer’sprotocol (Chomczynski and Sacchi, 1987). Single stepRT-PCR was carried out using 2 mg of total RNA fromdifferent tissues with the rTth enzyme (PE AppliedBiosystems, Branchburg, NJ), utilizing Genþ forwardHABP1 primer (50 GAAGGCCCTTGTGTTGGACT-GTCA 30) and Gen-reverse HABP1 primer (50 GGTAT-CAAAGTACCGTCCGAAACC 30), designed from theexons of HABP1 gene. The amplification was carriedout for 30 cycles to ensure linear amplification. Usingthe same reaction mixture, b-actin amplification wasused as internal control. RT-PCR for ß-actin was doneusing the following primers—forward primer: 50 CGAGCACGGCATCGTCACCAA 30 and reverse primer: 50

GTG GAT GCC ACA GGA CTC CAT 30.

Immunofluorescence Staining

At the end of cultivation or treatment, the COCs werefixed with 2% (w/v) paraformaldehyde-PBS (pH 7.4) atroom temperature for 20 min and then washed threetimes with PBS. The specimens were permeabilized in0.25% (v/v) Tween-20 in PBS–BSA for 1 min, and theexcess detergent was washed off with PBS. The fixedcells were preincubated in 1% BSA–PBS and thenincubated with rabbit anti-HABP1 antibody (1:500dilution) for 1 hr at room temperature. After theincubation period, the cells were rinsed three times overa period of 30 min and incubated for 1 hr with Cy3-conjugated goat anti-rabbit IgG (1:250 dilution). Thecells were washed thrice and mounted in PBS-glycerol.The antibodies were diluted in 1% BSA-PBS. Cells wereco-incubated with the secondary antibody and Hoechstfor 1 hr. Control experiment was carried out with anidentical procedure, replacing the primary antibodywith a pre-immune serum.

RESULTS

HABP1 Expression Profile in the Rat OvaryDuring Gonadotropin-Induced Ovulation

To compare the HABP1 expression in immature,mature and ovulating follicle in the rat ovary, we havedone immunodetection of HABP1 in the extracts fromovaries of adult cyclic rats, 24-day-old immature ratsand PMSG treated HCG stimulated ovaries after 4, 8,12, and 24 hr. It was observed that the HABP1expression gradually increasedwith the folliclematura-tion and was highest during ovulation i.e. 12 hr oftreatment and again decreased after ovulation. Equalloading of protein present in different lysates wasascertainedby immunoblottingwithanti-actin antibody(Fig. 1A).

Since HABP1 is upregulated during ovulation, weexamined immunohistochemically, the distribution and


HABP1 UPREGULATION DURING COC MATURATION 431

localization of HABP1, in correlation with maturation(COC expansion) offollicles isolated from gonadotropinstimulated ovaries. The follicles of immature rat ovarieswere induced to develop into large preovulatory (Graf-fian) follicles by 48 hr after the administration of PMSGtreatment. Subsequent treatment with HCG bringsabout a synchronized ovulation of many follicles thatpeaks around 12 hr after the administration of HCG. Atdifferent time points following the hormone treatments,sections of ovaries were immunostained and assessedfor the presence of HABP1. The relative intensity ofHABP1 staining in rat ovaries as a function of time is

shown in Fig. 1B. Before PMSG and HCG treatment,there was no detectable HABP1 signal in immaturefollicles. However, diffused HABP1 staining was foundin most of the oocytes in immature follicle of ovariesbefore PMSG treatment. Thecal cells and the granulosacells of immature follicles were completely devoid ofHABP1 expression. Four hours after the HCG treat-ment, a very slight staining for HABP1 was observed inthe surrounding cumulus cells. Eight hours after HCGinjection, HABP1 antigenicity was observed in theextracellular matrix of the cumulus cells surroundingthe oocyte and in the mural granulosa cells adjacent to


Fig. 1. Evidence for increased HABP1 expression during folliclematuration. A: Immunodetection of HABP1 in the ovary of 24-day-old(lane 1), PMSG-HCG stimulated ovary after 8 hr (lane 2), 12 hr (lane3), 24hr (lane4), adult rat ovary (lane5), Purified rHABP1 is in lane6.The equal amount of protein in the lysates is confirmed by immuno-blotting with anti-actin antibody. B: Immunostaining in gonadotropinstimulated ovary.A: 24-day-old ovary (magnification, 200�), (B) PMSG

þHCGstimulated rat ovary after 4h, (C) 8 hr, (D) 12 hr (magnification,100�), (E) magnified COC after 12 hr (magnification, 400�), (F) 24 hr(corpus luteum) (magnification, 200�). Corresponding section werestained using normal rabbit serum control are (G), (H), (I), (J), (K), and(L). C: Immunodetection of HABP1 by western blot in granulosa cells(lane 1) and follicular fluid (lane 2) of PMSGandHCG treated rat ovaryafter 12 hr. [See color version online at www.interscience.wiley.com.]


the antrum. Close to ovulation time, i.e. 12 hr afterHCGtreatment, the majority of HCG stimulated rat follicleswere expanding mature follicles, and a strong HABP1signal was observed. Intense staining of HABP1 wasobserved in mural granulosa cells and in expandingcumulus cells surrounding the oocytes.Most of the thecacells surrounding preovulatory follicles also showedHABP1 staining. Intense staining was also seen infollicular fluid in the antrum of mature follicles thatwere morphologically at a stage of COC expansion.HABP1 expression was seen in the cytoplasm andextracellular matrix of the expanded cumulus cells.Twenty-four hours after HCG treatment, the ovarieswere filledwith corpora lutea in their developing stages.The luteal cells in the corpus luteum were completelydevoid of HABP1.The intensity of immunostaining for HABP1 increas-

ed in granulosa cells as the follicle became larger andmatured. Distinct specific staining was detected in theexpanded cumulus cells and also in the follicular fluid ofthese preovulatory follicles. The strongest staining wasdetected in ovaries after HCG stimulation (8–12 hr). Inthese ovaries HABP1 was localized predominantly inthe antrum of ovulating follicles. Staining was clearlyseen in the cytoplasm and expanded matrix betweencumulus cells. However, no immunostaining wasobserved in corpus luteum of ovaries 24 hr after HCGtreatment. These findings clearly indicate that HABP1level increased during follicle maturation.

Confirmation of HABP1 in the Mural GranulosaCells and Follicular Fluid After

Gonadotropin Stimulation

To confirm the expression of HABP1 in muralgranulosa cells and follicular fluid as shown by immu-nohistochemistry, we isolated granulosa cells andfollicular fluid from the ovaries treated with PMSGfollowed by HCG treatment after 12 hr. Western blotanalysis (Fig. 1C) of protein extracted from muralgranulosa cells and follicular fluid was done usinganti-HABP1 antibody. A 34 kDa band was clearlydetectable in the lysates of both granulosa cells andfollicular fluid.

Increase in HABP1 Levels DuringIn Vivo COCs Expansion

To examine the protein expression profile of HABP1corresponding to COC expansion in vivo condition,compact and expanded COCs were isolated from PMSGtreated ovary after 48 hr and with PMSG followed byHCG for 16 hr from oviducts soon after ovulation. Equalloading of protein in different lysates was confirmed byimmunoblot analysis with anti-actin antibody (Fig. 2A).A fivefold increase in the level of HABP1 was immuno-detected in expanded COCs as compared to compactCOCs, indicating that HABP1 expression may beupregulated during COC maturation.Upregulation of HABP1 during COC maturation

prompted us to investigate the localization pattern of

HABP1 during COC expansion. The localization ofHABP1 in unexpanded and expanded COCs wasdetermined by indirect immunofluorescence usingCy3-conjugated goat anti-rabbit antibody as secondaryantibody (Fig. 2B). It was seen that HABP1 is mainlylocalized in the cytoplasm and extracellular matrixof expanded cumulus cells. Much lower intensity offluorescencewas seen inunexpandedCOCs.No stainingwas detected in the oocytes.

Upregulation of HABP1 mRNA ExpressionDuring In Vivo COCs Expansion

The enhanced expression of HABP1 during COCexpansion as evident by immunoblot and Immunofluor-escene, prompted us to look for HABP1 at the transcriptlevel during COC maturation. Semi-quantitative RT-PCR was done. Total RNA was isolated from compactand expanded COCs and was subjected to cDNAsynthesis. cDNA concentrations were normalized byamplification of a 610 bp b-actin fragment using genespecific actin primers. A restraint amplification of afragment of 327 bp using HABP1 gene specific primersgenþandgen�wasdone by limiting the amplification toonly 30 cycles. Densitometry analysis showed a fivefoldincrease inHABP1 transcript level afterCOCexpansionas compared to unexpanded COC, thus further confirm-ing transcriptional upregulation of HABP1 during COCexpansion (Fig. 2C). These results are a clear indicationof an increase in the HABP1 transcript level after COCsexpansion, suggesting that HABP1 is synthesizedduring the COC expansion.

Correlation of In Vitro COC ExpansionWith HABP1 Upregulation

To further investigate the expression ofHABP1 in theCOCs during in vitro maturation, compact COCs wereisolated after 48 hr of PMSG treatment and incubated inmediumcontainingFSH-LHandserum for 0–36hr, andthe level of HABP1 was determined by immunoblot.Equal loading was confirmed by immunoblot analysisusing anti-actin antibody. The blot revealed a gradualincrease in HABP1 expression in expanding COCs from0 to 24 hr (Fig. 3A(i)).

Fig. 3A(ii) reveals that FSH-LH caused a significantincrease in cumulus cell HABP1 production. Thesestimulatory effects were seen after as little as 6 hr andwere prominent after 24 hr of incubation. This resultdemonstrates that there is an increased deposition ofHABP1 in gonadotropin stimulated cells as compared tocontrol (without the addition of FSH-LH).

In an in vitro culture system in which COCs werecultured in the presence of FSH-LH and serum,immunocytochemistry revealed that the addition ofFSH-LH enhanced HABP1 expression in expandedcumulus cells as observed earlier during in vivoexpansion. These results demonstrate that FSH-LHstimulated cells increased the deposition of HABP1 intothe extracellular matrix as compared with that of thecontrol without the addition of FSH-LH and serum(Fig. 3B).



Increase in Transcript Levels of HABPl DuringIn Vitro COCs Expansion

We confirmed the increased expression of mRNA ofHABP1 in COCs using RT-PCR (Fig. 3C). The level ofHABP1 transcript increased by five times in expandedCOCs after 24 hr of culture in the presence ofgonadotropin and serum compared with medium alone,indicating that HABP1 transcription has a positivedependency on FSH-LH and serum.

Release of HABP1 From COC byHyaluronidase Treatment

To study whether HABP1 exists in association withHA, the cultured expanded COC were treated with

hyaluronidase for 15 min and subsequently thematrix was isolated. As shown in Figure 4A, HABP1could not be detected in the matrix of hyaluronidasetreated expanded COC, however its present in theuntreated expanded COC. In order to further analyze,we treated expanded COC for 5, 10 and 15 min withhyaluronidase anddetectedHABP1 in the cumulus cells(Fig. 4B). As expected we could detect significant levelof HABP1 in expanded COC. However after 5 min ofhyaluronidase treatmentHABP1was lost and initiationof cumulus cell dispersion was evident. A completedispersion of cumulus was achieved by hyaluronidasetreatment for 10 and 15min, which was associated withloss of HABP1 from matrix ascertaining that HABP1exists in association with HA.


Fig. 2. A: Immunodetection of HABP1 during in vivo COCsexpansion. The extracts of compact COCs (lane 1) and expandedCOCs(lane 2). Purified rHABP1 is in lane 3. The equal amount of protein indifferent lysates is confirmed by immunoblot analysis with anti-actinantibody.B: Immunofluorescence localization ofHABP1 during in vivoCOCs expansion. Compact COCs were isolated 48h after PMSGtreatment from ovary: (I) The immunolocalization of HABP1 (red).(II) The nucleus stained with Hoechst (blue). (III) Merged image of Iand II. ExpandedCOCswere isolated from oviduct after 16 hr of PMSGand HCG stimulation: (IV) The immunolocalization of HABP1 (red).

(V) The nucleus stained with Hoechst (blue). (VI) Merged image of IVandV (magnification, 400�).C: EnhancedmRNAexpression ofHABP1during in vivo COCs expansion. RT-PCR analysis with equal amount oftotal RNA using HABP1 specific primers genþ and gen� from compactCOCs (lane 2) and expanded COCs (lane 3). b-Actin mRNA expressionof compact COCs (lane 4) expanded COCs (lane 5) served as itsinternal control for the integrity and quantity of RNA used. Lane 1shows the 1 kb DNA ladder. [See color version online at www.interscience.wiley.com.]


DISCUSSION

The present study reports the upregulation of hyalur-onanbindingprotein (HABP1) during follicularmatura-tion and COC expansion. We have immunodetectedincreased level of HABP1 in the gonadotropin-stimu-lated rat ovary. More precisely, HABP1 level wasdetected in the cumulus and granulosa cells after 4 hrof HCG injection, which increased linearly with time inthe follicular fluid, granulosa and cumulus cells andattained the maximum level after 12 hr of HCGinjection, which coincides with COC expansion andovulation. After 24 hr of HCG injection, when ovulation

had taken place and corpus luteum is formed, theHABP1 level came down to the basal level in the lutealcells.

Further experiments demonstrated the similar pat-tern of upregulation of HABP1 expression during COCexpansion, when cultured in the presence of serum andFSH-LH. Increased HABP1 expression was observed,which was localized in the cytoplasm and extracellularmatrix of cumulus cells. These data were furtherconfirmed with RT-PCR indicating higher transcriptlevels in the expanded COCs, obtained from both in vivoand in vitro conditions. AsHA organization during COCexpansion is crucial for ovulation, our observation on the


Fig. 3. A(i): Immunodetection of HABP1 during in vitro COCsexpansion. Rat compact COCs were incubated for 0 hr (lane 2), 6 hr(lane 3), 12 hr (lane 4), 18 hr (lane 5), 24 hr (lane 6), 30 hr (lane7) and36 hr (lane 8) in the presence of serum supplemented with FSH-LH.Purified rHABP1 is in lane 1. Equal amount of protein in differentlysates is confirmed by immunoblot analysis with anti-actin antibody.A(ii): Graphical representation of the densitometry analysis of theband intensity clearly shows a gradual increase in HABP1 level from 0to 24 hr.B: Immunofluorescence localization of HABP1 during in vitroCOCs expansion. Compact COCs were cultured with medium contain-ing serum and FSH-LH for 24h: (I) The immunolocalization of HABP1(red). (II) The nucleus stained with Hoechst (blue). (III) Merged image

of I and II. Compact COCs were cultured without FSH-LH and serumfor 24h: (IV) The immunolocalization of HABP1 (red). (V) The nucleusstained with Hoescht (blue). (VI) Merged image of IV and V(magnification, 400�). C: Increased HABP1 transcript level duringin vitro COCs expansion. Semi-quantitative RT-PCR analysis of COCsRNA isolated from COCs that were incubated for 24 hr with mediumcontaining FSH-LH and serum (lane 5) and medium without FSH-LHand serum (lane 4) using HABP1 gene specific primers. b-Actin mRNAexpression ofCOCs incubated in thepresence (lane3) or absenceofFSHand serum (lane 2). Lane 1 shows the 1 kb DNA ladder. [See colorversion online at www.interscience.wiley.com.]


release ofHABP1, on hyaluronidase treatment suggeststhat HABP1 may participate in the crosslinking stabi-lization of HA in the matrix of cumulus cells duringovulation.

It is established that increased HA synthesis is due toelevated expression of HAS-2 in preovulatory folliclesand results in secretion ofHA in thematrix (Fulop et al.,1997). The formation and organization of the matrix iscrucial for ovulation and hence is dependent not only onthe synthesis of HA, a major component of ECM, but itscrosslinkings and stabilization with other matrix com-ponents. A number of matrix components have beenidentified and shown to play a role in HA crosslinkingsand matrix organization during last decade. In thiscontext, the reports of several hyaluronan bindingproteins for example, link protein, CD44, tumor stimu-lated necrosis factor gene-6 (TSG-6), and versican are tobe mentioned. During follicular development, markeddeposition of link protein (Kobayashi et al., 1999) isidentified in the matrix of cumulus and granulosa cellduring ovarian follicular development and persists evenin lutenized granulosa cells after ovulation and corpusluteum. Versican, another member of hyaluronectinfamily is reported to be present in granulosa cells duringfollicular development, however, its expression is notaltereddue toFSHtreatment but increases significantlyin the periovulatory period suggesting that all theisoforms of versican arematrix components of granulosacells during folliculogenesis (Russell et al., 2003). CD44is also shown to be upregulated in COCs along withincrease in HAS-2 in eCG and pFF cultured COCs(Yokoo et al., 2002). Along with these reports, othershave shown that serum derived hyaluronan bindingassociated protein SHAP, the heavy chains of seruminter-a-trypsin inhibitor molecule form covalent com-plexes with hyaluronan in the expanded cumulus cells(Zhuo et al., 2001) and in this regard the central role ofTSG-6,HA-binding proteinneeds to be elaborated.TSG-6, generally expressed during inflammation, is involvedin the COC expansion process and detected in thecumulus mass both as a free protein and covalentlycomplexed with IaI. Recently TSG-6 was shown as acatalyst in heavy chain transfer of IaI via an inter-mediary complex. Also TSG-6 interacts with pentaxin3,a multimeric protein implicated in COC expansion.Deletion of TSG-6 gene in mice inhibits heavy chaintransfer, which leads to impaired cumulus mucificationand female sterility (Fulop et al., 2003). Thus, TSG-6 isconsidered to play a central role in COC expansionserving to stabilize theHA rich cumulusmatrix throughat least independent or nonredundant mechanisms.Targeted deletion of PTX3 in mice produces femalesterility resulting oocyte fertilization failure and defec-tive in vivo cumulusmass expansion (Varani et al., 2002;Salustri et al., 2004). In vitro studies show that thepresence of PTX3 is essential for expansion of thecumulus cells to hold hyaluronan molecule in intracel-lular space.With the involvement of varioushyaluronanbinding proteins and the complexity generated duringCOC expansion and ovulation, our observation onovulation associated HABP1 regulation allowed us tospeculate that HABP1 may be another importantmolecule which participate in the HA crosslinking inECM along with other hyaluronan binding proteins.


Fig. 4. A: Loss of HABP1 in expanded COC by hyaluronidasetreatment. Cultured expanded COCs were treated with hyaluronidasefor 15 min and after centrifugation the supernatant containing matrixwas subjected to western blot (lane 2). Lane 1 contains COCs lysatewithout hyaluronidase treatment. B: Loss of HABP1 from expandedCOCs with hyaluronidase treatment. Cultured expanded COC weretreatedwith hyaluronidase for 0, 5, 10, and 15min and immunostainedwith HABP1 antibody. Expanded COC without hyaluronidase treat-ment stained with HABP1 antibody (I), Hoescht (blue) (II), Mergedimage of I and II (III). With hyaluronidase treatment for 5min stainedwith HABP1 antibody (IV), Hoescht staining (V) and merged image(VI), with hyaluronidase treatment for 10 min (VII), Hoescht staining(VIII) and merged image (IX), hyaluronidase treatment for 15 minstained with HABP1 antibody (X), Hoescht staining (XI) and mergedimage (XII). The last panel (XIII–XV) is the expanded COC withouthyaluronidase treatment stained with pre-immune serum (magnifica-tion, 400�).


In conclusion the present observation on the HABP1expression during COC maturation suggests its prob-able role in female fertility. However, it has to be furtherexamined in cumulus matrix deficient mouse model,obtained by disrupting TSG-6 or PTX3 in future to findits role in female fertility.

CONCLUSIONS

This report demonstrates that hyaluronan bindingprotein 1 (HABP1) is upregulated during folliculardevelopment and cumulus oocyte complex maturation,which is known to be associated with excess hyaluronansynthesis. TheHABP1 gene is upregulated at transcrip-tion level during COC maturation both in vivo andin vitro conditions. More precisely HABP1 is localizedin cytoplasm and extracellular matrix during COCmaturation. This is the first report in which apart fromother member of hyaladherins, HABP1 also has beenshown to be involved in stabilizing HA crosslinkingduring COC expansion.

ACKNOWLEDGMENTS

Weacknowledge the financial support byDepartmentof Science and Technology (DST). We expressed ourthanks to Dr. S.K. Chaube (National institute of healthand family welfare, New Delhi) for allowing us to usetheir facility for isolating Cumulus oocyte complex.

REFERENCES

Bharadwaj A, Ghosh I, Sengupta A, Cooper TG, Weinbauer GF,Brinkworth MH, Nieschlag E, Datta K. 2002. Stage-specific expres-sion of proprotein form of hyaluronan binding protein 1 (HABP1)during spermatogenesis in rat. Mol Reprod Dev 62:223–232.

Bradford MM. 1976. A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle of proteindye-binding. Anal Biochem 72:248–254.

Camaioni A, Hascall VC, Yanagishita M, Salustri A. 1993. Effects ofexogenous hyaluronic acid and serum on matrix organization andstability in themouse cumulus cell-oocyte complex. J Biol Chem 268:20473–20481.

Chen L, Wert S, Hendrix M, Russel P, Cannon M, Larsen WJ. 1990.Hyaluronic acid synthesis and gap junction endocytosis are neces-sary for normal expansion of the cumulus mass. Mol Reprod Dev 26:236–247.

Chen L, Mao SJT, Larsen WJ. 1992. Identification of a factor in fetalbovine serum that stabilizes the cumulus extracellularmatrix: a rolefor a member of the inter-a-trypsin inhibitor family. J Biol Chem267:12380–12386.

Chen L, Russel PT, Larsen WJ. 1993. Functional significance ofcumulus expansion in the mouse: Roles for the preovulatorysynthesis of hyaluronic acid within cumulus mass. Mol Reprod Dev34:87–93.

ChenL,Mao ST,McLeanL, PowersR, LarsenWJ. 1994. Proteins of theinter-a-trypsin inhibitor family stabilize the cumulus extracellularmatrix through their direct binding with hyaluronicacid. J BiolChem 269:28282–28287.

Chomczynski P, SacchiN. 1987. Single stepmethod ofRNA isolation byacid guanidinium thiocyanate–phenol–chloroform extraction. AnalBiochem 162:156–159.

Daen FP, Sato E, Naito K, Toyado Y. 1994. The effect of pig follicularfluid fractions on cumulus expansion andmale pronucleus formationin porcine oocytes matured and fertilized in vitro. J Reprod Fertil101:667–673.

Deb TB, Datta K. 1996. Molecular cloning of human fibroblasthyaluronic acid binding protein confirms its identify with P-32, a

protein co-purified with splicing factor SF2. J Biol. Chem 269:2206–2212.

Epigg JJ. 1979. FSH stimulates hyaluronic acid synthesis by oocyte-cumulus cell complexes from mouse preovulatory follicles. Nature281:483–485.

Epigg JJ. 1980. Role of serum inFSH stimulated cumulus expansion bymouseoocyte-cumuluscell complexes invitro.BiolReprod22:629–633.

FulopC, Salustri A,HascallVC. 1997.Coding sequence of ahyaluronansynthase homologue expressed during expansion of the mousecumulus oocyte complex. Arch Biochem Biophys 337:261–266.

FulopC, Sandor S,MukhopadhyayD,BardosT,KamathRV,RuggMS,Day AJ, Salustri A, Hascall VC, Glant TT,Mikecz K. 2003. Impairedcumulus mucification and female sterility in tumor necrosis factor-induced protein-6 deficient mice. Development 130:2253–2261.

Ghebrehiwet B, Lim BL, Peerschke EI, Willis CA, Reid KB. 1994.Isolation, cDNA cloning, and overexpression of a 33-kDa cell surfaceglycoprotein that binds to a globular ‘‘Heads’’ of C1q. J Exp Med179:1809–1821.

Ghosh I, Datta K. 2002. Sperm surface hyaluronan binding protein(HABP1) interacts with zona pellucida of water buffalo (Bubalusbubalis) through its clustered mannose residues. Mol Reprod Dev64:235–244.

Gupta S, Datta K. 1991. Possible role of hyaluronectin on cell adhesionin rat histiocytoma. Exp Cell Res 195:386–395.

Hess KA, Chen L, Larsen WJ. 1999. Inter-alpha-inhibitor binding tohyaluronan in the cumulus extracellular matrix is required foroptimal ovulation and development of mouse oocytes. Biol Reprod61:436–443.

Honore B, Madsen P, Rasmussen HH, Vandekerckhove J, Celis JE,Leffers H. 1993. Cloning and expression of a cDNA covering thecomplete coding region of the p32 subunit of human pre-mRNAsplicing factor SF2. Gene 134:283–287.

JhaBK, SalunkeDM,DattaK. 2002. Disulfide bond formation throughCys186 facilitates functionally relevant dimerization of trimerichyaluronan-binding protein (HABP1)/p32/gC1qR. Eur J Biochem2002. 269:298–306.

Kobayashi H, Sun GW, Hirashima Y, Terao T. 1999. Identification oflink protein during follicle development and cumulus cell cultures inrats. Endocrinology 140:3835–3842.

KrainerAR,MayedaA,KozakD, BinnsG. 1991. Functional expressionof cloned human splicing factor S F2:Homology to RNA-bindingproteins, U1 70K, and Drosophila splicing regulators. Cell 66:383–394.

LarsenWJ, Chen L, Powers R, Zhang H, Russel PT, Chambers C, HessK, Flick R. 1996. Cumulus expansion initiates physical anddevelopmental autonomy of the oocyte. Zygote 4:335–341.

Lauret TC, Fraser JR. 1992. Hyaluronan. FASEB J 6:2397–2404.MajumdarM,DattaK. 1998.Assignment of cDNAencodinghyaluronic

acid binding protein 1 to human chromosome 17p12–13. Genomics51:476–477.

Majumdar K, Meenakshi J, Goswami SK, Datta K. 2002. Hyaluronanbinding protein (HABP1)/C1QBP/p32 is an endogenous substrate forMAP kinase and is translocated to the nucleus upon mitogenicstimulation. Biochem Biophys Res Commun 291:829–837.

Ranganathan S, Ganguly AK, Datta K. 1994. Evidence for presence ofhyaluronan binding protein on spermatozoa and its possibleinvolvement in sperm function. Mol Reprod Dev 38:69–76.

Russell DL, Ochsner SA, Hsieh M, Mulders S, Richards JS. 2003.Hormone regulated expression and localization of versican in therodent ovary. Endocrinology 144:1020–1031.

Salustri A, Yanagishita M, Hascall V. 1989. Synthesis and accumula-tion of hyaluronic acid and proteoglycans in the mouse cumulus cell-oocyte during follicle stimulating hormone-induced mucification.J Biol Chem 264:13840–13847.

Salustri A,GarlandaC,HirschE,DeAcetisM,MaccagnoA,Bottazzi B,Doni A, Bastone A, Mantovani A. 2004. PTX3 plays a key role in theorganization of the cumulus oophorus extracellular matrix and invivo fertilization. Development 131:1577–1586.

Tempel C, Gilead A, Neeman M. 2000. Hyaluronic acid as an anti-angiogenic shield in the preovulatory rat follicle. Biol Reprod 63:134–140.

Tsafriri A. 1995. Ovulation as a tissue remodeling process. Proteolysisand cumulus expansion. Adv Exp Med Biol 377:121–140.



Varani S, Elvin JA, Yan C, Demayo J, Demayo FJ, Horton HF, ByrneMC, Matzuk MM. 2002. Knockout of pentraxin 3, a downstreamtarget of growth differentiation factor-9, causes female subfertility.Mol Endocrinol 16:1154–1157.

Yokoo M, Miyahayashi Y, Naganuma T, Kimura N, Sasada H. 2002.Identification of hyaluronic acid-binding proteins and their expres-sions in porcine cumulus-oocyte complexes during in vitro matura-tion. Biol Reprod 67:1165–1171.

YoshidaM, Ishizaki Y,KawagishiH, BambaK,KojimaY. 1992. Effectsof pig follicular fluid onmaturation of pig oocytes in vitro and on their

subsequent fertilizing and developmental capacity in vitro. J ReprodFertil 95:481–488.

Yudin AI, Cherr GN, Katz DF. 1988. Structure of the cumulus matrixand zona pellucida in the golden hamster: A new view of sperminteraction with oocyte-associated extracellular matrices. CellTissue Res 251:555–564.

Zhuo L, Yoneda M, Zhoa M, Yingsung W, Yoshida N, Kitagawa Y,Kawamura K, Suzuki T, Kimata K. 2001. Defect in SHAP-hyaluronan complex causes severe female infertility. J Biochem276:7693–7696.



Higher expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR/SF2) during follicular...

Documents

Transcript of Higher expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR/SF2) during follicular...