Analytical Biochemistry 466 (2014) 59–64

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

Haplotyping using a combination of polymerase chainreaction–single-strand conformational polymorphismanalysis and haplotype-specific PCR amplification

http://dx.doi.org/10.1016/j.ab.2014.08.0210003-2697/� 2014 Elsevier Inc. All rights reserved.

⇑ Corresponding authors.E-mail addresses: luoyz@gsau.edu.cn (Y. Luo), jon.hickford@lincoln.ac.nz

(J.G.H. Hickford).1 Abbreviations used: SNP, single nucleotide polymorphism; PCR, polymerase chain

reaction; SSCP, single-strand conformational polymorphism.

Huitong Zhou a,b, Shaobin Li a, Xiu Liu a, Jiqing Wang a, Yuzhu Luo a,⇑, Jon G.H. Hickford b,⇑a Gansu Key Laboratory of Herbivorous Animal Biotechnology, Faculty of Animal Science and Technology, Gansu Agricultural University, Lanzhou 730070, Chinab Faculty of Agricultural and Life Sciences, Lincoln University, Lincoln 7647, New Zealand

a r t i c l e i n f o

Article history:Received 8 July 2014Received in revised form 19 August 2014Accepted 20 August 2014Available online 28 August 2014

Keywords:HaplotypingSNP haplotypePCR–SSCPHaplotype-specific PCR amplification

a b s t r a c t

A single nucleotide polymorphism (SNP) may have an impact on phenotype, but it may also be influencedby multiple SNPs within a gene; hence, the haplotype or phase of multiple SNPs needs to be known.Various methods for haplotyping SNPs have been proposed, but a simple and cost-effective method iscurrently unavailable. Here we describe a haplotyping approach using two simple techniques: polymer-ase chain reaction–single-strand conformational polymorphism (PCR–SSCP) and haplotype-specific PCR.In this approach, individual regions of a gene are analyzed by PCR–SSCP to identify variation that definessub-haplotypes, and then extended haplotypes are assembled from the sub-haplotypes either directly orwith the additional use of haplotype-specific PCR amplification. We demonstrate the utility of thisapproach by haplotyping ovine FABP4 across two variable regions that contain seven SNPs and one indel.The simplicity of this approach makes it suitable for large-scale studies and/or diagnostic screening.

� 2014 Elsevier Inc. All rights reserved.

Single nucleotide polymorphisms (SNPs)1 have been intensivelystudied in an attempt to uncover the functional effect of variation ingenes. Although a single nucleotide substitution may produce a phe-notypic change, the haplotype or phase of multiple SNPs within agene is often the principal determinant of phenotypic consequences.Haplotyping converts the typically bi-allelic markers defined bySNPs into a multi-allelic system, and haplotypes accordingly havehigher polymorphic information content than the SNPs that com-prise them. There is also evidence that the use of haplotypes canbe more powerful than the use of individual SNP markers to revealassociations in quantitative trait analyses [1–3].

Haplotypes in diploid species can be determined indirectlyusing an in silico approach. This approach infers haplotypes fromobserved genotype data using statistical and computational meth-ods. Although this approach provides cost-effective phasing ofSNPs in small regions of genes, it can suffer from higher errorrates and has difficulty in incorporating rare SNPs into haplotypes[4].

Molecular techniques for direct haplotyping have beendeveloped, including single molecule-based and sequence-basedmethods. The single molecule-based methods rely on either DNAcloning [5], limiting dilution [6,7], or stochastic separation [8] toseparate the individual DNA sequences or haplotypes prior to thedetermination of sequences. In contrast, the sequence-based meth-ods use the SNP information to design specific polymerase chainreaction (PCR) primers or oligonucleotides for use in PCR amplifica-tion [9,10], pyrosequencing [11], or hybridization [12]. Thesemolecular techniques either are labor intensive, requiring multiplemanipulations, or are expensive, requiring specialized instrumen-tation or extensive rounds of PCR amplification and sequencing.Accordingly, they are less suitable for large-scale studies or forthe diagnostic screening of large numbers of individuals. Thesequence-based molecular methods may also be incapable ofdetecting previously unidentified sequence variation; hence, theymay lead to mis-typing of new haplotypes assuming that theyexist. This would suggest that there is demand for a simple, accu-rate, and cost-effective technique to determine haplotypes.

PCR–SSCP (single-strand conformational polymorphism) iscapable of differentiating multiple DNA fragments containing dif-ferent nucleotide sequences. This widely used technique can iden-tify individual sequences or DNA fragments and, therefore, offers asimple technique for haplotyping. However, the ability of

60 Haplotyping using PCR–SSCP and haplotype-specific PCR / H. Zhou et al. / Anal. Biochem. 466 (2014) 59–64

PCR–SSCP to detect sequence variation decreases when the lengthof DNA fragments increase; therefore, it is better suited to smallfragments in the range of 150 to 600 bp [13–15].

To overcome the above constraints, here we describe a newapproach for direct haplotyping. This method involves two proce-dures: (a) using PCR–SSCP to obtain haplotype information forindividual gene regions (called sub-haplotypes) and (b) construct-ing the haplotype structure from the sub-haplotype data and hap-lotype-specific PCR amplification if it is required.

We demonstrated this haplotyping approach using the ovineFABP4 gene as a target. This gene exhibits considerable variationin two regions, with five sequence variants having been describedin an exon 2–intron 2 region that contains three SNPs and oneindel and four sequence variants having been described in an exon3–intron 3 region containing four SNPs [16] (see Fig. 1). These tworegions span approximately 1.3 kb, and across these two regions14 different haplotype sequences have been reported [16].

Materials and methods

Sheep blood samples and DNA purification

A total of 920 New Zealand Romney sheep sired by 18 differentrams were investigated. Blood samples were collected on FTAcards, and genomic DNA for PCR amplifications was purified fromthese using a two-step procedure [17].

PCR–SSCP analysis of ovine FABP4

Two sets of region-specific PCR primers (F1 and R1, F2 and R2)(Table 1) were designed to simultaneously amplify two variableregions of ovine FABP4 in a multiplex PCR. Amplification was car-ried out in 15-ll reactions containing the DNA on one 1.2-mmpunch of an FTA card, 0.25 lM of each primer, 150 lM deoxynucle-oside triphosphates (dNTPs; Bioline, London), 2.5 mM Mg2+, 0.5 Uof Taq DNA polymerase (Qiagen, Hilden, Germany), and 1� thereaction buffer supplied with the enzyme. The thermal profile

Fig.1. Sub-haplotype sequences of the ovine FABP4 gene. A1 to E1 represent five sub-haplotype sequences in region 1 (exon 2–intron 2), and A2 to D2 represent four sub-haplotype sequences in region 2 (exon 3–intron 3). Only the variable nucleotidesand their flanking sequences are shown. Dashes indicate nucleotides identical tothe top sequence, and a dot represents a nucleotide deletion. Double slashes (/ /)indicate that the sequences are not continuous. Shaded sequences indicate thelocation of the haplotype-specific primers, with right arrows representing forwardprimers and left arrows representing reverse primers. The numbering of nucleotidepositions follows the guidelines described at http://www.hgvs.org/mutnomen.

consisted of 2 min at 94 �C, followed by 35 cycles of 30 s at94 �C, 30 s at 60 �C, and 30 s at 72 �C, with a final extension of5 min at 72 �C. Amplification was carried out in S1000 thermalcyclers (Bio-Rad, Hercules, CA, USA).

After denaturation at 95 �C for 5 min, the amplicons were ana-lyzed on 14% acrylamide/bis-acrylamide (37.5:1) gels(16 � 18 cm; Bio-Rad). Electrophoresis was performed using Pro-tean II xi cells (Bio-Rad) for 19 h in 0.5� TBE buffer at 7.5 �C and300 V, and gels were silver-stained according to the method ofRef. [18]. Amplicons of the known sequence variants for bothregions were included in each polyacrylamide gel, and their band-ing patterns were used as references for determining the variantspresent in individual sheep.

Haplotype-specific PCR

The previously reported sequences of regions 1 and 2 [16] wereused to design additional forward and reverse primers for haplo-type-specific PCR (Fig. 1). Each of these primers was designed totarget a unique sequence in one of these regions; hence, differentcombinations of a forward and reverse primer would amplify dif-ferent haplotypes across the two regions. A primer could not bedesigned to specifically target the C1 sequence in region 1.

All of the primers except the forward primer for B1 (FB1) had asingle nucleotide mismatch at the 30 end with nontargetsequences. For these primers, a second mismatch at the third posi-tion from the 30 end was deliberately introduced because it hasbeen shown to improve the specificity of the PCR amplificationby further destabilizing the extension of the 30 end double-mis-matched primer [19].

The choice of primers used in the haplotype-specific PCR ampli-fication depended on which sub-haplotype sequences were ini-tially identified by PCR–SSCP in individual samples. Amplificationentailed use of either a three-primer system (one forward primerand two reverse primers) or a two-primer system (one forward pri-mer and one reverse primer), both of which could be used to revealthe haplotypes (Fig. 2).

PCR amplification was carried out using the protocol describedabove but with the exception of different annealing temperaturesas described in Table 2 and an extension time of 60 s. For thetwo-primer system, a positive control system was also designedusing the primers 50-taacaaccctcctctcaatct-30 and 50-ttcatggactgaagttgaact-30. These amplify a 557-bp fragment of ovine KRTAP1-2 [15], and they were included in every reaction to ensure thatPCR amplification was occurring.

The haplotype-specific amplicons were visualized by electro-phoresis in 1% agarose gels (Quantum Scientific, Queensland,Australia) using 1� TBE buffer (89 mM Tris, 89 mM boric acid,and 2 mM Na2EDTA) containing 200 ng/ml ethidium bromide.

Haplotype construction

For those samples that were homozygous at both regions or hadonly one heterozygous region, their haplotypes could be con-structed directly based on the sub-haplotype data.

For those samples that were heterozygous at both regions, theirhaplotypes could be deduced by either of two haplotype-specificPCR approaches (see Fig. 2) using the specific primers for thesub-haplotypes detected in the PCR–SSCP system.

In the three-primer approach, the size of amplicons derivedfrom different haplotypes would be different. By comparing thesizes of amplicons, the haplotypes that were amplified could bedetermined (Table 2).

With the two-primer approach, the presence of an ampliconindicates that the sequence variants corresponding to the primersused are on the same chromosome, and the absence of an amplicon

Table 1PCR primers used for region-specific PCR–SSCP and haplotype-specific PCR amplification.

Primer Primer sequence (50 ? 30)a Target region/sub-haplotype (sequence)

PCR–SSCP F1 CAGGAATTTGATGAAGTCACT Region 1 (exon 2–intron 2)R1 GTAACATGGTTCAGAGCTAGF2 GATGGGAAATCAACCACCA Region 2 (exon 3–intron 3)R2 TCTCCTTCAATGCTGAGAAG

Haplotype-specific PCR FA1 GAGCAGAGTAAAAGCCAGG A1 (c.246 + 37G)

FB1 CTGGAGCAGAGTAAAAGCTG B1 (c.246 + 34delC)FD1 GAGTAAAAGCCTGATTTATACAT D1 (c.246 + 46T)

FE1 GTAAAAGCCTGATTTgTAAGCA E1 (c.246 + 47A)

RA2 AAGGAAAAAATGTTCATCAAGAA A2 (c.348 + 356T)

RB2 TAATAAACTAGGGAGACATAG B2 (c.348 + 298C)

RC2 AAATACTTCCTGGGGCATAG C2 (c.348 + 166C)

RD2 TATCATCCACAAGTTTTCACC D2 (c.317G)

a Deliberate mismatches are introduced to improve PCR specificity and are underlined. A nucleotide introduced to reduce primer complementarity is shown in lowercase. F,forward; R, reverse.

Fig.2. Schematic representation of haplotyping using PCR–SSCP (A) and haplotype-specific PCR amplification (B). M and N represent sub-haplotypes of region 1, and Xand Y represent sub-haplotypes of region 2. Haplotype-specific PCR amplificationcan be carried out using either a three-primer or two-primer approach. In the three-primer approach, the forward primer (PM) targets sub-haplotype M at region 1,whereas the reverse primers (PX and PY) target sub-haplotypes X and Y at region 2. Ifhaplotype M–X and M–Y produce different-sized PCR amplicons, then whether M–Xor M–Y is present in the sample can be identified based on their size; hence, thehaplotypes can be determined. In the two-primer approach, because haplotype M–Xproduces an amplicon and haplotype M–Y does not, if the sub-haplotypes have beendetermined using PCR–SSCP, then the haplotypes can be inferred.

Table 2Expected sizes (in bp) of ovine FABP4 amplicons (and annealing temperatures) usingdifferent combinations of haplotype-specific primers.

Forward Reverse

RA2 RB2 RC2 RD2

FA1 1051 (59 �C) 990 (59 �C) 853 (58 �C) 661 (59 �C)FB1 1053 (59 �C) 992 (59 �C) 855 (59 �C) 663 (59 �C)FD1 1046 (58 �C) 985 (58 �C) 848 (58 �C) 656 (59 �C)FE1 1044 (58 �C) 983 (58 �C) 846 (58 �C) 654 (58 �C)

Haplotyping using PCR–SSCP and haplotype-specific PCR / H. Zhou et al. / Anal. Biochem. 466 (2014) 59–64 61

indicates that they are on the different chromosomes. Based on thepresence or absence of an amplicon, the haplotypes could bededuced.

Confirmation of the deduced haplotypes by DNA cloning

The linkage of the ovine FABP4 sub-haplotypes can also bedetermined using a DNA cloning approach. However, as a conse-quence of the difficulty of this labor-intensive approach, only fivesamples that were heterozygous at both regions of FABP4 wereanalyzed to confirm the accuracy and effectiveness of the PCR–SSCP and haplotype-specific PCR method.

In the cloning approach, a DNA fragment covering the tworegions was amplified using Pwo SuperYield DNA polymerase(Roche Applied Science, Mannheim, Germany) and the primersF1 and R2 (Table 1). Amplification was carried out using the condi-tion described above except for an extension time of 80 s. Theamplicons were cloned into the pCR4 Blunt–TOPO vector (Invitro-gen, Carlsbad, CA, USA). Ten insert positive colonies for each sam-ple were picked and incubated overnight in Terrific broth(Invitrogen) at 37 �C in a shaking rotary incubator (225 rpm). Plas-mids were recovered from bacterial pellets by boiling for 10 min in0.8% Triton X-100 solution. These plasmids were then screenedusing a clonal PCR–SSCP approach [20]. Only those clones forwhich the multiplex PCR–SSCP patterns matched those from theoriginal genomic DNA were subject to further analysis. The twosub-haplotype sequences detected in the same clone indicated thatthey were on the same chromosome; hence, the linkage of sub-haplotypes to make haplotypes could be determined.

Results

Two separated groups of PCR–SSCP banding patterns for ovineFABP4 were observed on a single gel (Fig. 3). On the gels, the less

Fig.3. Haplotyping of ovine FABP4 spanning two regions. Haplotypes were constructed using multiplex PCR–SSCP to determine the sub-haplotypes in each region (A) andhaplotype-specific PCR to determine the linkage of sub-haplotypes spanning these regions (B). Five PCR–SSCP banding patterns corresponding to five sub-haplotypes (A1, B1,C1, D1, and E1) in region 1 are shown in the lower panel of the polyacrylamide gel, whereas four PCR–SSCP patterns corresponding to four sub-haplotypes (A2, B2, C2, and D2) inregion 2 are shown in the upper panel of the gel. Haplotypes of FABP4 determined for samples (S1–S8) are shown in boxes. Samples S1 and S8 had at least one homozygousregion; hence, their haplotypes could be determined directly from the PCR–SSCP results. Samples S2 to S7 were heterozygous at both regions; therefore, the linkage of sub-haplotypes was determined by haplotype-specific PCR amplification using either a two-primer or three-primer system. The haplotype-specific PCR primers used forindividual samples are shown above the corresponding samples. M is the 1-kb Plus DNA ladder (Invitrogen), and a 557-bp KRTAP1-2 amplicon was used as positive control(+ve). The asterisk (*) indicates the absence of a specific amplicon, confirming that the alternative haplotype is present.

62 Haplotyping using PCR–SSCP and haplotype-specific PCR / H. Zhou et al. / Anal. Biochem. 466 (2014) 59–64

mobile group represented region 2, and four different PCR–SSCPpatterns representing four different sub-haplotypes (A2, B2, C2,and D2) were detected. The more mobile group of patterns werederived from region 1, with five PCR–SSCP patterns representing

five different sub-haplotypes (A1, B1, C1, D1, and E1) being detected.All known sub-haplotypes exhibited unique PCR–SSCP patterns;hence, the sub-haplotypes at each region could be easily deter-mined when compared with the reference patterns.

Table 3The 15 FABP4 haplotypes identified in 359 Romney sheep.

Haplotype Frequency (%)

A1–A2 7.1A1–B2 14.1A1–C2 1.3B1–A2 1.9B1–B2 24.7B1–C2 0.1C1–A2 20.1C1–B2 2.4C1–C2 20.6C1–D2

a 0.1D1–A2 6.7D1–B2 0.1D1–C2 0.3E1–A2 0.1E1–B2

a 0.4

Total 100

a Newly identified haplotype.

Haplotyping using PCR–SSCP and haplotype-specific PCR / H. Zhou et al. / Anal. Biochem. 466 (2014) 59–64 63

Of the 920 sheep analyzed, 237 (25.8%) were homozygous inboth regions and 247 (26.8%) were heterozygous in just one region.For these sheep, two haplotypes spanning both regions could beconstructed directly from the sub-haplotype data.

The remaining 436 sheep (47.4%) were heterozygous in bothregions and, therefore, required haplotype-specific PCR analysis.Using either the three-primer or two-primer approach, the link-age of the sub-haplotypes in the two regions could be deter-mined (Fig. 3). In total, 15 extended haplotypes were detected,including 13 previously reported haplotypes and 2 (C1–D2 andE1–B2) that were newly identified (Table 3). Haplotype C1–D2

was identified in one sheep that was homozygous at region 1,whereas haplotype E1–B2 was detected in three sheep that werehomozygous at region 2.

To confirm the linkage of the sub-haplotypes deduced by haplo-type-specific PCR, five representative sheep DNA samples thatwere heterozygous at both regions, were haplotyped using a DNAcloning approach. The linkage of the sub-haplotypes determinedby the DNA cloning approach matched with those deduced by hap-lotype-specific PCR amplification.

Discussion

PCR–SSCP is a simple and cost-effective technique for haplotyp-ing small DNA fragments (up to 600 bp) [13]. Although sensitive,the technique might not detect all nucleotide variations in anygiven amplicon [13]; thus, it does not have the resolving powerof DNA sequencing. In contrast, PCR–SSCP does allow large num-bers of DNA samples to be typed simultaneously [21,22], althougha cautious approach to DNA typing may use both methods. Forexample, a minimum use of sequencing may entail the analysisof individual samples that appear to be homozygous using PCR–SSCP to confirm that unresolved nucleotide variation is not pres-ent. In this study, we demonstrated that even larger DNA frag-ments can be genotyped, first by typing individual smallerregions using PCR–SSCP and then by assembling haplotypes fromthe sub-haplotype data with the assistance of haplotype-specificPCR. We used ovine FABP4 to illustrate the application of this hap-lotyping approach, and the ability to determine haplotypes in all ofthe samples investigated illustrated its efficiency.

Multiplex PCR–SSCP enables more than one DNA region to begenotyped simultaneously in a single reaction; thus, it reduceslabor and running costs. It was used effectively in this study.However, in cases where a multiplex PCR–SSCP approach could

not be developed, such as when PCR and/or SSCP conditions cannotbe optimized for multiple amplicons, individual PCR–SSCP analysescould be undertaken. This would, of course, add time and cost tothe analysis.

In some cases, haplotypes could be assembled directly from thePCR–SSCP results without the need to use haplotype-specific PCR.However, for some sheep in this study, PCR–SSCP was not enoughby itself to determine the haplotypes. However, with sufficientknowledge of which sub-haplotypes were present in individualsheep, haplotype-specific primers could subsequently be selectedand the number of PCRs required for typing with these primerscould be minimized. Typically a single haplotype-specific PCRwas required to determine the linkage of the sub-haplotypes, incontrast to other SNP-specific PCR (also known as allele-specificPCR) techniques [9,10] that require four PCR amplifications todetermine the linkage phase of two SNPs. With ovine FABP4, if anSNP-specific PCR typing approach were used for the seven SNPsand one indel reported to date [16], haplotyping of the gene wouldbe complicated and might require at least 28 different PCRs.

Haplotype-specific PCRs were developed based on the conceptof SNP-specific PCR first described by Newton and coworkers[23]. For di-allelic SNPs, SNP-specific primers can resolve the twosequences, but if more than two alleles exist, then the SNP-specificprimers may bind more than one allele, making the genetic varia-tion appear to be more simple than it actually is. To resolve thisincreased level of sequence variation would require more thantwo primers and primers that can differentially and specificallybind the various alleles. Designing primers of this kind can beimpossible, and in the case of sub-haplotype C1 of ovine FABP4,any SNP-specific primer for this sub-haplotype would also targetother sub-haplotype sequences (Fig. 1), meaning that a C1-specificprimer could not be developed. However, the typing methoddescribed here could resolve the extended haplotypes that containC1 because it could be deduced based on its partner haplotype. Forexample, in a sheep that is (C1, D1) at region 1 and (A2, B2) at region2, if one haplotype is confirmed as D1–A2, then the C1-containinghaplotype can be deduced as C1–B2 and vice versa (i.e., if one hap-lotype is D1–B2, then the C1-containing haplotype would be C1–A2).

Haplotype-specific PCR could be carried out using either athree-primer or two-primer system (Fig. 2). In the three-primersystem, either a forward primer and two reverse primers or twoforward primers and one reverse primer can be used, dependingon differences in the expected sizes of the amplicons. In this study,because the locations of the forward primers were clustered andthose of the reverse primers were spread out, the use of a forwardprimer and two reverse primers could generate amplicons withconsiderable differences in size. However, in cases where these dif-ferences are too small to be detectable on an agarose gel, the use offluorescent dye-labeled primers may enable differentiation ofamplicons from different haplotypes and possibly the use of a col-umn-based separation with greater resolving power than agarosegel electrophoresis. This type of approach has been described pre-viously [24,25].

Another option would be to use the two-primer system. Usingthis system, sometimes the linkage phase of sub-haplotypes mayneed to be deduced based on the failure to produce a PCR ampli-con. Because the absence of an amplicon may also be the resultof PCR failure, an internal positive control PCR should be includedin every PCR to detect potential PCR failure. For any PCR negativesample, another haplotype-specific PCR using primers that wouldresult in a positive signal is also recommend. It also needs to beunderstood that PCR failure may also occur because of previouslyunrealized variation at the 30 end of a primer; hence, a primerdesigned to resolve a di-allelic system may fail to amplify up tothree different alleles, depending on the nucleotides present atthe 30 end of a primer binding site.

64 Haplotyping using PCR–SSCP and haplotype-specific PCR / H. Zhou et al. / Anal. Biochem. 466 (2014) 59–64

The limitation of this haplotyping approach is the size limitimposed by PCR. PCR works readily with DNA fragments up to2000 to 3000 bp in size, but above this length Taq DNA polymerasetends to either stall or fall off the template due to mis-incorpora-tion of nucleotides at the 30 end [26], and the typical heating cycledoes not leave enough time for polymerization to be completed. Itis, however, possible to amplify genomic DNA fragments exceeding20 kb in length with a slower heating cycle and special polymer-ases such as a polymerase that is fused with a processivity-enhanc-ing DNA-binding protein [27].

The haplotyping approach described here is simple to performbut requires some optimization of the conditions for the PCR–SSCPand haplotype-specific PCR in order to achieve accurate and reli-able results. Once the conditions are optimized, many (100–200)samples can be typed manually within 2 days. In addition to thishigh capacity for throughput, the approach is also capable ofdetecting new haplotypes, as described in this study (Table 3).

Acknowledgments

This work was financially supported by the Gansu InnovativeResearch Group Program (1210RJIA005) and the Lincoln UniversityGene-Marker Laboratory. The authors thank Freeman Fang andSeung-Ok Byun for technical assistance.

References

[1] J. Akey, L. Jin, M. Xiong, Haplotypes vs. single marker linkage disequilibriumtests: What do we gain?, Eur J. Hum. Genet. 9 (2001) 291–300.

[2] J.D. Rioux, M.J. Daly, M.S. Silverberg, K. Lindblad, H. Steinhart, Z. Cohen, T.Delmonte, K. Kocher, K. Miller, S. Guschwan, Genetic variation in the 5q31cytokine gene cluster confers susceptibility to Crohn disease, Nat. Genet. 29(2001) 223–228.

[3] R.W. Morris, N.L. Kaplan, On the advantage of haplotype analysis in thepresence of multiple disease susceptibility alleles, Genet. Epidemiol. 23 (2002)221–233.

[4] S.R. Browning, B.L. Browning, Haplotype phasing: existing methods and newdevelopments, Nat. Rev. Genet. 12 (2011) 703–714.

[5] C.M. Drysdale, D.W. McGraw, C.B. Stack, J.C. Stephens, R.S. Judson, K.Nandabalan, K. Arnold, G. Ruano, S.B. Liggett, Complex promoter and codingregion b2-adrenergic receptor haplotypes alter receptor expression and predictin vivo responsiveness, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 10483–10488.

[6] G. Ruano, K.K. Kidd, J.C. Stephens, Haplotype of multiple polymorphismsresolved by enzymatic amplification of single DNA molecules, Proc. Natl. Acad.Sci. U.S.A. 87 (1990) 6296–6300.

[7] C. Ding, C.R. Cantor, Direct molecular haplotyping of long-range genomic DNAwith M1-PCR, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 7449–7453.

[8] B.A. Peters, B.G. Kermani, A.B. Sparks, O. Alferov, P. Hong, A. Alexeev, Y. Jiang, F.Dahl, Y.T. Tang, J. Haas, Accurate whole-genome sequencing and haplotypingfrom 10 to 20 human cells, Nature 487 (2012) 190–195.

[9] Y.M.D. Lo, P. Patel, C.R. Newton, A.F. Markham, K.A. Fleming, J.S. Wainscoat,Direct haplotype determination by double ARMS: specificity, sensitivity, andgenetic applications, Nucleic Acids Res. 19 (1991) 3561–3567.

[10] Y. Eitan, Y. Kashi, Direct micro-haplotyping by multiple double PCRamplifications of specific alleles (MD–PASA), Nucleic Acids Res. 30 (2001) e62.

[11] J. Odeberg, K. Holmberg, P. Eriksson, M. Uhlén, Molecular haplotyping byPyrosequencing, Biotechniques 33 (2002) 1104–1109.

[12] J.D. Hurley, L.J. Engle, J.T. Davis, A.M. Welsh, J.E. Landers, A simple, bead-basedapproach for multi-SNP molecular haplotyping, Nucleic Acids Res. 32 (2004)e186.

[13] A.J. Nataraj, I. Olivos-Glander, N. Kusukawa, W.E. Highsmith Jr., Single-strandconformation polymorphism and heteroduplex analysis for gel-basedmutation detection, Electrophoresis 20 (1999) 1177–1185.

[14] H. Zhou, J.G.G. Hickford, Q. Fang, Y.S. Lin, Allelic variation of the ovine Toll-likereceptor 4 gene, Dev. Comp. Immunol. 31 (2007) 105–108.

[15] H. Gong, H. Zhou, Z. Yu, J. Dyer, J.E. Plowman, J.G.H. Hickford, Identification ofthe ovine keratin-associated protein KAP1-2 gene (KRTAP1-2), Exp. Dermatol.20 (2011) 815–819.

[16] W. Yan, H. Zhou, Y. Luo, J. Hu, J.G.H. Hickford, Allelic variation in ovine fattyacid-binding protein (FABP4) gene, Mol. Biol. Rep. 39 (2012) 10621–10625.

[17] H. Zhou, J.G.H. Hickford, Q. Fang, A two-step procedure for extracting genomicDNA from dried blood spots on filter paper for polymerase chain reactionamplification, Anal. Biochem. 354 (2006) 159–161.

[18] S.O. Byun, Q. Fang, H. Zhou, J.G.H. Hickford, An effective method for silver-staining DNA in large numbers of polyacrylamide gels, Anal. Biochem. 385(2009) 174–175.

[19] R. Okimoto, J.B. Dodgson, Improved PCR amplification of multiple specificalleles (PAMSA) using internally mismatched primers, Biotechniques 21(1996) 20–26.

[20] H. Zhou, J.G.H. Hickford, Clonal polymerase chain reaction–single-strandconformational polymorphism analysis: an effective approach for identifyingcloned sequences, Anal. Biochem. 378 (2008) 111–112.

[21] S.O. Byun, Q. Fang, H. Zhou, J.G.H. Hickford, Rapid genotyping of the ovineADRB3 gene by polymerase chain reaction–single-strand conformationpolymorphism (PCR–SSCP), Mol. Cell. Probes 22 (2008) 69–70.

[22] S.O. Byun, H. Zhou, J.G. Hickford, Development of a simple typing method forthe ovine Toll-like receptor 4 gene, Vet. Immunol. Immunopathol. 130 (2009)272–274.

[23] C.R. Newton, A. Graham, L.E. Heptinstall, S.J. Powell, C. Summers, N. Kalsheker,J.C. Smith, A.F. Markham, Analysis of any point mutation in DNA: theamplification refractory mutation system (ARMS), Nucleic Acids Res. 17(1989) 2503–2516.

[24] M.V. Myakishev, Y. Khripin, S. Hu, D.H. Hamer, High-throughput SNPgenotyping by allele-specific PCR with universal energy-transfer-labeledprimers, Genome Res. 11 (2001) 163–169.

[25] E. Schaeffeler, T. Lang, U.M. Zanger, M. Eichelbaum, M. Schwab, High-throughput genotyping of thiopurine S-methyltransferase by denaturingHPLC, Clin. Chem. 47 (2001) 548–555.

[26] W.M. Barnes, PCR amplification of up to 35-kb DNA with high fidelity and highyield from lambda bacteriophage templates, Proc. Natl. Acad. Sci. U.S.A. 91(1994) 2216–2220.

[27] H.H. Hogrefe, M.C. Borns, Long-range PCR with a DNA polymerase fusion,Methods Mol. Biol. 687 (2011) 17–23.