The Veterinary Journal 194 (2012) 303–308

Contents lists available at SciVerse ScienceDirect

The Veterinary Journal

journal homepage: www.elsevier .com/ locate/ tv j l

cd T lymphocytes are recruited into the inflamed uterus of bitches sufferingfrom pyometra

A. Bartoskova a, P. Turanek-Knotigova b, J. Matiasovic b, Z. Oreskovic b, M. Vicenova b, H. Stepanova b,P. Ondrackova b, R. Vitasek a, L. Leva b, P.F. Moore c, M. Faldyna b,⇑a Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno, Czech Republicb Veterinary Research Institute, Brno, Czech Republicc School of Veterinary Medicine, University of California, Davis, CA, USA

a r t i c l e i n f o a b s t r a c t

Article history:Accepted 23 May 2012

Keywords:CanineLymphocyte subsetsFlow cytometryChemokinescd Lymphocytes

1090-0233/$ - see front matter � 2012 Elsevier Ltd. Ahttp://dx.doi.org/10.1016/j.tvjl.2012.05.024

⇑ Corresponding author. Tel.: +420 53333 1301.E-mail address: faldyna@vri.cz (M. Faldyna).

Very little is known about the occurrence of immune system cells in the canine uterus. The aim of thisstudy was to generate information about lymphocyte subsets that are present in the healthy canineuterus and that are recruited under inflammatory conditions caused by pyometra. Using immunohisto-chemistry and flow cytometry, a significant influx of cd T lymphocytes was found in pyometra samplesmainly due to recruitment of cd+/CD8� T lymphocytes. The relative expression of genes encoding selectedcytokines/chemokines was evaluated in samples from healthy and pyometra-affected uteri. Expression ofpro-inflammatory cytokines (including IL-1b, TNF-a, IL-8, IL-17 and IFN-c) and chemokines (includingCXCL10, CCL4 and CCL5) was upregulated in pyometra samples confirming the presence of inflammation.In contrast, the expression of the homeostatic chemokine CCL25 and of the anti-inflammatory cytokineIL-10 was downregulated and unchanged, respectively.

� 2012 Elsevier Ltd. All rights reserved.

Introduction et al., 2001; Arrighi et al., 2007; Noronha et al., 2012), although

Pyometra is one of the most common and serious diseases inbitches that affects mainly older nulliparous bitches in the lutealstage of the oestrous cycle and may or may not be associated withneutrophilia. Even though the aetiopathology of pyometra hasbeen studied for decades, it is still not yet fully understood (Dow,1959; Fransson and Ragle, 2003; Kida et al., 2010) but impaired im-mune function, including reduced activity of lymphocytes, hasbeen reported (Faldyna et al., 2001a). Suppression of lymphocyteactivity returned to normal within 7 days after surgical removalof the uterus (Bartoskova et al., 2007).

Undoubtedly, local uterine immunity (or lack thereof) has a partin the development of pyometra. The local immune system of theuterus is very specific due to the fact that, besides the necessityto protect against various kinds of infections, it is under the influ-ence of sex hormones and has to interact with allogeneic sperma-tozoa and the immunologically distinct fetus to enable successfulreproduction. There is a large amount of information concerningboth innate and adaptive immunity in the female genital tract(Wira et al., 2005). In contrast, there little is known about the prev-alence of immune cells in the canine uterus compared to the situ-ation in cows, sows, or mares (Cobb and Watson, 1995; Kaeoket

ll rights reserved.

Groppetti et al. (2010) brought general insight into cytologicalchanges taking place in canine uteri throughout the oestrous cycleand also under pathological conditions such as pyometra.

The aim of the current study was to generate information aboutthe lymphocyte subsets that are present in healthy canine uteriand that are recruited into the uterus under inflammatory condi-tions caused by pyometra. We found that, as part of the incomingleukocytes, an increased percentage of cd T lymphocytes can be de-tected in the uteri of bitches suffering from pyometra. More inter-estingly, the percentage of cd T lymphocytes not expressing CD8was the cause of the increased percentage of the total number ofcd T lymphocytes.

Materials and methods

Animals and sample collection

Samples of hysterectomized uteri were obtained from bitches of various breedsthat were either surgically treated for pyometra (n = 7) or underwent elective ovar-iohysterectomy (referred to as ‘healthy’; n = 5) as requested by their owners at theDepartment of Reproduction, Clinic of Dog and Cat Diseases of the University of Vet-erinary and Pharmaceutical Sciences, Brno. All samples were used with the ex-pressed consent of the owners. The bitches with pyometra and the healthyanimals were 8.14 ± 3.29 and 6.20 ± 3.96 years old, respectively.

All animals were in the luteal phase of the oestrous cycle, as confirmed by thepresence of corpora lutea in the ovaries. The average time from the end of heat was6.14 ± 2.73 weeks in bitches with pyometra and 9.20 ± 0.84 weeks in healthy ani-mals. In pyometra cases, Escherichia coli was shown to be responsible of the bacte-rial contamination of the uterine lumen.

Table 1List of monoclonal antibodies used.

Antibody Expressed on Clone Isotype Manufacturer

CD3 T lymphocytes CA17.2A12 IgG1 P.F. Mooreb

CD4 T helper cells CA13.1E4 IgG1 P.F. MooreCD8 T cytotoxic cells YCATE 55.9a IgG1 Serotecc

CD21 B lymphocytes CA2.1D6 IgG1 P.F. MooreCD45 All leukocytes CA12.10C12 IgG1 P.F. Moorecd-TCR cd T-lymphocytes CA20.8H1 IgG2a P.F. MooreCD172a Myeloid cells DH59B IgG1 VMRDd

a Directly conjugated with RPE.b P.F. Moore, School of Veterinary Medicine, University of California, Davis, CA.c AbD Serotec.d Veterinary Medical Research & Development.

Table 2List of primers used.

Gene Primers

IL1-b F: CCCTGGAAATGTGAAGTGCTGCTGCCR: TGCAACTGGATGCCCTCATCTACCAG

TNF-a F: TTCTCCTTCCTCCTCGTCGCAGGGR: TGGGGGCCGATCACTCCAAAGTG

IFN-c F: TTGCGTGATTTTGTGTTCTTCTGGCTGTR: ACGAAAAGAGACCCACCGTCCGATACA

IL-17 F: TGACTCTGGTGACAACTTCATCCATGTTCCR: CCACCAGGCTCAGAAGCAGTAGCA

IL-8 F: CCAAGCTGGCTGTTGCTCTCTTGGCR: CAGCTTCACAGAGAGCTGCAGAAAGGACA

CXCL10 F: ACCTCTCTCTAGAACTATACGCTGTACCTGTATCAR: TGTGGCAATGATCTCAACATGTGGACACG

CCL3 F: TGTTGCCCAGCACCATGGAGGTCR: CAGCACCAAAAGTGGAAGAGCAGGTC

CCL4 F: GCGCTCTCAGCACCAATGGGTTCAGR: TACCACAGCTGGCTGGGAGCAGA

CCL5 F: GCCTCTGCCTCCCCATATGCCTCAGR: GACGACTGCTGGCATGGAGCACT

IL-10 F: TGCATGGCTCAGCACTGCTCTGTTGR: AGTGGGTGCAGTCGTCCTCAAGTAGG

CCL25 F: ACACTCAAGGTGTCTCTGAGGACTGCTGR: CTCACTTCCTGGCGCTGGTAGCC

GUSBa F: AGACGCTTCCAA/GTACCCCR: AGGTGTGGTGTAGAGGAGCAC

HPRT F: CGAAGTGTTGGCTATAAACCTGACTTTGTTGGR: TCAAGGGCATATCCTACAACAAACTTGTCTGGA

RPS19 F: CTCTCGCGAGCTCTCGCACCTCTR: TAACTCCAGGCATCGTGCGGCCTC

a Schlotter et al. (2009).

1 See: http://www.ncbi.nlm.nih.gov/tools/primer-blast/.

304 A. Bartoskova et al. / The Veterinary Journal 194 (2012) 303–308

Immunostaining and flow cytometric analysis

Samples of uterine tissue were collected immediately after hysterectomy intoRPMI 1640 medium (Sigma–Aldrich). Lymphocytes were isolated by incubatinguterine pieces in Hanks’ Balanced Salt solution containing collagenase type IV(50 U/mL, Sigma–Aldrich) for 90 min at 37 �C with stirring. Cells were then purifiedby gradient centrifugation (Histopaque 1.077, Sigma–Aldrich). Thereafter, isolatedcells were washed twice in washing and staining buffer (WSB) (phosphate bufferedsaline [PBS] containing 0.2% gelatin from cold water fish skin, 0.1% sodium azideand 0.05 mM EDTA, all reagents from Sigma–Aldrich) and resuspended in WSB sup-plemented with 10% non-immune heat-inactivated goat serum to the density of5 � 106/mL.

Cell suspensions were stained indirectly. A volume of 50 lL of cell suspensionwas incubated with a primary mouse monoclonal antibody (Table 1) at room tem-perature for 15 min. Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouseimmunoglobulin fraction (Southern Biotechnology Association) was added as thesecondary antibody for 20 min at 4 �C. After another washing, the cells were resus-pended in WSB. Samples stained with the secondary antibody only were used ascontrols. In the case of double staining of CD8 with cd-T cell receptor (cd-TCR), amodified protocol was used. Cell surfaces were indirectly stained with anti-cd-

TCR antibody and FITC-conjugated secondary antibody as described above. Duringthe last washing step, 10% heat-inactivated mouse serum was added to WSB toblock free binding sites on the secondary antibody. Then, R-phycoerythrin-conju-gated antibody against CD8 was added to cell culture for 20 min (Faldyna et al.,2003). After another washing, propidium iodide was used to stain DNA in deadand damaged cells and to exclude such events from the analysis.

Data were acquired on a FACSCalibur flow cytometer (Becton–Dickinson) oper-ated by the CELLQuest software (Becton–Dickinson). In each sample, 10,000–50,000events were acquired. The PC-lysys software was used for data analysis. Gating oflymphocytes was based on forward and side scatter properties of cells. The commonleukocyte antigen (CD45) and common myeloid antigen (CD172a) expression wereused for the ‘lymphogate’ setup and lymphocyte purity determination (Faldynaet al., 2001b). Results obtained for the other surface markers were recalculated to100% of CD45+ and CD172a� cells in the ‘lymphogate’.

Immunohistochemistry

Uteri were cut into small pieces (1 cm3) and rapidly frozen using N-heptanecooled with liquid nitrogen. Sections (5 lm) were cut using a routine cryo-micro-tome (Leica CM 1900) at �15 �C. Dry sections were fixed in ice-cold acetone for3 min and microscopic slides were stored at �20 �C until used. Untreated cryo-sec-tions were incubated for 5 min with Peroxidase-Blocking Reagent (Dako) for inhibi-tion of endogenous peroxidase activity. After washing (3 � 5 min, TRIS), sectionswere incubated for 5 min with Protein Block reagent (Dako) to block non-specificbackground staining.

Immunohistochemical staining was performed using a two-step visualizationhigh sensitivity peroxidase system. First, sections were incubated for 2 h withmouse monoclonal anti-dog antibodies (Table 1) in a humid chamber. Neutrophilswere detected using rabbit polyclonal antibody (Dako) prepared against human lac-toferrin (Sinkora et al., 2007). Antibodies were diluted in TRIS (dilutions 1:10 and1:50). Second, after washing (3 � 5 min, TRIS), sections were incubated with theEnVision System Kit (Dako) for 1 h and washed again (3 � 5 min, TRIS). All previoussteps were performed at room temperature. Sections were then incubated with thechromogenic substrate system diaminobenzidine (DAB) at 37 �C temperature for5 min, counterstained with Harris haematoxylin and cover-slipped.

Quantitative real-time PCR detection of cytokines/chemokines

Samples of uteri from 12 bitches taken immediately after surgery were stabi-lized with RNAlater (Qiagen) and stored at �20 �C. Tissue samples were thenhomogenized on MagnaLyser (Roche) with 2.3 mm zirconia/silica beads (BioSpecProducts) and lysed in 1 mL of TRI Reagent RT (Molecular Research Center). TotalRNA obtained from the RNA phase after 4-Bromoanisole treatment was purifiedaccording to the manufacturer’s instruction using the RNeasy Kit (Qiagen). RNAconcentration was measured spectrophotometrically and RNA integrity waschecked by agarose gel electrophoresis.

RNA was reversely transcribed using M-MLV reverse transcriptase (200 U)(Invitrogen) and oligo-dT primers at 37 �C for 1.5 h. cDNA was stored at – 20 �C untilused. Real-time PCR was performed with the LightCycler 480 (Roche) using Quan-tiTect SYBR Green PCR Kit (Qiagen). Primers for 11 chemokines/cytokines and threecandidate reference genes (GUSB, beta-glucuronidase; HPRT, hypoxanthine–guaninephosphoribosyltransferase; RPS19, ribosomal protein S19) (Table 2) were used. Primerdesign was performed using NCBI primer designing tool.1 Each run included a no-template control to test the assay reagents for contamination. Using GeNorm soft-ware (Vandesompele et al., 2002), GUSB was selected as the most stable gene amongthe candidates for a reference gene in our experiment. The relative expression of agene of interest was calculated as a ratio to GUSB using the following formula: [1/(2CtGOI)])/[1/(2CtGUSB)] (Zelnickova et al., 2008).

Data analysis

For comparison of result from affected and healthy bitches, the Mann–WhitneyU test was used. P < 0.05 was considered statistically significant. All calculationswere performed with GraphPad Prism v.3.03 software.

Results

Flow cytometry

Results obtained by flow cytometry are shown in Fig. 1. The per-centages of all T (CD3+) and all B (CD21+) lymphocytes did not dif-fer significantly between healthy control and pyometra-affecteduteri. Similarly, the percentages of Th (T helper, CD4+) and Tc (Tcytotoxic, CD8+) lymphocytes did not show statistically significant

Fig. 1. Percentage of lymphocyte subsets in healthy (n = 5) and pyometra-affected (n = 7) uteri. Data are shown as means ± standard deviation (SD).

Fig. 2. Immunohistochemical detection of CD45+ positive leukocytes (A and A0), lactoferrin+ neutrophils (B and B0) and of cd T lymphocytes (C and C0) in healthy (A, B, and C)and pyometra-affected (A0 , B0 , and C0) uteri.

A. Bartoskova et al. / The Veterinary Journal 194 (2012) 303–308 305

Fig. 3. Relative expression of pro-inflammatory cytokine or chemokine genes in healthy (n = 5) and pyometra-affected (n = 7) uteri. Data are shown as means ± SD of folds tothe GUSB reference gene.

Fig. 4. Relative expression of CCL25 and IL-10 genes in healthy (n = 5) and pyometra-affected (n = 7) uteri. Data are shown as means ± SD of folds to the GUSB reference gene.

306 A. Bartoskova et al. / The Veterinary Journal 194 (2012) 303–308

differences. Neither the T/B lymphocyte ratio, nor Th/Tc lympho-cyte ratio was changed (P > 0.05) in samples from pyometra af-fected uteri compared to healthy ones.

The only lymphocyte population whose percentage was signif-icantly different in pyometra samples was the cd T lymphocytes.Moreover, the ratio between CD8+ and CD8� cd T lymphocyteswas reversed. In healthy uteri, the number of CD8+ cd T-lympho-cytes was higher than that of their CD8� counterpart. In contrast,in pyometra-affected uteri, the number of CD8� cd T lymphocytesclearly prevailed (Fig. 1).

Immunohistochemistry

Immunohistological examination documented the massive in-flux of leukocytes, mainly neutrophils characterized by lactoferrinexpression (Fig. 2), into canine uteri with pyometra. Even thoughimmunohistochemistry demonstrated a marked increase in the to-tal number of both lymphocyte subsets and of total leukocytes,only cd T lymphocytes were shown by flow cytometry to be a pop-ulation with proportion actually altered (Fig. 1). Histologicalimages indicated that cd T lymphocytes are recruited predomi-

A. Bartoskova et al. / The Veterinary Journal 194 (2012) 303–308 307

nantly into the endometrium, although they were also detected inthe myometrium and outer layers of infected uteri. Nevertheless,the vast majority of the cd T lymphocytes were present in theendometrium (Fig. 2).

Cytokine/chemokine expression

Using real-time PCR, relative expression of 11 immune-relatedgenes was detected. Nine of them were pro-inflammatory, includ-ing interleukin (IL)-1b, tumour necrosis factor (TNF)-a, interferon(IFN)-c, IL-17, IL-8, chemokine (C-C motif) ligand 3 (CCL3), CCL4,CCL5 and C-X-C motif chemokine 10 (CXCL10) (Fig. 3). Expressionof eight of them (all but CCL3) increased under inflammatory con-ditions. In contrast, expression of CCL25, a member of the homeo-static chemokine family, was down-regulated in pyometric uteriand expression of IL-10 remained unchanged (Fig. 4).

Discussion

The first part of the study was conducted with the aim of com-paring the percentages of selected lymphocyte subsets to evaluatetheir migration into the uteri of bitches affected by pyometra. Sub-sets characterized by expression of CD21, CD3, CD4, CD8, and cd-TCR were chosen as representatives of the basic lymphocyte sub-types, including B, Th, Tc cells, and cd T lymphocytes.

Although by histological evaluation the total number of cells inuterus with pyometra was clearly higher compared to healthy uteri,the distribution of most of the monitored lymphocyte subsets wasnot statistically different in bitches with pyometra. The only statis-tically significant difference was observed in cells expressing cd-TCR. One of the most striking findings was the apparent propor-tional predominance of CD8� cd T lymphocytes recruited to thecompromised uterine tissue. Although cd T lymphocytes representonly a small population in the peripheral blood and lymphoid or-gans of adult dogs (Faldyna et al., 2001b, 2005a), they can be plau-sibly recruited to sites of inflammation as described in piglets(Faldyna et al., 2005b), where cd T lymphocytes recruited to thebronchoalveolar space after experimental infection with Actinoba-cillus pleuropneumoniae are also predominantly CD8� (Faldynaet al., 2005b). Based on evidence derived from swine, in whichCD8� cd T lymphocytes occur predominantly in blood, while CD8+

cd T lymphocytes are mainly found in tissue (Yang and Parkhouse,1996), blood can represent a source of CD8� cd T lymphocytes.

Since pyometra is an inflammation associated with recruitmentof leukocytes, the expression of selected cytokines and chemokines,which play a crucial role in the regulation of inflammation and themovement of immune system cells, was also evaluated. As ex-pected, early pro-inflammatory cytokines (IL-1b and TNF-a) werehighly up-regulated in pyometra affected uteri. In contrast, expres-sion of the anti-inflammatory cytokine IL-10 remained unchanged.

As tissue macrophages are the main source of IL-1b and TNF-a(Aggarwal et al., 2000; Dinarello, 2000), it might be concluded thatuterine macrophages were activated and therefore the primarysource of the increase of CXCL10 in the damaged tissue. CXCL10is a known chemoattractant for Th1 lymphocytes that produceIFN-c (Luster, 2002). IFN-c is together with lipopolysaccharide(LPS) responsible for stimulation of neutrophils (recruited by IL-8) and endothelium cells for further production of CXCL10 (Tamas-sia et al., 2007). Furthermore, since CXCL10 may also be directly in-duced by bacterial products and viruses, it may play an early role inrecruiting responsive cells to the inflammation site, i.e. cells capa-ble of expressing CXCR3 (Luster, 2002; Kabelitz and Wesch, 2003;Tamassia et al., 2007). Besides NK cells and Th1 lymphocytes (Qinet al., 1998), the majority of human blood cd T lymphocytes hasbeen shown to express CXCR3, which is in accordance with their

functional resemblance to the Th1 type of immunity as summa-rized by Kabelitz and Wesch (2003). Moreover, cd T lymphocytesproduce CCL4 and thus attract further cd T lymphocytes via CCR5(Glatzel et al., 2002).

One of the multiple possible functions of cd T lymphocytes is toproduce IL-17 (Roark et al., 2008; Stepanova et al., 2012). IL-17 isinvolved in innate immune response to many pathogens, includingE. coli (Sivick et al., 2010; Brereton et al., 2011) and plays a role inthe regulation of inflammation in the reproductive tract (Hirataet al., 2008; Scurlock et al., 2011).

The data generated for CCL25 were interesting. CCL25 is a che-mokine locally produced under homeostatic conditions. Its role in-volves the recruitment of cd T lymphocytes into the small intestineas shown in CCR9 knock-out mice, which have significantly re-duced numbers of cd intraepithelial T lymphocytes in the intestine(Uehara et al., 2002). Therefore, the decreased CCL25 expressionunder inflammatory conditions is not that surprising, although thisis the first time that production of CCL25 has been described in theuterus.

Conclusions

Pyometra is associated with an influx of leukocytes, includingneutrophils and lymphocytes into the uterus. The only lymphocytepopulation with significantly increased percentage during pyome-tra was the CD8� cd T lymphocyte. Pyometra was also associatedwith an up-regulated expression of pro-inflammatory cytokines/chemokines in the uterus.

Conflict of interest statement

None of the authors of this paper has a financial or personalrelationship with other people or organisations that could inappro-priately influence or bias the content of the paper.

Acknowledgements

The work was supported by the Ministry of Agriculture of theCzech Republic (MZE0002716202) and the Ministry of Education,Youth and Sports of the Czech Republic (AdmireVet; No. CZ 1.05/2.1.00/01.0006; ED0006/01/01). The authors would like to thankMrs Kotlarova of the Veterinary Research Institute for her helpwith lymphocyte isolation and Drs. Novotny and Janosovska, andMrs. Mrazkova from the University of Veterinary and Pharmaceu-tical Sciences Brno for their help with the collection of samplesused in the study.

The authors wish to thank Mr. Paul Veater (Bristol, United King-dom) for proofreading the manuscript.

References

Aggarwal, B.B., Samanta, A., Feldmann, M., 2000. TNF-a. In: Cytokine Reference.Academic Press, London, UK, pp. 413–434.

Arrighi, S., Cremonesi, F., Bosi, G., Groppetti, D., Pecile, A., 2007. Characterization of apopulation of unique granular lymphocytes in a bitch deciduoma, using a panelof histo- and immunohistochemical markers. Veterinary Pathology 44, 521–524.

Bartoskova, A., Vitasek, R., Leva, L., Faldyna, M., 2007. Hysterectomy and antibiotictherapy leads to fast improvement of the hematological and immunologicalparameters in bitches affected by pyometra. Journal of Small Animal Practice48, 564–568.

Brereton, C.F., Sutton, C.E., Ross, P.J., Iwakura, Y., Pizza, M., Rappuoli, R., Lavelle, E.C.,Mills, K.H., 2011. Escherichia coli heat-labile enterotoxin promotes protectiveTh17 responses against infection by driving innate IL-1 and IL-23 production.Journal of Immunology 186, 5896–5906.

Cobb, S.P., Watson, E.D., 1995. Immunohistochemical study of immune cells in thebovine endometrium at different stages of the oestrous cycle. Research inVeterinary Science 59, 238–241.

Dinarello, C.A., 2000. IL-1b. In: Cytokine Reference. Academic Press, London, UK, pp.351–374.

308 A. Bartoskova et al. / The Veterinary Journal 194 (2012) 303–308

Dow, C., 1959. The cystic hyperplasia–pyometra complex in the bitch. Journal ofComparative Pathology 69, 237–250.

Faldyna, M., Laznicka, A., Toman, M., 2001a. Immunosuppression in bitches withpyometra. Journal of Small Animal Practice 42, 5–10.

Faldyna, M., Leva, L., Knotigova, P., Toman, M., 2001b. Lymphocyte subsets inperipheral blood of dogs – A flow cytometric study. Veterinary Immunology andImmunopathology 82, 23–37.

Faldyna, M., Sinkora, J., Knotigova, P., Rehakova, Z., Moravkova, A., Toman, M., 2003.Flow cytometric analysis of bone marrow leukocytes in neonatal dogs.Veterinary Immunology and Immunopathology 95, 165–176.

Faldyna, M., Sinkora, J., Knotigova, P., Leva, L., Toman, M., 2005a. Lymphatic organdevelopment in dogs: Major lymphocyte subsets and activity. VeterinaryImmunology and Immunopathology 104, 239–247.

Faldyna, M., Nechvatalova, K., Sinkora, J., Knotigova, P., Leva, L., Krejci, J., Toman, M.,2005b. Experimental Actinobacillus pleuropneumoniae infection in piglets withdifferent types and levels of specific protection: Immunophenotypic analysis oflymphocyte subsets in circulation and respiratory mucosal lymphoid tissue.Veterinary Immunology and Immunopathology 107, 143–152.

Fransson, B.A., Ragle, C.A., 2003. Canine pyometra: An update on pathogenesis andtreatment. Compendium on Continuing Education for the PracticingVeterinarian 25, 602–611.

Glatzel, A., Wesch, D., Schiemann, F., Brandt, E., Janssen, O., Kabelitz, D., 2002.Patterns of chemokine receptor expression on peripheral blood gamma delta Tlymphocytes: Strong expression of CCR5 is a selective feature of V delta 2/Vgamma 9 gamma delta T cells. Journal of Immunology 168, 4920–4929.

Groppetti, D., Pecile, A., Arrighi, S., Di Giancamillo, A., Cremonesi, F., 2010.Endometrial cytology and computerized morphometric analysis of epithelialnuclei: A useful tool for reproductive diagnosis in the bitch. Theriogenology 73,927–941.

Hirata, T., Osuga, Y., Hamasaki, K., Yoshino, O., Ito, M., Hasegawa, A., Takemura, Y.,Hirota, Y., Nose, E., Morimoto, C., Harada, M., Koga, K., Tajima, T., Saito, S., Yano,T., Taketani, Y., 2008. Interleukin (IL)-17A stimulates IL-8 secretion,cyclooxygensase-2 expression, and cell proliferation of endometriotic stromalcells. Endocrinology 149, 1260–1267.

Kabelitz, D., Wesch, D., 2003. Features and functions of gamma delta Tlymphocytes: Focus on chemokines and their receptors. Critical Reviews inImmunology 23, 339–370.

Kaeoket, K., Persson, E., Dalin, A.M., 2001. The sow endometrium at different stagesof the oestrous cycle: Studies on morphological changes and infiltration by cellsof the immune system. Animal Reproduction Science 65, 95–114.

Kida, K., Maezono, Y., Kawate, N., Inaba, T., Hatoya, S., Tamada, H., 2010. Epidermalgrowth factor, transforming growth factor-alpha, and epidermal growth factorreceptor expression and localization in the canine endometrium during theestrous cycle and in bitches with pyometra. Theriogenology 73, 36–47.

Luster, A.D., 2002. The role of chemokines in linking innate and adaptive immunity.Current Opinion in Immunology 14, 129–135.

Noronha, L.E., Huggler, K.E., de Mestre, A.M., Miller, D.C., Antczak, D.F., 2012.Molecular evidence for natural killer-like cells in equine endometrial cups.Placenta 33, 379–386.

Qin, S., Rottman, J.B., Myers, P., Kassam, N., Weinblatt, M., Loetscher, M., Koch, A.E.,Moser, B., Mackay, C.R., 1998. The chemokine receptors CXCR3 and CCR5 marksubsets of T cells associated with certain inflammatory reactions. Journal ofClinical Investigation 101, 746–754.

Roark, C.L., Simonian, P.L., Fontenot, A.P., Born, W.K., O’Brien, R.L., 2008. Gammadelta T cells: An important source of IL-17. Current Opinion in Immunology 20,353–357.

Schlotter, Y.M., Veenhof, E.Z., Brinkhof, B., Rutten, V.P., Spee, B., Willemse, T.,Penning, L.C., 2009. A GeNorm algorithm-based selection of reference genes forquantitative real-time PCR in skin biopsies of healthy dogs and dogs with atopicdermatitis. Veterinary Immunology and Immunopathology 129, 115–118.

Scurlock, A.M., Frazer, L.C., Andrews Jr, C.W., O’Connell, C.M., Foote, I.P., Bailey, S.L.,Chandra-Kuntal, K., Kolls, J.K., Darville, T., 2011. Interleukin-17 contributes togeneration of Th1 immunity and neutrophil recruitment during Chlamydiamuridarum genital tract infection but is not required for macrophage influx ornormal resolution of infection. Infection and Immunity 79, 1349–1362.

Sinkora, J., Samankova, P., Kummer, V., Leva, L., Maskova, J., Rehakova, Z., Faldyna,M., 2007. Commercially available rabbit anti-human polyclonal antisera as auseful tool for immune system studies in veterinary species. VeterinaryImmunology and Immunopathology 119, 156–162.

Sivick, K.E., Schaller, M.A., Smith, S.N., Mobley, H.L., 2010. The innate immuneresponse to uropathogenic Escherichia coli involves IL-17A in a murine model ofurinary tract infection. Journal of Immunology 184, 2065–2075.

Stepanova, H., Mensikova, M., Chlebova, K., Faldyna, M., 2012. CD4+ and cdTCR+ Tlymphocytes are sources of interleukin-17 in swine. Cytokine 58, 152–157.

Tamassia, N., Calzetti, F., Ear, T., Cloutier, A., Gasperini, S., Bazzoni, F., McDonald, P.P.,Cassatella, M.A., 2007. Molecular mechanisms underlying the synergisticinduction of CXCL10 by LPS and IFN-gamma in human neutrophils. EuropeanJournal of Immunology 37, 2627–2634.

Uehara, S., Grinberg, A., Farber, J.M., Love, P.E., 2002. A role for CCR9 in T lymphocytedevelopment and migration. Journal of Immunology 168, 2811–2819.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Peape, A.,Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCRdata by geometric averaging of multiple internal control genes. Genome Biology3, 7.

Wira, C.R., Fahey, J.V., Sentman, C.L., Pioli, P.A., Shen, L., 2005. Innate and adaptiveimmunity in female genital tract: Cellular responses and interactions.Immunological Reviews 206, 306–335.

Yang, H., Parkhouse, R.M., 1996. Phenotypic classification of porcine lymphocytesubpopulations in blood and lymphoid tissues. Immunology 89, 76–83.

Zelnickova, P., Matiasovic, J., Pavlova, B., Kudlackova, H., Kovaru, F., Faldyna, M.,2008. Quantitative nitric oxide production by rat, bovine and porcinemacrophages. Nitric Oxide: Biology and Chemistry 19, 36–41.