Gastroenterology® - BPG Management System

World Journal of

Gastroenterology

Volume 11 Number 21

June 7, 2005

Contents

www.wjgnet.com

Supported by NSFC2005-2006

3171 Resveratrol: A medical drug for acute pancreatitisMa ZH, Ma QY

3175 Kimchi and soybean pastes are risk factors of gastric cancerNan HM, Park JW, Song YJ, Yun HY, Park JS, Hyun T, Youn SJ, Kim YD, Kang JW, Kim H

3182 Co-expression of CDX2 and MUC2 in gastric carcinomas: Correlations withclinico-pathological parameters and prognosisRoessler K, Mönig SP, Schneider PM, Hanisch FG, Landsberg S, Thiele J, Hölscher AH,

Dienes HP, Baldus SE

3189 Quality of life in gastric cancerKaptein AA, Morita S, Sakamoto J

3197 Helicobacter pylori promote gastric cancer cells invasion through a NF-B andCOX-2-mediated pathwayWu CY, Wang CJ, Tseng CC, Chen HP, Wu MS, Lin JT, Inoue H, Chen GH

3204 Anti-gastric cancer active immunity induced by FasL/B7-1 gene-modifiedtumor cellsZheng SY, Li DC, Zhang ZD, Zhao J, Ge JF

3212 Relationship between abnormality of FHIT gene and EBV infection in gastriccancerXiao YP, Han CB, Mao XY, Li JY, Xu L, Ren CS, Xin Y

3217 Expression of some tumor associated factors in human carcinogenesis anddevelopment of gastric carcinomaZhao MD, Hu XM, Sun DJ, Zhang Q, Zhang YH, Meng W

3222 Relationship between matrix metalloproteinase-2 mRNA expression andclinicopathological and urokinase-type plasminogen activator system parametersand prognosis in human gastric cancerJi F, Chen YL, Jin EY, Wang WL, Yang ZL, Li YM

3227 Correlative studies on bFGF mRNA and MMP-9 mRNA expressions withmicrovascular density, progression, and prognosis of gastric carcinomasZhao ZS, Zhou JL, Yao GY, Ru GQ, Ma J, Ruan J

3234 Relationship between Epstein-Barr virus-encoded proteins with cellproliferation, apoptosis, and apoptosis-related proteins in gastric carcinomaWang Y, Luo B, Yan LP, Huang BH, Zhao P

3240 Mechanism and clinical significance of cyclooxygenase-2 expression in gastriccancerWang BC, Guo CQ, Sun C, Sun QL, Liu GY, Li DG

3245 Increased proliferation activity measured by immunoreactive Ki67 is associatedwith survival improvement in rectal/recto sigmoid cancerSalminen E, Palmu S, Vahlberg T, Roberts PJ, Söderström KO

3250 Link between colorectal cancer and polymorphisms in theuridine-diphosphoglucuronosyltransferase 1A7 and 1A1 genesTang KS, Chiu HF, Chen HH, Eng HL, Tsai CJ, Teng HC, Huang CS

REVIEW

ELSEVIER

National Journal Award2005

GASTRIC CANCER

COLORECTAL CANCER

www.wjgnet.com

Contents

World Journal of Gastroenterology

Volume 11 Number 21 June 7, 2005

3255 Deletion of cagA gene of Helicobacter pylori by PCR productsZeng X, He LH, Yin Y, Zhang MJ, Zhang JZ

3260 Relationship between serum cytokine levels and histopathological changes ofliver in patients with hepatitis BAkpolat N, Yahsi S, Godekmerdan A, Demirbag K, Yalniz M

3264 Interplay between nitric oxide and VIP in CCK-8-induced phasic contractileactivity in the rabbit sphincter of OddiPálvölgyi A, Sári R, Németh J, Szabolcs A, Nagy I, Hegyi P, Lonovics J, Szilvássy Z

3267 Predictors of common bile duct lithiasis in laparoscopic eraSgourakis G, Dedemadi G, Stamatelopoulos A, Leandros E, Voros D, Karaliotas K

3273 Helicobacter pylori serology in a birth cohort of New Zealanders from age 11to 26Fawcett JP, Barbezat GO, Poulton R, Milne BJ, Xia HHX, Talley NJ

3277 Gene expression in Barrett’s esophagus and reflux esophagitis induced bygastroduodenoesophageal reflux in ratsCheng P, Gong J, Wang T, Jie C, Liu GS, Zhang R

3281 Tissue distribution and excretion of 125I-lidamycin in mice and ratsLiu YP, Li QS, Huang YR, Liu CX

3285 Oncogenic role of clusterin overexpression in multistage colorectal tumorigenesisand progressionXie D, Sham JST, Zeng WF, Che LH, Zhang M, Wu HX, Lin HL, Wen JM, Lau SH, Hu L, Guan XY

3290 Raman spectra of single cell from gastrointestinal cancer patientsYan XL, Dong RX, Zhang L, Zhang XJ, Zhang ZW

3293 Expression of bcl-2 oncogene in gastric precancerous lesions and its correlationwith syndromes in traditional Chinese medicineHu L, Lao SX, Tang CZ

3297 Pivotal molecules of MHC I pathway in human primary hepatocellular carcinomaChen W, Cai MY, Wei DP, Wang X

3300 Construction of single chain Fv antibody against transferrin receptor and itsprotein fusion with alkaline phosphataseYang DF, Zhu HF, Wang ZH, Shen GX, Tian DY

3304 Mutation in D-loop region of mitochondrial DNA in gastric cancer and itssignificanceZhao YB, Yang HY, Zhang XW, Chen GY

3307 Superior mesenteric artery syndrome following scoliosis surgery: Its riskindicators and treatment strategyZhu ZZ, Qiu Y

3311 Hand-assisted laparoscopic surgery for complex gallstone disease: A reportof five casesWei Q, Shen LG, Zheng HM

3315 Portal venous stent placement for treatment of portal hypertension causedby benign main portal vein stenosisShan H, Xiao XS, Huang MS, Ouyang Q, Jiang ZB

3319 Expression of gamma-aminobutyric acid A receptor subunits 1, 1, 2 mRNAin rats with hepatic encephalopathyLi XQ, Dong L, Liu ZH, Luo JY

3323 Occult celiac disease prevents penetrance of hemochromatosisGeier A, Gartung C, Theurl I, Weiss G, Lammert F, Dietrich CG, Weiskirchen R, Zoller H,

Hermanns B, Matern S

CASE REPORT

Helicobacter pylori

BRIEF REPORTS

www.wjgnet.com

Contents

World Journal of Gastroenterology

Volume 11 Number 21 June 7, 2005

HONORARY EDITORS-IN-CHIEFKe-Ji Chen, BeijingDai -Ming Fan, Xi’anZhi-Qiang Huang, BeijingNicholas F LaRusso, RochesterJie-Shou Li, NanjingGeng-Tao Liu, BeijingFa-Zu Qiu, WuhanEamonn M Quigley, CorkDavid S Rampton, LondonRudi Schmid, CaliforniaNicholas Joseph Talley, RochesterZhao-You Tang, ShanghaiGuido NJ Tytgat, AmsterdamMeng-Chao Wu, ShanghaiXian-Zhong Wu, TianjinHui Zhuang, BeijingJia-Yu Xu, Shanghai

PRESIDENT AND EDITOR-IN-CHIEFLian-Sheng Ma, Beijing

EDITOR-IN-CHIEFBo- Rong Pan, Xi’an

ASSOCIATE EDITORS-IN-CHIEFBruno Annibale, RomaHenri Bismuth, VillesuifJordi Bruix, BarcelonaRoger William Chapman, OxfordAlexander L Gerbes, MunichShou-Dong Lee, TaipeiWalter Edwin Longo, New HavenYou-Yong Lu, BeijingMasao Omata, TokyoHarry H-X Xia, Hong Kong

EDITORIAL BOARDSee full details flyleaf I-V

DEPUTY EDITORMichelle Gabbe, Xian-Lin Wang

ASSOCIATE MANAGING EDITORSJian-Zhong Zhang, Shi-Yu Guo

EDITORIAL OFFICE MANAGERJing-Yun Ma

EDITORIAL ASSISTANTJuan Li

TECHNICAL EDITORSMeng Li, Shao-Hua Li, Xi Li, Hu Wang

PROOFREADERSHong Li, Wen-Jian Mei, Shi-Yu Guo

PUBLISHED JOINTLY BYThe WJG Press and Elsevier Inc

PRINTING GROUPPrinted in Beijing on acid-free paper byBeijing Kexin Printing House

COPYRIGHT© 2005 Published jointly by The WJG Pressand Elsevier Inc. All rights reserved; no partof this publication may be reproduced,stored in a retrieval system, or transmittedin any form or by any means, electronic,mechanical, photocopying, recording, orotherwise without the prior permission of

The WJG Press and Elsevier Inc. Authorare required to grant WJG an exclusivelicence to publish. Print ISSN 1007-9327CN 14-1219/R.

SPECIAL STATEMENTAll articles published in this journal representthe viewpoints of the authors except whereindicated otherwise.

EDITORIAL OFFICEEditor: World Journal of Gastroenterology,The WJG Press, Apartment 1066 YishouGarden, 58 North Langxinzhuang Road,PO Box 2345, Beijing 100023, ChinaTelephone: +86-(0)10-85381901-1023Fax: +86-10-85381893E-mail: [email protected]://www.wjgnet.com

Public Relationship ManagerShi-Yu GuoThe WJG Press, Apartment 1066 YishouGarden, 58 North Langxinzhuang Road,PO Box 2345, Beijing 100023, ChinaTelephone: +86-(0)10-85381901-1023Fax: +86-10-8538 1893E-mail: [email protected]://www.wjgnet.com

SUBSCRIPTION INFORMATIONForeignElsevier (Singapore) Pte Ltd, 3 Killiney Road#08-01, Winsland House I, Singapore 239519Telephone: +65-6349 0200Fax: +65-6733 1817

World Journal of Gastroenterology ( World J Gastroenterol , WJG ), a leading international journal in gastroenterology and hepatology, has an established reputation

for publishing first class research on esophageal cancer, gastric cancer, liver cancer, viral hepatitis, colorectal cancer, and Helicobacter pylori infection, providing

a forum for both clinicians and scientists, and has been indexed and abstracted in Index Medicus, MEDLINE, PubMed, Chemical Abstracts, EMBASE,Abstracts Journals, Nature Clinical Practice Gastroenterology and Hepatology, CAB Abstracts and Global Health. Impact factor of ISI JCR during 2000-2003

is 0.993, 1.445, 2.532 and 3.318 respectively. WJG is a weekly journal published jointly by The WJG Press and Elsevier Inc. The publication date is on 7th,

14th, 21st, and 28th every month. The WJG is supported by The National Natural Science Foundation of China, No. 30224801 and No.30424812, which wasfounded with a name of China National Journal of New Gastroenterology on October 1,1995, and renamed as WJG on January 25, 1998.

E-mail: [email protected]

http://asia.elsevierhealth.com

Institutional Rates Print-2005 rates: USD1 500.00

Personal Rates Print-2005 rates: USD700.00

Domestic

Local Post Offices Code No. BM 82-261

Author Reprints

The WJG Press, Apartment 1066 Yishou

Garden, 58 North Langxinzhuang Road,

PO Box 2345, Beijing 100023, China

Telephone: +86-(0)10-85381901-1023

Fax: +86-10-85381893


http://www.wjgnet.com

ADVERTISING

Rosalia Da Carcia

Elsevier Science

Journals Marketing & Society Relations

Health Science Asia

3 Killiney Road #08-01, Winsland House 1

Singapore 239519

Telephone: +65-6349 0200

Fax +65- 6733 1817


http://asia.elsevierhealth.com

INSTRUCTIONS TO AUTHORS

Full instructions are available online at

http://www.wjgnet.com/wjg/help/

instructions.jsp If you do not have web

access please contact the editorial office.

I-V Editorial Board

ISI journal citation reports 2003-GASTROENTEROLOGY AND HEPATOLOGY

E-journal of World Journal of Gastroenterology

FLYLEAF

INSIDE FRONT COVER

INSIDE BACK COVER

Editorial Coordinator for this issue: Anitha Kumaran

1A Meetings

2A Instructions to authors

4A World Journal of Gastroenterology standard of quantities and units

APPENDIX

ACKNOWLEDGMENTS 3330 Acknowledgments to reviewers for this issue

3327 Manipulation of enteric flora in ulcerative colitisGuslandi M

3328 A diagnostic approach to abdominal tuberculosisVardareli E, Kircali B

3329 Endoscopic biopsy: Duodenal ulcer penetrating into liverKircali B, Saricam T, Ozakyol A, Vardareli E

LETTERS TO THEEDITOR

www.wjgnet.com

World Journal of

Gastroenterology®

Editorial Board

2004-2006

Published by The WJG Press and Elsevier Inc., PO Box 2345, Beijing 100023, ChinaFax: +86-(0)10-85381893 E-mail: [email protected] http://www.wjgnet.com

HONORARY EDITORS-IN-CHIEF

Ke-Ji Chen, Beijing

Dai -Ming Fan, Xi’an

Zhi-Qiang Huang, Beijing

Nicholas F LaRusso, Rochester

Jie-Shou Li, Nanjing

Geng-Tao Liu, Beijing

Fa-Zu Qiu, Wuhan

Eamonn M Quigley, Cork

David S Rampton, London

Rudi Schmid, California

Nicholas Joseph Talley, Rochester

Zhao-You Tang, Shanghai

Guido NJ Tytgat, Amsterdam

Meng-Chao Wu, Shanghai

Xian-Zhong Wu, Tianjin

Hui Zhuang, Beijing

Jia-Yu Xu, Shanghai

PRESIDENT AND EDITOR-IN-CHIEF

Lian-Sheng Ma, Beijing

EDITOR-IN-CHIEF

Bo- Rong Pan, Xi’an

ASSOCIATE EDITORS-IN-CHIEF

Bruno Annibale, Roma

Henri Bismuth, Villesuif

Jordi Bruix, Barcelona

Roger William Chapman, Oxford

Alexander L Gerbes, Munich

Shou-Dong Lee, Taipei

Walter Edwin Longo, New Haven

You-Yong Lu, Beijing

Masao Omata, Tokyo

Harry H-X Xia, Hong Kong

MEMBERS OF THE EDITORIAL BOARD

Albania

Bashkim Resuli, Tirana

Algeria

Hocine Asselah, Algiers

Argentina

Julio Horacio Carri, Córdoba

Australia

Darrell HG Crawford, Brisbane

Robert JL Fraser, Daw Park

Yik-Hong Ho, Townsville

Gerald J Holtmann, Adelaide

Michael Horowitz, Adelaide

Riordan SM, Sydney

IC Roberts-Thomson, Adelaide

James Toouli, Adelaide

Austria

Dragosics BA, Vienna

Peter Ferenci, Vienna

Alfred Gangl, Vienna

Michael Trauner, Graz

Harald Vogelsang, Vienna

Belarus

Yury K Marakhouski, Minsk

Belgium

Geerts AEC, Brussels

Cremer MC, Brussels

Yves J Horsmans, Brussels

Yvan Vandenplas, Brussels

Eddie Wisse, Keerbergen

Brazil

Heitor Rosa, Goiania

www.wjgnet.com

Bulgaria

Zahariy Alexandrov Krastev, Sofia

Canada

Wang-Xue Chen, Ottawa

Richard N Fedorak, Edmonton

Hugh James Freeman, Vancouver

Samuel S Lee, Calgary

Philip Martin Sherman, Toronto

Alan BR Thomson, Edmonton

Eric M Yoshida, Vancouver

China

Francis KL Chan, Hong Kong

Xiao-Ping Chen, Wuhan

Jun Cheng, Beijing

Chi-Hin Cho, Hong Kong

Zong-Jie Cui, Beijing

Da-Jun Deng, Beijing

Er-Dan Dong, Beijng

Sheung-Tat Fan, Hong Kong

Xue-Gong Fan, Changsha

Jin Gu, Beijing

De-Wu Han, Taiyuan

Shao-Heng He, Shantou

Fu-Lian Hu, Beijing

Wayne HC Hu, Hong Kong

Ching Lung Lai, Hong Kong

Kam Chuen Lai, Hong Kong

Wai-Keung Leung, Hong Kong

Zhi-Hua Liu, Beijing

Ai- Ping Lu, Beijing

Jing-Yun Ma, Beijing

Lun-Xiu Qin, Shanghai

Yu-Gang Song, Guangzhou

Peng Shang, Xi’an

Qin Su, Beijing

Yuan Wang, Shanghai

Benjamin Wong, Hong Kong

Wai-Man Wong, Hong Kong

Hong Xiao, Shanghai

Dong-Liang Yang, Wuhan

Xue-Biao Yao, Hefei

Yuan Yuan, Shenyang

Man-Fung Yuen, Hong Kong

Jian-Zhong Zhang, Beijing

Zhi-Rong Zhang, Chengdu

Xiao-Hang Zhao, Beijing

Shu Zheng, Hangzhou

Costa Rica

Edgar M Izquierdo, San José

Croatia

Marko Duvnjak, Zagreb

Denmark

Flemming Burcharth, Herlev

Peter Bytzer, Copenhagen

Hans Gregersen, Aalborg

Jens H Henriksen, Hvidovre

Fin Stolze Larsen, Copenhagen

Søren Møller, Hvidovre

Egypt

Abdel-Rahman El-Zayadi, Giza

Finland

Pentti Sipponen, Espoo

France

Charles Paul Balabaud, Bordeaux

Jacques Belghiti, Clichy

Pierre Brissot, Rennes

Franck Carbonnel, Besancon

Bruno Clément, Rennes

Jacques Cosnes, Paris

Francoise Degos, Clichy

Francoise Lunel Fabian, Angers

Gérard Feldmann, Paris

Jean Fioramonti, Toulouse

Rene Lambert, Lyon

Didier Lebrec, Clichy

Francis Mégraud, Bordeaux

Richard Moreau, Clichy

Jose Sahel, Marseille

Jean-Yves Scoazec, Lyon

Jean-Pierre Henri Zarski, Grenoble

Germany

HD Allescher, Garmisch-Partenkirchen

Rudolf Arnold, Marburg

Hubert Blum, Freiburg

Peter Born, Muchen

Heinz J Buhr, Berlin

Haussinger Dieter, Düsseldorf

Dietrich CF, Bad Mergentheim

Wolfram W Domschke, Muenster

Ulrich Robert Fölsch, Kiel

Peter R Galle, Mainz

Burkhard Göke, Munich

Axel M Gressner, Aachen

Eckhart Georg Hahn, Erlangen

Werner Hohenberger, Erlangen

RG Jakobs, Ludwigshafen

Joachim Labenz, Siegen

Ansgar W Lohse, Hamburg

Peter Malfertheiner, Magdeburg

Andrea Dinah May, Wiesbaden

Stephan Miehlke, Dresden

Gustav Paumgartner, Munich

Ulrich Ks Peitz, Magdeburg

Giuliano Ramadori, Göttingen

Tilman Sauerbruch, Bonn

Hans Seifert, Oldenburg

J Ruediger Siewert, Munich

Manfred V Singer, Mannheim

Jurgen M Stein, Frankfurt

Manfred Stolte, Bayreuth

Wolfgang R Stremmel, Heidelberg

Hans Ludger Tillmann, Leipzig

Siegfried Wagner, Deggendorf

Bertram Wiedenmann, Berlin

Greece

Arvanitakis C, Thessaloniki

Elias A Kouroumalis, Heraklion

Hungary

Simon A László, Szekszárd

János Papp, Budapest

Iceland

Hallgrimur Gudjonsson, Reykjavik

India

Sujit Kumar Bhattacharya, Kolkata

Chawla YK, Chandigarh

Radha Dhiman K, Chandigarh

Sri Prakash Misra, Allahabad

Kartar Singh, Lucknow

Iran

Reza Malekzadeh, Tehran

Israel

Abraham Rami Eliakim, Haifa

Yaron Niv, Pardesia

Italy

Giovanni Addolorato, Roma

Alfredo Alberti, Padova

Annese V, San Giovanni Rotondo

Giovanni Barbara, Bologna

Gabrio Bassotti, Perugia

Franco Bazzoli, Bologna

Adolfo Francesco Attili, Roma

Antomio Benedetti, Ancona

Giovanni Cammarota, Roma

Antonino Cavallari, Bologna

Dario Conte, Milano

Gino Roberto Corazza, Pavia

Guido Costamagua, Roma

Antonio Craxi, Palermo

Fabio Farinati, Padua

Giovanni Gasbarrini, Roma

Paolo Gentilini, Florence

Edoardo G Giannini, Genoa

www.wjgnet.com

Paolo Gionchetti, Bologna

Roberto De Giorgio, Bologna

Mario Guslandi, Milano

Giovanni Maconi, Milan

Giulio Marchesini, Bologna

Giuseppe Montalto, Palermo

Luisi Pagliaro, Palermo

Fabrizio R Parente, Milan

Perri F, San Giovanni Rotondo

Raffaele Pezzilli, Bologna

Pilotto A, San Giovanni Rotondo

Massimo Pinzani, Firenze

Gabriele Bianchi Porro, Milano

Piero Portincasa, Bari

Giacomo Laffi, Firenze

Enrico Roda, Bologna

Massimo Rugge, Padova

Vincenzo Savarino, Genova

Vincenzo Stanghellini, Bologna

Calogero Surrenti, Florence

Roberto Testa, Genoa

Dino Vaira, Bologna

Japan

Kyoichi Adachi, Izumo

Takashi Aikou, Kagoshima

Taiji Akamatsu, Matsumoto

Takafumi Ando, Nagoya

Akira Andoh, Otsu

Taku Aoki, Tokyo

Masahiro Arai, Tokyo

Tetsuo Arakawa, Osaka

Yasuji Arase, Tokyo

Masahiro Asaka, Sapporo

Hitoshi Asakura, Tokyo

Yutaka Atomi, Tokyo

Takeshi Azuma, Fukui

Nobuyuki Enomoto, Yamanashi

Kazuma Fujimoto, Saga

Toshio Fujioka, Oita

Yoshihide Fujiyama, Otsu

Hiroyuki Hanai, Hamamatsu

Kazuhiro Hanazaki, Nagano

Naohiko Harada, Fukuoka

Makoto Hashizume, Fukuoka,

Tetsuo Hayakawa, Nagoya

Kazuhide Higuchi, Osaka

Ichiro Hirata, Osaka

Keiji Hirata, Kitakyushu

Takafumi Ichida, Shizuoka

Kenji Ikeda, Tokyo

Kohzoh Imai, Sapporo

Fumio Imazeki, Chiba

Masayasu Inoue, Osaka

Hiromi Ishibashi, Nagasaki

Shunji Ishihara, Izumo

Toru Ishikawa, Niigata

Kei Ito, Sendai

Masayoshi Ito, Tokyo

Hiroaki Itoh, Akita

Hiroshi Kaneko, Aichi-Gun

Shuichi Kaneko, Kanazawa

Takashi Kanematsu, Nagasaki

Junji Kato, Sapporo

Mototsugu Kato, Sapporo

Shinzo Kato, Tokyo

Sunao Kawano, Osaka

Yoshikazu Kinoshita, Izumo

Masaki Kitajima, Tokyo

Tsuneo Kitamura, Chiba

Seigo Kitano, Oita

Hironori Koga, Kurume

Satoshi Kondo, Sapporo

Shoji Kubo, Osaka

Shigeki Kuriyama, Kagawa

Masato Kusunoki, Mie

Takashi Maeda, Fukuoka

Shin Maeda, Tokyo

Osamu Matsui, Kanazawa

Yasushi Matsuzaki, Tsukuba

Hiroto Miwa, Hyogo

Masashi Mizokami, Nagoya

Motowo Mizuno, Hiroshima

Morito Monden, Suita

Hisataka S Moriwaki, Gifu

Yoshiharu Motoo, Kanazawa

Akihiro Munakata, Hirosaki

Kazunari Murakami, Oita

Kunihiko Murase, Tusima

Masato Nagino, Nagoya

Yujl Naito, Kyoto

Hisato Nakajima, Tokyo

Hiroki Nakamura, Yamaguchi

Shotaro Nakamura, Fukuoka

Akimasa Nakao, Nagoya

Mikio Nishioka, Niihama

Susumu Ohmada, Maebashi

Masayuki Ohta, Oita

Tetsuo Ohta, Kanazawa

Susumu Okabe, Kyoto

Katsuhisa Omagari, Nagasaki

Saburo Onishi, Nankoku

Morikazu Onji, Ehime

Hiromitsu Saisho, Chiba

Hidetsugu Saito, Tokyo

Takafumi Saito, Yamagata

Isao Sakaida, Yamaguchi

Michiie Sakamoto, Tokyo

Iwao Sasaki, Sendai

Motoko Sasaki, Kanazawa

Chifumi Sato, Tokyo

Shuichi Seki, Osaka

Hiroshi Shimada, Yokohama

Mitsuo Shimada, Tokushima

Hiroaki Shimizu, Chiba

Tooru Shimosegawa, Sendai

Tadashi Shimoyama, Hirosaki

Ken Shirabe, Iizuka City

Yoshio Shirai, Niigata

Katsuya Shiraki, Mie

Yasushi Shiratori, Okayama

Yasuhiko Sugawara, Tokyo

Toshiro Sugiyama, Toyama

Kazuyuki Suzuki, Morioka

Hidekazu Suzuki, Tokyo

Tadatoshi Takayama, Tokyo

Tadashi Takeda, Osaka

Koji Takeuchi, Kyoto

Kiichi Tamada, Tochigi

Akira Tanaka, Kyoto

Eiji Tanaka, Matsumoto

Noriaki Tanaka, Okayama

Shinji Tanaka, Hiroshima

Kyuichi Tanikawa, Kurume

Tadashi Terada, Shizuoka

Akira Terano, Shimotsugagun

Kazunari Tominaga, Osaka

Hidenori Toyoda, Ogaki

Akihito Tsubota, Chiba

Shingo Tsuji, Osaka

Takato Ueno, Kurume

Shinichi Wada, Tochigi

Hiroyuki Watanabe, Kanazawa

Sumio Watanabe, Akita

Toshio Watanabe, Osaka

Yuji Watanabe, Ehime

Chun-Yang Wen, Nagasaki

Koji Yamaguchi, Fukuoka

Takayuki Yamamoto, Yokkaichi

Takashi Yao, Fukuoka

Hiroshi Yoshida, Tokyo

Masashi Yoshida, Tokyo

Norimasa Yoshida, Kyoto

Kentaro Yoshika, Toyoake

Masahide Yoshikawa, Kashihara

Lithuania

Sasa Markovic, Japljeva

Macedonia

Vladimir Cirko Serafimoski, Skopje

Malaysia

Andrew Seng Boon Chua, Ipoh

Jayaram Menon, Sabah

Khean-Lee Goh, Kuala Lumpur

Monaco

Patrick Rampal, Monaco

Netherlands

Louis MA Akkermans, Utrecht

Karel Van Erpecum, Utrecht

Albert K Groen, Amsterdam

Dirk Joan Gouma, Amsterdam

Jan BMJ Jansen, Nijmegen

Evan Anthony Jones, Abcoude

Ernst Johan Kuipers, Rotterdam

Chris JJ Mulder, Amsterdam

Michael Müller, Wageningen

www.wjgnet.com

Pena AS, Amsterdam

Andreas Smout, Utrecht

RW Stockbrugger, Maastricht

GP Vanberge-Henegouwen,

Utrecht

New Zealand

Ian David Wallace, Auckland

Norway

Trond Berg, Oslo

Helge Lyder Waldum, Trondheim

Pakistan

Muhammad S Khokhar, Lahore

Philippines

Eulenia Rasco Nolasco, Manila

Poland

Tomasz Brzozowski, Cracow

Andrzej Nowak, Katowice

Portugal

Miguel Carneiro De Moura, Lisbon

Russia

Vladimir T Ivashkin, Moscow

Leonid Lazebnik, Moscow

Vasiliy I Reshetnyak, Moscow

Singapore

Bow Ho, Kent Ridge

Francis Seow-Choen, Singapore

Slovakia

Anton Vavrecka, Bratislava

South Africa

Michael C Kew, Parktown

South Korea

Jin-Hong Kim, Suwon

Myung-Hwan Kim, Seoul

Yun-Soo Kim, Seoul

Yung-Il Min, Seoul

Jae-Gahb Park, Seoul

Dong Wan Seo, Seoul

Spain

Abraldes JG, Barcelona

Fernando Azpiroz, Barcelona

Ramon Bataller, Barcelona

Josep M Bordas, Barcelona

Maria Buti, Barcelon

Xavier Calvet, Sabadell

Antoni Castells, Barcelona

Manuel Daz-Rubio, Madrid

Juan C Garcia-Pagán, Barcelona

Genover JB, Barcelona

Javier P Gisbert, Madrid

Jaime Guardia, Barcelona

Angel Lanas, Zaragoza

Ricardo Moreno-Otero, Madrid

Julian Panes, Barcelona

Miguel Perez-Mateo, Alicante

Josep M Pique, Barcelona

Jesus Prieto, Pamplona

Luis Rodrigo, Oviedo

Sri Lanka

Janaka De Silva, Ragama

Swaziland

Gerd Kullak-Ublick, Zurich

Sweden

Lars Christer Olbe, Molndal

Curt Einarsson, Huddinge

Lars R Lundell, Stockholm

Xiao-Feng Sun, Linkoping

Switzerland

Christoph Beglinger, Basel

Michael W Fried, Zurich

Bruno Stieger, Zurich

Arthur Zimmermann, Berne

Turkey

Yusuf Bayraktar, Ankara

Figen Gurakan, Ankara

Cihan Yurdaydin, Ankara

United Kingdom

Axon ATR, Leeds

Paul Jonathan Ciclitira, London

Amar Paul Dhillon, London

Stuarts Forbes

Subrata Ghosh, London

Brian T Johnston, Belfast

David EJ Jones, Newcastle

Michael A Kamm, Harrow

Hong-Xiang Liu, Cambridge

Giorgina Mieli-Vergani, London

Nikolai V Naoumov, London

John P Neoptolemos, Liverpool

James Neuberger, Birmingham

Colm Antoine O’Morain, Dublin

Simon D Taylor-Robinson, London

Frank Ivor Tovey, Basingstoke

Min Zhao, Foresterhill

United States

Firas H Ac-Kawas, Washington

Gianfranco D Alpini, Temple

Paul Angulo, Rochester

Jamie S Barkin, Miami Beach

Todd Baron, Rochester

Kim Elaine Barrett, San Diego

Jennifer D Black, Buffalo

Xu Cao, Birmingham

David L Carr-Locke, Boston

Marc F Catalano, Milwaukee

Xian-Ming Chen, Rochester

James M Church, Cleveland

Vincent Coghlan, Beaverton

James R Connor, Hershey

Pelayo Correa, New Orleans

John Cuppoletti, Cincinnati

Peter V Danenberg, Los Angeles

Kiron Moy Das, New Brunswick

Hala El-Zimaity, Houston

Ronnie Fass, Tucson

Emma E Furth, Pennsylvania

John Geibel, New Haven

Graham DY, Houston

Joel S Greenberger, Pittsburgh

Anna S Gukovskaya, Los Angeles

Gavin Harewood, Rochester

Atif Iqbal, Omaha

Hajime Isomoto, Rochester

Dennis M Jensen, Los Angeles

Leonard R Johnson, Memphis

Peter James Kahrilas, Chicago

Anthony Nicholas Kalloo, Baltimore

Neil Kaplowitz, Los Angeles

Emmet B Keeffe, Palo Alto

Joseph B Kirsner, Chicago

Burton I Korelitz, New York

Robert J Korst, New York

Richard A Kozarek, Seattle

Shiu-Ming Kuo, Buffalo

Frederick H Leibach, Augusta

Andreas Leodolter, La Jolla

Ming Li, New Orleans

Lenard M Lichtenberger, Houston

Gary R Lichtenstein, Philadelphia

Josep M Llovet, New York

Martin Lipkin, New York

www.wjgnet.com

Robin G Lorenz, Birmingham

James David Luketich, Pittsburgh

Henry Thomson Lynch, Omaha

Paul Martiw, New York

Richard W McCallum, Kansas City

Timothy H Moran, Baltimore

Hiroshi Nakagawa, Philadelphia

Douglas B Neison, Minneapalis

Juan J Nogueras, Weston

Curtis T Okamoto, Los Angeles

Pankaj Jay Pasricha, Galveston

Zhiheng Pei, New York

Pitchumoni CS, New Brunswiuc

Satish Rao, Iowa City

Adrian Reuben, Charleston

Victor E Reyes, Galveston

Richard E Sampliner, Tucson

Vijay H Shah, Rochester

Stuart Sherman, Indianapolis

Stuart Jon Spechler, Dallas

Michael Steer, Boston

Gary D Stoner, Columbus

Rakesh Kumar Tandon, New Delhi

Tchou-Wong KM, New York

Paul Joseph Thuluvath, Baltimore

Swan Nio Thung, New York

Travagli RA, Baton Rouge-La

Triadafilopoulos G, Stanford

David Hoffman Vanthiel, Mequon

Jian-Ying Wang, Baltimore

Kenneth Ke-Ning Wang, Rochester

Judy Van De Water, Davis

Steven David Wexner, Weston

Russell Harold Wiesner, Rochester

Keith Tucker Wilson, Baltimore

George Y Wu, Farmington

Jian Wu, Sacramento,

Chung Shu Yang, Piscataway

David Yule, Rochester

Michael Zenilman, Brooklyn

Yugoslavia

Jovanovic DM , Sremska Kamenica

Yogesh K Chawla, Chandigarh

Chiung-Yu Chen, Tainan

Gran-Hum Chen, Taichung

Li-Fang Chou, Taipei

Jennifer E Hardingham, Woodville

Ming-Liang He, Hong Kong

Li-Sung Hsu, Taichung

Guang-Cun Huang, Shanghai

Shinn-Jang Hwang, Taipei

Jia-Horng Kao, Taipei

Aydin Karabacakoglu, Konya

Sherif M Karam, Al-Ain

Tadashi Kondo, Tsukiji

Jong-Soo Lee, Nam-yang-ju

Lein-Ray Mo, Tainan

Kpozehouen P Randolph, Shanghgai

Bin Ren, Boston

Tetsuji Sawada, Osaka

Cheng-Shyong Wu, Cha-Yi

Ming-Shiang Wu, Taipei

Wei-Guo Zhu, Beijing

Manuscript reviewers ofWorld Journal of Gastroenterology

• REVIEW •

Resveratrol: A medical drug for acute pancreatitis

Zhen-Hua Ma, Qing-Yong Ma

EL SEVIER

PO Box 2345, Beijing 100023, China World J Gastroenterol 2005;11(21):3171-3174

www.wjgnet.com World Journal of Gastroenterology ISSN 1007-9327

[email protected] © 2005 The WJG Press and Elsevier Inc. All rights reserved.

Zhen-Hua Ma, Qing-Yong Ma, Division of General Surgery ofFirst Hospital of Xi’an Jiaotong University, Xi’an 710061, ShaanxiProvince, ChinaCorrespondence to: Dr. Zhen-Hua Ma, PhD, Division of GeneralSurgery of First Hospital of Xi’an Jiaotong University, Xi’an 710061,Shaanxi Province, China. [email protected]: +86-29-85324009 Fax: +86-29-85323536Received: 2004-07-23 Accepted: 2004-11-25

Abstract

Accumulating evidence demonstrates that resveratrol, anatural polyphenolic compound extracted from plants,inhibit inflammation when administered. It has directeffects on suppression of platelet coagulation and cytokinesproduction in many experimental models. Becausemicrocirculation occlusion and cytokines over-productionis involved in many diseases such as acute pancreatitis(AP), the discovery of resveratrol as platelet and cytokinesinhibitors has shed light on the treatment of AP, whichstill has significant mortality and morbidity. It is anticipatedthat this natural polyphenol could serve as a therapeuticcompound in managing AP through different pathways.

© 2005 The WJG Press and Elsevier Inc. All rights reserved.

Key words: Resveratrol; Drug; Acute pancreatitis

Ma ZH, Ma QY. Resveratrol: A medical drug for acutepancreatitis. World J Gastroenterol 2005; 11(21): 3171-3174

http://www.wjgnet.com/1007-9327/11/3171.asp

INTRODUCTION

Acute pancreatitis (AP) is an emergent and severe diseaseof peptic system and the plasma amylase and lipase valuesare elevated in most patients[1]. There are different factorsleading to AP. However, if dangerous factors are immediatelycleared off and do not produce the progressive injury, thepancreatic structure and function can recover to normal.On the contrary, pancreas would encounter injury if thelife-threatening factors could not be controlled. For example,severe AP can change the structure of pancreatic duct andfinally lead to chronic obstructive pancreatitis. Currently,the diagnosis and management of AP have already becomethe hot topic of research and has made great progress.

In 1940, Dr. Takaoka extracted resveratrol from plantand found its chemical structure as 3,4’,5-trihydroxy-trans-stibene[2]. In recent years, resveratrol has already been foundin about 70 plant species. The highest concentration ofresveratrol (50-100 µg/g) is found in grape skins. Many

biological characters of resveratrol have already been proved,including anti-inflammatory, anti-oxidation, chemopreventiveeffects, and inhibition of platelet aggregation[3-5]. From thealready admitted characters of resveratrol and the factorsleading to the occurrence of AP, we can draw a hypothesisthat resveratrol has beneficial effects on AP.

Role of cytokines and microcirculatory dysfunction in acute

pancreatitisThe transcription and nuclear factor kappa B (NF-kappaB) is an important substance of delivering intracellularsignals[6-8]. It can modulate inflammatory procedures andimmune reactions. It has already been proved that activationof NF-kappa B and NF-kappa B-medicated cytokineexpression can act as one of the major factors for initiatingand aggravating AP[9,10]. Furthermore, as an importantinflammatory cell of AP, macrophage can release lots ofcytokines that have multiple actions, overlap and synergizewith each other. Those would make AP prone to develop fromlocal disease to systemic inflammatory reaction syndrome(SIRS) and multiple organ system failure (MOSF)[11-13].

Microcirculatory dysfunction can induce AP as an initialfactor and constant microcirculation dysfunction canaggravate pancreatic injury[14,15]. A lot of documents havesuggested that the possible mechanism of microcirculatorydysfunction includes increased vascular permeability,reduced blood flow, leukocyte-endothelial cell interaction,ischemia/reperfusion injury, intravascular thrombusformation, and hypercoagulation[16-20]. The intervention inone or more of these processes can prevent at least partlythe development of microcirculatory dysfunction in AP[21,22].

The pancreas is an organ highly susceptible to ischemicdamage[23-25] and ischemia/reperfusion causes an inflammatoryreaction in AP[26]. Several experimental studies have foundthat ischemia is associated to pancreatic injury. Ischemia/reperfusion injury is increasingly recognized as a commonand important mechanism in the pathogenesis of AP andespecially in the progression from mild edematous to severenecrotizing form[27].

Effect of resveratrol on the production of cytokinesSurh et al[28], showed that resveratrol could suppress theactivation of NF-kappa B. Pellegatta et al[29], reported thatthe anti-inflammatory activity of resveratrol could bemediated by its interference with NF-kappa B dependenttranscription. In this study, the influence of resveratrol(≤1 mmol/L) on the NF-kappa B signaling pathway afterTNF- stimulation of endothelial cells was observed. Theresult indicated that the long-term treatment of resveratrolcould inhibit the nuclear appearance of NF-B in endothelialcells.

3172 ISSN 1007-9327 CN 14-1219/ R World J Gastroenterol June 7, 2005 Volume 11 Number 21

Besides, resveratrol can directly influence the productionof macrophage function molecules (inhibiting the productionof IL-6 and TNF)[30,31], which are all important inflammationmedium in the development of AP[32].

Effect of resveratrol on microcirculationMany studies have shown that resveratrol can affect themicrocirculation of different organs by different mechanisms.They include the effects of resveratrol on NO production,aggregation of platelets, ischemic/reperfusion injury, andtissue factor (TF) expression.

Giovannini et al, has shown that preconditioning thehearts with resveratrol, provided cardioprotection asevidenced by improved postischemic ventricular functionalrecovery (developed pressure and aortic flow) and reducedmyocardial infarct size. It was detected that resveratrol couldinduce the expression of inducible nitric oxide synthase(iNOS) mRNA beginning at 30 min after reperfusion andincreasing steadily up to 60 min after reperfusion. The resultssuggested that resveratrol can precondition the heart in anitric oxide (NO) dependent manner[33]. Other studiesinvestigated the effect of resveratrol on endothelial functionin hypercholesterolemic rabbits. By measuring of plasmaendothelia (ET-1) and NO levels, the researchers foundthat feeding a high cholesterol diet, significantly increasedplasma ET-1 and decreased plasma NO concentration. Withadministration of resveratrol, plasma ET-1 levels statisticallydecreased, in parallel with a significant elevation in NOlevel[34]. Wallerath et al [35], suggested that resveratrolupregulated NOS mRNA expression in endothelial cells.NOS protein expression and NOS-derived production werealso increased after long-term management of resveratrol.However, some trials drew the reverse conclusion, resveratrolregulating down the expression of NO[36,37], so furtherinvestigation should be performed.

By measuring platelet aggregation rate by Born’s method,Wang et al[38], stated that aggregation of platelets in vitro bycollagen (5 mg/mL), thrombin (0.33 units/mL), and ADP(4 mmol/L) was significantly inhibited by resveratrol ina concentration-dependent manner. Olas et al[39], showedthe preincubation of washed platelets with resveratrol(25-100 mg/mL, 30 min, 37 ℃), has an inhibitory effecton adhesion of platelet after being activated by LPSalone or LPS with thrombin and the strongest inhibitoryeffect was caused by resveratrol at the concentration of100 mg/mL. They drew the conclusion that resveratrol maybe an important compound responsible for the reductionof platelet adhesion and could change the reactivity ofblood platelets in inflammatory process. The study ofSuttnar et al[40], also supported that resveratrol has thecapacity of inhibiting the aggregation response of washedplatelet activated by collagen.

Shigematsu et al[41], reported that resveratrol preventsleukocyte recruitment and endothelial barrier disruption inthe ischemic/reperfusion injury model in rat constructedby exposing mesenteries to 60 min reperfusion following20 min ischemia and these effects may be related to theantioxidant properties of resveratrol. These results areconsistent with that of other researches on heart, whichsupported that resveratrol has a beneficial effect on

ischemia/reperfusion injury[42-45]. Bradamante et al[46], provedthat resveratrol can reduce ischemia/reperfusion injury intwo time-related cardiac models and long-term moderateresveratrol consumption could play a more significant rolein producing cardioprotective effects than short-term one.Moreover, as TF is a cell surface receptor for factor VII(a) and the binding of factor VII (a) to TF initiates, thecoagulation cascade. Pendurthi et al[47], have shown thatresveratrol inhibited the induction of TF expression inendothelial cells and mononuclear cells.

Therapeutic effect of resveratrol on APDue to its strong effect of inhibiting activation of NF-kappa B and reducing secondary activation of cytokines,resveratrol is regarded as a promising drug of blocking theinitiation and progress of AP. However, the current trialhas only proved the inhibiting effect of resveratrol on NF-kappa B from cellular level, its mechanism needs beillustrated with further studies.

Though NO function in AP is still obscure and hasdisagreements in the public, many scholars think that NOmay have a beneficial influence on the capillary organperfusions, reduce release of amylase and prevent thedevelopment of AP[48-50]. As resveratrol may induce theproduction of NO[4,51], it is possible for resveratrol toimprove the capillary organ perfusion in AP.

Pancreatic capillary endothelial barrier dysfunction is aninitial and characteristic feature of acute pancreatic injuryand pancreatitis, it is related to hypercoagulation[52], increasedvascular permeability and leukocyte adhesion. It is partlymanifested by increased platelet adhesion and aggregation.Resveratrol can inhibit platelet aggregation both in vitro andin vivo[53,54] and enhance the integrity of endothelium inatherosclerosis and cardiovascular disease and significantlyprevented the cytokine-induced vascular leakage, so it isalso possible for resveratrol to prevent the injury of vascularendothelium in AP and reduce the extent of bloodcoagulation[55,56].

DISCUSSION

Following the deep recognition of the pathogenesis in AP,there have been recently many changes in the managementof AP. Pure medical measures and surgical treatment havereverted to comprehensive management and operationshould be performed only when there is a secondaryinfection[57]. However, the current mortality of AP is stillvery high[58], and new measures are strongly needed.

Many new drugs have appeared as effective methods inmanaging AP and most of them exert therapeutic effectsthrough different pathways. Being extracted from plants,resveratrol is proved to have various pharmacologic activations(anti-inflammatory, antioxidation, chemopreventive effectsand inhibition of platelet aggregation). It has already beenregarded as an effective medical drug on the managementof arteriosclerosis, cardiac disease and tumor. Though thereis still no document to illustrate the function of resveratrolin AP, we can draw the conclusion from upper argumentsthat resveratrol can have some effects in the managementof acute parcreatitis by inhibiting the activation of cytokines

Ma ZH et al. Resveratrol for acute pancreatitis 3173

and in improving microcirculation. The primary trial in ourlaboratory has found that resveratrol could inhibit theproduction of TNF and IL-6 in pancreatitis, but moreresearches still need to be performed. Furthermore, itstoxicity and pharmacokinetics should be studied further.

REFERENCES1 Chase CW, Barker DE, Russell WL, Burns RP. Serum amy-

lase and lipase in the evaluation of acute abdominal pain. Am

Surg 1996; 62 : 1028-10332 Shen F, Chen SJ, Dong XJ, Zhong H, Li YT, Cheng GF. Sup-

pression of IL-8 gene transcription by resveratrol in phorbol

ester treated human monocytic cells. J Asian Nat Prod Res2003; 5: 151-157

3 Olas B, Wachowicz B. Biological activity of resveratrol. Postepy

Hig Med Dosw 2001; 55: 71-794 Bhat KPL JW, Pezzuto JM. Biological effects of resveratrol.

Antioxid Redox Signal 2001; 3: 1041-1064

5 Baolin L, Inami Y, Tanaka H, Inagaki N, Iinuma M, Nagai H.Resveratrol inhibits the release of mediators from bone mar-

row-derived mouse mast cells in vitro. Planta Med 2004; 70:

305-3096 Altavilla D, Famulari C, Passaniti M, Galeano M, Macri A,

Seminara P, Minutoli L, Marini H, Calo M, Venuti FS, Esposito

M, Squadrito F. Attenuated cerulein-induced pancreatitis innuclear factor-kappaB-deficient mice. Lab Invest 2003; 83 :

1723-1732

7 Liu HS, Pan CE, Liu QG, Yang W, Liu XM. Effect of NF-kappaB and p38 MAPK in activated monocytes/macroph-

ages on pro-inflammatory cytokines of rats with acute

pancreatitis. World J Gastroenterol 2003; 9: 2513-25188 Algul H, Tando Y, Schneider G, Weidenbach H, Adler G,

Schmid RM. Acute experimental pancreatitis and NF-

kappaB/Rel activation. Pancreatology 2002; 2: 503-509

9 Chen X, Ji B, Han B, Ernst SA, Simeone D, Logsdon CD. NF-kappaB activation in pancreas induces pancreatic and sys-

temic inflammatory response. Gastroenterology 2002; 122: 448-

4571 0 Seo JY, Kim H, Seo JT, Kim KH. Oxidative stress induced

cytokine production in isolated rat pancreatic acinar cells:

effects of small-molecule antioxidants. Pharmacology 2002;64 : 63-70

1 1 Mikami Y, Takeda K, Shibuya K, Qiu-Feng H, Shimamura

H, Yamauchi J, Egawa S, Sunamura M, Yagi H, Endo Y,Matsuno S. Do peritoneal macrophages play an essential role

in the progression of acute pancreatitis in rats? Pancreas 2003;

27 : 253-2601 2 Demydov VM, Zaporozhchenko BS, Demidov SM. Changes

of cytokine levels in the serum in patients with acute pancre-

atitis as an early symptom for diagnosis. Klin Khir 2003; 3 :29-32

1 3 Sakai Y, Masamune A, Satoh A, Nishihira J, Yamagiwa T,

Shimosegawa T. Macrophage migration inhibitory factor is acritical mediator of severe acute pancreatitis. Gastroenterology

2003; 124 : 725-736

1 4 Schmidt J, Ebeling D, Ryschich E, Werner J, Gebhard MM,Klar E. Pancreatic capillary blood flow in an improved model

of necrotizing pancreatitis in the rat. J Surg Res 2002; 106:

335-3411 5 Dobosz M, Hac S, Mionskowska L, Dobrowolski S, Wajda Z.

Microcirculatory disturbances of the pancreas in cerulein-in-

duced acute pancreatitis in rats with reference to L-arginine,heparin, and procaine treatment. Pharmacol Res 1997; 36: 123-

128

1 6 Gao HK, Zhou ZG, He T, Chen YQ, Han FH, Wang C. Effectsof TCMP-1 on the changes of platelet endothelial cell adhe-

sion molecule-1 expression in acute edematous pancreatitis.

Hepatobiliary Pancreat Dis Int 2004; 3: 311-3151 7 Hackert T, Werner J, Gebhard MM, Klar E. Effects of heparin

in experimental models of acute pancreatitis and post-ERCP

pancreatitis. Surgery 2004; 135: 131-138

1 8 Kaska M, Pospisilova B, Slizova D. Pathomorphologicalchanges in microcirculation of pancreas during experimental

acute pancreatitis. Hepatogastroenterology 2000; 47: 1570-1574

1 9 Sunamura M, Shibuya K, Yamauchi J, Matsuno S. Microcir-culatory derangement and ischemia of the pancreas. Nihon

Geka Gakkai Zasshi 1999; 100: 342-346

2 0 Schmidt J, Klar E. Etiology and pathophysiology of acutepancreatitis.Ther Umsch 1996; 53: 322-332

2 1 von Dobschuetz E, Bleiziffer O, Pahernik S, Dellian M,

Hoffmann T, Messmer K. Soluble complement receptor 1 pre-serves endothelial barrier function and microcirculation in

postischemic pancreatitis in the rat. Am J Physiol Gastrointest

Liver Physiol 2004; 286: G791-G7962 2 Werner J, Hartwig W, Schmidt E, Gebhard MM, Herfarth C,

Klar E. Reduction of local and systemic complications of acute

pancreatitis by monoclonal antibody to ICAM-1. LangenbecksArch Chir Suppl Kongressbd 1998; 115: 725-729

2 3 Obermaier R, Benz S, Kortmann B, Benthues A, Ansorge N,

Hopt UT. Ischemia/reperfusion-induced pancreatitis in rats:a new model of complete normothermic in situ ischemia of a

pancreatic tail-segment. Clin Exp Med 2001; 1: 51-59

2 4 Sakorafas GH, Tsiotos GG, Sarr MG. Ischemia/Reperfusion-Induced pancreatitis. Dig Surg 2000; 17: 3-14

2 5 Hoffmann TF, Leiderer R, Harris AG, Messmer K. Ischemia

and reperfusion in pancreas. Microsc Res Tech 1997; 37: 557-571

2 6 Hoffmann TF, Leiderer R, Waldner H, Arbogast S, Messmer

K. Ischemia reperfusion of the pancreas: a new in vivo modelfor acute pancreatitis in rats. Res Exp Med (Berl) 1995; 195:

125-144

2 7 Sakorafas GH, Tsiotou AG. Etiology and pathogenesis ofacute pancreatitis: current concepts. J Clin Gastroenterol 2000;

30 : 343-356

2 8 Surh YJ, Chun KS, Cha HH, Han SS, Keum YS, Park KK, LeeSS. Molecular mechanisms underlying chemopreventive ac-

tivities of anti-inflammatory phytochemicals: down-regula-

tion of COX-2 and iNOS through suppression of NF-kappa Bactivation. Mutat Res 2001; 480-481: 243-268

2 9 Pellegatta F, Bertelli AA, Staels B, Duhem C, Fulgenzi A,

Ferrero ME. Different short- and long-term effects of resveratrolon nuclear factor-kappaB phosphorylation and nuclear ap-

pearance in human endothelial cells. Am J Clin Nutr 2003; 77:

1220-12283 0 Culpitt SV, Rogers DF, Fenwick PS, Shah P, De Matos C,

Russell RE, Barnes PJ, Donnelly LE. Inhibition by red wine

extract, resveratrol, of cytokine release by alveolar macroph-ages in COPD. Thorax 2003; 58 : 942-946

3 1 Zhong M, Cheng GF, Wang WJ, Guo Y, Zhu XY, Zhang JT.

Inhibitory effect of resveratrol on interleukin 6 release by stimu-

lated peritoneal macrophages of mice. Phytomedicine 1999; 6:

79-84

3 2 Feng YH, Zou JP, Li XY. Effects of resveratrol and ethanol on

production of pro-inflammatory factors from endotoxin acti-

vated murine macrophages. Acta Pharmacol Sin 2002; 23: 1002-

1006

3 3 Hattori R, Otani H, Maulik N, Das DK. Pharmacological

preconditioning with resveratrol: role of nitric oxide. Am J

Physiol Heart Circ Physiol 2002; 282: H1988-H1995

3 4 Zou JG, Wang ZR, Huang YZ, Cao KJ, Wu JM. Effect of red

wine and wine polyphenol resveratrol on endothelial func-

tion in hypercholesterolemic rabbits. Int J Mol Med 2003; 11:

317-320

3 5 Wallerath T, Deckert G, Ternes T, Anderson H, Li H, Witte K,

Forstermann U. Resveratrol, a polyphenolic phytoalexin present

in red wine, enhances expression and activity of endothelial

nitric oxide synthase. Circulation 2002; 106: 1652-1658

3 6 Tsai SH, Lin-Shiau SY, Lin JK. Suppression of nitric oxide

synthase and the down-regulation of the activation of

NFkappaB in macrophages by resveratrol. Br J Pharmacol 1999;

126: 673-680

3 7 Roman V, Billard C, Kern C, Ferry-Dumazet H, Izard JC,

Mohammad R, Mossa layi DM, Kol b JP. Analysis of

resveratrol-induced apoptosis in human B-cel l chronicleukaemia. Br J Haematol 2002; 117: 842-851

3 8 Wang Z, Huang Y, Zou J, Cao K, Xu Y, Wu JM. Effects of red

wine and wine polyphenol resveratrol on platelet aggregationin vivo and in vitro. Int J Mol Med 2002; 9: 77-79

3 9 Olas B, Wachowicz B, Saluk-Juszczak J, Zielinski T. Effect of

resveratrol, a natural polyphenolic compound, on plateletactivation induced by endotoxin or thrombin. Thromb Res 2002;

107: 141-145

4 0 Suttnar J, Masova L, Scheiner T, Sorelova V, Dyr JE. Role offree radicals in blood platelet activation. Cas Lek Cesk 2002;

141 Suppl: 47-49

4 1 Shigematsu S, Ishida S, Hara M, Takahashi N, YoshimatsuH, Sakata T, Korthuis RJ. Resveratrol, a red wine constituent

polyphenol, prevents superoxide-dependent inflammatory

responses induced by ischemia/reperfusion, platelet-activat-ing factor, or oxidants. Free Radic Biol Med 2003; 34: 810-817

4 2 Hung LM, Su MJ, Chen JK. Resveratrol protects myocardial

ischemia-reperfusion injury through both NO-dependent andNO-independent mechanisms. Free Radic Biol Med 2004; 36:

774-781

4 3 de Lorgeril M, Salen P, Guiraud A, Boucher F, de Leiris J.Resveratrol and non-ethanolic components of wine in experi-

mental cardiology. Nutr Metab Cardiovasc Dis 2003; 13: 100-

1034 4 Cui J, Tosaki A, Bertelli AA, Bertelli A, Maulik N, Das DK.

Cardioprotection with white wine. Drugs Exp Clin Res 2002;

28: 1-104 5 Hung LM, Chen JK, Lee RS, Liang HC, Su MJ. Beneficial

effects of astringinin, a resveratrol analogue, on the ischemia

and reperfusion damage in rat heart. Free Radic Biol Med 2001;30 : 877-883

4 6 Bradamante S, Barenghi L, Piccinini F, Bertelli AA, De Jonge

R, Beemster P, De Jong JW. Resveratrol provides late-phasecardioprotection by means of a nitric oxide- and adenosine-

mediated mechanism. Eur J Pharmacol 2003; 465: 115-123

4 7 Pendurthi UR, Meng F, Mackman N, Rao LV. Mechanism of

resveratrol-mediated suppression of tissue factor geneexpression. Thromb Haemost 2002; 87: 155-162

4 8 DiMagno MJ, Williams JA, Hao Y, Ernst SA, Owyang C.

Endothelial nitric oxide synthase is protective in the initiationof caerulein-induced acute pancreatitis in mice. Am J Physiol

Gastrointest Liver Physiol 2004; 287: G80-G87

4 9 Zhang Z, Sun J, Li F, Zhang S, Cui Y, Sun H, Liu S. Protectiveeffect of nitric oxide on pancreas and its relation to sulfhydryl

compounds and oxygen free radicals. Zhonghua Waike Zazhi

2000; 38 : 928-9305 0 Dobosz M, Hac S, Wajda Z. Does nitric oxide protect from

microcirculatory disturbances in experimental acute pancre-

atitis in rats? Int J Microcirc Clin Exp 1996; 16: 221-2265 1 Taubert D, Berkels R. Upregulation and activation of eNOS

by resveratrol. Circulation 2003; 107: e78-e79; author reply

e78-e795 2 Vergara M, Modolell I, Puig-Divi V, Guarner L, Malagelada

JR. Acute pancreatitis as a triggering factor for thrombotic

thrombocytopenic purpura. Am J Gastroenterol 1998; 93: 2215-2218

5 3 Wang Z, Zou J, Huang Y, Cao K, Xu Y, Wu JM. Effect of

resveratrol on platelet aggregation in vivo and in vitro. ChinMed J (Engl) 2002; 115: 378-380

5 4 Huang SS, Tsai MC, Chih CL, Hung LM, Tsai SK. Resveratrol

reduction of infarct size in Long-Evans rats subjected to focalcerebral ischemia. Life Sci 2001; 69: 1057-1065

5 5 Slater SJ, Seiz JL, Cook AC, Stagliano BA, Buzas CJ. Inhibi-

tion of protein kinase C by resveratrol. Biochim Biophys Acta2003; 1637 : 59-69

5 6 Bertelli AA, Baccalini R, Battaglia E, Falchi M, Ferrero ME.

Resveratrol inhibits TNF alpha-induced endothelial cellactivation. Therapie 2001; 56: 613-616

5 7 Mitchell RM, Byrne MF, Baillie J. Pancreatitis. Lancet 2003;

361: 1447-14555 8 Yousaf M, McCallion K, Diamond T. Management of severe

acute pancreatitis. Br J Surg 2003; 90: 407-420

Science Editor Guo SY Language Editor Elsevier HK


• GASTRIC CANCER •

Kimchi and soybean pastes are risk factors of gastric cancer

Hong-Mei Nan, Jin-Woo Park, Young-Jin Song, Hyo-Yung Yun, Joo-Seung Park, Taisun Hyun, Sei-Jin Youn, Yong-Dae

Kim, Jong-Won Kang, Heon Kim

EL SEVIER




Hong-Mei Nan, Yong-Dae Kim, Jong-Won Kang, Heon Kim,Department of Preventive Medicine and Medical Research Institute,College of Medicine, Chungbuk National University, Cheongju, KoreaJin-Woo Park, Young-Jin Song, Hyo-Yung Yun, Department ofSurgery, College of Medicine, Chungbuk National University,Cheongju, KoreaJoo-Seung Park, Department of Surgery, Eulji University, Schoolof Medicine, Daejon, KoreaTaisun Hyun, Department of Food and Nutrition, ChungbukNational University, Cheongju, KoreaSei-Jin Youn, Department of Internal Medicine, College of Medicine,Chungbuk National University, Cheongju, KoreaSupported by the Korea Science and Engineering Foundation, No.2000-2-219-001-2Co-first-authors: Hong-Mei Nan and Jin-Woo ParkCo-correspondents: Young-Jin SongCorrespondence to: Dr. Heon Kim, Department of PreventiveMedicine, College of Medicine, Chungbuk National University, 12Kaeshin-dong, Hungdok-gu, Cheongju-si, Chungbuk 361-763,Korea. [email protected]: +82-43-261-2864 Fax: +82-43-274-2965Received: 2004-11-03 Accepted: 2005-01-13

Abstract

AIM: This case-control study investigated the effects ofkimchi, soybean paste, fresh vegetables, nonfermentedalliums, nonfermented seafood, nonfermented soybeanfoods, and the genetic polymorphisms of some metabolicenzymes on the risk of gastric cancer in Koreans.

METHODS: We studied 421 gastric cancer patients and632 age- and sex-matched controls. Subjects completeda structured questionnaire regarding their food intakepattern. Polymorphisms of cytochrome P450 1A1 (CYP1A1),cytochrome P450 2E1 (CYP2E1), glutathione S-transferasemu 1 (GSTM1), glutathione S-transferase theta 1 (GSTT1)and aldehyde dehydrogenase 2 (ALDH2) were investigated.

RESULTS: A decreased risk of gastric cancer was notedamong people with high consumption of nonfermentedalliums and nonfermented seafood. On the other hand,consumption of kimchi, and soybean pastes was associatedwith increased risk of gastric cancer. Individuals with theCYP1A1 Ile/Val or Val/Val genotype showed a significantlyincreased risk for gastric cancer. Increased intake of kimchior soybean pastes was a significant risk factor for theCYP1A1 Ile/Ile, the CYP2E1 c1/c1, the GSTM1 non-null,the GSTT1 non-null, or the ALDH2 *1/*1 genotype. Inaddition, eating soybean pastes was associated with theincreased risk of gastric cancer in individuals with theGSTM1 null type. Nonfermented alliums were significantin individuals with the CYP1A1 Ile/Ile, the CYP2E1 c1/c2

or c2/c2, the GSTT1 null, the GSTT1 non-null, or the ALDH2*1/*2 or *2/*2 genotype, nonfermented seafood wasthose with the CYP1A1 Ile/Ile, the CYP2E1 c1/c1, the ALDH2*1/*1 genotype or any type of GSTM1 or GSTT1. Inhomogeneity tests, the odds ratios of eating kimchi forgastric cancer according to the GSTM1 or GSTT1 genotypewere not homogeneous.

CONCLUSION: Kimchi, soybean pastes, and the CYP1A1Ile/Val or Val/Val are risk factors, and nonfermentedseafood and alliums are protective factors against gastriccancer in Koreans. Salt or some chemicals contained inkimchi and soybean pastes, which are increased byfermentation, would play important roles in thecarcinogenesis of stomach cancer. Polymorphisms of theCYP1A1, CYP2E1, GSTM1, GSTT1, and ALDH2 genes couldmodify the effects of some environmental factors on therisk of gastric cancer.


Key words: Kimchi; Soybean pastes; Gastric cancer

Nan HM, Park JW, Song YJ, Yun HY, Park JS, Hyun T, YounSJ, Kim YD, Kang JW, Kim H. Kimchi and soybean pastes arerisk factors of gastric cancer. World J Gastroenterol 2005;11(21): 3175-3181


INTRODUCTION

Stomach cancer is the most common cancer in Koreans[1],and the second leading site of cancer occurrence worldwide[2].Environmental factors including dietary habits are importantin its development[3,4]. Salted, smoked, pickled, and preservedfoods rich in salt, nitrite, and preformed N-nitroso compoundshave been reported to be associated with an increased riskof gastric cancer. In contrast, high intake of fresh fruit,raw vegetables, and antioxidants significantly reduced therisk of gastric cancer[5].

Since Crane et al [6] suggested a causal relationshipbetween intake of traditional Korean foods and gastriccancer, there have been debates whether kimchi and soybeanpaste are protective factors or risk factors for gastric cancer.Messina et al[7] suggested that there was an inconsistentrelationship between intake of soybean foods and stomachcancer; the risk seemed to increase with intake of fermentedsoybean foods and decrease with intake of nonfermentedsoybean foods. Kimchi and soybean pastes have been reportedas risk factors for gastric cancer in some epidemiologicalstudies[3,6] and as protective factors against gastric cancer in


others[8].Genetic polymorphisms of xenobiotic-metabolizing

enzymes can affect the susceptibility to cancers. The associationof susceptibility to gastric cancer has been investigated inrelation to the genetic polymorphisms of metabolic enzymessuch as cytochrome P450 1A1 (CYP1A1), cytochrome P4502E1 (CYP2E1), glutathione S-transferase mu 1 (GSTM1),glutathione S-transferase theta 1 (GSTT1), and aldehydedehydrogenase 2 (ALDH2)[9-13]. Some of these studies foundsignificant associations between these genetic polymorphismsand susceptibility to gastric cancer, but these results werenot replicated in other studies[10,14,15].

Changes in the activity of enzymes metabolizingenvironmental carcinogens may modify the effect ofexposure to environmental factors such as dietary factors,and result in alterations in an individual’s susceptibility togastric cancer. Thus, genetic factors as well as environmentalfactors should be considered in epidemiological studies.

In this case-control study, we investigated the effects ofkimchi and soybean pastes on gastric cancer and comparedthem with those of the ingredients of kimchi, such as freshvegetables, nonfermented alliums, and nonfermentedseafood, and those of nonfermented soybean foods. Wealso considered genetic polymorphisms of major metabolicenzymes and the interactions between the polymorphismsand intake of those food items in the present study.

MATERIALS AND METHODS

SubjectsFour hundred and twenty-one people with gastric cancerand 632 controls frequency-matched based on age (within3 years) and sex were the subjects of this hospital-basedcase-control study. Cases of cancer were all histologicallyconfirmed from February 1997 to June 2003 at ChungbukNational University Hospital and Eulji University Hospital,Korea. Gastric cancer patients who had coexisting chronicdisease affecting dietary pattern or communication problemswere excluded. Control subjects were selected from patientsnewly diagnosed with diseases other than cancers at thesame hospitals. In order to increase comparability betweencases and controls, controls were also selected from patientswho were admitted to the Department of OrthopedicSurgery of the same hospitals from where the cases werechosen, because of bony fractures, osteoarthritis, orinflammatory bone diseases. Individuals with a history ofcancer, chronic disease affecting their dietary intake pattern,or communication problems were not included in the controlgroup. The distributions of age and gender of the studysubjects are shown in Table 1. The mean ages of the casesand control groups were 60.0±11.2 and 59.4±10.7 years,respectively. Case group comprised 276 men and 145women, and control group 414 men and 218 women. Among421 cases included, 24 individuals (7.0%) had tumor incardiac area.

This study was conducted in accordance with therecommendations outlined in the Declaration of Helsinki,and every subject provided written informed consent.

Exposure to environmental factorsTrained interviewers interviewed subjects with a structured

questionnaire not later than 1 mo after the diagnosis ofgastric cancer or benign diseases. This included questionson demographic factors and diet. Dietary data were collectedusing a semi-quantitative food frequency table previouslyevaluated for validity and reliability[16]. All subjects were askedabout the average frequency of intake and portion size offood items for a 1-year period leading up to the interview.These items were classified into six food groups havingsimilar ingredients. Those food groups and correspondingfood items were as follows: ‘kimchi’ - Chinese cabbagekimchi, radish kimchi, white kimchi, and kimchi stew,‘soybean paste’ - soybean paste stew, fermented soybeanstew, and miso soup, ‘fresh vegetables’ - fresh Chinesecabbage, lettuce, cucumber, hot pepper, and carrot,‘nonfermented alliums’ - nonfermented garlic, onion, andWelsh onion, ‘nonfermented seafood’ - nonfermentedshrimp, shellfish, oyster, and anchovy, ‘nonfermentedsoybean foods’ - bean curd, soybeans boiled in soysauce,boiled soybean, and soymilk.

Analysis of genetic polymorphismsGenomic DNA was isolated from peripheral leukocytes byproteinase K digestion and phenol/chloroform extraction.The A4889G polymorphism in exon 7 of CYP1A1 genewas analyzed for each subject as described previously[17].Briefly, the PCR were performed in 25 µL of a solutioncontaining 50 ng of genomic DNA, 1× PCR buffer(50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9.0), 1.5 mmol/LMgCl2 and 0.1% Triton X-100), 5 pmoL of each primer,80 µmol/L each dNTP, and 2.0 unit Taq polymerase(Promega, Madison, WI, USA). The primers used were 5’-GAA CTG CCA CTT CAG CTG TC-3’ and 5’-GAA AGACCT CCC AGC GGT CA-3’. Amplifications were carriedout in a Thermocycler (Perkin Elmer, Cetus, UK) as follows:5 min of denaturation at 94 ℃, then 35 cycles consistingof denaturation at 94 ℃ for 60 s, annealing at 53 ℃ for 90s and extension at 74 ℃ for 30 s. The PCR products (187-bp fragments) were digested with HincII restriction enzymeat 37 ℃ overnight and subjected to electrophoresis on 12%polyacrylamide gels. PCR analysis resulted in the followinggenotype classification: a predominant homozygote (Ile/Ile),a heterozygote (Ile/Val), and a rare homozygote (Val/Val).

The 5’-flanking region polymorphism of the CYP2E1gene was analyzed by procedures described previously[18].Briefly, PCR was performed using the primers 5’-CCA GTCGAG TCT ACA TTG TCA-3’ and 5’-TTC ATT CTG TCT

Table 1 Age and gender distribution of cases and controls

Number of subjects (%)Variables

Cases Controls

Gender

Male 276 (65.6) 414 (65.5)

Female 145 (34.4) 218 (34.5)

Age (yr)

<39 18 (4.3) 27 (4.3)

40–49 54 (12.8) 81 (12.8)

50–59 115 (27.3) 173 (27.4)

60–69 152 (36.1) 228 (36.1)

≥70 82 (19.5) 123 (19.4)

Nan HM et al. Kimchi, soybean pastes and gastric cancer 3177

TCT AAC TGG-3’. Initial denaturation was performed at94 ℃ for 5 min, followed by 35 thermal cycles consistingof denaturation for 1 min at 94 ℃, annealing for 1 min at53 ℃ and extension for 30 s at 74 ℃. The 410-bp PCRproduct was digested with RsaI at 37 ℃ overnight andsubjected to electrophoresis on 2% agarose gels. Thegenotypes of CYP2E1 were classified as follows: apredominant homozygote (c1/c1), a heterozygote (c1/c2),and a rare homozygote (c2/c2).

A multiplex PCR method[19] was used to simultaneouslydetect the presence or absence of the GSTM1 and GSTT1genes with slight modification. The primers used were 5’-GAA GGT GGC CTC CTC CTT GG-3’ and 5’-AAT TCTGGA TTG TAG CAG AT-3’ for GSTM1, 5’-TTC CTTACT GGT CCT CAC ATC TC-3’ and 5’-TCA CCG GATCAT GGC CAG CA-3’ for GSTT1, and 5’-CAA CTT CATCCA CGT TCA CC-3’ and 5’-GAA GAG CCA AGG ACAGTT AC-3’ for -globin, the internal reference gene. Afterinitial denaturation for 5 min at 94 ℃, a thermal cycleconsisting of denaturation for 60 s at 94 ℃, annealing for60 s at 58 ℃ and extension for 60 s at 74 ℃ was repeated35 times. PCR products were separated on 2% agarose gelswith ethidium bromide. GSTM1 and GSTT1 genotypes werenot scored unless the PCR product of the -globin genewas evident.

The MboII polymorphism of ALDH2 was identifiedusing a PCR-RFLP method[20] with slight modification.Briefly, PCR was performed using the primers 5’-CCA CACTCA CAG TTT TCT CTT-3’ and 5’-AAA TTA CAG GGTCAA CTG CT-3’. We used the same PCR conditions as inthe CYP1A1 gene analysis. The 134-bp amplicon wasdigested with MboII restriction enzyme at 37 ℃ overnightand subjected to electrophoresis on 15% polyacrylamidegels. The genotypes of ALDH2 were identified as apredominant homozygote (*1/*1), a heterozygote (*1/*2)and a rare homozygote (*2/*2).

Data analysisExposures to dietary factors were categorized into ‘high’and ‘low’ intake groups based on median of intake in controls.For statistical analysis, the SAS System for Windows, Release6.12 was used. P-value less than 0.05 was consideredsignificant. Unconditional logistic analyses were performedto estimate odds ratios and 95%CI for high intake amountof food groups. To test for any increasing or decreasingtrend of the risk of gastric cancer according to an increaseof drinking amount, an unconditional logistic modelincluding age and sex as independent variables was used.

Odds ratios and 95%CI according to genotype of theCYP1A1, CYP2E1, GSTM1, GSTT1, and ALDH2 geneswere estimated for food groups using unconditional logisticmodels including age and sex as independent variables.Homogeneities of the odds ratios according to the CYP1A1,CYP2E1, GSTM1, GSTT1, and ALDH2 genotypes wereevaluated using the Breslow-Day test[21].

RESULTS

Average intake amounts of kimchi and soybean paste weresignificantly higher, and that of nonfermented alliums wassignificantly lower in gastric cancer cases than in controls.However, there was no significant difference in the intakeamount of fresh vegetables, nonfermented seafood andsoybean food (Table 2).

A decreased risk of gastric cancer was noted amongpeople with high consumption of nonfermented alliumsand nonfermented seafood. On the other hand, consumptionof kimchi and soybean pastes was associated with increasedrisk of gastric cancer. The odds ratio (95%CI) of highconsumption of kimchi was 1.57 (1.22, 2.01), and that ofsoybean paste was 1.62 (1.26, 2.09) (Table 3).

Individuals with the CYP1A1 Ile/Val or Val/Val genotypeshowed a significantly increased risk for gastric cancer, andthe adjusted odds ratio (95%CI) was 1.34 (1.04, 1.73). Nogenetic polymorphism of CYP2E1, GSTM1, GSTT1, orALDH2 was significant as an independent factor (Table 4).

Increased intake of kimchi or soybean pastes was asignificant risk factor for the CYP1A1 Ile/Ile, the CYP2E1c1/c1, the GSTM1 non-null, the GSTT1 non-null, or theALDH2 *1/*1 genotype. In addition, eating soybeanpastes was associated with the increased risk of gastriccancer in individuals with the GSTM1 null type. Among theenvironmental protective factors, nonfermented alliums weresignificant in individuals with the CYP1A1 Ile/Ile, the

Table 2 Mean±SE of intake amount of selected food items in casesand controls (unit: g/wk)

Food group Cases Controls P1

Kimchi 861.5±34.7 655.4±21.8 <0.0001

Soybean pastes 661.3±28.2 570.7±24.0 0.0155

Fresh vegetables 232.8±13.0 242.5±10.8 0.5681

Nonfermented alliums 74.3±6.6 99.9±6.8 0.0071

Nonfermented seafood 17.0±3.2 14.7±1.5 0.5125

Nonfermented soybean foods 208.9±14.4 229.7±12.3 0.2808

1P-value was estimated using a Student’s t-test.

Table 3 Distribution of cases and controls according to the intake offood groups

Number (%)Food group OR1 (95%CI2) P

Cases Controls

Kimchi

Low 166 (39.4) 318 (50.3) 1.00 0.0004

High 255 (60.6) 314 (49.7) 1.57 (1.22, 2.01)

Soybean pastes

Low 162 (38.5) 319 (50.5) 1.00 0.0002

High 259 (61.5) 313 (49.5) 1.62 (1.26, 2.09)

Fresh vegetables

Low 217 (51.5) 311 (49.2) 1.00 0.4830

High 204 (48.5) 321 (50.8) 0.92 (0.72, 1.17)

Nonfermented alliums

Low 250 (59.4) 318 (50.3) 1.00 0.0046

High 171 (40.6) 314 (49.7) 0.70 (0.54, 0.89)

Nonfermented seafood

Low 254 (60.3) 317 (50.2) 1.00 0.0012

High 167 (37.9) 315 (49.8) 0.66 (0.51, 0.85)

Nonfermented soybean foods

Low 227 (53.9) 314 (49.7) 1.00 0.2160

High 194 (46.1) 318 (50.3) 0.85 (0.66, 1.10)

1Odds ratio adjusted for age and sex. 2Confidence interval.

CYP2E1 c1/c2 or c2/c2, the GSTT1 null, the GSTT1 non-null, or the ALDH2 *1/*2 or *2/*2 genotype, nonfermentedseafood was those with the CYP1A1 Ile/Ile, the CYP2E1c1/c1, the ALDH2 *1/*1 genotype or any type of GSTM1or GSTT1 (Table 5).

In homogeneity tests, the odds ratios of eating kimchifor gastric cancer according to the GSTM1 or GSTT1genotype were not homogeneous (Table 5).

DISCUSSION

In this present study, a decreased risk of gastric cancerwas noted among people with a high consumption ofnonfermented seafood and alliums. Eating fish has beenreported to decrease the risk of gastric cancer in Japanese

women[22], and in Swedes[23]. However, effects of fish intakeon the risk of gastric cancer varied by preparation method.Pan-fried fish decreased, whereas stewed or broiled fishincreased the risk of gastric cancer in Koreans[4]. Alliumshave been repeatedly reported to decrease the risk of gastriccancer[24]. Alliums have been shown to suppress the growthof Helicobacter pylori[25], and N-nitrosodimethylamine-inducedforestomach tumor in mice[26]. Some chemicals in alliumsinhibit the expression of carcinogen-activating cytochromeP450 enzymes but induce GSTs[27]. Diallyl sulfide, which isabundant in alliums, has been suggested as the key protectivematerial[28]. Intake of fresh vegetables, which has beenreported to reduce the risk of gastric cancer[22,29], showed anodds ratio smaller than 1, but was not statistically significant.

Eating kimchi and soybean pastes was associated with

Table 4 Distribution of genetic polymorphisms of the GSTM1, GSTT1, CYP1A1, CYP2E1, and ALDH2 genes in cases and controls

Number (%)Genotype Total (%) OR1 (95%CI2)

Cases Controls

CYP1A1

Ile/Ile 246 (58.9) 415 (65.8) 661 (63.0) 1.00

Ile/Val or Val/Val 172 (41.1) 216 (34.2) 388 (37.0) 1.34a (1.04, 1.73)

CYP2E1

c1/c1 268 (64.4) 400 (63.5) 668 (63.9) 1.00

c1/c2 or c2/c2 148 (35.6) 230 (36.5) 378 (36.1) 0.96 (0.74, 1.24)

GSTT1

Non-null 229 (57.3) 367 (59.8) 596 (58.8) 1.00

Null 171 (42.7) 247 (40.2) 418 (41.2) 1.11 (0.86, 1.44)

GSTM1

Non-null 149 (37.3) 254 (41.4) 403 (39.7) 1.00

Null 251 (62.7) 360 (58.6) 611 (60.3) 1.18 (0.91, 1.53)

ALDH2

*1/*1 286 (67.9) 462 (73.3) 748 (71.2) 1.00

*1/*2 or *2/*2 135 (32.1) 168 (26.7) 303 (28.8) 1.30 (0.99, 1.70)

1Odds ratio. 2Confidence interval.

Table 5 Odds ratios (95%CI) for food groups according to polymorphisms of the CYP1A1, CYP2E1, GSTM1, GSTT1, and ALDH2 genes

Genotype Kimchi Soybean pastes Fresh vegetables Nonfermented Nonfermented Nonfermented alliums seafood soybean foods

CYP1A1 Ile/Ile 1.89b 1.78b 0.92 0.60b 0.56b 0.78

(1.37, 2.61) (1.29, 2.46) (0.67, 1.26) (0.44, 0.83) (0.40, 0.77) (0.56, 1.07)

Ile/Val or 1.13 1.34 0.85 0.91 0.89 0.96

Val/Val (0.75, 1.70) (0.89, 2.02) (0.57, 1.28) (0.61, 1.38) (0.59, 1.34) (0.63, 1.44)

CYP2E1 c1/c1 1.74b 1.77b 0.91 0.74 0.57b 0.84

(1.27, 2.40) (1.29, 2.43) (0.67, 1.24) (0.54, 1.01) (0.42, 0.78) (0.61, 1.15)

c1/c2 or 1.27 1.37 0.91 0.63a 0.87 0.87

c2/c2 (0.84, 1.93) (0.90, 2.09) (0.60, 1.38) (0.41, 0.96) (0.57, 1.33) (0.57, 1.33)

GSTM1 Null 1.152 1.51a 0.84 0.69a 0.64b 0.84

(0.83, 1.59) (1.08, 2.10) (0.61, 1.16) (0.50, 0.95) (0.46, 0.89) (0.61, 1.17)

Non-null 2.31b 1.73b 1.00 0.71 0.64a 0.82

(1.51, 3.53) (1.14, 2.61) (0.66, 1.50) (0.47, 1.08) (0.42, 0.96) (0.54, 1.24)

GSTT1 Null 1.052 1.38 0.94 0.70 0.64a 0.79

(0.71, 1.56) (0.93, 2.04) (0.63, 1.39) (0.47, 1.04) (0.43, 0.96) (0.53, 1.17)

Non-null 2.01b 1.85b 0.89 0.67a 0.64b 0.87

(1.43, 2.84) (1.32, 2.61) (0.64, 1.24) (0.48, 0.94) (0.45, 0.90) (0.62, 1.22)

ALDH2 *1/*1 1.67b 1.64b 1.01 0.75 0.66b 0.81

(1.34, 2.26) (1.22, 2.22) (0.75, 1.36) (0.56, 1.01) (0.49, 0.89) (0.60, 1.10)

*1/*2 or 1.24 1.57 0.68 0.61a 0.68 1.00

*2/*2 (0.77, 1.99) (0.98, 2.51) (0.43, 1.08) (0.38, 0.97) (0.42, 1.10) (0.62, 1.61)

1Odds ratios and 95%CI were adjusted for age and sex. 2Odds ratio was significantly different from that of the other genotype in a homogeneity test. aP<0.05. bP<0.01 vs others.


increased risk of gastric cancer in this present study(Table 3). The odds ratios for gastric cancer of kimchiand soybean pastes were less than 2, but those fooditems are very popular among the Koreans. Therefore, therisks attributable for gastric cancer by the intake of kimchiand soybean pastes would be relatively high among theKorean population. Fermented Korean foods, such askimchi and soybean pastes, have been reported to showhigh nitrate concentrations[30,31]. During fermentation ofkimchi, nitrate contents decrease but secondary amineincreases continuously[32], especially in Chinese cabbage kimchimade with fermented shrimp sauce[30]. Nitrosodimethylamineincreased in every kind of kimchi after simulated gastricdigestion of kimchi[33]. Increases in the risk of gastric cancerassociated with a high intake of fermented soy-based foodshave been reported in epidemiologic studies among theKoreans[3,6], Japanese[34,35], Taiwanese[36], and Chinese[37]. Wedid not find any statistical significance for risks associatedwith nonfermented soybean foods as reported by Lee et al[36]

and Hoshiyama et al[34]. Fermented soybean pastes also showa high nitrate level[31].

After dietary nitrate is absorbed, about 25% is activelysecreted into the saliva and 5% of ingested nitrate is reducedto nitrite by oral bacteria. Since most saliva is swallowed,about 80% of gastric nitrite in the normal acidic stomacharises from the reduction of ingested or endogenous nitrate[38].Gastric nitrosation, which is carried out by nitrite, mayproduce unstable N-nitroso compounds that do not reachextra-gastric sites and act directly in the stomach to initiategastric cancer, or may produce stable N-nitroso compoundsthat induce cancer at other sites[38,39].

Many epidemiologica l studies have reported arelationship between a high salt diet and gastric cancer[40-45].Koreans have one of the highest rates of 24-h urinarysodium excretion in the world[45], and one of the highestrates of mortality from gastric cancer. It should be notedthat kimchi and soybean pastes, which were significant riskfactors of gastric cancer in this study, also have very highsalt contents.

A few epidemiological studies on gastric cancer haveincluded genetic polymorphisms in the analysis, and fewerstudies have tested gene and environmental interactions.The results of epidemiological studies on the effects ofgenetic polymorphisms on gastric cancer are not alwaysconsistent. In spite of the expression of CYP1A1 in gastricmucosa, no studies have been identified that assess thepotential influence of CYP1A1 polymorphisms in gastriccancer risk[46]. Increased risks of developing gastric cancerhave been reported for the CYP2E1 c1/c2 or c2/c2[13],GSTM1 null[9,10], GSTT1 null[12], and *2-allele containingALDH2 genotypes[11] independently, or in combination withenvironmental factors. However, these significant associationswere not found in other studies[10,14,15]. In this present study,we could find an increased risk of gastric cancer inindividuals with the CYP1A1 Ile/Val or Val/Val genotype.This result is concordant with the previous studies thatcigarette smoking is a risk factor of stomach cancer, andthe CYP1A1 genotype would be involved in the gastriccarcinogenesis by cigarette smoking[47].

In this present study, kimchi and soybean pastes showed

very similar interactions with the genetic polymorphisms,and were significant risk factors in individuals with theCYP1A1 Ile/Ile, the CYP2E1 c1/c1, the GSTM1 non-null,the GSTT1 non-null, and the ALDH2 *1/*1 genotypes.This fact leads to a possibility that kimchi and soybean pastescontain some common carcinogens which are metabolizedby the same metabolic enzymes. Though CYP2E1 activityfor the metabolism of chlorzoxazone has been reported tobe lower in individuals with CYP2E1 c2/c2 type than inthose with other genotypes[48], CYP2E1 activity for themetabolism of N-nitroso compound would be low inindividuals with CYP2E1 c1/c1 type. Therefore, hepaticCYP1A1 or CYP2E1 activity and first-pass clearance wouldbe low in individuals with CYP1A1 Ile/Ile genotype orCYP2E1 c1/c1 type. In that case, the blood level of theunmetabolized carcinogens and, in turn, exposure ofextrahepatic organs to the carcinogen may be increased[49].N-nitroso compounds originating from kimchi and soybeanpastes would not be rapidly metabolized in the hepatic tissueof individuals with CYP1A1 Ile/Ile or CYP2E1 c1/c1genotypes, and the risk of gastric cancer may be increasedby the increased exposure of gastric mucosa to N-nitrosocompounds.

On the contrary, in hepatic tissue of individuals withGSTM1 non-null or GSTT1 non-null genotype, rapidglutathione conjugation of activated carcinogens wouldoccur. Since glutathione conjugates are water-soluble, plasmaconcentration of the glutathione-conjugated carcinogenswould be increased. The high plasma concentration mayincrease exposure of gastric tissue to glutathione conjugatedcarcinogens and, in turn, the risk of gastric cancer inindividuals with GSTM1 non-null or GSTT1 non-nullgenotype.

In homogeneity tests, the odds ratios of eating kimchifor gastric cancer according to the GSTM1 or GSTT1genotype were not homogeneous. Because homogeneity wastested for 36 times and the P-value was 0.05, about twotests would be expected to be statistically significant bychance.

Because the interval between exposure to dietarycarcinogens and the development of gastric cancer couldbe 20 years or more, it would be desirable to test the causalrelationships between the historical dietary intake patternsand present gastric cancer development. However, it isalmost impossible to get an unbiased information on suchpast dietary intake patterns. We therefore assessed theaverage frequencies of intake and portion size of six foodgroups in a 1-year period leading up to the interview. Thereis a possibility that the very symptoms of gastric cancermight change the food intake pattern or nutritional state ofpatients with gastric cancers that have been neglected foryears. Therefore, the diet-related results of this study shouldbe carefully interpreted.

Tumors located at cardiac area have been reported tohave different etiological factors from non-cardiac gastriccancers. We did not exclude cardiac gastric cancers fromthe case group of this present study. Although the proportionof cardiac cancer (7.0%) was not so high, we cannot ruleout the possibility of selection bias.

In summary, kimchi, soybean pastes, and the CYP1A1


Ile/Val or Val/Val are risk factors, and nonfermentedseafood and alliums are protective factors against developinggastric cancer. Salt or some chemicals contained in kimchiand soybean pastes, which are increased by fermentation,would play important roles in the carcinogenesis of stomachcancer. Polymorphisms of the CYP1A1, CYP2E1, GSTM1,GSTT1, and ALDH2 genes could modify the effects ofsome environmental factors on the risk of gastric cancer.

REFERENCES1 Kim JP, Park JG, Lee MD, Han MD, Park ST, Lee BH, Jung

SE. Co-carcinogenic effects of several Korean foods on gastric

cancer induced by N-methyl-N’-nitro-N-nitrosoguanidine in

rats. Jpn J Surg 1985; 15 : 427-437

2 Parkin DM, Pisani P, Ferlay J. Estimates of the worldwide

incidence of 25 major cancers in 1990. Int J Cancer 1999; 80:

827-8413 Lee JK, Park BJ, Yoo KY, Ahn YO. Dietary factors and stom-

ach cancer: a case-control study in Korea. Int J Epidemiol 1995;

24 : 33-41

4 Ahn YO. Diet and stomach cancer in Korea. Int J Cancer 1997;

Suppl 10: 7-9

5 Palli D. Epidemiology of gastric cancer: an evaluation of

available evidence. J Gastroenterol 2000; 35 Suppl 12: 84-89

6 Crane PS, Rhee SU, Seel DJ. Experience with 1,079 cases of

cancer of the stomach seen in Korea from 1962 to 1968. Am J

Surg 1970; 120: 747-751

7 Messina MJ, Persky V, Setchell KD, Barnes S. Soy intake and

cancer risk: a review of the in vitro and in vivo data. Nutr

Cancer 1994; 21: 113-131

8 Kim HJ, Chang WK, Kim MK, Lee SS, Choi BY. Dietary fac-

tors and gastric cancer in Korea: a case-control study. Int J

Cancer 2002; 97: 531-535

9 Harada S, Misawa S, Nakamura T, Tanaka N, Ueno E, Nozoe

M. Detection of GST1 gene deletion by the polymerase chain

reaction and its possible correlation with stomach cancer in

Japanese. Hum Genet 1992; 90: 62-64

1 0 Katoh T, Nagata N, Kuroda Y, Itoh H, Kawahara A, Kuroki

N, Ookuma R, Bell DA. Glutathione S-transferase M1 (GSTM1)

and T1 (GSTT1) genetic polymorphism and susceptibility to

gastric and colorectal adenocarcinoma. Carcinogenesis 1996;

17 : 1855-1859

1 1 Yokoyama A, Muramatsu T, Ohmori T, Makuuchi H, Higuchi

S, Matsushita S, Yoshino K, Maruyama K, Nakano M, Ishii H.

Multiple primary esophageal and concurrent upper

aerodigestive tract cancer and the aldehyde dehydrogenase-2

genotype of Japanese alcoholics. Cancer 1996; 77: 1986-1990

1 2 Setiawan VW, Zhang ZF, Yu GP, Li YL, Lu ML, Tsai CJ,

Cordova D, Wang MR, Guo CH, Yu SZ, Kurtz RC. GSTT1

and GSTM1 null genotypes and the risk of gastric cancer: a

case-control study in a Chinese population. Cancer Epidemiol

Biomarkers Prev 2000; 9: 73-80

1 3 Gao C, Takezaki T, Wu J, Li Z, Wang J, Ding J, Liu Y, Hu X,

Xu T, Tajima K, Sugimura H. Interaction between cytochrome

P-450 2E1 polymorphisms and environmental factors with

risk of esophageal and stomach cancers in Chinese. Cancer

Epidemiol Biomarkers Prev 2002; 11: 29-34

1 4 Kato S, Onda M, Matsukura N, Tokunaga A, Matsuda N,

Yamashita K, Shields PG. Genetic polymorphisms of the can-

cer related gene and Helicobacter pylori infection in Japanese

gastric cancer patients. An age and gender matched case-

control study. Cancer 1996; 77: 1654-1661

1 5 Deakin M, Elder J, Hendrickse C, Peckham D, Baldwin D,Pantin C, Wild N, Leopard P, Bell DA, Jones P, Duncan H,

Brannigan K, Alldersea J, Fryer AA, Strange RC. Glutathione

S-transferase GSTT1 genotypes and susceptibility to cancer:studies of interactions with GSTM1 in lung, oral, gastric and

colorectal cancers. Carcinogenesis 1996; 17: 881-884

1 6 Kim MK, Lee SS, Ahn YO. Reproducibility and validity of a

self-administered semiquantitative food frequency question-

naire among middle-aged men in Seoul. Korean J CommunNutrit 1996; 1 : 376-394

1 7 Oyama T, Mitsudomi T, Kawamoto T, Ogami A, Osaki T,

Kodama Y, Yasumoto K. Detection of CYP1A1 gene poly-morphism using designed RFLP and distributions of CYP1A1

genotypes in Japanese. Int Arch Occup Environ Health 1995;

67 : 253-2561 8 Kawamoto T, Koga M, Murata K, Matsuda S, Kodama Y.

Effects of ALDH2, CYP1A1, and CYP2E1 genetic polymor-

phisms and smoking and drinking habits on toluene metabo-lism in humans. Toxicol Appl Pharmacol 1995; 133: 295-304

1 9 Chen H, Sandler DP, Taylor JA, Shore DL, Liu E, Bloomfield

CD, Bell DA. Increased risk for myelodysplastic syndromesin individuals with glutathione transferase theta 1 (GSTT1)

gene defect. Lancet 1996; 347: 295-297

2 0 Harada S, Zhang S. New strategy for detection of ALDH2

mutant. Alcohol Alcohol Suppl 1993; 1A: 11-13

2 1 Breslow NE, Day NE. Statistical methods in cancer research.

Volume 1 – The analysis of case-control studies. Lyon: Inter-

national Agency for Research on Cancer 1980: 142-146

2 2 Ito LS, Inoue M, Tajima K, Yamamura Y, Kodera Y, Hirose K,

Takezaki T, Hamajima N, Kuroishi T, Tominaga S. Dietary

factors and the risk of gastric cancer among Japanese women:

a comparison between the differentiated and non-differenti-

ated subtypes. Ann Epidemiol 2003; 13: 24-31

2 3 Hansson LE, Nyren O, Bergstrom R, Wolk A, Lindgren A,

Baron J, Adami HO. Diet and risk of gastric cancer. A popu-

lation-based case-control study in Sweden. Int J Cancer 1993;

55 : 181-189

2 4 Dorant E, van den Brandt PA, Goldbohm RA, Hermus RJ,

Sturmans F. Garlic and its significance for the prevention of

cancer in humans: a critical view. Br J Cancer 1993; 67: 424-

429

2 5 Cellini L, Di Campli E, Masulli M, Di Bartolomeo S, Allocati

N. Inhibition of Helicobacter pylori by garlic extract (Allium

sativum). FEMS Immunol Med Microbiol 1996; 13: 273-277

2 6 Wattenberg LW, Sparnins VL, Barany G. Inhibition of N-

nitrosodiethylamine carcinogenesis in mice by naturally oc-

curring organosulfur compounds and monoterpenes. Cancer

Res 1989; 49 : 2689-2692

2 7 Yang CS, Chhabra SK, Hong JY, Smith TJ. Mechanisms of

inhibition of chemical toxicity and carcinogenesis by diallyl

sulfide (DAS) and related compounds from garlic. J Nutr

2001; 131 : 1041S-1045S

2 8 Hu PJ, Wargovich MJ. Effect of diallyl sulfide on MNNG-

induced nuclear aberrations and ornithine decarboxylase ac-

tivity in the glandular stomach mucosa of the Wistar rat.

Cancer Lett 1989; 47: 153-158

2 9 Galanis DJ, Kolonel LN, Lee J, Nomura A. Intakes of se-

lected foods and beverages and the incidence of gastric canceramong the Japanese residents of Hawaii: a prospective study.

Int J Epidemiol 1998; 27 : 173-180

3 0 Kim JH, Shin HS. Effects of main raw material and jeot-kal(fermented fish sauce) on formation of N-nitrosamines dur-

ing kimchi fermentation. J Food Hyg Safety 1997; 12: 333-339

3 1 Seel DJ, Kawabata T, Nakamura M, Ishibashi T, Hamano M,Mashimo M, Shin SH, Sakamoto K, Jhee EC, Watanabe S. N-

nitroso compounds in two nitrosated food products in south-

west Korea. Food Chem Toxicol 1994; 32: 1117-11233 2 Kim SY, Hyon JS, Oh CK, Oh MC, Park CS, Kang SB. Changes

of secondary, tertiary amines and quaternary ammonium

compounds, and formation of N-nitrosamine during fermen-tation of Kimchi and anchovy sauce. J Korean Soc Food Nutr

1994; 23 : 704-710

3 3 Kim KR, Shin JH, Lee SJ, Kang HH, Kim HS, Sung NJ. Theformation of N-nitrosamine in kimchi and salt-fermented fish

under simulated gastric digestion. J Food Hyg Safety 2002; 17:

94-1003 4 Hoshiyama Y, Sasaba T. A case-control study of stomach

cancer and its relation to diet, cigarettes, and alcohol con-

sumption in Saitama Prefecture, Japan. Cancer Causes Control


1992; 3: 441-448

3 5 Hirohata T, Kono S. Diet/nutrition and stomach cancer inJapan. Int J Cancer 1997; Suppl 10: 34-36

3 6 Lee HH, Wu HY, Chuang YC, Chang AS, Chao HH, Chen

KY, Chen HK, Lai GM, Huang HH, Chen CJ. Epidemiologiccharacteristics and multiple risk factors of stomach cancer in

Taiwan. Anticancer Res 1990; 10: 875-881

3 7 Hu JF, Zhang SF, Jia EM, Wang QQ, Liu SD, Liu YY, Wu YP,Cheng YT. Diet and cancer of the stomach: a case-control

study in China. Int J Cancer 1988; 41: 331-335

3 8 Mirvish SS. Role of N-nitroso compounds (NOC) and N-nitrosation in etiology of gastric, esophageal, nasopharyngeal

and bladder cancer and contribution to cancer of known ex-

posures to NOC. Cancer Lett 1995; 93: 17-483 9 Fine DH, Ross R, Rounbehler DP, Silvergleid A, Song L. For-

mation in vivo of volatile N-nitrosamines in man after inges-

tion of cooked bacon and spinach. Nature 1977; 265: 753-7554 0 Haenszel W, Kurihara M, Segi M, Lee RK. Stomach cancer

among Japanese in Hawaii. J Natl Cancer Inst 1972; 49: 969-

9884 1 You WC, Blot WJ, Chang YS, Ershow AG, Yang ZT, An Q,

Henderson B, Xu GW, Fraumeni JF, Wang TG. Diet and high

risk of stomach cancer in Shandong, China. Cancer Res 1988;48 : 3518-3523

4 2 Haenszel W, Kurihara M, Locke FB, Shimuzu K, Segi M.

Stomach cancer in Japan. J Natl Cancer Inst 1976; 56: 265-2744 3 Nagai M, Hashimoto T, Yanagawa H, Yokoyama H, Minowa

M. Relationship of diet to the incidence of esophageal andstomach cancer in Japan. Nutr Cancer 1982; 3: 257-268

4 4 Montes G, Cuello C, Correa P, Zarama G, Liuzza G, ZavalaD, de Marin E, Haenszel W. Sodium intake and gastric cancer.J Cancer Res Clin Oncol 1985; 109: 42-45

4 5 Joossens JV, Hill MJ, Elliott P, Stamler R, Lesaffre E, Dyer A,Nichols R, Kesteloot H. Dietary salt, nitrate and stomachcancer mortality in 24 countries. European Cancer Prevention(ECP) and the INTERSALT Cooperative Research Group. IntJ Epidemiol 1996; 25: 494-504

4 6 González CA, Sala N, Capellá G. Genetic susceptibility andgastric cancer risk. Int J Cancer 2002; 100: 249-260

4 7 Hietanen E, Husgafvel-Pursiainen K, Vainio H. Interactionbetween dose and susceptibility to environmental cancer: ashort review. Environ Health Perspect 1997; 105 Suppl 4: 749-754

4 8 Marchand LL, Wilkinson GR, Wilkens LR. Genetic and di-etary predictors of CYP2E1 activity: A phenotyping study inHawaii Japanese using chlorzoxazone. Cancer EpidemiolBiomarkers Prev 1999; 8: 495-500

4 9 Swann PF, Coe AM, Mace R. Ethanol and dimethylnitro-samine and diethylnitrosamine metabolism and dispositionin the rat. Possible relevance to the influence of ethanol onhuman cancer incidence. Carcinogenesis 1984; 5: 1337-1343

Science Editor Li WZ Language Editor Elsevier HK



Co-expression of CDX2 and MUC2 in gastric carcinomas: Correlations

with clinico-pathological parameters and prognosis

Kristina Roessler, Stefan P. Mönig, Paul M. Schneider, Franz-Georg Hanisch, Stephanie Landsberg, Juergen Thiele,

Arnulf H. Hölscher, Hans P. Dienes, Stephan E. Baldus

EL SEVIER




Kristina Roessler, Stephanie Landsberg, Juergen Thiele, HansP. Dienes, Stephan E. Baldus, Institute of Pathology, Universityof Cologne, 50931 Cologne, GermanyStefan P. Mönig, Paul M. Schneider, Arnulf H. Hölscher,Department of Visceral and Vascular Surgery, University of Cologne,50931 Cologne, GermanyFranz-Georg Hanisch, Center of Biochemistry, University ofCologne, Cologne, GermanySupported by the Cologne Fortune ProgramCorrespondence to: Dr. Stephan E. Baldus, Institute of Pathology,University of Cologne, Joseph-Stelzmann-Str. 9, D-50931 Cologne,Germany. [email protected]: +49-221-478-6372 Fax: +49-221-478-6360Received: 2004-08-30 Accepted: 2004-10-07

Abstract

AIM: To evaluate the role of CDX2 homeobox protein asa predictor for cancer progression and prognosis as wellas its correlation with MUC2 expression. CDX2 representsa transcription factor for various intestinal genes (includingMUC2) and thus an important regulator of intestinaldifferentiation, which could previously be identified ingastric carcinomas and intestinal metaplasia.

METHODS: Formalin-fixed and paraffin-embedded tissuesfrom 190 gastric carcinoma patients were stained withmonoclonal antibodies recognizing CDX2 and MUC2, respectively.Immunoreactivity was evaluated semiquantitatively andstatistical analyses including 2 tests, uni- and multi-variatesurvival analyses were performed.

RESULTS: CDX2 was mostly expressed in a nuclear orsupranuclear pattern, whereas MUC2 showed an almostexclusive supranuclear reactivity. Both antigens werepresent in >80% of areas exhibiting intestinal metaplasia.An immunoreactivity in >5% of the tumor area was observedin 57% (CDX2) or in 21% (MUC2) of the carcinomas. Thepresence of both molecules did not correlate with WHO,Laurén and Goseki classification (with the exception of asignificantly stronger MUC2 expression in mucinoustumors). CDX2 correlated with a lower pT and pN stagein the subgroups of intestinal and stage I cancers andwas associated with MUC2 positivity. A prognostic impactof CDX2 or MUC2 was not observed.

CONCLUSION: CDX2 and MUC2 play an important rolein the differentiation of normal, inflamed, and neoplasticgastric tissues. According to our results, loss of CDX2may represent a marker of tumor progression in early gastric

cancer and carcinomas with an intestinal phenotype.


Key words: CDX2; MUC2; Monoclonal antibody; Gastriccarcinoma; Prognosis

Roessler K, Mönig SP, Schneider PM, Hanisch FG, LandsbergS, Thiele J, Hölscher AH, Dienes HP, Baldus SE. Co-expressionof CDX2 and MUC2 in gastric carcinomas: Correlations withclinico-pathological parameters and prognosis. World JGastroenterol 2005; 11(21): 3182-3188


INTRODUCTION

CDX2 (caudal type homeobox 2) belongs to the group ofhomeobox (hox) genes and is characterized by structuraland functional similarities to the homeobox gene caudalexpressed in Drosophila melanogaster[1-3]. All homeobox genescode for a so-called homeodomain, a typical amino acidsequence (of about 60 amino acids), which binds DNA andcontrols the transcription of several genes. Thereby, especiallythe morphologic diversification along the anterior-posterioraxis of the body is determined[4,5]. Mice with a homozygotecdx2 knockout die within 5 d after conception, whereascdx2 heterozygosity leads to malformations of the skeletonand the development of multiple adenomatous polyps,especially in the proximal colon within the first three monthsof life[6]. During the embryogenesis of intestinal tissues,CDX2 is also involved in the process of proliferation anddifferentiation[2,7]. In this context CDX2 regulates theexpression of sucrase-isomaltase, lactase, phospholipase A/lysophospholipase in the small bowel[2,8] and carboanhydrase1 in the colon[9].

The distribution of CDX2 in human gastrointestinaltissues was investigated by Mizoshita et al[10]. They observedthe highest levels of cdx2 mRNA in the cecum and colon,lower levels in other tracts of the intestine, and a lack ofexpression in the stomach. However, in cdx2-transgenic mice,gastric epithelia are transformed into intestinal ones[11]. Inhumans, an infection with Helicobacter pylori induces a CDX2expression[12], which is characterized by a cytoplasmic orsupranuclear staining[13,14]. A nuclear CDX2 expression couldbe demonstrated in intestinal metaplasia as well as in gastriccarcinomas of the intestinal type according to Laurén[13,15].A positivity of gastric mucosa exhibiting intestinal metaplasiawas observed in about 90% of the cases, whereas about 50%

of the carcinomas showed a CDX2 immunoreactivity[14,15].Differentiated adenocarcinomas are characterized by ahigher CDX2 expression compared with undifferentiatedtumors[15], and correlating with a stronger reactivity in theintestinal vs diffuse phenotype[15,16]. On the other hand, Almeidaet al[14], did not observe a significant correlation of CDX2and the histopathological tumor type, coinciding with thehypothesis that diffuse-type carcinomas may exhibit featuresof intestinal differentiation[17,18]. Recent studies reported aninverse correlation between CDX2 expression and the depthof invasion as well as lymph node metastasis[15,16]. In a series of40 patients, those with CDX2 positive tumor had a significantlyhigher survival probability[15].

Interestingly, CDX2 also binds to the promoter of theintestinal-type mucin MUC2 and thereby activates MUC2translation and expression[19]. Whereas normal gastric mucosadoes not express MUC2[20-24], intestinal metaplasia is characte-rized by a reduction of gastric mucin types (MUC5AC andMUC6) and an ectopic MUC2 production[20,24-26]. Inmetaplasia[16,26] and in gastric carcinomas[14], CDX2 andMUC2 are co-expressed. However, previous results regardingcorrelations of MUC2 expression in gastric cancer withclinico-pathological parameters and prognosis arecontradictory[18,24,25,27-30]. Therefore, we studied the expressionof CDX2 and MUC2 proteins immunohistochemically in aseries of 190 patients suffering from gastric adenocarcinomas.The staining results were correlated with each other, variousclinical and pathological factors as well as survival data.


PatientsThe study comprised 190 patients, which underwent apotentially curative total or partial gastrectomy between 1982and 1991. One hundred patients were male, 90 were female.The mean age was 61.1 years (SD±13.0) with a median of61.3 years. Patients who died within 4 wk after the surgicalintervention were excluded from the study (post-operativemortality). A (neo-)adjuvant radio-or chemotherapy was notperformed. Surviving patients were followed-up for at least5 years. All carcinomas were classified pathologically accordingto the classifications of the UICC[31], WHO[32], Laurén[33],and Goseki et al[34]. The distribution is shown in Table 2.

Tissue preparat ion, monoclonal antibodies, and

immunohistochemical methodTumor and corresponding normal tissues were fixed in 3.7%formaldehyde and embedded in paraffin. After cutting of5-µm thick sections, de-paraffinization was performedaccording to standard pathological procedures, followed bya microwave pre-treatment (2 min×5 min at 600 W in citratebuffer, pH 6.0). Afterwards, sections were washed in coldwater for about 15 min. Endogenous peroxidase activitywas blocked by 0.3% H2O2 in methanol (20 min, RT). Afterwashing once with water and twice with tris-buffered saline(TBS), pH 7.6, the incubation with monoclonal antibodiesdirected against CDX2 (Biogenex, San Ramon, USA) orMUC2 (Novocastra, Newcastle-upon-Tyne, UK) followed.Both were incubated in a dilution of 1:100 (v/v) in antibodydilution buffer (Zymed, San Francisco, USA) overnight

at 4 ℃ and TBS was used as negative control. Afterwashing twice with TBS, the sections were incubated withEnVisionTM+HRP (DAKO, Hamburg, Germany) for 30 minat RT. The sections were washed twice again with TBSfollowed by 3-amino-9-ethylcarbazol solution (DAKO,Hamburg, Germany) in order to visualize the reaction (30 min,RT). Counterstaining with hematoxylin and embedding inglycerol jelly concluded the immunohistochemical stainingprocedure.

Microscopic scoring and statistical analysesA semiquantitative microscopic evaluation was performedby two pathologists independently. Nuclear, supranuclearand cytoplasmic staining was scored according to thepercentage of positive tumor cells as follows: score 0: 0-5%positive tumor cells; score 1: >5-35% positive tumor cells;score 2: >35-65% positive tumor cells; score 3: >65%positive tumor cells. Different scores were observed in lessthan 10% of the cases, a consensus could always be achieved.Cases with score 0 were regarded as negative, cases withscore 1-3 as positive.

The data were analyzed statistically using the software(version 4.57) StatView for Windows (Abacus, Berkeley,CA, USA). The relationship between CDX2 and MUC2immunoreactivity, respectively, and clinico-pathologicalparameters was evaluated using 2 tests at a significancelevel of 5%. Univariate survival analysis was performedaccording to Kaplan-Meier[35], applying the log-rank(Mantel Cox) test.

RESULTS

Immunohistochemical staining patterns of CDX2 and MUC2in normal gastric mucosa, intestinal metaplasia, andcarcinomasNon-neoplastic gastric mucosa was present in most cases(n = 104) in the neighborhood of the carcinomas. It wasmostly reactively altered (inflammatory reactions) andexhibited a supranuclear CDX2 staining in the majority ofthe cases (54.8%), whereas others showed a cytoplasmic ornuclear reactivity only and 18.3% was CDX2 negative.CDX2 was mostly found in the deep parts of the gastricglands. Only few cases (8.6%) of intestinal metaplasia (n = 58)were completely negative for CDX2 and in the positiveareas, a nuclear or mixed staining in several cell compartmentspredominated. Among the carcinomas, 42.6% did not expressCDX2, and most of the positive cases were reactive in thenuclear and supranuclear cell compartments (Figure 1 andTable 1). On the other hand, MUC2 was only detected in asupranuclear pattern. Whereas most normal (93.3%) andcarcinomatous (78.4%) tissues remained negative, intestinalmetaplasia was immunoreactive in 84.5% of the cases(Figure 1 and Table 1).

Correlation of CDX2 and MUC2 immunoreactivity with clinico-pathological parametersCDX2 or MUC2 positivity or negativity, respectively, wascorrelated with various clinico-pathological parameters applying2 tests. Whereas the status of CDX2 immunoreactivity didnot show any association with these variables, MUC2 was

Roessler K et al. CDX2 and MUC2 in gastric carcinomas 3183

significantly stronger in mucinous compared with other typesof adenocarcinomas (Table 2). However, if carcinomas ofthe intestinal type according to Laurén were separatelyanalyzed, a correlation between CDX2 and pTNM as wellas pN staging was observed (Table 3). In addition, femaleand older (>60 years) patients with intestinal type gastriccarcinoma exhibited a higher rate of CDX2 positive cases(Table 3) (within this subgroup). On the other hand, MUC2expression was present in 10.7% of younger (≤60 years)and 26.5% of older patients in the subgroup of diffusecarcinomas according to Laurén (P = 0.04).

Correlation of CDX2 and MUC2 immunoreactivityIn 2 tests, a positive correlation between CDX2 and MUC2immunoreactivity could be observed in the total group ofpatients under study, as well as in the following subgroups:

intestinal and diffuse type according to Laurén, stage Icancers according to the UICC classification (Table 4).

Analysis of the prognostic relevance of CDX2 and MUC2The immunoreactivity of both antigens was tested with regardto a possible prognostic importance according to the univariatesurvival analysis as described by Kaplan and Meier[35]. CDX2and MUC2 did not show any significant association withpatients’ survival probability (Table 5). The same result wasobtained, when subgroups according to Laurén and UICCclassification were investigated separately (data not shown).

DISCUSSION

In the present study, a CDX2 immunoreactivity was observedin the majority of gastric mucosal tissue under study. A supra-

Figure 1 Supranuclear CDX2 immunostaining in non-neoplastic gastric mucosa(A), signet-ring cell carcinoma (B) and tubular adenocarcinoma (C) of the

stomach. MUC2 expression in non-neoplastic gastric tissue (D), signet-ring cell(E) and tubular adenocarcinoma (F).

Table 1 Expression of CDX2 and MUC2 in non-tumorous gastric mucosa, intestinal metaplasia, and carcinomas

Localization of staining Score Gastric mucosa (%) Intestinal metaplasia (%) Carcinoma (%)

CDX2 0 19 (18.3) 5 (8.6) 81 (42.6)

Nuclear 1 2 (1.9) 3 (5.2) 6 (3.2)

2 1 (1) 5 (8.6) 9 (4.7)

3 3 (2.9) 12 (20.7) 8 (4.2)

Supranuclear 1 17 (16.3) 5 (8.6) 14 (7.4)

2 18 (17.3) 2 (3.4) 18 (9.5)

3 22 (21.2) 6 (10.3) 31 (16.3)

Cytoplasmic 1 10 (9.6) 0 3 (1.6)

2 4 (3.8) 0 2 (1.1)

3 3 (2.9) 0 2 (1.1)

Mixed 1 0 0 2 (1.1)

2 3 (2.9) 1 (1.7) 2 (1.1)

3 2 (1.9) 19 (32.8) 12 (6.3)

MUC2 0 97 (93.3) 9 (15.5) 149 (78.4)

Supranuclear 1 5 (4.8) 19 (32.8) 22 (11.6)

2 2 (1.9) 14 (24.1) 13 (6.8)

3 0 16 (27.6) 6 (3.2)

A C

D

B

E F


nuclear staining pattern was prevalent, but a cytoplasmic ornuclear expression was also present, as described earlier[13,14].Such an expression may be induced by inflammatoryreactions caused by H pylori infection and may precede thedevelopment of an intestinal phenotype[12,13,15]. Intestinalmetaplasia exhibited a stronger CDX2 staining comparedwith carcinomas (91.4% vs 57.4%). Analogous results ofother groups[14-16] are confirmed by our data. Since CDX2exerts an important function regarding differentiation andmaintenance of an intestinal phenotype[2,7], its loss may leadto an uncontrolled proliferation, as observed in the colon[36]

and lung[37]. Some authors observed a stronger CDX2 expressionin differentiated compared with undifferentiated tumor ofthe stomach[15,16], whereas we and others[14,36] failed to confirmthis finding. With regard to possible correlations with thehistopathological tumor type according to Laurén, a strongerCDX2 reactivity in intestinal vs diffuse type cancers wasreported[15,16]. Our data are retrieved from a greater series

of patients and confirm the results of other authors[14,36],who did not describe such associations. A correlation of CDX2expression and tumor progression as reflected by stagingand lymph node metastasis was present in intestinal-typecancers in our study. In the total patient series a similar tendencywas found, which was not significant, as opposed to previousreports[15,16]. Analogously, Seno et al[15], observed a significantlybetter prognosis of CDX2 positive vs. negative carcinomasin a series of 40 patients. Our data show a similar tendency,which was statistically insignificant, however.

In morphologically normal or reactively altered gastricmucosa, only few glands contained MUC2 positive cells.Such a pattern presumably reflects an initial step of intestinaldifferentiation, since normal gastric mucosa does not expresssignificant amounts of MUC2[20,24], whereas MUC2 mRNAmay be elevated even in the absence of intestinal metaplasia[38].However, the overwhelming majority of areas exhibitingintestinal metaplasia is MUC2 positive, as observed earlier[24-27].

Table 2 Correlation of CDX2 and MUC2 expression with clinico-pathological parameters and classifications

Parameter n CDX2 positive cases (%) MUC2 positive cases (%)

Age (yr)

≤60 yr 87 48 (55.2) 14 (16.1)

＞60 yr 103 61 (59.2) 27 (26.2)

P 0.57 0.09

Gender

Female 90 57 (63.3) 21 (23.3)

Male 100 52 (52) 20 (20)

P 0.11 0.58

WHO classification

Mucinous 4 3 (75) 4 (100)

Signet-ring cell 85 49 (57.6) 13 (15.3)

Tubular/papillary 80 47 (58.8) 20 (25)

Undifferentiated 21 10 (47.6) 4 (19)

P 0.71 0.0007

Laurén classification

Diffuse 105 61 (58.1) 19 (18.1)

Intestinal 70 40 (57.1) 18 (25.7)

Unclassified/mixed 15 8 (53.3) 4 (26.7)

P 0.94 0.43

Goseki classification

Type I 54 30 (55.6) 14 (25.9)

Type II 22 16 (72.7) 6 (27.3)

Type III 20 9 (45) 3 (15)

Type IV 94 54 (57.4) 18 (19.1)

P 0.33 0.60

pTNM stages

I 53 29 (54.7) 7 (13.2)

II 58 41 (70.7) 18 (31)

III 54 27 (50) 10 (18.5)

IV 25 12 (48) 6 (24)

P 0.09 0.13

pT stages

pT1 33 16 (48.5) 4 (12.1)

pT2 112 69 (61.6) 28 (25)

pT3 32 18 (56.3) 6 (18.8)

pT4 13 6 (45.2) 3 (23.1)

P 0.46 0.44

pN stages

pN0 52 31 (59.6) 8 (15.4)

pN1 76 48 (63.2) 21 (27.6)

pN2 52 25 (48.1) 9 (17.3)

pN3 10 5 (50) 3 (30)

P 0.36 0.28


MUC2 expression in gastric carcinomas varied significantlyin dependence from the histological subtype. All mucinouscarcinomas under study were immunoreactive, followed bytubular and papillary (25%), undifferentiated (19%) andsignet-ring cell (15%) carcinomas according to the WHOclassification. A correlation with subtypes according to theLaurén classification was not demonstrated. These dataconfirm previous observations in part[25,39], whereas othergroups reported contradictory results[24,29,38,40,41] especiallywith regard to associations between MUC2 expression andmucinous differentiation or intestinal vs diffuse type. Asignificant correlation with pTNM staging and MUC2expression could not be found, as published by Akyüreket al[24]. Previous data suggesting associations between a

positive MUC2 status and a better prognosis[24,28], at least inthe group of intestinal carcinomas[25], could not be confirmedin the present study. However, a different monoclonal antibodyand another immunohistochemical detection system wereapplied.

As described earlier[14], CDX2 and MUC2 expressioncorrelated positively. This association was independent fromthe histopathological subtype (Laurén classification) and ananalogous result was obtained in stage I tumors. Consideringthe results of Satoh et al[13], it is tempting to speculate thatgastric mucosa cells exhibiting nuclear CDX2 represent atransient form resulting in intestinally differentiated metaplasticcells. This hypothesis fits in with the role of CDX2 as atranscription factor of intestinal gene products like MUC2.Confirming such a functional relationship, binding of CDX2to a special sequence of the MUC2 promoter was demonstratedin cdx2-transfected COS-7 cells[19]. This sequence containsa CDX2 protein binding site TTTA(C/T), which was also

Table 4 Correlation of CDX2 and MUC2 expression

n CDX2 negative CDX2 positive

All cases 190 81 109

MUC2 negative 149 72 77

MUC2 positive 41 9 32

P 0.003

Intestinal type (Laurén) 70 30 40



P 0.04

Diffuse type (Laurén) 105 44 61



P 0.01

Stage I (pTNM) 53 24 29


MUC2 positive 7 0 7

P 0.01

Table 3 Correlation of CDX2 expression with clinico-pathologicalparameters and classifications in intestinal carcinomas according toLaurén

Parameter n CDX2 positive cases (%)

Age (yr)

≤60 yr 26 10 (38.5)

＞60 yr 44 30 (68.2)

P 0.02

Gender

Female 29 21 (72.4)

Male 41 19 (46.3)

P 0.03

pTNM stages

I 21 13 (61.9)

II 23 18 (78.3)

III 17 4 (23.5)

IV 9 5 (55.6)

P 0.01

pN stages

pN0 22 14 (63.6)

pN1 26 18 (69.2)

pN2 20 6 (30)

pN3 2 2 (100)

P 0.02

Table 5 Univariate survival analysis with regard to the CDX2 and MUC2 expression

Observations Uncensored Censored Survival (yr) SD P (log-rank)

CDX2 expression

Negative 81 57 24

Q1 (25%) 0.799 0.216

Median 1.884 0.062

Q2 (75%) 0 0

Mean 3.606 0.369

Positive 109 72 37

Q1 (25%) 1.060 0.069

Median 2.968 1.108

Q2 (75%) 11.524 0

Mean 5.184 0.461 0.28

MUC2 expression

Negative 149 100 49

Q1 (25%) 0.942 0.102

Median 2.171 0.368

Q2 (75%) 11.524 0

Mean 4.966 0.394

Positive 41 29 12

Q1 (25%) 1.024 0.361

Median 2.557 1.284

Q2 (75%) 0 0

Mean 2.788 0.315 0.61


described in the context of other typical intestinal geneslike sucrase-isomaltase[2], lactase[42], and guanylyl cyclase-C[43].

In conclusion, our data confirm that CDX2 representsa transcription factor which is involved in different aspectsof gastric pathogenesis. It may be of special importance ininflammatory conditions resulting in the development ofintestinal metaplasia. However, CDX2 expression is reducedin gastric carcinomas as compared with intestinal metaplasia.On the other hand, it is associated with tumor progressionin the subgroup of intestinal carcinomas according to Laurénas well as early cancers (stage I). A significant correlationwith survival probability was not observed at all. In addition,CDX2 expression is positively associated with MUC2 levels.The latter is strongly detectable in mucinous adenocarcinomasbut does not exhibit correlations with other relevant clinico-pathologically parameters of gastric carcinomas.

REFERENCES

1 Macdonald PM, Struhl G. A molecular gradient in earlyDrosophila embryos and its role in specifying the body pattern.

Nature 1986; 324: 537-545

2 Suh E, Chen L, Taylor J, Traber PG. A homeodomain proteinrelated to caudal regulates intestine-specific gene transcription.

Mol Cell Biol 1994; 14: 7340-7351

3 Drummond F, Putt W, Fox M, Edwards YH. Cloning andchromosome assignment of the human CDX2 gene. Ann Hum

Genet 1997; 61: 393-400

4 Gehring WJ, Muller M, Affolter M, Percival-Smith A, BilleterM, Qian YQ, Otting G, Wuthrich K. The structure of the

homeodomain and its functional implications. Trends Genet

1990; 6: 323-329

5 Cillo C. HOX genes in human cancers. Invasion Metastasis1994; 14: 38-49

6 Chawengsaksophak K, James R, Hammond VE, Kontgen F,

Beck F. Homeosis and intestinal tumours in Cdx2 mutantmice. Nature 1997; 386: 84-87

7 Suh E, Traber PG. An intestine-specific homeobox gene regu-

lates proliferation and differentiation. Mol Cell Biol 1996; 16:619-625

8 Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren

O, Sjostrom H. Regulation of lactase-phlorizin hydrolase geneexpression by the caudal-related homoeodomain protein Cdx-

2. Biochem J 1997; 322(Pt 3): 833-838

9 Drummond F, Sowden J, Morrison K, Edwards YH. The cau-dal-type homeobox protein Cdx-2 binds to the colon pro-

moter of the carbonic anhydrase 1 gene. Eur J Biochem 1996;

236: 670-6811 0 Mizoshita T, Inada K, Tsukamoto T, Kodera Y, Yamamura

Y, Hirai T, Kato T, Joh T, Itoh M, Tatematsu M. Expression of

Cdx1 and Cdx2 mRNAs and relevance of this expression todifferentiation in human gastrointestinal mucosa-with spe-

cial emphasis on participation in intestinal metaplasia of the

human stomach. Gastric Cancer 2001; 4: 185-1911 1 Mutoh H, Hakamata Y, Sato K, Eda A, Yanaka I, Honda S,

Osawa H, Kaneko Y, Sugano K. Conversion of gastric mu-

cosa to intestinal metaplasia in Cdx2-expressing transgenicmice. Biochem Biophys Res Commun 2002; 294: 470-479

1 2 Eda A, Osawa H, Yanaka I, Satoh K, Mutoh H, Kihira K,

Sugano K. Expression of homeobox gene CDX2 precedes thatof CDX1 during the progression of intestinal metaplasia. J

Gastroenterol 2002; 37: 94-100

1 3 Satoh K, Mutoh H, Eda A, Yanaka I, Osawa H, Honda S, KawataH, Kihira K, Sugano K. Aberrant expression of CDX2 in the gastric

mucosa with and without intestinal metaplasia: effect of

eradication of Helicobacter pylori. Helicobacter 2002; 7: 192-1981 4 Almeida R, Silva E, Santos-Silva F, Silberg DG, Wang J, De

Bolos C, David L. Expression of intestine-specific transcrip-

tion factors, CDX1 and CDX2, in intestinal metaplasia and

gastric carcinomas. J Pathol 2003; 199: 36-40

1 5 Seno H, Oshima M, Taniguchi MA, Usami K, Ishikawa TO,

Chiba T, Taketo MM. CDX2 expression in the stomach with

intestinal metaplasia and intestinal-type cancer: Prognostic

implications. Int J Oncol 2002; 21: 769-774

1 6 Bai YQ, Yamamoto H, Akiyama Y, Tanaka H, Takizawa T,

Koike M, Kenji Yagi O, Saitoh K, Takeshita K, Iwai T, Yuasa

Y. Ectopic expression of homeodomain protein CDX2 in in-

testinal metaplasia and carcinomas of the stomach. Cancer

Lett 2002; 176: 47-55

1 7 Carneiro F, Moutinho-Ribeiro M, David L, Seixas M, Sansonetty

F, Soares P, Serrano A, Sobrinho-Simoes M. Signet ring cell

carcinoma of the stomach: a morphometric, ultrastructural,

and DNA cytometric study. Ultrastruct Pathol 1992; 16: 603-614

1 8 Reis CA, David L, Carvalho F, Mandel U, de Bolos C,

Mirgorodskaya E, Clausen H, Sobrinho-Simoes M. Immuno-

histochemical study of the expression of MUC6 mucin and

co-expression of other secreted mucins (MUC5AC and MUC2)

in human gastric carcinomas. J Histochem Cytochem 2000; 48:

377-388

1 9 Yamamoto H, Bai YQ, Yuasa Y. Homeodomain protein CDX2

regulates goblet-specific MUC2 gene expression. Biochem

Biophys Res Commun 2003; 300: 813-818

2 0 Carrato C, Balague C, de Bolos C, Gonzalez E, Gambus G,

Planas J, Perini JM, Andreu D, Real FX. Differential apomucin

expression in normal and neoplastic human gastrointestinal

tissues. Gastroenterology 1994; 107: 160-172

2 1 De Bolos C, Garrido M, Real FX. MUC6 apomucin shows a

distinct normal tissue distribution that correlates with Lewis

antigen expression in the human stomach. Gastroenterology

1995; 109: 723-734

2 2 Ho SB, Shekels LL, Toribara NW, Kim YS, Lyftogt C, CherwitzDL, Niehans GA. Mucin gene expression in normal, preneoplastic,

and neoplastic human gastric epithelium. Cancer Res 1995;

55: 2681-26902 3 Reis CA, David L, Nielsen PA, Clausen H, Mirgorodskaya K,

Roepstorff P, Sobrinho-Simoes M. Immunohistochemical

study of MUC5AC expression in human gastric carcinomasusing a novel monoclonal antibody. Int J Cancer 1997; 74: 112-121

2 4 Akyürek N, Akyol G, Dursun A, Yamac D, Gunel N. Expres-

sion of MUC1 and MUC2 mucins in gastric carcinomas: theirrelationship with clinicopathologic parameters and prognosis.

Pathol Res Pract 2002; 198: 665-674

2 5 Baldus SE, Zirbes TK, Engel S, Hanisch FG, Mönig SP, LorenzenJ, Glossmann J, Fromm S, Thiele J, Pichlmaier H, Dienes HP.

Correlation of the immunohistochemical reactivity of mucin

peptide cores MUC1 and MUC2 with the histopathologicalsubtype and prognosis of gastric carcinomas. Int J Cancer

1998; 79: 133-138

2 6 Reis CA, David L, Correa P, Carneiro F, de Bolos C, Garcia E,Mandel U, Clausen H, Sobrinho-Simoes M. Intestinal meta-

plasia of human stomach displays distinct patterns of mucin

(MUC1, MUC2, MUC5AC, and MUC6) expression. CancerRes 1999; 59: 1003-1007

2 7 Filipe MI, Linehan JM, Durrant LG, Price MR, Smeeton NC,

Pathak S, Swallow DM. Expression of a peptide epitope ofthe colonic mucin MUC2 in precursor lesions to gastric

carcinoma. Eur J Cancer Prev 1996; 5: 287-295

2 8 Utsunomiya T, Yonezawa S, Sakamoto H, Kitamura H,Hokita S, Aiko T, Tanaka S, Irimura T, Kim YS, Sato E. Ex-

pression of MUC1 and MUC2 mucins in gastric carcinomas:

its relationship with the prognosis of the patients. Clin CancerRes 1998; 4: 2605-2614

2 9 Sakamoto H, Yonezawa S, Utsunomiya T, Tanaka S, Kim

YS, Sato E. Mucin antigen expression in gastric carcinomas ofyoung and old adults. Hum Pathol 1997; 28: 1056-1065

3 0 Lee HS, Lee HK, Kim HS, Yang HK, Kim YI, Kim WH. MUC1,

MUC2, MUC5AC, and MUC6 expressions in gastric carcinomas:their roles as prognostic indicators. Cancer 2001; 92: 1427-1434

3 1 Sobin C, Wittekind C TNM Classification of Malignant

Tumours., 5th edition. New York: Wiley, 19973 2 Hamilton SR, Aaltonen LA. WHO classification of tumours:


Pathology and genetics of tumours of the digestive system.

Lyon: IARC Press, 20003 3 Laurén P. The two histological main types of gastric

carcinoma: Diffuse and so-called intestinal-type carcinoma.

An attempt at a histo-clinical classification. Acta PatholMicrobiol Scand 1965; 64: 31-49

3 4 Goseki N, Takizawa T, Koike M. Differences in the mode of

the extension of gastric cancer classified by histological type:new histological classification of gastric carcinoma. Gut 1992;

33: 606-612

3 5 Kaplan EL, Meier J. Nonparametric estimations from incom-plete observations. J Am Assoc Stat 1958; 53: 457-481

3 6 Werling RW, Yaziji H, Bacchi CE, Gown AM. CDX2, a highly

sensitive and specific marker of adenocarcinomas of intesti-nal origin: an immunohistochemical survey of 476 primary

and metastatic carcinomas. Am J Surg Pathol 2003; 27: 303-310

3 7 Hinoi T, Tani M, Lucas PC, Caca K, Dunn RL, Macri E, LodaM, Appelman HD, Cho KR, Fearon ER. Loss of CDX2 expres-

sion and microsatellite instability are prominent features of

large cell minimally differentiated carcinomas of the colon.Am J Pathol 2001; 159: 2239-2248

3 8 Mitsuuchi M, Hinoda Y, Itoh F, Endo T, Satoh M, Xing PX,Imai K. Expression of MUC2 gene in gastric regenerative,metaplastic, and neoplastic epithelia. J Clin Lab Anal 1999;13: 259-265

3 9 Pinto-de-Sousa J, David L, Reis CA, Gomes R, Silva L,Pimenta A. Mucins MUC1, MUC2, MUC5AC and MUC6expression in the evaluation of differentiation and clinico-biological behaviour of gastric carcinoma. Virchows Arch 2002;440: 304-310

4 0 Taylor KL, Mall AS, Barnard RA, Ho SB, Cruse JP. Immuno-histochemical detection of gastric mucin in normal and dis-ease states. Oncol Res 1998; 10: 465-473

4 1 Gürbüz Y, Kahlke V, Klöppel G. How do gastric carcinomaclassification systems relate to mucin expression patterns?An immunohistochemical analysis in a series of advancedgastric carcinomas. Virchows Arch 2002; 440: 505-511

4 2 Fang R, Santiago NA, Olds LC, Sibley E. The homeodomainprotein Cdx2 regulates lactase gene promoter activity duringenterocyte differentiation. Gastroenterology 2000; 118: 115-127

4 3 Park J, Schulz S, Waldman SA. Intestine-specific activity ofthe human guanylyl cyclase C promoter is regulated by Cdx2.Gastroenterology 2000; 119: 89-96




Quality of life in gastric cancer

Ad A. Kaptein, Satoshi Morita, Junichi Sakamoto

EL SEVIER




Ad A. Kaptein, Psychology Unit, Leiden University Medical Center(LUMC), Leiden, The NetherlandsSatoshi Morita, Department of Epidemiology and Health Care Research,Kyoto University Graduate School of Medicine, Kyoto, JapanJunichi Sakamoto, Department of Epidemiological and ClinicalResearch Information Management, Kyoto University GraduateSchool of Medicine, Kyoto, JapanCorrespondence to: Dr. Ad A. Kaptein, Psychology Unit, LeidenUniversity Medical Center (LUMC), PO Box 9555, 2300 RB Leiden,The Netherlands. [email protected]: +31-71-5275237 Fax: +31-71-5273669Received: 2004-05-07 Accepted: 2004-07-09

Abstract

AIM: To summarize the empirical research on assessingquality of life (QOL) in patients with gastric carcinoma.

METHODS: Literature searches were conducted inMedLine from 1966 to February 2004.

RESULTS: Twenty-six studies were identified. QOL wasused as an outcome measure in virtually all identifiedstudies, such as those examining the effects of gastriccancer and various medical or surgical treatments in thepatients. QOL was assessed mainly with generic measures;the social dimensions of QOL were largely neglected. Thelack of gastric cancer-specific QOL measures hampers QOLresearch up to now. The gastric cancer-specific EORTC-QLQ-STO22 and the FACT-Ga are important additions tothe arsenal of disease-specific QOL measures. In most ofthe studies, the label QOL is used for questionnaires, whichonly assess symptoms or performance status, or arephysician-reported rather than patient-reported outcomes.

CONCLUSION: QOL in patients with gastric cancerdeserves more systematic studies, especially as one ofthe outcome measures in randomized clinical trials. Resultsof studies that include QOL in patients with gastric cancershould be applied in clinical care, which aims at improvingQOL of these patients.


Key words: Quality of life; Gastric cancer

Kaptein AA, Morita S, Sakamoto J. Quality of life in gastriccancer. World J Gastroenterol 2005; 11(21): 3189-3196


INTRODUCTION

‘So, Dormidont Tikhonovich, I came to ask you to come

down and give me a gastrointestinal examination. Any daythat suits you, we’ll arrange it.’ She looked grey and hervoice faltered. Oreshchenkov watched her steadily, his glancenever wavering and his angular eyebrows expressing notone millimetre of surprise. ‘Of course, Ludmila Afanasyevna.We shall arrange the day. However, I should like you toexplain what your symptoms are, and what you think aboutthem yourself.’ ‘I’ll tell you my symptoms right away, but asfor what I think about them-well, you know, I try not tothink about them. That is to say, I think about them all toomuch, and now I’ve begun not sleeping at nights. The bestthing would be if I knew nothing! I’m serious. You decidewhether I’m to go into hospital or not and I’ll go, but Idon’t want to know the details. If I’m to have an operationI would rather not know the diagnosis, otherwise I’ll bethinking the whole time during the operation, “What onearth are they doing to me now? What are they taking outnow?” Do you understand?[1]

In medical care for patients with (gastric) cancer, the 5-yearsurvival is a crucial outcome. At the same time, quantity ofsurvival is increasingly supplemented by data on quality ofsurvival. In this journal, for example, 15 articles that areretrieved under the search heading ‘gastric cancer and qualityof life’ have all been published since 1998. Defining qualityof life (QOL) is a complex matter, a universally accepteddefinition does not exist[2]. Schipper et al[3], proposed “ thefunctional effect of an illness and its consequent therapyupon a patient, as perceived by the patient”. Functionaleffects usually are separated into three categories:physiological, psychological, and social. QOL, therefore, isa multidimensional construct. In a patient with gastric cancer,a physiological effect might be nausea or problems withswallowing, and a psychological effect could be depression,and a social effect might be withdrawal due to embarrassmentabout being ill. Sometimes economic effects are alsodiscussed in the context of functional effects of illness[2].There is also a discussion about spiritual effect of illness[4].In general, however, the triad ‘physiological’, ‘psychological’,and ‘social’ effects is considered to represent the QOL.

QOL can be assessed using generic or disease-specificmeasures. Generic measures are used in every conceivabledisease or disorder. Scores on those measures allowcomparisons between groups of patients with an identicaldiagnosis but with different grades of severity or in differentsettings or countries, between two groups of patients withdifferent diseases, or between a group of patients with adisease and persons without disease. Disease-specificmeasures have been designed to particularly assess QOLof patients with a specific disease. For example, in patientswith Crohn’s disease, the IBS-QOL is a disease-specific QOLmeasure[5], and the SF-36 is a generic QOL measure[6].


Cancer-generic measures (e.g., EORTC-QLQ-C30) assessQOL across various diagnostic cancer categories[7]. EORTCand FACIT have developed a wide range of questionnairesthat assess QOL for various specific cancer types (visit www.eortc.be and www.facit.org/qlist.aspx)[8].

QOL is not a ‘soft’ measure. If surgical technique Aresults in a similar 5-year survival as surgical technique B,differences in aspects of QOL, such as nausea, depression,and embarrassment, may determine which surgical techniqueis preferable. This view has been previously described inthe area of gastroenterology, e.g., in functional bowelsyndrome[9]. In gastric cancer, however, the topic of QOLis virtually unexplored. Recent reviews of gastric cancer inmajor journals do not mention QOL at all, let alonediscussing QOL in the context of one of the outcomemeasures[10]. This is in sharp contrast with the area of QOLand, for instance, breast cancer. In this area, QOL is assessedwith well-developed and validated measures, and QOL is amajor outcome variable, which also influences the choiceof medical management[11].

In this paper, our aim is to review all empirical studieson the topic of gastric cancer and QOL, with a view tooutline strengths and weaknesses in the empirical materialavailable, and to suggest some future research avenues.


Literature searches were conducted in MedLine from 1966

to February 2004, with Mesh headings ‘gastric cancer’ and‘quality of life’, and ‘gastric cancer’ and ‘psychology’.References in the retrieved papers were studied meticulously,and ‘snowballing’ produced additional papers. Only papersin English were selected. Excluded were studies on mixeddiagnostic groupings, i.e., patients with gastric cancer werepart of a large group of patients with various other typesof (usually gastrointestinal) cancer, or that dealt with QOL,but only symptoms were measured, where only one of thethree core QOL domains was assessed, or where QOL wasnot a patient-reported outcome but merely a physician-reported outcome[12]. Given the high prevalence of gastriccancer in Japan, an additional literature search was carriedout in Ichushi-WEB, one of the largest literature searchesin Japan of original papers, case reports and minutes ofmeetings held in Japan, which can be searched.

Empirical studies were analyzed according to first authorand year of publication, country where the study wasconducted, diagnosis or diagnostic category, study objective(s), number of patients and sociodemographic details,measure(s) used to assess QOL, results, domains in the QOLassessment, type of scale (generic, cancer-generic, or disease-specific), and remarks (on weaknesses in the study). Theresults are summarized in Table 1.

RESULTS

The literature searches plus extensive and detailed studying

Table 1 Summary of the 26 studies on QOL in gastric cancer

First Country Diagnosis Objective(s) N patients, QOL Result(s) Domains Type(s) of Remarksauthor, age in yr, ♂; ♀ measure(s) regarding QOL questionnairesyr

Adachi, Japan Early Evaluate QOL 76-64±10 Mailed Laparascopic- PHY: eating Gastric-Spec No Bonferroni

1999[15] gastric after laparoscopic (mean) questionnaire, assisted PSY: fatigue, -H, C-Gen correction for

cancer assisted vs ♂44; ♀32 24 items (cf. gastrectomy pain SOC: – multiple

conventional Korenaga patients: QOL ↑ testing, no

gastrectomy 1992[28] ) ‘QOL’, social

dumping dimension in

syndrome QOL, non-

randomized

design

Anderson, Scotland Adenocarcinoma Examine relief 57 Symptom list After surgery: PHY: dysphagia, Gastric-Spec-H –

1995[16] of the stomach of symptoms 67 (median) scored via symptoms ↓ dyspepsia

after surgical 48–88 (range) interviews PSY: pain

treatment ♂35; ♀22 SOC: –

Buhl, Germany Gastric cancer Evaluate QOL 89-61±13 Troidl No significant PHY: eating Disease Of the six

1990[17] after subtotal (mean) questionnaire: differences PSY: intrusion, specific, H measures, only

vs total ♂–♀: n.r. disease-specific between groups avoidance, three assessed

gastrectomy and socio- fatigue, pain, QOL; no

personal depression correlation

dimensions; SOC: – between

psychological objective and

problems subjective

(Horowitz measures; no

scale; Zerrsen social

Kaptein AA et al. Life quality in gastric cancer 3191

scale) dimension

Davies, UK Gastric Evaluate QOL 47 ADL, HAD, QOL ↑ in Full blown Cancer generic, Non-

1998[18] carcinoma after subtotal vs 69 (median) RSCL, Troidl subtotal QOL: PHY, gastric cancer randomized

total gastrectomy 33–84 (range) gastrectomy PSY, SOC specific, H design

♂27; ♀20

Eguchi, Japan Gastric cancer Examine effects 5 EORTC- QOL ↑ Full blown Cancer generic QOL is

2003[19] of docetaxel+5FU 64 (mean) QOL-C30 QOL: PHY, secondary

on survival and 57–70 (range) PSY, SOC endpoint

QOL ♂4 ; ♀1

Fuchs, Germany Gastric cancer QOL as one of 120 Spitzer and No differences PHY: functional Cancer generic Interesting:

1995[20] the outcome 58 (mean) Visick between status Spitzer and

measures in two ♂78; ♀42 questionnaires: procedures PSY: activities Visick were

surgical both patient SOC: support patient scored;

procedures scored randomized

(JIP vs RYP) design

Hoffman, Sweden Gastric cancer Assess relevance 61 EORTC-QOL- Patients’ views, Full blown QOL: Cancer generic, CBR reflects

1998[21] of Clinical Benefit 63 (median) C30, QLQ-C13 doctors’ views PHY, PSY, SOC gastric cancer combination of

Response (CBR) 40–75 (range) items, and CBR: specific, H objective and

criteria for ♂-♀: n.r. symptoms → similar results subjective

effectiveness of translated into changes;

chemotherapy CBR retrospective

design

Hoksch, Germany Gastric cancer Assess QOL after 41-59 (mean) EORTC-QLQ- No major Full blown QOL: Cancer generic, Prospective

2002[22] gastrectomy, with 25–74 (range) C30, food differences, PHY, PSY, SOC gastric cancer randomized

different types of ♂20; ♀21 consumption except for ‘global specific, H trial; QOL

reconstruction health status’ was target

(IPP, IPP7, IPP15) (IPP15↑) of trial

Horváth, Hungary Total gastrectomy Assess QOL 46 GIQLI In aboral pouch: Full blown QOL: Disease specific Randomized

2001[23] (aboral pouch, 60 (median) QOL ↑ PHY, PSY, SOC for controlled

R-and-Y) 26-80 (range) gastrointestinal study

♂24; ♀22 disorders in

general

Ishihara, Japan Stomach cancer Evaluate QOL 51 QLI, dumping QOL ↓ PHY: physical Cancer generic, Validity?

1999[24] and ADL≥2 yr 67 (mean) symptoms strength H; gastric

after total 39–82 (range) PSY: fatigue, cancer specific, H

gastrectomy ♂32; ♀19 anxiety SOC: –

Jentschura, Germany Gastric carcinoma Effects of 195 GIQLI Subtotal Full blown QOL: Questionnaire Non-

1997[25] subtotal vs total 61 (mean) gastrectomy PHY, PSY, SOC designed for randomized

gastrectomy on ♂122; ♀73 better QOL assessing design

QOL gastrointestinal

symptoms

Kalmár, Hungary Adenocarcinoma Aboral pouch vs 40 GIQLI Pouch better Full blown QOL: See Jentschura Randomized

2001[26] of the stomach total gastrectomy -60±-9 QOL PHY, PSY, SOC 1997[25] trial; see also

re QOL ♂19;♀21 Horváth et al.,

2001[23]

Kono, Japan Early gastric R -en- Y vs 47 GSRS and Pouch better PHY: reflux Disease Randomized

2003[27] cancer pouch re QOL -66±11 symptoms QOL (at 3 mo; PSY: pain specific for controlled

♂32;♀15 not at 12 or SOC: – gastrointestinal study; author

48 mo) disorders in modified

general GSRS; no social

dimension

Korenaga, Japan Gastric cancer Retrospective 150 QOL: symptoms Food tolerance ↓ PHY: eating Gastric cancer QOL?

1992[28] QOL assessment ≤59:89 via interview Appetite ↓ PSY: appetite specific, H

after gastrectomy ≥60:61 (cf. Adachi et al., SOC: –

♂97; ♀53 1999[15] ) See Adachi et al.,

1999[15]

de Liaňo, Spain Gastric cancer Assess QOL after 54 EORTC-QLQ- QOL-social ↓ Full blown QOL: Cancer generic No correlation

2003[29] curative resection 67 (mean) C30, and PHY, PSY, SOC and disease between

41–89 (range) disease-specific specific tumor stage

♂36; ♀18 questions and QOL

Liedman, Sweden Gastric cancer To examine 32 BSS, CPRS, Strong Full blown QOL: Generic and –

2001[30] relations between 66 (mean) GSRS (gastric correlations PHY, PSY, SOC gastric

clinical nutritional 41–82 (range) symptoms), between symptoms

parameters and ♂21; ♀11 MACL, SIP, change in body specific

QOL after SSIAM composition

gastrectomy and QOL

Miyoshi, Japan Gastric cancer Compare long- 34 GSRS and Pouch: QOL ↑ PHY: pain, Gastric QOL?

2001[31] term results -63±12 symptoms reflux symptoms

regarding ♂22; ♀12 PSY: eating questionnaire

symptoms and SOC: –

nutritional status

in patients with/

without pouch

Nakano, Japan Unresectable Effects of 45 Homemade Lentinan: QOL↑ Full blown QOL: Disease specific Validity of

1999[32] gastric cancer Lentinan on -64 (mean) QOL PHY, PSY, SOC questionnaire QOL scale?

and postoperative survival and 45–75 (range) questionnaire (14 items)

gastric cancer QOL ♂34;♀11

Shiraishi, Japan Gastrectomy Compare QOL 51 Adachi 1999[15] Gastric tube Full blown QOL: Gastric cancer Validity? see

2002[33] among three -63±11 questionnaire: reconstruction: PHY, PSY, SOC specific, H Adachi 1999[15]

surgical ♂37;♀14 24 items best QOL;

techniques on symptoms no other

differences in

QOL between

techniques

Svedlund, Sweden Subtotal vs total Examine impact 64 BSS, CPRS, EDS, Physical QOL Full blown QOL: Disease generic; One of the few

1999[34] gastrectomy of gastrectomy 67 (mean) GSRS, MACL, categories PHY, PSY, SOC gastric follow-up

(see also procedures on ♂39;♀25 SIP, SSIAM negatively symptoms studies in this

Svedlund, QOL impaired specific; gastric area;

1997[35]) cancer specific prospective

symptoms randomized

trial;

psychiatric

focus

Svedlund, Sweden Gastrectomy QOL before 103 BSS, MACL, SIP Patients vs Full blown QOL: Generic and Comparison of

1996[36] gastrectomy 72 (mean) healthy controls: PHY, PSY, SOC symptom gastric cancer

♂60; ♀43 QOL ↓; 25% specific patients with

report functional other patient

limitations groups

Thybusch Germany Total gastrectomy Effects on QOL 62 EORTC-QOL- No major Full blown QOL: Cancer generic; Non-

-Bernhardt, and D2 following surgical 63 (mean) C30 and gastric differences in PHY, PSY, SOC gastric cancer randomized

1999[37] lymphadenectomy procedures 32–80 (range) cancer module QOL between specific, H design

♂40;♀22 procedures

Troidl, Germany Gastric cancer Esophago- 38 Troidl HLR: QOL ↑ PHY: daily Disease specific Randomized

1987[38] jejunostomy vs -69 (median) questionnaire: activities symptoms, H trial, no social

Hunt-Lawrence- 41–75 (range) 11 items, PSY: fatigue dimension;

Rodino pouch on ♂23; ♀15 “disease SOC: – validity?

QOL specific” and “

socio-personal”

Vickery, France, Gastric cancer Develop disease- 115 22-item EORTC 5 scales, 4 items Full blown QOL: Disease specific First formal

2001[39] Germany, specific QOL 66 (mean) -QLQ-STO22 PHY, PSY, SOC QOL disease-

Spain, UK questionnaire 35–97 (range) questionnaire specific QOL


of the references resulted in 26 studies that fitted ourselection criteria (Table 1).

The year 1987 saw the publication of the first empiricalpaper on QOL in gastric cancer: Troidl and colleaguespublished their QOL questionnaire, which seems to havebeen very useful to quite a few researchers later[38]. The 26studies pertain to a 17-year period; on average, every 8 moa study was published. It is rather striking to note that wedid not find a paper from North America; 17 papers arefrom European countries and 9 from Japan. Since our focusis on QOL assessment, we did not specify in great detaildiagnosis, diagnostic categories, surgical or other medicalprocedures. Virtually all studies aimed at assessing QOL asan outcome for medical care. The number of patients inthe studies ranged from 5 to 207.

A great variety of QOL instruments are reported in the26 studies. The column in Table 1, which summarizes theQOL questionnaires, illustrates the relatively new status ofQOL research in gastric cancer. Homemade questionnaires,questionnaires that assess performance status, and questionnairesnot designed specifically for (gastric) cancer patients, areapplied quite frequently. The increasing use of the cancer-specific, but gastric cancer generic EORTC-QLQ-C30questionnaire is a positive development. This is a measurewith adequate psychometric characteristics and it allowscomparisons between gastric cancer patients with othercategories of cancer patients. The majority of studies coverphysical and psychological functioning; social functioning isassessed somewhat less frequently. The authors of thereviewed papers sometimes label questionnaires as assessing‘quality of life’, where they are in fact physician-reportedscores (e.g., the Karnofsky, Spitzer, and Visick questionnaires)which by definition is not quality of life.

The search in Ichushi-WEB produced 119 original papersand 94 original case reports hits. Of the 119 studies, 8 assessedQOL of patients using a QOL questionnaire. Almost allquestionnaires were homemade ones, and only three studies

used a cancer-specific core questionnaire developed in Japanby standardized psychometric testing[42]. The three studieswere all published in the Japanese Journal of CancerChemotherapy, in Japanese[43-45].

DISCUSSION

QOL in patients with gastric cancer is increasingly added asan outcome measure in clinical research. Over half of thestudies in the review are recent (>1998 or later) studies. Thisdevelopment is in line with other areas in medicine[46,47]. Inmost of the reviewed studies, QOL was used to evaluatethe effects of medical treatment, usually after some formof surgery or chemotherapy. So far, there are no studieson prediction of QOL or on determinants of QOL in thearea of gastric cancer. Another finding of our review reflectsthe coming of age of QOL research in gastric cancer:physiological functioning is included in virtually all studies,psychological functioning is included in about half of thestudies, and social functioning is hardly included at all. Clearly,future research must take this result into account. Usingsymptom scores as a measure of QOL is not appropriateany longer-it reflects a rather strict biomedical model ofthinking, while QOL research aims to further develop abiopsychosocial model of medicine[48].

Using only traditional outcome criteria such as responserate or objective tumor regression, for example in patientswith solid tumors of the lung, colon or breast, is hardlyvalid any more in modern research on the outcome in cancer(cf. RECIST[48]). This is especially the case in patients withgastric cancer as over one-third of those patients have non-measurable disease (e.g., ascites, lymphangitis carcinomatosa,miliary liver metastasis). The concept of ‘clinical benefitresponse’ (CBR) as a potential addition to QOL deservesmention in this regard[49,50]. CBR combines objective withsubjective measures to assess changes in the clinical statusof patients.

♂75;♀40 instrument

for gastric

cancer

Yamaoka, Japan Gastrectomy Examine effects 207 EPQ, Relationships Full blown QOL: Disease generic Interesting

1998[40] of personality on -57 (mean) HRQOL-20 between PHY, PSY, SOC scale, H; generic theoretical

HRQOL 32–83 (range) personality questionnaire extension:

♂140;♀67 and QOL examine

personality

factors

Zieren, Germany Gastric Compare Spitzer 71 EORTC- Physical Full blown QOL: Cancer –

1998[41] carcinoma with EORTC-QOL 59 (mean) QLQ-C36 functioning PHY, PSY, SOC generic

-C36, after 27–77 (range) most limited questionnaire

resection ♂47; ♀24

ADL, activities of daily living; BSS, body symptom scale; C, cancer; C-Gen, cancer generic; CBR, clinical benefit response; CPRS, comprehensive psychopathological rating

scale; EDS, eating dysfunction scale; EORTC-QLQ-C36, EORTC, QLQ, cancer 36 items; EORTC-QLQ-STO22, EORTC, QLQ, stomach cancer 22 items; EORTC-QOL-C30,

European Organization for Research and Treatment of Cancer, QOL, cancer 30 items; EPQ, Eysenck Personality Questionnaire; Gastric-Spec-H, gastric cancer specific,

home made; Gen, generic; GIQLI, gastrointestinal quality of life index; GSRS, gastrointestinal symptom rating scale; H, home made; HAD, hospital anxiety depression;

HRQOL-20, health related quality of life, 20 items; IPP, Longmire’s reconstruction without a pouch; JIP, jejunal interposition with pouch; MACL, mood adjective check list;

PHY, physical; PSY, psychological; QLI, quality of living index; QLQ-C13, Quality of Life Questionnaire, cancer 13 items; QOL, quality of life; RSCL, Rotterdam Symptom

Check List; RYP, Roux-en-Y reconstruction; SIP, sickness impact profile; SOC, social; Spec, specific; SSIAM, structured and scaled interview to assess maladjustments.


The recent publication of the EORTC-QLQ-STO22questionnaire signals a major improvement in the field ofassessing QOL in patients with gastric cancer[39]. Thequestionnaire has five scales (dysphagia, pain, diet, symptoms,emotional problems), and four single items (dry mouth, bodyimage, and hair loss (two items)). The rigorous psychometrictesting procedures of the EORTC QOL group suggest thatthe STO22 will no doubt become one of the standards forassessing QOL in this category of patients. Given the robustnature of this questionnaire, future research will allowexamining correlates and predictors of QOL-in variousdomains, e.g., physiological, psychological, and social. Routinelyincorporating the STO22 in clinical research on gastric cancerwill improve our knowledge on the impact of gastric cancerand its treatment as perceived by the patient[51,52].

In addition to the EORTC-QLQ-STO22, which is aEuropean-based questionnaire, the FACT-Ga, which wasdeveloped in USA, also assesses QOL in patients with gastriccancer. The FACT-Ga as a cancer generic QOL questionnairehas 27 items covering four subscales that assess physical,social/family, emotional, and functional well-beings[8].The gastric cancer-specific FACT-Ga is under constructionand will be available shortly. Dumping syndrome (e.g.,postprandial dizziness, cold perspiration) can also beconsidered when assessing QOL, as addition to gastriccancer-specific QOL questionnaires[50].

The ultimate study will examine the research question:How can we improve QOL in patients with gastric cancer?Medical care has the power to improve QOL. Othertreatment strategies may also help improve QOL: self-management training, skills training, and support groupshave shown to produce improvements in QOL[53]. In gastriccancer patients, the study by Persson and Glimelius illustratedthe positive effects on QOL of a group rehabilitationprogram combined with individual support[54]. The studyby Kuchler et al[55], is a hallmark paper in this regard. In thisstudy, patients with gastrointestinal cancer were randomlyallocated to standard care vs additional psychotherapeuticsupport. Patients in the experimental group survived longerthan in the ‘care as usual’ group. Generally, recent meta-analyses demonstrated the positive effects of psychosocialcare for cancer patients, as gauged by improvements inQOL[56,57]. Patients, physicians and researchers, therefore,may benefit from developing psychosocial support programsand from examining their effects on behavioral and medicaloutcomes.

A number of authors emphasize the importance ofpaying attention to QOL, given the important but as yetrelatively modest effects of surgery, chemotherapy orradiotherapy in gastric cancer in particular. Bozzetti writes,“we think that when two surgical procedures are compared,if the oncological results are the same, the operation whichis associated with least discomfort and impairment of QOL,should be chosen”[61]. Our review indicates how in empiricalstudies on gastric cancer QOL has been addressed, assessedand evaluated. Choosing a questionnaire to assess QOLdepends entirely on the study topic. There is no ‘best’ QOLquestionnaire for patients with gastric cancer. The researchquestion and clinical objectives determine the choice ofthe QOL instruments. The recent publication of the

EORTC-QLQ-STO22 is a breakthrough. However,additional questionnaires are needed to answer specificresearch questions or to explore other psychosocial issuesin patients with gastric cancer, e.g., demand for informationby patients or on the partner’s concern and worries[58-60].Improving the medical care for patients with gastric cancerwill ultimately be judged by improvement in survival andQOL. The quotation from ‘Cancer Ward’ at the beginningof our paper intended to help focus our attention on thegoal of health care: to help people live longer and feelbetter[61–64].

ACKNOWLEDGMENTS

We acknowledge the help of Jos Leenes, librarian, for hishelp with the literature searches, and Wendy van der Putten,for secretarial skills.

REFERENCES

1 Solzhenitsyn A. Cancer ward. Harmondsworth, UK: Pen-

guin Books, 19712 Spilker B, ed. Quality of life and pharmacoeconomics in

clinical trials. Philadelphia: Lippincott-Raven, 1996

3 Schipper H, Clinch J, Olweny LM. Definitions and concep-t ua l i s sue s. In : Sp il ker B , e d . Qua l i t y o f l i fe and

pharmacoeconomics in clinical trials. Philadelphia: Lippincott-

Raven, 1996: 11-244 van Wegberg B, Bacchi M, Heusser P, Helwig S, Schaad R,

von Rohr E, Bernhard J, Huerny C, Castiglione M, Cerny T.

The cognitive-spiritual dimension--an important addition tothe assessment of quality of life: validation of a questionnaire

(SELT-M) in patients with advanced cancer. Ann Oncol 1998;

9: 1091-10965 Drossman DA, Patrick DL, Whitehead WE, Toner BB,

Diamant NE, Hu Y, Jia H, Bangdiwala SI. Further valida-

tion of the IBS-QOL: a disease-specific quality-of-l ifequestionnaire. Am J Gastroenterol 2000; 95: 999-1007

6 Blondel-Kucharski F, Chircop C, Marquis P, Cortot A, Baron

F, Gendre JP, Colombel JF. Health-related quality of life inCrohn’s disease: a prospective longitudinal study in 231

patients. Am J Gastroenterol 2001; 96: 2915-2920

7 Aaronson NK, Ahmedzai S, Bergman B, Bullinger M, Cull A,Duez NJ, Filiberti A, Flechtner H, Fleishman SB, de Haes JC.

The European Organization for Research and Treatment of

Cancer QLQ-C30: a quality-of-life instrument for use in in-ternational clinical trials in oncology. J Natl Cancer Inst 1993;

85 : 365-376

8 Cella DF, Tulsky DS, Gray G, Sarafian B, Linn E, Bonomi A,Silberman M, Yellen SB, Winicour P, Brannon J. The Func-

tional Assessment of Cancer Therapy scale: development and

validation of the general measure. J Clin Oncol 1993; 11: 570-579

9 Drossman DA, Toner BB, Whitehead WE, Diamant NE,Dalton CB, Duncan S, Emmott S, Proffitt V, Akman D,Frusciante K, Le T, Meyer K, Bradshaw B, Mikula K, MorrisCB, Blackman CJ, Hu Y, Jia H, Li JZ, Koch GG, Bangdiwala

SI. Cognitive-behavioral therapy versus education and de-sipramine versus placebo for moderate to severe functionalbowel disorders. Gastroenterology 2003; 125: 19-31

1 0 Hohenberger P, Gretschel S. Gastric cancer. Lancet 2003; 362:305-315

1 1 Bottomley A, Therasse P. Quality of life in patients undergo-

ing systemic therapy for advanced breast cancer. Lancet Oncol2002; 3: 620-628

1 2 Bamias A, Hill ME, Cunningham D, Norman AR, Ahmed

FY, Webb A, Watson M, Hill AS, Nicolson MC, O’Brien ME,Evans TC, Nicolson V. Epirubicin, cisplatin, and protracted

venous infusion of 5-fluorouraci l for esophagogastric


adenocarcinoma: response, toxicity, quality of life, and

survival. Cancer 1996; 77: 1978-19851 3 Glimelius B, Ekström K, Hoffman K, Graf W, Sjödén PO,

Haglund U, Svensson C, Enander LK, Linné T, Sellström H,

Heuman R. Randomized comparison between chemotherapyplus best supportive care with best supportive care in ad-

vanced gastric cancer. Ann Oncol 1997; 8: 163-168

1 4 Dent DM, Werner ID, Novis B, Cheverton P, Brice P. Pro-spective randomized trial of combined oncological therapy

for gastric carcinoma. Cancer 1979; 44: 385-391

1 5 Adachi Y, Suematsu T, Shiraishi N, Katsuta T, Morimoto A,Kitano S, Akazawa K. Quality of life after laparoscopy-as-

sisted Billroth I gastrectomy. Ann Surg 1999; 229: 49-54

1 6 Anderson ID, MacIntyre IM. Symptomatic outcome follow-ing resection of gastric cancer. Surg Oncol 1995; 4: 35-40

1 7 Buhl K, Schlag P, Herfarth C. Quality of life and functional

results following different types of resection for gastriccarcinoma. Eur J Surg Oncol 1990; 16: 404-409

1 8 Davies J, Johnston D, Sue-Ling H, Young S, May J, Griffith J,

Miller G, Martin I. Total or subtotal gastrectomy for gastriccarcinoma? A study of quality of life. World J Surg 1998; 22:

1048-1055

1 9 Eguchi T, Fujii M, Wakabayashi K, Aisaki K, Tsuneda Y,Kochi M, Takayama T. Docetaxel plus 5-fluorouracil for ter-

minal gastric cancer patients with peritoneal dissemination.

Hepatogastroenterology 2003; 50: 1735-17382 0 Fuchs KH, Thiede A, Engemann R, Deltz E, Stremme O,

Hamelmann H. Reconstruction of the food passage after to-

tal gastrectomy: randomized trial. World J Surg 1995; 19 :698-705; discussion 705-706

2 1 Hoffman K, Glimelius B. Evaluation of clinical benefit of

chemotherapy in patients with upper gastrointestinal cancer.Acta Oncol 1998; 37: 651-659

2 2 Hoksch B, Ablassmaier B, Zieren J, Mueller JM. Quality of life

after gastrectomy: Longmire’s reconstruction alone comparedwith additional pouch reconstruction. World J Surg 2002; 26:

335-341

2 3 Horváth OP K, Cseke L, Poto L, Zambo K. Nutritional and

life-quality consequences of aboral pouch construction after

total gastrectomy: a randomized, controlled study. Eur J Surg

Oncol 2001; 27 : 558-563

2 4 Ishihara K. Long-term quality of life in patients after total

gastrectomy. Cancer Nurs 1999; 22: 220-227

2 5 Jentschura D, Winkler M, Strohmeier N, Rumstadt B,

Hagmueller E. Quality-of-life after curative surgery for gas-

tric cancer: a comparison between total gastrectomy and sub-

total gastric resection. Hepatogastroenterology 1997; 44: 1137-

1142

2 6 Kalmar K, Cseke L, Zambo K, Horvath OP. Comparison of

quality of life and nutritional parameters after total gastrec-

tomy and a new type of pouch construction with simple Roux-

en-Y reconstruction: preliminary results of a prospective,

randomized, controlled study. Dig Dis Sci 2001; 46: 1791-

1796

2 7 Kono K, Iizuka H, Sekikawa T, Sugai H, Takahashi A, Fujii

H, Matsumoto Y. Improved quality of life with jejunal pouch

reconstruction after total gastrectomy. Am J Surg 2003; 185:

150-154

2 8 Korenaga D, Orita H, Okuyama T, Moriguchi S, Maehara Y,

Sugimachi K. Quality of life after gastrectomy in patients

with carcinoma of the stomach. Br J Surg 1992; 79: 248-250

2 9 Diaz De Liano A, Oteiza Martinez F, Ciga MA, Aizcorbe M,

Cobo F, Trujillo R. Impact of surgical procedure for gastric

cancer on quality of life. Br J Surg 2003; 90: 91-94

3 0 Liedman B, Svedlund J, Sullivan M, Larsson L, Lundell L.

Symptom control may improve food intake, body composition,

and aspects of quality of life after gastrectomy in cancer

patients. Dig Dis Sci 2001; 46: 2673-2680

3 1 Miyoshi K, Fuchimoto S, Ohsaki T, Sakata T, Ohtsuka S,

Takakura N. Long-term effects of jejunal pouch added to

Roux-en-Y reconstruction after total gastrectomy. Gastric Can-

cer 2001; 4: 156-161

3 2 Nakano H, Namat ame K, Nemoto H, Motohashi H,

Nishiyama K, Kumada K. A multi-institutional prospectivestudy of lentinan in advanced gastric cancer patients with

unresectable and recurrent diseases: effect on prolongation of

survival and improvement of quality of life. KanagawaLentinan Research Group. Hepatogastroenterology 1999; 46 :

2662-2668

3 3 Shiraishi N, Adachi Y, Kitano S, Kakisako K, Inomata M,Yasuda K. Clinical outcome of proximal versus total gastrec-

tomy for proximal gastric cancer. World J Surg 2002; 26: 1150-

11543 4 Svedlund J, Sullivan M, Liedman B, Lundell L. Long term

consequences of gastrectomy for patient's quality of life: the

impact of reconstructive techniques. Am J Gastroenterol 1999;94 : 438-445

3 5 Svedlund J, Sullivan M, Liedman B, Lundell L, Sjödin I. Qual-

ity of life after gastrectomy for gastric carcinoma: controlledstudy of reconstructive procedures. World J Surg 1997; 21 :

422-433

3 6 Svedlund J, Sullivan M, Sjödin I, Liedman B, Lundell L. Qual-ity of life in gastric cancer prior to gastrectomy. Qual Life Res

1996; 5: 255-264

3 7 Thybusch-Bernhardt A, Schmidt C, Küechler T, Schmid A,Henne-Bruns D, Kremer B. Quality of life following radical

surgical treatment of gastric carcinoma. World J Surg 1999;

23 : 503-5083 8 Troidl H, Kusche J, Vestweber KH, Eypasch E, Maul U. Pouch

versus esophagojejunostomy after total gastrectomy: a ran-

domized clinical trial. World J Surg 1987; 11: 699-7123 9 Vickery CW, Blazeby JM, Conroy T, Arraras J, Sezer O, Koller

M, Rosemeyer D, Johnson CD, Alderson D. Development of

an EORTC disease-specific quality of life module for use inpatients with gastric cancer. Eur J Cancer 2001; 37: 966-971

4 0 Yamaoka K, Shigehisa T, Ogoshi K, Haruyama K, Watanabe

M, Hayashi F, Hayashi C. Health-related quality of life varieswith personality types: a comparison among cancer patients,

non-cancer patients and healthy individuals in a Japanese

population. Qual Life Res 1998; 7: 535-5444 1 Zieren HU, Zippel K, Zieren J, Müller JM. Quality of life after

surgical treatment of gastric carcinoma. Eur J Surg 1998; 164:

119-125

4 2 Kurihara M, Shimizu H, Tsuboi K, Kobayashi K, Murakami

M, Eguchi K, Shimozuma K. Development of quality of life

questionnaire in Japan: quality of life assessment of cancer

patients receiving chemotherapy. Psychooncology 1999; 8: 355-

363

4 3 Saji S, Toge T, Kurosu Y, Hirata K, Gochi A, Tominaga S,

Inokuchi K. Interim report of JFMC study no. 23 –phase III

randomized clinical trial on the effectiveness of low-dose

cisplatin plus 5-FU as a postoperative adjuvant chemotherapy

for advanced gastric cancer. Gan To Kagaku Ryoho 2002; 29:

2499-2507

4 4 Toge T, Fujita M, Hirata K, Kunii Y, Kitamura M, Nagawa H,

Kubota T, Wakasugi J, Kasai Y, Takahashi Y, Furukawa H,

Takao T, Kaibara N, Takashima S, Kakegawa T, Tomita M,

Nose Y. Interim report of JFMTC study no. 20 on the effec-

tiveness of high dose CDDP plus 5-FU regimen as an adju-

vant therapy for far-advanced cancer of the stomach. Gan To

Kagaku Ryoho 2000; 27 : 395-403

4 5 Yoshino K, Fujita M, Hirata K, Kunii Y, Kitamura M, Nagawa

H, Kubota T, Wakasugi J, Kasai Y, Takahashi Y, Furukawa

H, Takao T, Kaibara N, Takashima S, Kakegawa T, Tomita

M, Nose Y. Interim report on JFMTC Study no. 21 on the

effectiveness of UFT as an adjuvant therapy for semi-ad-

vanced cancer of the stomach. Gan To Kagaku Ryoho 2000; 27:

263-270

4 6 Holland JC, Marchini A. International psycho-oncology. In:

Holland JC (ed) Psycho-oncology. New York: Oxford Univer-

sity Press 1998: 1165-1169

4 7 van Korlaar I, Vossen C, Rosendaal F, Cameron L, Bovill E,

Kaptein A. Quality of life in venous disease. Thromb Haemost

2003; 90 : 27-35


4 8 Therasse P, Arbuck SG, Eisenhauer EA, Wanders J, Kaplan

RS, Rubinstein L, Verweij J, van Glabbeke M, van OosteromAT, Christian MC, Gwyther SG. New guidelines to evaluate

the response to treatment in solid tumors. J Nat Cancer Inst

2000; 92 : 205-2164 9 Rothenberg ML, Moore MJ, Cripps MC, Andersen JS,

Portenoy RK, Burris HA, Green MR, Tarassoff PG, Brown TD,

Casper ES, Storniolo AM, Von Hoff DD. A phase II trial ofgemcitabine in patients with 5-FU-refractory pancreas cancer.

Ann Oncol 1996; 7: 347-353

5 0 Sakamoto J, Morita S, Yumiba T, Narahara H, Kinoshita K,Nakane Y, Imamoto H, Shiozaki H. A phase II clinical trial to

evaluate the effect of paclitaxel in patients with ascites caused

by advanced or recurrent gastric carcinoma: a new concept ofclinical benefit response for non-measurable type of gastric

cancer. Jpn J Clin Oncol 2003; 33: 238-240

5 1 Maillé AR, Kaptein AA, de Haes JC, Everaerd WT. Assess-ing quality of life in chronic non-specific lung disease--a re-

view of empirical studies published between 1980 and 1994.

Qual Life Res 1996; 5: 287-3015 2 Kaplan RM. The significance of quality of life in health care.

Qual Life Res 2003; 12 Suppl 1: 3-16

5 3 Lepore SJ, Helgeson VS, Eton DT, Schulz R. Improving qual-ity of life in men with prostate cancer: a randomized con-

trolled trial of group education interventions. Health Psychol

2003; 22 : 443-4525 4 Persson C, Glimelius B. The relevance of weight loss for sur-

vival and quality of life in patients with advanced gastrointes-

tinal cancer treated with palliative chemotherapy. AnticancerRes 2002; 22 : 3661-3668

5 5 Kuchler T, Henne-Bruns D, Rappat S, Graul J, Holst K, Wil-

liams JI, Wood-Dauphinee S. Impact of psychotherapeuticsupport on gastrointestinal cancer patients undergoing

surgery: survival results of a trial. Hepatogastroenterology 1999;

46 : 322-335

5 6 Bottomley A, Vanvoorden V, Flechtner H, Therasse P. Thechallenges and achievements involved in implementing Qual-ity of Life research in cancer clinical trials. Eur J Cancer 2003;39 : 275-285

5 7 Andersen BL. Biobehavioral outcomes following psychologi-cal interventions for cancer patients. J Consult Clin Psychol2002; 70 : 590-610

5 8 Rehse B, Pukrop R. Effects of psychosocial interventions onquality of life in adult cancer patients: meta analysis of 37published controlled outcome studies. Patient Educ Couns 2003;50 : 179-186

5 9 Arraras JI, Wright S, Greimel E, Holzner B, Kuljanic-VlasicK, Velikova G, Eisemann M, Visser A. Development of aquestionnaire to evaluate the information needs of cancerpatients: the EORTC questionnaire. Patient Educ Couns 2004;54 : 235-241

6 0 Brédart A, Mignot V, Rousseau A, Dolbeault S, Beauloye N,Adam V, Elie C, Léonard I, Asselain B, Conroy T. Validationof the EORTC QLQ-SAT32 cancer inpatient satisfaction ques-tionnaire by self- versus interview assessment comparison.Patient Educ Couns 2004; 54: 207-212

6 1 Bozzetti F. Total versus subtotal gastrectomy in cancer of thedistal stomach: facts and fantasy. Eur J Surg Oncol 1992; 18:572-579

6 2 Detmar SB, Muller MJ, Schornagel JH, Wever LD, AaronsonNK. Health-related quality-of-life assessments and patient-physician communication: a randomized controlled trial.JAMA 2002; 288: 3027-3034

6 3 Gilbody SM, House AO, Sheldon T. Routine administrationof Health Related Quality of Life (HRQoL) and needs assess-ment instruments to improve psychological outcome – a sys-tematic review. Psychol Med 2002; 32: 1345-1356

6 4 Kaptein AA, Scharloo M, Helder DI, Kleijn WC, van KorlaarIM, Woertman M. Representations of chronic illnesses. In:Cameron LD, Leventhal H (eds) The self-regulation of health

and illness behaviour. London: Routledge 2003: 97-118


Science Editor Ma JY and Guo SY Language Editor Elsevier HK


Helicobacter pylori promote gastric cancer cells invasion through

a NF-B and COX-2-mediated pathway

Chun-Ying Wu, Chau-Jong Wang, Chi-Chuan Tseng, Hsiao-Ping Chen, Ming-Shing Wu, Jaw-Town Lin, Hiroyasu Inoue,

Gran-Hum Chen

EL SEVIER




Chun-Ying Wu, Jaw-Town Lin, Graduate Institute of ClinicalMedicine, College of Medicine, National Taiwan University, Taiwan,ChinaChun-Ying Wu, Hsiao-Ping Chen, Gran-Hum Chen, Division ofGastroenterology, Taichung Veterans General Hospital, Taiwan, ChinaChun-Ying Wu, College of Public Health, China Medical University,Taiwan, ChinaChau-Jong Wang, Hsiao-Ping Chen, Institute of Biochemistry,College of Medicine, Chung-Shan Medical University, Taiwan, ChinaChi-Chuan Tseng, Section of Gastroenterology, Boston University,School of Medicine, Boston, USAMing-Shing Wu, Jaw-Town Lin, Division of Gastroenterology,Department of Internal Medicine, National Taiwan UniversityHospital, Taiwan, ChinaHiroyasu Inoue, Department of Pharmacology, National CardiovascularCenter Research Institute, JapanSupported by the Taichung Veterans General Hospital ResearchGrant: TCVGH-933308CCo-first-author: Chun-Ying WuCo-correspondent: Chi-Chuan TsengCorrespondence to: Dr. Gran-Hum Chen, Division of Gastroenterology,Taichung Veterans General Hospital, 160, Section 3, Taichung-KangRd, Taichung, 407, Taiwan, China. [email protected]: +886-2359-2525-3306 Fax: +886-2374-1331Received: 2004-11-02 Accepted: 2004-12-20

Abstract

AIM: To examine the effects of Helicobacter pylori (H pylori)infection on the invasiveness of gastric cancer cells, andto elucidate its mechanism.

METHODS: Gastric carcinoma cells, MKN-45, were incubatedwith CagA-positive H pylori, and cell invasion was determinedby Matrigel analysis. The expression of matrix metallopr-oteinase-9 (MMP-9), vascular endothelial growth factor(VEGF), and cyclooxygenase-2 (COX-2) were assessedby Western-blot analysis, and transcriptional activationof the COX-2 promoter was examined by measuringluciferase and -galactosidase activities. Lastly, the protein-DNA interaction was confirmed by an electrophoretic mobilityshift assay.

RESULTS: The current studies showed that: (1) incubationof CagA-positive H pylori with MKN-45 cells significantlypromotes gastric cancer cells invasion, and this effect isattenuated by pre-treatment with NS-398, a COX-2 inhibitor,or PDTC, a nuclear factor B (NF-B) inhibitor; (2) theinduction of MKN-45 cells invasion by H pylori is associatedwith increases in COX-2, MMP-9, and VEGF proteinexpression, and co-incubation of NS-398 or PDTC

significantly reduces these effects; (3) H pylori infectiontransactivates COX-2 promoter activity and increases thebinding of NF-B to this promoter.

CONCLUSION: Our data demonstrate that H pylori infectionpromotes gastric epithelial cells invasion by activatingMMP-9 and VEGF expression. These effects appear to bemediated through a NF-B and COX-2 mediated pathway,as COX-2 or NF-B inhibitor significantly attenuate theinvasiveness of gastric cancer cells and the expressionsof MMP-9 and VEGF protein.


Key words: H pylori; Gastric cancer; Invasion; MMP-9;VEGF; COX-2; NF-B

Wu CY, Wang CJ, Tseng CC, Chen HP, Wu MS, Lin JT, Inoue H,Chen GH. Helicobacter pylori promote gastric cancer cells invasionthrough a NF-B and COX-2-mediated pathway. World JGastroenterol 2005; 11(21): 3197-3203


INTRODUCTION

Helicobacter pylori (H pylori) is a spiral, microaerophilic, neutralophilicgram-negative bacterium that colonizes the gastric mucosain 25-50% and 70-90% of the population in the developedand developing countries, respectively[1]. H pylori is believedto be the major contributing factor to the development ofchronic gastritis and peptic ulcer diseases in human, andepidemiological and interventional studies in human as wellas in experimental animals strongly suggest that H pyloriinfection increases the risk of adenocarcinoma in the distalstomach[2,3]. Although H pylori has been demonstrated to beassociated with gastric cancer occurrence, whether H pyloripromote gastric cancer cells invasion is still unknown.

Upon bacterial infection, host effectors induced by H pyloriare likely to contribute to gastric carcinogenesis and tumorinvasion. Matrix metalloproteinases (MMPs), a family ofclosely related enzymes that degrade extracellular matrix(ECM), are considered to be important factors in facilitatingtumor invasion and spread[4]. MMPs displays broad andoverlapping substrate specificity and collectively and theyare capable of degrading the major components of ECM.Furthermore, MMPs are found to play major roles in connectivetissue remodeling during pathologic conditions, such ascancer and inflammatory disease. Among these MMPs,


matrix metalloproteinase-9 (MMP-9) has been consideredto be an important factor in facilitating lymphatic invasionand metastases in early gastric carcinoma[5], and the levelof tissue MMP-9 has been shown to be related to the overallsurvival of patients with gastric carcinoma[6]. Recently,MMP-9 has been reported to be induced by H pylori throughactivation of nuclear factor B (NF-B)[7]. Whether H pylorican promote gastric cancer cell invasion through MMP-9is unknown.

Vascular endothelial growth factor (VEGF), the mostwell-characterized angiogenic factor, is known to play a majorrole in the multistep process leading to the reconstructionof normal mucosa architecture. This process is believed tobe mediated through angiogenesis, ensuring an adequatesupply of nutrients to the healing tissue[8]. Moreover, VEGFalso plays a vital role in tumor-associated microvascularinvasion[9]. In human gastric cancers, VEGF has been foundto be over-expressed[10,11], and in a recent study, VEGFexpression has been reported to be upregulated by H pylorithrough a cyclooxygenase-2 (COX-2) dependent mechanism[12]. Whether VEGF contributes to gastric cancer invasioninduced by H pylori infection remains unknown.

Cyclooxygenase (COX), the rate-limiting enzyme in theconversion of arachidonic acid to prostaglandin H2, is themain target of non-steroid anti-inflammatory drugs (NSAIDs).Two isoforms of this enzyme have been identified: COX-1is constitutively expressed in most tissues and is involved in theproduction of prostaglandins to maintain normal physiologicalfunctions; and COX-2 is involved in inflammation and hasbeen shown to be induced by mitogens, cytokines, hormones,and growth factors. Several recent studies suggested thatCOX-2 might be an important factor in carcinogenesis, andCOX-2 inhibitors were shown to possess anticancer effects.These properties were mediated through the inhibition ofprostaglandins production by COX-2, leading to decreasesin angiogenic factors, and changes in MMP activity[13]. Inhuman gastric cancer cells, NF-B mediated COX-2 expressionis associated with cell proliferation[14]. Furthermore, H pyloriactivates NF-B expression in gastric cancer cells[15].

The present study was undertaken to examine the effectof H pylori infection on gastric cancer cells invasivenessand to elucidate its mechanism. Our results suggest thatH pylori may induce the expression of MMP-9 and VEGFand promote gastric cell invasion through a NF-B-andCOX-2-mediated pathway.


Cell lineHuman gastric carcinoma cell line, MKN-45, was obtainedfrom American Type Culture Collection (Manassas, VA,USA). MKN-45 cells were maintained in DMEM mediumcontaining 10% fetal bovine serum, 100 U/mL penicillin and100 g/mL streptomycin. On the day of experiment, cellswere refed with fresh medium and co-cultured with H pylori.

Bacterial strainCag pathogenicity island-positive H pylori (ATCC 43504)strain was used in experiments described in this study. Stockcultures were maintained at -70 ℃ in brucella broth supple-

mented with 30% glycerol. The bacteria were grown at 37 ℃in 5% horse blood agar plates and in a microaerobic condition.Cultures were routinely screened for urease activity. Forco-infection studies, H pylori were harvested between 48and 72 h after inoculation of agar plates, resuspended insterile phosphate buffered saline (PBS), and enumeratedby absorbance at 600 nm (1 optical density (A) at 600 nm= 2.4×108 colony-forming units/mL). MKN-45 cells wereseeded into 65 mm dishes, and H pylori at a multiplicity ofinfection 80 were added in the culture.

Cell migration assaysThe effect of H pylori infection on cell migration was examinedusing the Matrigel Invasion chamber, as suggested by themanufacturer (BD Bioscience). The lower surface of thechamber contained a transwell filter (8-m pores), coatedwith fibronectin, and vitronectin. MKN 45 cells (1×105)and H pylori were added to the upper chamber, in the presenceor absence of NS-398, and incubated overnight in ahumidified tissue culture incubator, at 37 ℃, 50 mL/L CO2

atmosphere. The next day, a cotton tipped swab was insertedinto chambers to remove non-invading cells by applyinggentle but firm pressure while moving the tip around themembrane surface. The cells on the lower surface of insertchambers were stained with hematoxylin for 10 min, andthe cell number was counted under a microscope (40 to200× magnifications). The extent of cell invasion wasexpressed as fold increases of total number of cells on thelower surface of chambers in treated over untreated samples.

Western blot analysisTo obtain whole-cell extracts, cells were washed twice withice-cold phosphate-buffer saline (PBS), and pelleted bycentrifugation (200 r/min). Cell pellets were then lysed in astandard RIPA buffer (50 mmol/L Tris-HCl, pH 7.5, 150mmol/L NaCl, 1.0% NP-40, 0.5% sodium deoxycholate,and 0.1% SDS), containing protease inhibitors. Proteinconcentrations were determined by Bio-Rad assays. Proteinsamples were dissolved in the loading buffer (60 mmol/LTris-HCl, pH 6.8, 2% SDS, 100 mmol/L dithiothreitol, and0.01% bromophenol blue), heated to 100 ℃ for 3 min, andloaded onto the gel in an electrophoresis buffer containing25 mmol/L Tris-HCl, pH 8.3, 250 mmol/L glycine, and0.1% SDS. At the completion of electrophoresis, proteinwas transferred to a nitrocellulose membrane (Hybond-ECL,Amersham Life Science). The membrane was incubated inthe blocking buffer (10 mmol/L Tris, pH 7.5, 100 mmol/LNaCl, 0.1% Tween 20), containing 5% nonfat powderedmilk for 2 h. The membrane was immunoblotted with COX-2, MMP-9, or VEGF antiserum (obtained from Santa CruzBiotech, Santa Cruz, CA, USA). After incubation with thesecondary antibody, the membrane was visualized withEnhanced Chemiluminescence kit from Amersham.

Transfection and luciferase assayTo examine transcriptional regulation of COX-2 promotersby NF-B, MKN-45 cells were transiently transfected withpMT2-LacZ and COX-2-Luc or phPES2 (KBM)-Luc DNAs,in the presence of NF-B p65, p50, or control pMT2 plasmid(kindly supplied by Dr. Gail Sonenshein, Boston Medical

Wu CY et al. H pylori-induced gastric cancer cell invasion 3199

Center, Boston, MA, USA). The phPES2 (KBM) plasmidcontains a full-length COX-2 promoter in which a putativeNF-B binding site is mutated, as described previously[16].For luciferase assays, cells were washed twice with PBSand then lysed in 500 L of lysis buffer following themanufacturer’s instructions (Analytical Luminescence, SanDiego, CA, USA). To assay luciferase activity, cell lysate(100 L) was mixed with 100 L of luciferase substratesolution A (Analytical Luminescence). Using a luminometerwith automatic injection, 100 L of luciferase solution Bwas added (Analytical Luminescence) and luciferase activitywas detected as the light emission over a 30-s period.

The -galactosidase activity in 40 L of the cell lysatewas determined after a 5-30-min incubation at 37 ℃ with2 mmol/L chlorophenol red -galactopyranoside (BoehringerMannheim) in 2 mmol/L MgCl2, 0.1 mmol/L MnCl2, 45 mmol/L2-mercaptoethanol, and 100 mmol/L NaHPO4, pH 8.0. Thereactions were terminated by adding 500 L of 0.5 mol/LEDTA, pH 8.0, and the absorbance at 570 nm was measuredusing a spectrophotometer. With each experiment, the luciferaseactivity was determined in duplicate and normalized to the-galactosidase activity for each dish.

Electrophoretic mobility shift assayNuclear extracts were prepared using Nuclear Extract kit (ActiveMotif, Carlsbad, CA, USA). A double-strand oligonucleotide(5’-AGTTGAGGGGACTTTCCCAGGC-3’), correspondingto the putative NF-B binding domain on the COX-2promoter was synthesized and was labeled with [-32P] ATP(3 000 Ci/mmol at 10 mCi/mL) using a T4 polynucleotidekinase. Nuclear protein (1 g) was incubated in a buffercontaining 20% glycerol, 5 mmol/L MgCl2, 2.5 mmol/LEDTA, 2.5 mmol/L DTT, 250 mmol/L NaCl, 50 mmol/LTris-HCl (pH 7.5), 0.25 mg/mL poly (dl-dC)·poly (dl-dC),for 10 min at room temperature, and 32P-labeled NF-Boligo was added to each reaction and incubated for additional20 min. Samples were subjected to electrophoresis at roomtemperature on a 4% acrylamide gel at 25 mA using 0.5×TBE buffer. The gels were dried at 80 ℃ for 2 h andexposed to radiography film at -70 ℃.

Immunohistochemical studiesTo further investigate the role of MMP-9 and VEGF ingastric cancer invasion, the expression of these two proteinswere examined in H pylori-positive gastric cancer tissues.Tissue sections from gastric cancer were de-paraffinized,rehydrated, and immersed in 3% hydrogen peroxide–methanol solution for 10 min at room temperature to inhibitendogenous peroxidase activity. The sections were thenincubated with unmasking solution (0.01 mol/L citrate bufferpH 6.0), heated for 10 min. The sections were allowed tocool down to room temperature and washed twice in PBSbuffer for 5 min. The sections were pre-incubated withdiluted normal serum for 10 min, and then incubated with1:40 mouse anti-MMP-9 monoclonal antibody (NovocastraLab. Ltd, Newcastle, UK), 1:100 rabbit anti-VEGF polyclonalantibody (Zymed Lab. Inc., South San Francisco, CA, USA),or 1:40 mouse anti-COX-2 monoclonal antibody (CaymanChemical Co., Ann Arbor, MI, USA) for 1 h at roomtemperature. The sections were washed in PBS for 5 min

twice, and incubated with appropriate biotinylated secondaryantibody. After washing in PBS for 5 min twice, the slideswere incubated with ABC reagents, followed with DAB orother suitable peroxidase substrates. The sections werecounterstained with hematoxylin for 30 s, washed, dried,and mounted.

RESULTS

H pylori infection promotes gastric cancer cells invasionIn vivo tumor invasion includes not only migration process, butalso adhesion, proliferation and angiogenesis, etc., dissociationof in vitro assay for tumor cell invasion (migration) with invivo tumor invasion might exist. However, similar migrationassay to assess tumor cell invasion has been used by severalarticles published recently[17].

We used Matrigel invasion chamber to examine whetherH pylori infection induces gastric cancer cells invasion andto determine the effect of COX-2 inhibitor on this process.MKN-45 cells were incubated with H pylori in the presenceor absence of COX-2 inhibitor, NS-398 (100 ng/mL). Asillustrated in Figure 1A co-infection with H pylori induced a2.5 fold increase in MKN-45 cells migrated throughMatrigel-coated filters, indicating that H pylori promotedgastric cancer cells invasion. The COX-2 inhibitor, NS398,significantly reduced cell invasion in H pylori stimulated, butnot in untreated cells. This result suggested that H pyloriinduced gastric cancer cells invasion was, in part, mediatedthrough a COX-2-dependent mechanism.

To examine the effect of NF-B on the migration ofMKN-45 cells, cells were incubated with H pylori in thepresence or absence of NF-B inhibitor, (pyrrolidinedithiocarbamate (PDTC), 0.1 mol/L, purchased fromSigma Chem, St. Louis, MO, USA). As illustrated in Figure 1Bthe effect of H pylori infection on gastric cancer cells migrationwas completely abolished by NF-B inhibitor, suggesting apotential involvement NF-B in this process. The representativemicroscopic photos of stained cells treated with H pylori inthe presence or absence of COX-2 inhibitor were shown inFigures 1C-E.

H pylori infection induces MMP-9 and VEGF expressionSeveral proteins, including MMP-9 and VEGF, have beenreported to play an important role in tumor invasion. Theeffects of H pylori on the expression level of MMP-9 andVEGF were examined in MKN 45 cells after co-infectionwith H pylori for a different period of time. The inductionof VEGF protein expression was noticeable within an hourafter H pylori infection and reached the highest level in 24 h(Figure 2A). Although the increment of MMP-9 level afterH pylori infection was smaller than that of VEGF, a significantincrease was observed at 24 h (Figure 2A).

COX-2 and NF-B inhibitors reduce MMP-9 and VEGF

expressionsRecent studies showed that COX-2 inhibitor reduced therelease of MMP and COX-2-induced MMP-9 expression[18,19].Therefore, we examined whether the activation of MMP-9and VEGF by H pylori infection was also dependent onCOX-2 expression. The MKN-45 cells were co-cultured

with H pylori for 24 h in the presence or absence of a COX-2 inhibitor, NS-398, and our results showed that co-culturewith H pylori resulted in a time-dependent increase in COX-2protein concentration in MKN-45 cells (Figure 2B). Moreover,NS398 significantly reduced the expression levels of COX-2,MMP-9, and VEGF, induced by H pylori in MKN-45 cellsat 24 h (Figure 3A). These data suggest that the inductionof MMP-9 and VEGF by H pylori is mediated through aCOX-2-dependent mechanism.

To examine whether activations of MMP-9 and VEGFby H pylori infection were also dependent on NF-Bexpression, MKN-45 cells were co-cultured with H pylorifor 24 h in the presence or absence of a NF-B inhibitor,PDTC. As demonstrated in Figure 3B, the effects of H pylorion COX-2, MMP-9, and VEGF expression were significantlyreduced by PDTC. These results suggest that the inductionof COX-2, MMP-9, and VEGF by H pylori is also NF-B-dependent.

Induction of MMP-9 and VEGF by H pylori infection depends

on a NF-B-mediated COX-2 activationA previous study has shown that NF-B regulated COX-2expression and affected cell proliferation in human gastriccancer cells[14]. We hypothesize that the induction of MMP-9and VEGF by H pylori is associated with NF-B mediated

COX-2 expression. To investigate this hypothesis, we firstexamined the effect of NF-B on COX-2 promoter activitiesin MKN45 cells. As illustrated in Figure 4A co-transfectionwith NF-B p65 or p50 plasmid DNA significantly enhancedCOX-2 promoter activity, and the induction was completely

Figure 1 Effects of H pylori infection, a cox-2 (NS398), or a NF-B inhibitor(PDTC) on gastric cancer cell invasion. A: MKN-45 cells were treated withH pylori in the presence or absence of NS398. Cells on the lower surface ofinsert chamber were stained with hematoxylin for 10 min and counted undermicroscope with 200× magnifications. Data are presented as mean±SD of three

separate experiments (P<0.05); B: MKN-45 cells were treated with H pylori inthe presence or absence of PDTC (P<0.05); microscopic photos of stainedmigration cells: C: control; D: with H pylori; E: with H pylori and NS-398; F:control; G: with H pylori; H: with H pylori and PDTC.

Figure 2 H pylori infection increases MMP-9, VEGF, and COX-2 expressionsin gastric epithelial cell. MKN-45 gastric cancer cells were incubated with H pylorifor 0-24 h and total cellular protein was extracted for Western blot analysis for theexpression of A: MMP-9 and VEGF and B: COX-2 proteins. The blots werestripped and probed with -act in to document equal protein loading. Theexperiment was performed for thrice with similar results.

3.0

2.5

2.0

1.5

1.0

0.5

0.0

C D E

F HG

Control H pylori NS398+H pylori

Inva

sion r

atio

5

4

3

2

1

0Control H pylori PDTC+H pylori

Inva

sion r

atio

B

H pylori

MMP9

VEGF

-actin

Control 1 h 2 h 3 h 6 h 24 h

H pylori

Control 1 h 2 h 3 h 6 h 24 h

COX-2

-actin

A

B


0 0.1 0.2 0.2 0.4 1.9 Fold

0 0.6 0.5 0.8 1.7 4.4 Fold

A

0 0.03 0.2 0.07 0.6 0.7 Fold

abolished in phPES2 (KBM) construct where a putative NF-Bbinding domain was mutated. Furthermore, the interactionbetween NF-B and COX-2 promoter was also enhancedby H pylori infection in MKN-45 cells (Figure 4B).

High level of MMP-9 and VEGF expression in gastric cancertissues with H pylori infectionTo investigate whether these observations were also presentin vivo, we randomly selected six gastric cancer patients (threecases with H pylori infection, confirmed by Giemsa stain andCLO test; three cases without H pylori infection) and examinedthe expression of COX-2, MMP-9, or VEGF protein in the

surgical specimens. The immunostain of COX-2 (Figures 5Aand B), MMP-9 (Figures 5C and D), or VEGF (Figures 5Eand F) was located predominantly on the surface epithelialcells, and the intensity was more abundant in H pylori-positive than H pylori-negative tissue samples (Figure 5).

DISCUSSION

Gastric cancer is one of the most common malignancies inthe world, especially in Eastern Asia. Although the incidenceof gastric carcinoma is declining in Western countries, gastric

Figure 3 Effect of COX-2 or NF-B inhibitor on COX-2, MMP-9, or VEGF proteinlevel in MKN-45 cells. A: Cells were cultured in the presence or absence of H pyloriand NS398 for 24 h, and cellular protein was extracted and subjected to Westernblot analysis; B: MKN-45 cells were treated with or without PDTC and in thepresence or absence of H pylori for 24 h. The experiments were repeated on atleast three occasions, and the results were identical to these presented here. Allblots were stripped and probed with -actin to check for equal protein loading.

Figure 4 A: Transactivation of COX-2 promoter by NF-B. MKN-45 cells weretransiently transfected with full-length COX-2 promoter (Black bar), or mutatedCOX-2 construct, phPES2 (KBM), where the putative NF-B binding domainwas mutated (open bar), in the presence of p65, p50, or control vector (pMT2)plasmid. Luciferase and -galactosidase activities were performed 48 h aftertransfection. (n = 4, P<0.05); B: Binding of nuclear NF-B to COX-2 promoterDNA in MKN-45 cells. Nuclear protein was extracted from cells cultured in theabsence (lane 2), or presence (lane 3) of H pylori. The protein-DNA interactionbands were shown as (→). Lane 1 showed free probe only.

Figure 5 Immunohistochemical detection of COX-2, MMP-9, and VEGF ingastric cancer tissues. The serial sections of gastric cancer surgical specimenswere stained with anti-COX-2 (A and B), anti-MMP-9 (C and D) , and anti-VEGF(E and F) antibodies. Sections were counterstained with hematoxylin. The

immunoreactivities of COX-2, MMP-9 and VEGF are predominantly detected inthe cytoplasm of the tumor cell. Tissues in A, C, and E are from H pylori-positivepatients, whereas, sections in B, D, and F are from H pylori-negative individuals.(Magnification: A-F: 400×).

H pylori - + +

MMP9

VEGF

-actin

COX-2

MMP9

VEGF

-actin

COX-2

NS398 - - +

Control 24 h 24 h

H pylori - + +

PDTC - - +

Control 24 h 24 h

A

B

5

4

3

2

1

0Rela

tive L

uci

fera

se A

ctiv

ity

pM

T2

p65

p50

phPES2

(KBM

)

phPES2

+p65

phPES2

+p50

1 2 3

→→

A B

A C

D E

B

F


1 1.25 0.9 Fold

1 1.8 1.09 Fold

1 4.3 1.3 Fold

1 1.9 1.8 Fold

1 1.3 0.8 Fold

1 1.7 0.9 Fold

cancer remains the leading cause of cancer death worldwide.Current strategies to reduce mortality from this disease focuson early detection of gastric cancer or its precursor lesionsby endoscopic screening. There is an increasing interest inthe use of drugs to prevent the occurrence or the invasionof gastric cancers. Epidemiological studies have shown thatNSAIDs decrease the risk of gastrointestinal carcinomas[20].However, the mechanisms by which NSAIDs inhibit neoplasticgrowth are not fully elucidated[21,22].

The involvement of COX-2 in carcinogenesis has beenshown in many epidemiological, animal and clinical studies.Individuals who took NSAIDs regularly had a markedlyreduced risk of developing colon cancer[13], and COX-2inhibitors have been proved to be effective in suppressingtumor progression both in vitro and in vivo in nude mice[21].The anti-tumor effect of COX-2 inhibitors was attributedto their ability to induce apoptosis and inhibit tumor cellproliferation and angiogenesis. COX-2 inhibitors have alsobeen illustrated to prevent tumor invasion in colon cancer,hepatocellular carcinoma[22], and lung cancer[23]. There is littleevidence that COX-2 inhibitors may prevent gastric cancerinvasion, although gastric cancers have been shown to over-express COX-2 protein[24].

In the present study, we found that H pylori infectionpromoted gastric cancer cells invasion and a COX-2 specificinhibitor significantly attenuated this process. Furthermore,the induction of gastric cancer cells invasion is associatedwith an increase in COX-2, MMP-9, or VEGF protein level,and these effects were also attenuated by a COX-2 inhibitor,suggesting a potential role of MMP-9 or VEGF in this process.In MKN-45 cells, H pylori infection enhanced nuclear NF-B activity and transactivated COX-2 promoter. In addition,the induction of MMP-9 and VEGF by H pylori was suppressedby a NF-B inhibitor. These data indicate that H pylori-induced MMP-9 and VEGF expressions in MKN-45 cellsare mediated through the interaction of NF-B on the COX-2 promoter. These results also support an important roleof COX-2 in gastric cancer cells invasion.

Lim et al[14], have recently shown that inhibition of NF-B results in inhibition of COX-2 expression andproliferation of gastric cancer cells. These data suggest NF-B may play an important role in gastric cancer proliferationvia COX-2 expression. Recently, Callejas et al[17], reported thatCOX-2 expression promotes the release of MMP-9 in fetalrat hepatocytes, and Caputo et al[12], also revealed that Hpylori induce VEGF expression in MKN-28 gastric epithelialcells through a COX-2 dependent mechanism. Furthermore,Li et al, reported that COX-2 increased the angiogenic andmetastatic potential of tumor cells by activation of VEGF inhuman transitional cell carcinoma cell line, and the effect oninvasiveness could be reversed by COX-2 inhibitors[25-27].

Compared with previous studies, we have found severalinteresting points. In Figure 1 PDTC attenuated cell invasioncompletely, NS-398 only partially inhibited, suggesting thatNF-B could induce cell invasion not only through COX-2,but also through other pathways. One of the possibilities wasthrough direct activation of VEGF expression. In Figure 3we found that the inhibition of COX-2 by NS-398 attenuatedMMP-9 expression to the control level, but it did not attenuateVEGF expression completely. On the other hand, the inhibition

of NF-B by PDTC inhibited both MMP-9 and VEGFexpression to the control levels. These results suggest thatMMP-9 expression is dependent on COX-2 pathway, whileVEGF expression might be independent of COX-2 pathway.These observations might explain why NS-398 only partiallyattenuated cell invasion.

The activation of NF-B by H pylori has been describedby several groups[15,28,29]. Mori et al[7], reported that H pyloriinduced NF-B activation and stimulated MMP-9 expression.In the present study, we have observed that H pylori infectionin gastric cancer cells induced MMP-9 protein level andthe increase was attenuated by either a NF-B inhibitor ora COX-2 inhibitor. These data suggested that the expressionof MMP-9 in H pylori-infected cells is mediated by a directactivation NF-B, or through a COX-2 mediated pathway.This conclusion is supported by a recent report showing thatMMP-9 promoter contains several putative NF-B bindingsites, and its transcription requires the activation of NF-B.

Infection with H pylori affects more than 50% of theworld population; some patients exhibit a progressionthrough chronic atrophic gastritis to cancer, others developpeptic ulcer, but most do not exhibit either disease[30]. It isbelieved that different pathogens, host and environmentalfactors may lead to variable outcomes. In this study, wesuggest that the induction of MMP-9 and VEGF proteinsby H pylori can be considered part of a host response toaccelerate an oncogenic progression via disruption of epit-helial organization or increased invasion. The identificationof H pylori-specific signaling pathways leading to the gastriccancer cells invasion will add to our understanding of themechanism of H pylori-associated gastric carcinogenesis andthe potential use of therapeutic agents in preventing H pylori-associated gastric cancer.

In summary, we have demonstrated that H pylori promotegastric epithelial cells invasion by activating the expression ofMMP-9 and VEGF, and these effects are attenuated by aCOX-2 or a NF-B inhibitor. Moreover, H pylori infectioninduces nuclear NF-B binding activity to the COX-2 promoter,and the activation of COX-2 promoter is abolished when theNF-B binding site is mutated. These data suggest that thepromotion of gastric cancer cells invasion by H pylori infectionappears to be mediated through a NF-B and COX-2 mediatedpathway. Therefore, we proposed a model of H pylori-inducedgastric cancer cell invasion as shown in Figure 6.

Figure 6 The schematic presentation of proposed mechanism of H pylori promotegastric epithelial cells invasion.

IB

p65 p50

P

p65 p50 COX-2

COX-2

NS398

MMP9VEGF

Cell invasion

H pylori

PDTC


REFERENCES1 Gooz M, Gooz P, Smolka AJ. Epithelial and bacterial

metalloproteinases and their inhibitors in H pylori infection of

human gastric cells. Am J Physiol Gastrointest Liver Physiol

2001; 281: G823-G832

2 Huang JQ, Sridhar S, Chen Y, Hunt RH. Meta-analysis of the

relationship between Helicobacter pylori seropositivity and

gastric cancer. Gastroenterology 1998; 114: 1169-1179

3 Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi

S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter

pylori infection and the development of gastric cancer. N Engl

J Med 2001; 345: 784-789

4 Murray GI, Duncan ME, O’Neil P, Melvin WT, Fothergill JE.

Matrix metalloproteinase-1 is associated with poor progno-

sis in colorectal cancer. Nat Med 1996; 2: 461-462

5 Kabashima A, Maehara Y, Kakeji Y, Baba H, Koga T, Sugimachi

K. Clinicopathological features and overexpression of matrix

metalloproteinases in intramucosal gastric carcinoma with

lymph node metastasis. Clin Cancer Res 2000; 6: 3581-3584

6 Sier CF, Kubben FJ, Ganesh S, Heerding MM, Griffioen G,

Hanemaaijer R, van Krieken JH, Lamers CB, Verspaget HW.

Tissue levels of matrix metalloproteinases MMP-2 and MMP-

9 are related to the overall survival of patients with gastric

carcinoma. Br J Cancer 1996; 74: 413-417

7 Mori N, Sato H, Hayashibara T, Senba M, Geleziunas R, Wada

A, Hirayama T, Yamamoto N. Helicobacter pylori induces

matrix metalloproteinase-9 through activation of nuclear fac-

tor kappaB. Gastroenterology 2003; 124: 983-992

8 Jones MK, Tomikawa M, Mohajer B, Tarnawski AS. Gas-

trointestinal mucosal regeneration: role of growth factors. Front

Biosci 1999; 4: D303-D309

9 Connolly DT, Heuvelman DM, Nelson R, Olander JV, Eppley

BL, Delfino JJ, Siegel NR, Leimgruber RM, Feder J. Tumor

vascular permeability factor stimulates endothelial cell growth

and angiogenesis. J Clin Invest 1989; 84: 1470-1478

1 0 Tian X, Song S, Wu J, Meng L, Dong Z, Shou C. Vascular

endothelial growth factor: acting as an autocrine growth fac-

tor for human gastric adenocarcinoma cell MGC803. Biochem

Biophys Res Commun 2001; 286: 505-512

1 1 Yamamoto S, Yasui W, Kitadai Y, Yokozaki H, Haruma K,

Kajiyama G, Tahara E. Expression of vascular endothelial

growth factor in human gastric carcinomas. Pathol Int 1998;

48 : 499-506

1 2 Caputo R, Tuccillo C, Manzo BA, Zarrilli R, Tortora G, Blanco

Cdel V, Ricci V, Ciardiello F, Romano M. Helicobacter pylori

VacA toxin up-regulates vascular endothelial growth factor

expression in MKN 28 gastric cells through an epidermal

growth factor receptor-, cyclooxygenase-2-dependent

mechanism. Clin Cancer Res 2003; 9: 2015-2021

1 3 Church RD, Fleshman JW, McLeod HL. Cyclo-oxygenase 2

inhibition in colorectal cancer therapy. Br J Surg 2003; 90 :

1055-1067

1 4 Lim JW, Kim H, Kim KH. Nuclear factor-kappaB regulatescyclooxygenase-2 expression and cell proliferation in human

gastric cancer cells. Lab Invest 2001; 81: 349-360

1 5 Maeda S, Akanuma M, Mitsuno Y, Hirata Y, Ogura K, YoshidaH, Shiratori Y, Omata M. Distinct mechanism of Helicobacter

pylori-mediated NF-kappa B activation between gastric can-

cer cells and monocytic cells. J Biol Chem 2001; 276: 44856-448641 6 Inoue H, Nanayama T, Hara S, Yokoyama C, Tanabe T. The

cyclic AMP response element plays an essential role in the

expression of the human prostaglandin-endoperoxide syn-thase 2 gene in differentiated U937 monocytic cells. FEBS Lett

1994; 350: 51-54

1 7 Ueda J, Kajita M, Suenaga N, Fujii K, Seiki M. Sequence-specific silencing of MT1-MMP expression suppresses tumor

cell migration and invasion: importance of MT1-MMP as a

therapeutic target for invasive tumors. Oncogene 2003; 22 :8716-8722

1 8 Attiga FA, Fernandez PM, Weeraratna AT, Manyak MJ, Patierno

SR. Inhibitors of prostaglandin synthesis inhibit human pros-tate tumor cell invasiveness and reduce the release of matrix

metalloproteinases. Cancer Res 2000; 60: 4629-4637

1 9 Callejas NA, Casado M, Diaz-Guerra MJ, Bosca L, Martin-Sanz P. Expression of cyclooxygenase-2 promotes the release

of matrix metalloproteinase-2 and -9 in fetal rat hepatocytes.

Hepatology 2001; 33 : 860-8672 0 Huls G, Koornstra JJ, Kleibeuker JH. Non-steroidal anti-in-

flammatory drugs and molecular carcinogenesis of colorectal

carcinomas. Lancet 2003; 362: 230-2322 1 Thun MJ, Henley SJ, Patrono C. Nonsteroidal anti-inflamma-

tory drugs as anticancer agents: mechanistic, pharmacologic,

and clinical issues. J Natl Cancer Inst 2002; 94: 252-2662 2 Chan TA. Nonsteroidal anti-inflammatory drugs, apoptosis,

and colon-cancer chemoprevention. Lancet Oncol 2002; 3: 166-174

2 3 Barnes CJ, Cameron IL, Hardman WE, Lee M. Non-steroidolanti-inflammatory drug effect on crypt cell proliferation and

apoptosis during initiation of rat colon carcinogenesis. Br J

Cancer 1998; 77: 573-5802 4 Koga H. Hepatocellular carcinoma: is there a potential for

chemoprevention using cyclooxygenase-2 inhibitors? Cancer

2003; 98 : 661-6672 5 Dohadwala M, Luo J, Zhu L, Lin Y, Dougherty GJ, Sharma S,

Huang M, Pold M, Batra RK, Dubinett SM. Non-small cell

lung cancer cyclooxygenase-2-dependent invasion is medi-ated by CD44. J Biol Chem 2001; 276: 20809-20812

2 6 Jiang XH, Wong BC. Cyclooxygenase-2 inhibition and gastric

cancer. Curr Pharm Des 2003; 9: 2281-22882 7 Li G, Yang T, Yan J. Cyclooxygenase-2 increased the angio-

genic and metastatic potential of tumor cells. Biochem Biophys

Res Commun 2002; 299: 886-8902 8 Gupta RA, Polk DB, Krishna U, Israel DA, Yan F, DuBois

RN, Peek RM. Activation of peroxisome proliferator-activated

receptor gamma suppresses nuclear factor kappa B-medi-ated apoptosis induced by Helicobacter pylori in gastric epi-

thelial cells. J Biol Chem 2001; 276: 31059-31066

2 9 Maeda S, Akanuma M, Mitsuno Y, Hirata Y, Ogura K, YoshidaH, Shiratori Y, Omata M. Distinct mechanism of Helicobacter

pylori-mediated NF-kappa B activation between gastric can-

cer cells and monocytic cells. J Biol Chem 2001; 276: 44856-448643 0 Wada A, Ogushi K, Kimura T, Hojo H, Mori N, Suzuki S,

Kumatori A, Se M, Nakahara Y, Nakamura M, Moss J, Hirayama

T. Helicobacter pylori-mediated transcriptional regulation ofthe human beta-defensin 2 gene requires NF-kappaB. Cell

Microbiol 2001; 3: 115-123




Anti-gastric cancer active immunity induced by FasL/B7-1

gene-modified tumor cells

Shi-Ying Zheng, De-Chun Li, Zhi-De Zhang, Jun Zhao, Jin-Feng Ge

EL SEVIER




Shi-Ying Zheng, Jun Zhao, Jin-Feng Ge, Department of Cardio-thoracic Surgery, The First Affiliated Hospital of Suzhou University,Suzhou 215006, Jiangsu Province, ChinaDe-Chun Li, Zhi-De Zhang, Department of General Surgery, TheFirst Affiliated Hospital of Suzhou University, Suzhou 215006,Jiangsu Province, ChinaSupported by the Medical Scientific Foundation of JiangsuProvince, No. H200147Correspondence to: Dr. Shi-Ying Zheng, Department of Cardio-thoracic Surgery, The First Affiliated Hospital of Suzhou University,Suzhou 215006, Jiangsu Province, China. syzheng88@ sina.comTelephone: +86-512-65263570Received: 2004-06-19 Accepted: 2004-08-06

Abstract

AIM: To study the activation of cytotoxic T lymphocytes(CTLs) against gastric cancer cells induced by FasL/B7-1(FB-11) gene-modified tumor cells, and to explorewhether co-expression of FasL and B7-1 in SGC-7901tumor cells could initiate synergistic antitumor effect.

METHODS: FasL and B7-1 genes were transfected intohuman SGC-7901 gastric cancer cells with adenovirusvectors. The positive clones were selected by G418. FasLand B7-1 genes were detected by flow cytometry andRT-PCR. Abdominal infiltrating lymphocytes and sensitizedspleen cells were obtained from mice that wereimmunized with SGC-7901/FB-11 or wild type SGC-7901cells intraperitoneally, and cytotoxicity of these CTLsagainst tumor cells was determined by MTT assay.

RESULTS: Flow cytometry and RT-PCR showed that FasLand B7-1 genes were highly expressed. FasL and B7-1transfected cancer cells had a high apoptosis index. DNAladdering suggested that FasL and B7-1 genes inducedgastric cancer cell apoptosis. FasL+/B7-1+SGC-7901 cells(SGC-7901/FB-11) were inoculated subcutaneously in thedorsal skin of C57BL/6 mice and then decreased theirtumorigenicity greatly (z = 2.15-46.10, P<0.01). SGC-7901/FB-11 cell-sensitized mice obtained protectiveimmune activity against the rechallenge of wild type SGC-7901 cells (z = 2.06-44.30, P<0.05). The cytotoxicity ofCTLs induced by SGC-7901/FB-11 cells against SGC-7901was significantly higher than that of CTLs activated bywild-type SGC-7901 cells (84.1±2.4% vs 30.5±2.3%,P<0.05).

CONCLUSION: FasL and B7-1 genes can effectivelypromote the activity of CTLs against gastric cancer cells.FasL/B7-1 molecules play an important role in CTL cytotoxicity.


Key words: Gastric cancer; FasL gene; B7-1 gene; Genetherapy; Synergistic effect

Zheng SY, Li DC, Zhang ZD, Zhao J, Ge JF. Anti-gastric canceractive immunity induced by FasL/B7-1 gene-modified tumorcells. World J Gastroenterol 2005; 11(21): 3204-3211


INTRODUCTION

The immune surveillance and killing activity of immunoactivecells on tumor cells play crucial roles in tumor immunity.However, oncologists and immunologists have long beenfaced with a tough task, i.e., how to successfully induceanti-tumor cytotoxic effects mediated by antigen specific Tlymphocytes[1-3].

Research has revealed that one major reason for thelow responsiveness of cytotoxic T lymphocytes (CTLs) tocancerous cells lies in the loss of interaction betweencostimulatory factors CD28 and CD152 and B-7 moleculeson tumor cell surface which results from the low expressionof the costimulatory factors of B-7 family on the surfaceof tumor cells[3-6]. This precludes CTLs partially activatedafter recognition of antigens from being fully activated,making it impossible to generate cytokines with immunologicalattacking activity against tumor cells and membrane lysissignals (from the Fas-FasL system) as well[4-7].

In the present study, we constructed the recombinantadenovirus vector (AdV) containing human FasL and B7-1genes (termed FB-11), which was used to transfect humangastric cancer cells. Transfection rates and expression ofthe two genes were determined, and the capability ofinducing tumor-specific CTLs from peripheral blood Tlymphocytes (PBT) and tumorigenicity in mice of the FasL/B7-1-modified gastric cancer cells were observed. Thisprovides an experimental base for the combination of tumorimmunology and gene therapy in the treatment of cancer.


Animals, cells, materialsC57BL/6 (H-2b) inbred mice at the age of 6-8 wk werebought from the Shanghai Laboratory Animal ResearchCenter of Chinese Academy of Sciences. SV40 promoter(PSV40) driven human B7-1 cDNA was presented byProfessor Daru Lu at the Institute of Molecular Genetics,Fudan University, Shanghai. Rat-anti-mouse monoclonal

antibody (mAb) against B7-1 was purchased fromPharmingen Corporation, San Diego, CA, USA. Alkalinephosphatase-conjugated goat-anti-rat IgG was obtained fromOrganon Teknika Corporation, Durham, NC, USA. G418was the product of Gibco. CMV promoter (PCMV) containinghuman FasL cDNA and its labeled antibody weremanufactured by Jinmei Company, Shanghai, China.

Human gastric cancer cell line SGC-7901 was providedby the Institute of Cell Biology of Chinese Academy ofSciences, Shanghai. The cells were grown in RPMI-1640supplemented with 10% fetal calf serum at 37 ℃ in a50 mL/L CO2 atmosphere.

Human embryonic kidney cell line 293 containing E1region of human adenovirus type 5 (Ad5) was bought fromGeneTherapy Unit of Baxter Healthcare Company, USA,and cultured in high glucose Dulbecco’s modified Eagle’smedium (DMEM) supplemented with 10% fetal calf serumat 37 ℃ in a 50 mL/L CO2 atmosphere.

Construction of recombinant adenovirusRecombinant adenovirus (rAd) carrying green fluorescenceprotein (GFP) gene (Ad-GFP) was purchased fromGeneTherapy Unit of Baxter Healthcare Company, USA.E1/E3-deleted replication defective Ad5 vectors containingPCMV driven human FasL cDNA and PSV40 drivenhuman B7-1 cDNA were constructed by Jinmei Corporationand Professor Daru Lu at the Institute of MolecularGenetics of Fudan University, Shanghai. This vector wastermed FB-11. Amplification and purification of rAd andmeasurements of concentration, titer and infection ratewere performed as previously described[8].

Transfection of gastric cancer cells with adenoviral vectorSGC-7901 cells were seeded in six-well plates at a densityof 5×105 cells/well. Culture media were aspirated after12 h and Ad-GFP in 0.8 mL of culture medium was addedto each well at various MOIs (0, 12.5, 25, 50, and 100,respectively). After soaking for 1-2 h, the viral solution wasaspirated and 2 mL of culture medium was added to eachwell. After 12 h, the numbers of GFP+-cancer cells wascounted under fluorescence microscope. Each counting wasrepeated thrice and transfection rates were calculated.

Measurement of expression of B7-1 gene by flow cytometrySGC-7901 gastric cancer cells were grown in 60-mm dishesat a density of 1×106 cells/dish. After 24 h, the cells wereinfected with FP-11 at a MOI of 50 for 48 h, trypsinizedand washed twice with Hank’s solution, and resuspended in100-200 L Hank’s solution. This was followed by theaddition of 20 L of AV-FITC labeled mouse-anti-humanB7-1 mAb solution, incubated at 4 ℃ for 30 min, washedtwice in Hank’s solution, and resuspended in 1 mL of PIcontaining Hank’s solution. The expression of B7-1 genedelivered by FB-11 on the surface of the two cancer celllines was determined by AV/PI bivariate flow cytometry.

Measurement of expression of FasL gene by RT-PCRTotal RNA of FB-11-transfected SGC-7901 cells (termedSGC-7901/FB-11, respectively) was extracted by TRIzolRNA isolation method (Life Technologies, Gaithersburg,

MD, USA). The RNA was then reversely transcribed intocDNA with Moloney mouse leukemia virus (MoMLV)reverse transcriptase (GIBCO-BRL) and Oligo-dT (GIBCO-BRL). The human FasL cDNA was amplified with primersas follows: sense primer (483-503): 5’ CTGGGGATGTT-TCAGCTCTTC 3’; antisense primer (713-693): 5’ CTTC-ACTCCAGA AAGCAGGAC 3’.

cDNA amplification was conducted in a 50-L reactionvolume comprising four sorts of dNTP (200 mol/L each),2.5 mmol/L MgCl2, 2.5 U Taq polymerase and sense andantisense primers (0.4 mol/L each). Amplification wasperformed for 35 cycles, each consisted of 30 s at 94 ℃,1 min at 55 ℃, and 1.5 min at 72 ℃. PCR products wereseparated by electrophoresis on a 2% agarose gel and visualizedby ethidium bromide (EB) staining, revealing a 231 bp bandcorresponding to human FasL gene fragment. Furthermore,PCR products were analyzed by restriction enzyme mapping.

Inhibitory effects of FB-11 on SGC-7901 cell growthSGC-7901 cancer cells were plated in 24-well plates at adensity of 1×106 cells/well, and infected with FB-11 orAd-GFP at a MOI of 50 after 24 h. Subsequent growth ofthe two cell lines was monitored daily. The cells weretrypsinized, stained with trypan blue, and counted by ahemacytometer, and the growth curve was plotted.

Measurement of apoptosis in FB-11-transfected gastric cancer

cells by Hoechst33342 stainingSuspended FB-11-transfected SGC-7901 gastric cancer cellswere passed through filters and adjusted to a concentrationof 5×105 cells/mL. Then the cells were fixed in 1%formaldehyde in 1× phosphate buffered solution (PBS) for30 min at 4 ℃. After washing twice in 1× PBS, 0.5 g/mLHoechst33342 was added and incubated at 37 ℃ for 2 h.After being washed in 1× PBS, the number of apoptoticcells was counted under fluorescence microscope. In detail,a total of 200 cells were observed and only cells with typicalcharacteristics of apoptosis were counted. Apoptosis index(AI) was calculated according to the following formula:

Number of apoptotic cells AI(%)= ×100% Total number of observed cells

Analysis of DNA fragmentsSGC-7901 cells infected with FB-11 or Ad-GCP at a MOIof 100 were collected (above 106 cells). NP40 lysis buffer(1% NP40, 20 mmol/L EDTA, and 50 mmol/L Tris-HCl,pH 7.4) was added and stood still for 10 s. Supernatant wascollected after centrifugation, SDS was added to a concentrationof 1% and RNase to a concentration of 50 g/mL. Afterincubation at 56 ℃ for 1-2 h, protease K was added to aconcentration of 2.5 g/mL and incubated at 37 ℃ for 2 hor overnight. DNA was precipitated by ethanol, dissolvedin 10-20 L of TE buffer, and subsequently analyzed by1% agarose gel electrophoresis.

Tumorigenicity testSeven C57BL/6 mice were randomly divided into test (n = 4)and control (n = 3) groups. The test group received a

Zheng SY et al. Anti-gastric cancer active immunity 3205

subcutaneous inoculation with 5×106 SGC-7901/FB-11cells in dorsal skin and the control group received aninoculation with the same number of SGC-7901 cells atthe same site. The growth of subcutaneous tumors wasmonitored by measuring long and short diameters with aslide gauge. The size of tumors was expressed in longdiameter×short diameter. Tumor sizes of the test and controlgroups were compared.

Immunological protection testFour mice sensitized with SGC-7901/FB-11 cells wereinoculated subcutaneously in the dorsal skin with 2.5×106

wild-type SGC-7901 cells. Meanwhile, four normal micewere inoculated with the same number of SGC-7901 cellsat the same site as normal controls. Sizes of the subcutaneoustumors were monitored and compared between the twogroups.

In vitro cytotoxic testMice were sensitized peritoneously with 5×106 SGC-7901and SGC-7901/FB-11 cells and killed 7 d later. The abdominalcavity was then lavaged with 5 mL Hank’s solution, whichwas subsequently aspirated and depleted of red blood cells.The remaining macrophages and tumor cells were removedby attachment to the wall so that abdominal infiltratinglymphocytes were obtained. In addition, erythrocyte-freesingle cell suspension of mouse splenocytes was prepared.Cytotoxic activity of activated CTLs was determined byMTT assay.

Statistical analysisStatistical analysis was performed with SPSS v10.0 forWindows (SPSS Inc., Chicago, IL, USA) and P<0.05 wasconsidered statistically significant.

RESULTS

Preparation of high titer recombinant adenovirus (rAd)Highly concentrated rAd was collected by CsCl2 densitygradient super-speed centrifugation. The concentration ofrAd calculated according to 1 A260 = 1.1×1012 particles, wasgreater than 1012 particles/mL with a high purity (A260/A280>1.3). The concentrations of FB-11 and Ad-GFPmeasured by plaque assay were 3×1010 and 4×1011 pfu/mL,respectively.

Transfection rates of rAd in gastric cancer cellsGastric cancer cell lines were susceptible to the adenoviralvectors FB-11 and Ad-GFP. The greater the amount ofviral particles, the higher were the transfection rates. Thetransfection rate reached up to above 90% at a MOI of 50(Figure 1B). But when the amount of adenoviral particleswas further increased, the cell growth was suppressed withelevated dead cells (Figure 1C).

B7-1 gene expressionResults from flow cytometry indicated that SGC-7901gastric cancer cells did not express B7-1 gene (Figure 2).There were 37.5% of cells expressing B7-1 on cell surfaceon the first day and 80% of cells expressing high levelB7-1, 2 d after they were transfected with FB-11 at a MOIof 50.

Figure 2 Flow cytometric analysis of B7-1 gene expression. A: SGC-7901; B:SGC-7901/FB-11.

FasL gene expressionTotal RNA of FB-11-modified SGC-7901 cells wasextracted and the extracellular segment of FasL gene wasamplified by RT-PCR. The length of PCR products was asexpected (Figure 3).

Inhibitory and cytotoxic effects of FB-11 on gastric cancercellsAs compared to non-infected cells, the growth of FB-11-transfected SGC-7901 gastric cancer cells was significantlyinhibited (Figure 4) with SGC-7901/FB-11 displaying moresignificant inhibition.

Figure 1 Transfection rates of rAd in gastric cancer cells. A: MOI = 20; B: MOI = 50; C: MOI = 100.

A CB

0 C

ount

4

4

1 1 000 1 1 000

0 C

ount

2

8

A B


D C F B

Figure 4 Proliferation inhibition of gastric cancer cell lines. ■: SGC-7901; ○:SGC-7901L/FasL; ●: SGC-7901/FB-11; □: PBS.

Apoptosis induced by FB-11 deliveryFB-11- or Ad-GFP-transfected SGC-7901 cells stained withHoechst33342 were observed under fluorescence microscope.FB-11-transfected cancer cells had a high apoptosis index,but no apoptosis was seen in Ad-GFP-transfected cells(Figure 5). DNA laddering (Figure 6) suggested that FasLand B7-1 genes induced gastric cancer cell apoptosis.

Tumorigenicity of FB-11- transfected gastric cancer cells innude miceAs seen in Figure 7, SGC-7901 gastric cancer cell linesacquired lower tumorigenicity in C57BL/6 mice aftertransfected with FB-11. On day 13 after the transfection, asignificant difference in size and weight of the transplantedtumor was noticed between FB-11-modified cancer cellsand non-transfected cancer cells.

FB-11-mediated protective immunitySGC-7901/FB-11-sensitized mice were re-inoculated withwild-type cell lines. No tumor growth was seen during theperiod from day 1 to 32 after the inoculation. But in thecontrol group, measurable tumors occurred 7 d after theinoculation with a slight decrease in size of the tumor in the2nd wk. Significant differences were revealed between thetwo groups (Figure 8).

In vitro cytotoxic testPeritoneal inoculation with either FB-11-transfected SGC-7901 cells or their wild-type counterparts could bring aboutabdominal lymphocyte infiltration, but the number of

lymphocytes and remaining tumor cells in abdominal cavityvaried. In the cytotoxic test, SGC-7901/FB-11-activatedabdominal infiltrating lymphocytes and splenocytes showedgreater cytotoxic activity on SGC-7901 cancer cells thanSGC-7901-activated lymphocytes and splenocytes (Figure 9).Moreover, infiltrating lymphocytes induced by SGC-7901/FB-11 had greater killing rates on SGC-7901/FB-11 cancercells than on the wild-type cell lines (Figure 10). Thesesuggested that transfection with recombinant adenoviralvector FB-11 could enhance the immunogenicity of humangastric cancer cell line SGC-7901.

DISCUSSION

CD4+ and CD8+ T lymphocytes activated by antigens ormitogens from freshly isolated T lymphocytes highly expressFasL molecule. FasL and perfurin/granzyme account forthe two mechanisms of cytotoxic effects of cytotoxic Tlymphocytes (CTLs)[9-12]. CD8+ CTLs, which take on theresponsibility of resisting virus and micro-organism invasionand antineoplasm, recognize and kill MHC-I carrying targetcells. CD4+ CTLs, which have the activities of immuneregulation such as transplantational immunity, eliminateMHC-II carrying cells. However, when the cytotoxic activityof CD8+ CTLs is impaired especially on the occasion thatMHC-I molecules are not expressed or are slightly expressedin tumor cells, CD4+ CTLs act as major cytotoxic effectors.The cytotoxic activity of non-specific mitogen activatedCD4+ T lymphocytes and mouse splenocytes within 24 hof the activation results mainly from upregulation of FasLexpression which binds to Fas receptor, initiating programmedcell death.

Figure 3 RT-PCR analysis of FasL expression in SGC-7901/FB-11 and SGC-7901. A: SGC-7901/FB-11; B: SGC-7901; C: DNA Marks.

Figure 5 Apoptosis of SGC-7901 cells stained with Hoechst 33342 induced byFB-11 (×400). A: SGC-7901/GFP cells; B: SGC-7901/FB-11 cells.

Figure 6 DNA fragmentation of SGC-7901 cells induced by FB-11. A: DNAMarks; B: SGC-7901/FB-11; C: MGC-803/FB-11; D: BGC-823/FB-11; E:SGC-7901.

A B

A B C

Paw

volu

me (L)

5.5

5.0

4.5

4.0

3.5

3.0

2.50 5 10 15 20 25 30 35 40 45 50 Time (d)

A B C D E


bp

213

838

CTLs are major effector cells in immune system. T cellcytotoxicity is mediated by two independent cytolyticmechanisms[13-15], namely release of perfurin acting on targetcells and membrane binding or release of FasL acting onFas-expressing cells. Degranulization of CTLs and perfurin-induced cytolysis are two separate steps of the specificcytotoxic process, which requires the recognition of T cellreceptor (TCR) and MHC molecules on the surface oftarget cells and involves perfurin, granzyme, Ca2+ and ICEfamily, etc. However, the Fas-FasL system mediates a non-specific, non-MHC restricted cytotoxicity. In the absenceof Ca2+ or perfurin and granzyme, the cytotoxicity ofcultured CTLs is completely dependent on the Fas-FasLsystem. It is now believed that Fas-dependent cytotoxicityof CTLs comprises two steps. The first step is that CTLsrecognize Fas carrying cells and are activated to expressFasL, the second step is that CTL-expressed FasL binds totarget cell-carried Fas, leading to target cell apoptosis. SinceFasL-induced apoptosis does not rely on MHC and Ca2+,the cytotoxic activity of FasL+-CTLs is not only broad-spectrum but also Fas+-cell targeted. Since tumor cells alwaysexpress Fas, FasL and CTLs are two important weaponsagainst tumors. These are the rationale for the co-deliveryof FasL and B7-1 genes in the present study.

FasL is a 40-ku type II trans-membrane protein whichis a member of the TNF family. It is used to be believedthat only activated T cells express FasL, but later studiesdemonstrated that this cytokine expresses on several other

species of cells including neutrophils, neurons, thyrocytes,retinal stromal cells, salivary gland cells and mouse testicularpodocytes[16-21].

Fas and FasL bind in a trimer style, leading to apoptosisof Fas-expressing cells. Interaction between Fas and FasLis currently believed to take place in the followingfashions[16,22-24]. Target cell apoptosis induced by T cells isthe most common situation, i.e., FasL+-T cells (mostly CD8+)lead Fas-expressing target cells to apoptosis. Induction ofapoptosis between T cells (activated T cells express bothFasL and Fas so that apoptosis is induced at one or bothsides of interacted T lymphocytes) can result in diminutionof immune responses. The target cells express both Fasand FasL, leading to apoptotic death at one or both sidesof interacted target cells. Fas-FasL-induced apoptosisbetween different types of cells is called trans apoptosis,while apoptosis-induced between cells of one type is calledcis apoptosis. Based on the above-mentioned theory, wetransduced FasL and B7-1 genes into human gastric carcinomacells by adenoviral vector and hoped to achieve cis apoptosisbetween tumor cells and trans apoptosis in tumor cellsinduced by T cells whose activation was expanded throughB7-1 gene delivery.

Figure 7 Tumorigenicity of FB-11-transfected gastric cancer cells and tumorsize in preventive and control groups. ●: FB-11 preventive group; ■: controlgroup.

Figure 8 FB-11-mediated protective immunity. ■: SGC-7901/FB-11-sensitizedmice group; ●: SGC-7901 mice group (not sensitized with SGC-7901/FB-11).

Figure 9 Cytotoxicity of abdominal lymphocyte infiltration against tumor cellsinduced by FB-11. A: cytotoxicity of SGC-7901/FB-11-induced abdominallymphocyte infiltration against SGC-7901/FB-11 cells (n = 4); B: cytotoxicity ofSGC-7901/FB-11-induced abdominal lymphocyte infiltration against SGC-7901cells (n = 4); C: cytotoxicity of SGC-7901-induced abdominal lymphocyteinfiltration against SGC-7901 cells (n = 4).

Figure 10 Cytotoxicity of spleen cells against tumor cells induced by FB-11.A: cytotoxicity of SGC-7901/FB-11-induced spleen cells against SGC-7901/FB-11 cells (n = 4); B: Cytotoxicity of SGC-7901/FB-11-induced spleen cells againstSGC-7901 cells (n = 4); C: Cytotoxicity of SGC-7901-induced spleen cellsagainst SGC-7901 cells (n = 4).

Tum

or si

ze (cm

2)

6 12 18 24 30 36 Time (d)

2.25

17.5

1.25

0.75

0.25

-0.25

Tum

or si

ze (cm

2 )

0 3 6 9 12 15 18 21 24 27 30 33 Time (d)

1.05

0.75

0.45

0.15

-0.15

Perc

enta

ge o

f cy

toto

xici

ty (

%) 120

100

80

60

40

20

0

5:1 10:1 20:1 40:1

A B C

Perc

enta

ge o

f cy

toto

xici

ty (

%) 100

80

60

40

20

0

5:1 10:1 20:1 40:1

A B C


Antitumor immunity in human body is mainly T cell-mediated cellular immune response. T cells require threesignals to become activated. The first signal is through Tcell receptor (TCR) to which specific Ag-MHC complexbinds. The binding activates TCR-CD3 complex and thenCD3 molecule transducts the binding signal into CTLs. Thesecond signal is co-stimulating signal[25-27]. CTLs are activatedby the intercellular contact mediated by CTL surfaceadhesive molecules. One example is the interaction betweenCTL surface molecule CD28 and molecule B7-1 on thesurface of antigen-presenting cells (APC) and tumorcells, which is thought to have an important role in CTLactivation. The third signal is stimulation of cytokines likeIL-2, etc. One recent great progress in the field of antitumortherapy is the expansion of tumor-specific CTLs by non-specific methods[21]. In preclinical studies, the vitality andspecificity of CTL cultures can be maintained byintermittent stimulation by tumor cells or tumor antigens,thus acquiring large quantities of tumor-specific CTLs foranticancer therapy. However, this method cannot be usedto expand human tumor-specific CTLs. One reason is therisk of using human cancerous cells as stimuli, and anotheris that the presence of CTL-recognized human tumorantigens has been confirmed, which is hard to purify suchantigens to expand CTLs. Therefore, expansion of tumor-specific CTLs by transfection of genes of non-specificmAbs (anti-CD3 and anti-CD28), cytokines (IL-2) and B7-1has great prospects in current immunotherapy and genetherapy for the treatment of cancer. But the feasibility ofthis method in clinical practice lies on the availability oflarge amounts of expanded tumor-specific CTLs with highantitumor cytotoxicity of clinical standard. In this study,transfection of B7-1 gene promoted expansion and activationof CTLs and transfection of FasL gene gave rise to cisapoptosis in tumor cells. An important innovation of thisstudy is that co-delivery of the two genes results in arrestof tumor cell growth, which has not been reported at homeand abroad.

During the effect phase of co-stimulatory molecules,interactions between CD28 and CD86 and between CD152and CD80 generate cytolytic signals, leading to tumor celldeath. Membrane lysis caused by Fas-FasL interaction isone of the effects. Tumor cells do express Fas which iscapable of transducting cell apoptotic signals. These arethe two prerequisites to the application of anti-Fas antibodyand FasL transfection in the treatment of cancer. As yet,FasL gene has not been used in the treatment of gastriccancer. To study the role of the Fas-FasL system in gastriccancer cell apoptosis, Liu measured the expression of Fasand FasL in gastric cancer cells and found that some cellshave low expression of Fas but high expression of FasL.This is the same as previously reported that the expressionof Fas in some cancer cell lines is downregulated or lost[28].Many human tumor cell lines have no or low expression ofFas, and this probably results in the incapability of T cellsinducing apoptosis of tumor cells, which is a probable reasonfor the escape of tumor cells from immune surveillanceand tumor formation and progression. However, otherstudies[29,30] have demonstrated that the expression of FasLon tumor cells and islet cells has immune protective action,

but FasL-expressing cells were destroyed because of theinfiltration of large amounts of granulocytes. Whereastumor cells have low or no expression of Fas but highexpression of FasL on some occasions. It is necessary toexplore the mechanisms underlying regulation of Fas/FasLon the surface of tumor cells.

Some cytokines including IFN-, TNF- and IL-2upregulate Fas expression, and transfection of FasL in Fas-tumor cells can induce inflammatory reactions[18-20]. Inaddition, B7-1 overexpression-induced interaction betweenco-stimulatory molecules increases the expression ofcytokines during the effect phase. These suggest that FasLgene transfection can elevate Fas expression in tumor cells(bystander effect indicates that mixed culture of FasLgene-modified cancer cells and parent cells increases theexpression of Fas in parent cell lines), and greatly enhancesthe immunogenicity of parent tumor cell lines. Thisstrengthens the cytolytic effects of CTLs on tumor cells(trans apoptosis).

In this study, FB-11-transfected human gastric cancercells had lower tumorigenicity and newly-formed tumorsregressed in a short time. The control group had persistentlygrowing tumors, suggesting that FB-11 containing gastriccancer cells acquires cis apoptosis as well as the ability toinduce strong immune responses. The mechanism for thisreaction is that with the co-stimulatory effects of B7-1,CTL clones specific for the major epitopes on gastric cancercells are greatly amplified and B7-1 co-stimulatory signalinguncovers the sub-dominant epitopes on the surface ofgastric cancer cells, causing the sub-dominant epitope-specificCTL precursors activation and proliferation of and inductionof immune reactions[31,32]. However, these sub-dominantepitopes are not able to induce immune reactions in usualcases. Primary tumors in C57BL/6 mice inoculated withFB-11-transfected human gastric cancer cells can regress,and reimplantation of wild-type gastric cancer cell lines inmice sensitized with FB-11-transfected gastric cancer cellscannot result in new tumor formation. The reason for thisis that tumor-specific CTL clones are activated by the sub-dominant epitopes on gastric cancer cell surface and theco-stimulatory molecule B7-1. Hereby immune responsesoccur immediately upon the inoculation with wild-type cancercells with the same antigens. The activation of T cellsrequires the co-stimulatory signal of B7-1. But in the post-activation effect phase, most researchers believe that theparticipation of B7-1 is not essential, which is in contradictionwith other studies[33,34,]. In the present study, results of theprotective immune test showed that mice sensitized withFB-11-transfected gastric carcinoma cells rejected newimplant of wild-type cancer cells, and activated CTLs hadefficient cytotoxic activity on FB-11+-cancer cells, suggestingthat the cytotoxicity of activated CTLs can be inducedwithout B7-1 co-stimulatory signaling. Results from cytotoxicassay revealed that CTLs activated by FB-11+ gastric cancercells had greater killing activity on FB-11+ gastric cancercells than on wild-type cell lines, suggesting that both FasLand B7-1 molecules play crucial roles in effect phase. Theprobable mechanisms are as follows: The overexpressionof FasL recruits great many inflammatory cells, leading tolocal immune responses. Released inflammatory cytokines


can in turn enhance activation and proliferation of CTLs,binding of B7-1 to CD28 facilitates adhesiveness betweenlymphocytes and tumor cells, promotes the binding ofpolypeptide-MHC complex to TCR, in other words, B7-1can lower the threshold value of T cell responses. Therefore,we propose that the molecule B7-1 is not essential in T celleffect phase, but can boost the cytotoxic activity of Tcells.

In conclusion, tumor cells express Fas and FasL.Overexpression of FasL/B7-1 genes in tumor cells do notcause ‘immune counteraction’ against CTLs, but can elevateFas expression in tumor cells through inflammatory reactions,which facilitates the performance of CTL cytotoxicity ontumor cells. Overexpression of FasL can increase theimmunogenicity of gastric cancer cell lines in the presenceof overexpressed B7-1 gene, which promotes the developmentof antitumor immunity in mice. Overexpression of bothtumor immunity-associated gene B7-1 and apoptosis-inducing gene FasL in gastric cancer cell line can generatesynergistic anti-tumor activity.

REFERENCES

1 Grosenbach DW, Schlom J, Gritz L,Gomez Yafal A, Hodge

JW. A recombinant vector expressing transgenes for four T-

cell costimulatory molecules (OX40L, B7-1, ICAM-1, LFA-3)

induces sustained CD4+and CD8+ T-cell activation, protec-

tion from apoptosis, and enhanced cytokine production. Cell

Immunol 2003; 222: 45–57

2 Khatlani TS, Ma Z, Okuda M, Onishi T. Molecular cloning

and sequencing of canine T-cell costimulatory molecule

(CD28). Vet Immunol Immunopathol 2001; 78: 341-348

3 Shankar P, Schlom J, Hodge JW. Enhanced activation of

rhesus T cells by vectors encoding a triad of costimulatory

molecules (B7-1, ICAM-1, LFA-3). Vaccine 2001; 20 : 744–

755

4 Denfeld RW, Dietrich A, Wuttig C, Tanczos E, Weiss JM,

Vanscheidt W, Schopf E, Simon JC. In situ expression of B7

and CD28 receptor families in human malignant melanoma:

relevance for T-cell-mediated anti-tumor immunity. Int J Can-

cer 1995; 62: 259-265

5 Nagai A, Nakagawa E, Hatori K, Choi HB, McLarnon JG,

Lee MA, Kim SU. Generation and characterization of im-

mortalized human microglial cell lines: expression of

cytokines and chemokines. Neurobiol Dis 2001; 8: 1057–1068

6 Sharma K, Wang RX, Zhang LY, Yin DL, Luo XY, Solomon

JC, Jiang RF, Markos K, Davidson W, Scott DW, Shi YF. Death

the Fas way: regulation and pathophysiology of CD95 and

its ligand. Pharmacol Ther 2000; 88: 333-347

7 Rad AN, Schlom J, Hodge JW. Vector-driven hyperexpression

of a triad of costimulatory molecules confers enhanced T-cell

stimulatory capacity to DC precursors. Crit Rev Oncol Hematol

2001; 39 : 43–57

8 Shering AF, Bain D, Stewart K, Epstein AL, Castro MG,

Wilkinson GW, Lowenstein PR. Cell type-specific expression

in brain cell cultures from a short human cytomegalovirus

major immediate early promoter depends on whether it is

inserted into herpesvirus or adenovirus vectors. J Gen Virol

1997; 78(Pt 2): 445-459

9 Buggins AG, Lea N, Gaken J, Darling D, Farzaneh F, Mufti

GJ, Hirst WJ. Effect of costimulation and the microenviron-

ment on antigen presentation by leukemic cells. Blood 1999;

94 : 3479-3490

1 0 Qiu ZH, Wu CT, Lao MF, Pan LZ, Li YM. Growth suppres-

sion and immunogenicity enhancement of Hep-2 or primary

laryngeal cancer cells by adenovirus-mediated co-transfer of

human wild-type p53, granulocyte macrophage colony-stimu-

lating factor and B7-1 genes. Cancer Lett 2002; 182: 147–154

1 1 McCarthy DO, Meisner LF, Bourdeau-Heller J, Roberts TR,Wu SQ, Warner TF, Albertini MR. Localization of transfected

B7-1 (CD80) DNA in human melanoma cells after particle-

mediated gene transfer. Cancer Genet Cytogenet 2003; 144: 106–111

1 2 Zheng J, Si L, Song J, Sun X, Yu J, Wang Y. Enhanced immune

re sponse t o D NA -base d HPV 16 L1 v a cc i na t i on bycostimulatory molecule B7-2. Antiviral Res 2003; 59: 61–65

1 3 Seko Y, Takahashi N, Tada Y, Yagita H, Okumura K, Nagai

R. Restricted usage of T-cell receptor Vgamma-Vdelta genesand expression of costimulatory molecules in Takayasu's

arteritis. Int J Cardiol 2000; 75 Suppl 1: S77-S83; discussion

S85-S871 4 Fox SA, Loh S, Thean AL, Garlepp MJ. Identification of

differentially expressed genes in murine mesothelioma cell

lines of differing tumorigenicity using suppression sub-tractive hybridization. Biochim Biophys Acta 2004; 1688 :

237-244

1 5 Fujii H, Inobe M, Kimura F, Murata J, Murakami M, OnishiY, Azuma I, Uede T, Saiki I. Vaccination of tumor cells

transfected with the B7-1(CD80) gene induces the anti-meta-

static effect and tumor immunity in mice. Int J Cancer 1996;66 : 219-224

1 6 Nagata S, Golstein P. The Fas death factor. Science 1995; 267:

1449-1456

1 7 Webb SD, Sherratt JA, Fish RG. Cells behaving badly: a theo-

retical model for the Fas/FasL system in tumour immunology.

Math Biosci 2002; 179: 113-129

1 8 Houston A, O’Connell J. The Fas signalling pathway and its

role in the pathogenesis of cancer. Curr Opin Pharmacol 2004;

4: 321-326

1 9 Lee SH, Bar-Haim E, Goldberger O, Reich-Zeliger S, Vadai E,

Tzehoval E, Eisenbach L. Expression of FasL by tumor cells

does not abrogate anti-tumor CTL function. Immunol Lett

2004; 91 : 119–126

2 0 Toillon RA, Descamps S, Adriaenssens E, Ricort JM, Ber-

nard D, Boilly B, Le Bourhis X. Normal breast epithelial cells

induce apoptosis of breast cancer cells via Fas signaling. Exp

Cell Res 2002; 275: 31–43

2 1 Arai H, Gordon D, Nabel EG, Nabel GJ. Gene transfer of Fas

ligand induces tumor regression in vivo. Proc Natl Acad Sci

USA 1997; 94 : 13862-13867

2 2 Suda T, Takahashi T, Golstein P, Nagata S. Molecular clon-

ing and expression of the Fas ligand, a novel member of the

tumor necrosis factor family. Cell 1993; 75: 1169-1178

2 3 Kawasaki M, Kuwano K, Nakanishi Y, Hagimoto N, Takayama

K, Pei XH, Maeyama T, Yoshimi M, Hara N. Analysis of Fas

and Fas ligand expression and function in lung cancer cell

lines. Eur J Cancer 2000; 36: 656-663

2 4 Nafe C, Cao YJ, Quinones A, Dobberstein KU, Kramm CM,

Rainov NG. Expression of mutant non-cleavable Fas ligand

on retrovirus packaging cells causes apoptosis of immuno-

competent cel ls and improves prodrug activation gene

therapy in a malignant glioma model. Life Sci 2003; 73 :

1847-1860

2 5 Lang S, Atarashi Y, Nishioka Y, Stanson J, Meidenbauer N,

Whiteside TL. B7.1 on human carcinomas: costimulation of T

cells and enhanced tumor-induced T-cell death. Cell Immunol

2000; 201 : 132-143

2 6 Tamura H, Dong H, Zhu G, Sica GL, Flies DB, Tamada K,

Chen L. B7-H1 costimulation preferentially enhances

CD28-independent T-helper cell function. Blood 2001; 97 :

1809-1816

2 7 Arlen PM, Gulley JL, Palena C, Marshall J, Schlom J, Tsang

KY. A novel ELISPOT assay to enhance detection of antigen-

specific T cells employing antigen presenting cells expressing

vector-driven human B7-1. J Immunol Methods 2003; 279: 183–

192

2 8 Tan LJ, Jing N, Zhang N, Zhang XR, Qiu DH. Fas/FasL ex-

pression of esophageal squamous cell cancinoma, dysplasia

tissues and normal mucosa. Shijie Huaren Xiaohua Zazhi 2001;


9: 15-19

2 9 Reichmann E. The biological role of the Fas/FasL systemduring tumor formation and progression. Semin Cancer Biol

2002; 12 : 309-315

3 0 Shinoura N, Muramatsu Y, Yoshida Y, Asai A, Kirino T,Hamada H. Adenovirus-mediated transfer of caspase-3 with

Fas ligand induces drastic apoptosis in U-373MG glioma

cells. Exp Cell Res 2000; 256: 423-4333 1 Ganss R, Hanahan D. Tumor microenvironment can restrict

the effectiveness of activated antitumor lymphocytes. Cancer

Res 1998; 58 : 4673-46813 2 McCarthy DO, Meisner LF, Bourdeau-Heller J, Roberts TR,

Wu SQ, Warner TF, Albertini MR. Localization of transfected

B7-1 (CD80) DNA in human melanoma cells after particle

mediated gene transfer. Cancer Genet Cytogenet 2003; 144: 106-111

3 3 Salford LG, Siesjo P, Skagerberg G, Persson BRR, Larsson

EM, Lindvall M, Visse E, Widegren B. Search for effectivetherapy against glioblastoma multiforme-clinical immuniza-

tion with autologous glioma cells transduced with the hu-

man interferon- gene. International Congress Series 2002; 1247:211-220

3 4 Tao G, Hu J, Zou H, Lin Q, Liu F, Wu Y, Sun Q. Therapeutic

antitumor response to cervical cancer in mice immunized withU14 vaccines transfected with costimulatory B7 gene. Chin

Med J (Engl) 2001; 114: 623-627


Science Editor Wang XL and Guo SY Language Editor Elsevier HK


Relationship between abnormality of FHIT gene and EBV infection

in gastric cancer

Yu-Ping Xiao, Cheng-Bo Han, Xiao-Yun Mao, Jin-Yi Li, Lei Xu, Chang-Shan Ren, Yan Xin

EL SEVIER




Yu-Ping Xiao, Cheng-Bo Han, Xiao-Yun Mao, Jin-Yi Li, Lei Xu,Chang-Shan Ren, Yan Xin, Cancer Institute, the First Hospital ofChina Medical University, Shenyang 110001, Liaoning Province, ChinaSupported by the National Natural Science Foundation of China,No. 30371607Correspondence to: Professor Yan Xin, the Fourth Laboratory ofCancer Institute, the First Hospital, China Medical University,Shenyang 110001, Liaoning Province, China. [email protected]: +86-24-23256666-6351Received: 2004-06-07 Accepted: 2004-06-24

Abstract

AIM: To examine the aberrant expression of fragile histidinetriad (FHIT) gene and protein in gastric cancer, and toevaluate the role of FHIT gene and the relationship betweenFHIT gene and EBV infection in gastric carcinogenesis.

METHODS: FHIT transcripts were detected by nested RT-PCR in 30 cases of gastric cancer and their products weresequenced. FHIT protein was detected by Western blot.EBV infection was detected by PCR method in 50 cases ofgastric cancer.

RESULTS: The wild type transcripts were detected in all30 matched normal tissues of gastric cancer. Aberranttranscripts were found in 11/30 (36.7%) gastric canceroustissues. Sequencing analysis of the aberrant fragmentsfound an RT-PCR product missing exons 5-7 in one caseof gastric cancer, and another product missing exons 4-7.Four of ten (40.0%) cases of primary gastric cancershowed absent or decreased expression of FHIT proteinas compared with their matched normal tissues. EBV wasdetected in 5/50 (10%) gastric cancers, among which 4/5(80%) had aberrant transcripts of FHIT gene.

CONCLUSION: Loss of FHIT gene or FHIT protein playsan important role in carcinogenesis, development andprogression of gastric cancer. EBV infection might influencecarcinogenesis of gastric cancer by inducing the abnormalityof FHIT gene.


Key words: Gastric carcinoma; Fragile histidine triad;Epstein-Barr virus; LOH

Xiao YP, Han CB, Mao XY, Li JY, Xu L, Ren CS, Xin Y. Relationship

between abnormality of FHIT gene and EBV infection in gastric

cancer. World J Gastroenterol 2005; 11(21): 3212-3216


INTRODUCTIONGastric carcinogenesis has been thought to be associatedwith its highly exposed risk factors such as Helicobacter pyloriinfection[1] and excessive nitrite salt intake[2-4]. In recent years,close attention has been paid to the carcinogenic factor ofEpstein-Barr virus (EBV)[5-8]. It has been known that multipleoncogenes and tumor suppressor genes are involved ingastric carcinogenesis, however, no specific oncogenes andtumor suppressor genes have been identified. Fragilehistidine triad (FHIT) gene, a tumor suppressor gene, islocated at chromosome 3p14.2 and contains the mostcommon aphidicolin-induced fragile site FRA3B[9]. FRA3Bis the non-randomly fragmental or fissured site throughchromosome’s spontaneous or induced actions, and alsosusceptible to chromosome loss and rearra-ngement becauseof the frequent fragmentation or fissure, which might berelated to tumorigenesis[9]. Moreover, one of the EBVpathogenesis mechanisms might be related to the integrationof EBV DNA into FRA3B and consequently decreasingFRA3B compliance[10]. Considering that FHIT contains theFRA3B region, EBV might make FHIT inactivated leadingto carcinogenesis. In this paper, mRNA and proteinexpression of FHIT gene, EBV infection and their relationshipin gastric carcinogenesis was determined.


MaterialsSpecimens, including 50 cases of primary gastric cancerousand matched distant normal gastric mucosal tissues, weresurgically resected at the First Hospital of China MedicalUniversity without preoperative chemotherapy andradiotherapy. They were put immediately into liquid nitrogen,and reserved at -70 ℃. All cases were classified respectivelyby Borrmann, WHO histological classification, Laurenclassification, invasive depth and lymph node metastasis.

MethodsDNA and RNA extraction DNA was extracted from frozengastric cancerous and normal mucosal tissues by standardphenol–chloroform method[6,8], dissolved and reserved inTE buffer[11]. RNA extraction was conducted according toinstruction of TRIzol reagent kit (GIBCO). Briefly: frozengastric tissues were ground into pieces, homogenized in l mLTRIzol reagent using a homogenizer for 30 s, and incubatedfor 5 min. and then 200 L chloroform was added and spunby centrifugation at 3 000 r/min for 15 min. The aqueousphase was transferred to another Eppendorf tube, 500 Lisoamyl alcohol was added and placed on ice for 1 h, and

spun by centrifugation at 3 000 r/min for 15 min, finally,the supernatant was discanded, RNA pellet was washed oncewith 750 mL/L ethanol, dissolved in 1 mL/L DEPC sterilewater, and kept at -20 ℃.PCR and nested RT-PCR PCR and nested RT-PCR wereused to amplify the EBV DNA and FHIT mRNA, respect-ively. Primer sequence for EBV was: (F)5’-CCAGACAGCA-GCCAATTGTC-3’; (R)5’-GGTAGAAGACCCCCTC-TTAC-3’. The PCR product was 129 bp in length, spanningthe BamH1-w of EBV. PCR amplification was carried out ina final volume of 25 µL, containing 50 ng DNA, 0.5 µmol/Lof each primer, 200 µmol/L of each dNTP, and 0.5 U TaqDNA polymerase (TaKaRa Ex TaqTM). The amplificationcondition: an initial incubation at 94 ℃ for 3 min, followedby 30 cycles of 94 ℃ for 30 s, 58 ℃ for 30 s and 72 ℃for 1 min; and the final step of extension at 72 ℃ for 5 min.The cDNA synthesis of RT-PCR referred to the instructionof BcaBEST RNA PCR kit (TaKaRa). Nest-PCR primerswere: (F2)5’-ATCCTGGAAGCTTTGAAGCTGA-3’; (R2)5’-TCACTGGTTGAAGAATACAGG-3’; (F1)5’-TCCGTA-*CTGCTATCTACATC-3’; (Rl)5’-CATGCTGATTCA-GTTCCTCTTGC-3’.First cycle of nest-PCR was the sameas aforementioned except for PCR reaction volume 25 Lcontaining 50 ng cDNA, 0.5 mmol/L of each outer primerF2 and R2. The second cycle reaction system contained 5 Lof the first cycle product and 0.5 mmol/L of each inner primerF1 and R1, the others were similar.Polyacrylamide gel electrophoresis (PAGE) EBV PCRproducts and nest-PCR products of FHIT gene in gastriccancerous and matched normal tissues were run on 1.5%agarose gel in 1× TBE buffer at a constant voltage of 60 Vfor 1 h.Sequencing Abnormal nest-PCR products confirmed withagarose gel electrophoresis were cloned and sequenced byAoKe Biology Company (Beijing, China).Protein extraction Tissues were sheared and homogenizedin a homogenizer, added with suspending buffer containing2 mmol/L EDTA, 10 mmol/L EGTA, 20 mol/L Tris-HCl, pH 7.5, 56 g/L sucrose and 100 g/L PMSF, agitatedwith ultrasonic instrument, then spun by centrifugation at 4 ℃13 000 g for 1 h. The supernatants were collected forWestern blot.Western blot Sixteen microliters of protein extracts wereadded into 4 L 5× sampling buffer containing 130 mmol/LTris-Cl, pH 8.0, 200 mL/L glycerol, 46 g/L SDS, 20 g/LDTT, pre-denatured at 96 ℃ for 10 min, run on 12%polyacrylamide gel (PAGE), then transferred to pyroxylinmembrane at a voltage of 300 V for 2 h. The membranewas soaked in 1×TBS for approximately 10 min, and rabbitanti-human FHIT antibody (SANsc-8215, Gene CompanyLtd) added at room temperature overnight, rinsed with1× TBS buffer, goat anti-rabbit IgG antibody (ZhongshanCompany, Beijing, China) added, shaken gently for 1 h, andrinsed with 1× TBS again. Finally Horseradish peroxidase(HRP) was added for 30 min and color development wasdone with DAB for 15-30 min, and membrane was rinsedwith distilled water to stop reaction.

Statistic analysis2-test was applied with SPSS software (version 10.0 for

Windows). A P value of less than 0.05 was consideredstatistically significant.

RESULTS

Abnormal transcripts of FHIT gene in gastric cancerThe normal transcripts (wild type, 707 bp) of FHIT genewere detected out in 30 cases of matched normal gastricmucosa. Abnormal transcripts were found in 11 of 30 cases(36.7%) of gastric cancers, among which five were shorterthan 500 bp in length. Three cases of gastric cancers weresimultaneously accompanied with normal transcripts, onewith complete loss. Repeated experiments suggested thatthere existed FHIT gene loss in gastric cancer (Figure 1).

Figure 1 Deletion of FHIT gene in gastric cancer. Lanes T3 and T4 showtruncated FHIT gene.

Sequencing resultsAfter two abnormal transcripts were purified via gel electrop-horesis, the following sequencing results showed that one lostexons 5-7 of FHIT gene with a deletion of 297 bp andconnection of exon 4 and exon 8; the other lost exons 4-7,with a deletion of 389 bp and connection of exon 3 and 8. Inaddition, all losses occurred in exon joints (Figures 2 and 3).

Figure 2 Sequencing analysis of abnormal FHIT gene expression. Arrowindicates the splicing joint of FHIT gene exons 4 and 8.

Figure 3 Sequencing analysis of abnormal FHIT gene expression. Arrowindicates the splicing joint of FHIT gene exons 3 and 8.

M N1 T1 N2 T2 N3 T3 N4 T4 N5 T5

1 057770495

210

162

M: PCR marker; N: normal mucosa; T: tumor tissue

exon 4↓exon 8

exon 3↓exon 8

Xiao YP et al. FHIT gene and EBV infection in gastric cancer 3213

FHIT protein expression and EBV infection in gastric cancerWestern blot showed 4 of 10 cases (40.0%) of gastriccancers had loss or decreased expression of FHIT protein(Figure 4). EBV was detected in 5 of 50 (10%) cases ofgastric cancers (Figure 5), among which 4 out of 5 (80.0%)has abnormal FHIT gene transcripts. The relationshipbetween EBV infection and FHIT gene expression in gastriccancer is shown in Table 1.

Figure 4 Expression of FHIT protein in gastric cancer. Lane T1 shows thedeletion of FHIT protein. N: normal; T: tumor.

Figure 5 Electrophoresis result of EBV in gastric cancer. Lanes 2, 6-8 show thepositive EBV infection.

Table 1 Relationship between EBV infection and FHIT transcripts

FHIT Transcripts

EBV n Abnormal Normal

+ 5 4 1

- 45 7 38

Sum 50 11 39

P = 0.006, EBV+ vs EBV-.

DISCUSSION

Exon 5 of FHIT gene is the first coding exon (initiation oftranslation), adjacent to fragile site FRA3B. DNA repairand rearrangement of FRA3B fissured site result in deletionof FHIT gene exon. Exon 8 containing highly conservedregion, is a combing site of zinc ion and also the importanttarget region of FHIT gene loss. The coding protein ofFHIT gene, FHIT, a typical dinucleotide triphosphoric acidhydrolase (Ap3A), could hydrolyze adenosine diphosphateinto ADP and AMP[12]. FHIT combines with mRNA capstructure, making mRNA de-cap, loss of function, increasingthe probability of tumorigenesis[12]. FHIT combines withits substrate and exerts tumor suppression by its compound,which might be a signaling molecule and has more importantfunction than its hydrolase[13].

Our research showed that FHIT gene in 36.7% gastric

cancers presented truncated or deleted transcripts, about450, 350, and 280 bp in length, suggesting there weredifferent deletions of FHIT gene in gastric cancer. Sequencingresults showed FHIT gene had deletion of exons 5-7 and4-7. The deleted sites of FHIT transcripts were all splicingsites of FHIT gene exons, suggesting that deletion of FHITgene usually resulted from its abnormal splice.

Baffa et al[14], reported that 53% gastric cancers hadabnormal transcripts of FHIT gene, and 67% showed lossexpression of FHIT protein. Huiping et al[15] , also reportedthat 87% gastric caners presented abnormal transcripts ofFHIT gene. Ohta et al[16], discovered via nest RT-PCR that53.6% gastric cancers and 37.5% large intestinal cancershad abnormal transcripts of FHIT gene, suggesting deletionof FHIT gene was common in gastric cancer. Abnormaltranscripts of FHIT gene often involved one or more exons’deletion, and mostly occurred in the two important functionalexons 5 and 8, which were defined as types I and II,respectively by Ohta et al[16]. Whether types I or II, abnormaltranscripts could not encode fully functional FHIT protein,so the two exons’ deletion might play a very important rolein carcinomatous change of gastric mucosal epithelium. Wesummarize the abnormalities of FHIT gene transcripts asfollows: (1) Exons 4-6 deletion; (2) exons 4-8 deletion; (3)single one exon deletion such as exon 5 or exon 8; (4) wholetranscript’s deletion. The deletion of FHIT transcripts ofteninvolved important functional exons 5 and 8, furtherinfluencing the function of FHIT protein, resulting in adecrease or loss of FHIT protein activity, which affectedcatabolism of Ap3A and Ap4A. Accumulated intracellularAp3A and Ap4A could repress cell apoptosis, and inducecell carcinomatous change[17-20].

Previous reports[21,22] showed that frequent deletions ofFHIT transcripts were accompanied with decrease or lossof FHIT protein. Our researches showed that 40% gastriccancers displayed decreased or depleted FHIT protein(statistic analysis was not performed for fewer cases), andall of them had lymph node metastasis, suggesting that adecreased FHIT protein might be associated with lymphnode metastasis and poor prognosis. Otterson et al[23], foundthat over-expression of FHIT protein could not suppressthe cell clonal formation and cell proliferation. When transferof normal FHIT gene into cancer cells without wide typeFHIT per se, the product FHIT protein, however, could notsuppress the cell growth. We presumed that the molecularmechanism of FHIT gene might be intrinsically differentfrom the traditional tumor suppressor gene such as p53.

It has been found[5-7,24,25] that some gastric carcinomas areassociated with the infection of EBV since Shibata et al[26],firstly reported their relationship. Most of the gastric carcinomasassociated with EBV (EBVaGC) occurred at cardia or bodyof the stomach, or just appeared in the remnant gastric cancer,and showed the malignant features such as poor differentiationand infiltrated lymph nodes. We found five cases of gastriccancers infected with EBV and simultaneously all of themhad lymph node metastasis, among which three cases werepoorly differentiated late-stage gastric cancers, one moderatelydifferentiated early-stage, and one poorly differentiated middle-stage gastric cancer. From the view of clinicopathologicalfeatures, EBVaGC tended to be poorly differentiated, with

N1 T1 N2 T2 N3 T3

ku1714

M 1 2 3 4 5 6 7 8

129 bp


lymph node metastasis, suggesting a poor prognosis of gastriccancer.

Divergent opinions have been reported concerning themolecular mechanism of EBVaGC. Some researchers[27-29]

proposed that EBVaGC was associated with the abnormalityof P53, Bcl-2, and TGF-, and microsatellite instability.Chang et al[30], thought that there was no correlation betweenthe infection of EBV and gastric carcinomas. At present,the mechanism of EBV in promoting gastric carcinogenesishas been unknown. Ohta et al[16], discovered that abnormalitiesof FHIT were frequently observed in some malignant tumorsin certain areas, such as nasopharyngeal carcinomas in Chinaand gastric cancers in Southeast Asia, and EBV might resultin abnormal FHIT gene by its integration into the regionof FRA3B. Four of the five gastric cancers with EBVinfection in our study presented abnormal transcripts,indicating the close association between EBV and theabnormality of FHIT gene, and even the cell carcinomatouschange. We also detected the loss of heterozygosity (LOH)and microsatellite instability (MSI) in the same five cases.LOH was observed at microsatellite sites D3S4103 (4/5),D3S1300 (3/5), D3S1481 (2/5) and D3S1234 (2/5), whileMSI appeared at sites D3S1300 (1/5), D3S1481 (1/5) andD3S1234 (1/5). As D3S4103, D3S1300 and D3S1481 alllocated near exon 5 of FHIT gene, we presume that theintegrating site of EBV might be just near exon 5.

In conclusion, we supply some new clues for furtherstudies on the relations between abnormal FHIT and themalignant biological behaviors of gastric cancer cells. Thestudies of the relationship between EBV infection andabnormality of FHIT gene also provide a new scientific basison pathogenesis of gastric cancer. By a certain mechanismsuch as integration, EBV might result in FHIT geneinstability, down-regulate transcripts or truncated (deleted)FHIT proteins, which are likely to play an important role ingastric carcinogenesis, local infiltration and regional lymphnode metastasis.

REFERENCES

1 Nardone G, Rocco A, Vaira D, Staibano S, Budillon A,

Tatangelo F, Sciulli MG, Perna F, Salvatore G, Di Benedetto

M, De Rosa G, Patrignani P. Expression of COX-2, mPGE-

synthase1, MDR-1 (P-gp), and Bcl-xL: a molecular pathway

of H pylori-related gastric carcinogenesis. J Pathol 2004; 202:

305-312

2 Mayne ST, Risch HA, Dubrow R, Chow WH, Gammon MD,

Vaughan TL, Farrow DC, Schoenberg JB, Stanford JL, Ahsan

H, West AB, Rotterdam H, Blot WJ, Fraumeni JF. Nutrient

intake and risk of subtypes of esophageal and gastric cancer.

Cancer Epidemiol Biomarkers Prev 2001; 10: 1055-1062

3 Palli D. Epidemiology of gastric cancer: an evaluation of

available evidence. J Gastroenterol 2000; 35 Suppl 12: 84-894 van Loon AJ, Botterweck AA, Goldbohm RA, Brants HA,

van Klaveren JD, van den Brandt PA. Intake of nitrate and

nitrite and the risk of gastric cancer: a prospective cohortstudy. Br J Cancer 1998; 78: 129-135

5 Sudo M, Chong JM, Sakuma K, Ushiku T, Uozaki H, Nagai

H, Funata N, Matsumoto Y, Fukayama M. Promoterhypermethylation of E-cadherin and its abnormal expression

in Epstein-Barr virus-associated gastric carcinoma. Int J Can-

cer 2004; 109: 194-1996 van Beek J, zur Hausen A, Klein Kranenbarg E, van de Velde

CJ, Middeldorp JM, van den Brule AJ, Meijer CJ, Bloemena E.

EBV-positive gastric adenocarcinomas: a distinct clinicopatho-

logic entity with a low frequency of lymph node involvement.J Clin Oncol 2004; 22: 664-670

7 Oh ST, Seo JS, Moon UY, Kang KH, Shin DJ, Yoon SK, Kim

WH, Park JG, Lee SK. A naturally derived gastric cancer cellline shows latency I Epstein-Barr virus infection closely re-

sembling EBV-associated gastric cancer. Virology 2004; 320:

330-3368 Lee HS, Chang MS, Yang HK, Lee BL, Kim WH. Epstein-barr

virus-positive gastric carcinoma has a distinct protein ex-

pression profile in comparison with epstein-barr virus-nega-tive carcinoma. Clin Cancer Res 2004; 10: 1698-1705

9 Mimori K, Inoue H, Shiraishi T, Matsuyama A, Mafune K,

Tanaka Y, Mori M. Microsatellite instability is often observedin esophageal carcinoma patients with allelic loss in the FHIT/

FRA3B locus. Oncology 2003; 64 : 275-279

1 0 Lee HS, Chang MS, Yang HK, Lee BL, Kim WH. Epstein-barr virus-positive gastric carcinoma has a distinct pro-

tein expression profile in comparison with Epstein-barr

vi rus-negativ e ca rci noma . Cl in Cance r Re s 20 04 ; 1 0 :1 6 9 8-1 7 0 5

1 1 Han CB, Zhao YJ, Li F, He Q, Ma JM, Xin Y. Quantitation

and detection of deletion in tumor mitochondrial DNA bymicroarray technique. Zhonghua Zhongliu Zazhi 2004; 26 :

10-1 3

1 2 Fouts RL, Sandusky GE, Zhang S, Eckert GJ, Koch MO,Ulbright TM, Eble JN, Cheng L. Down-regulation of fragile

histidine triad expression in prostate carcinoma. Cancer 2003;

97 : 1447-14521 3 Sukosd F, Kuroda N, Beothe T, Kaur AP, Kovacs G. Dele-

tion of chromosome 3p14.2-p25 involving the VHL and FHIT

genes in conventional renal cell carcinoma. Cancer Res 2003;63 : 455-457

1 4 Baffa R, Veronese ML, Santoro R, Mandes B, Palazzo JP,

Rugge M, Santoro E, Croce CM, Huebner K. Loss of FHITexpression in gastric carcinoma. Cancer Res 1998; 58 : 4708-

4 7 1 4

1 5 Huiping C, Kristjansdottir S, Bergthorsson JT, Jonasson JG,Magnusson J, Egilsson V, Ingvarsson S. High frequency of

LOH, MSI and abnormal expression of FHIT in gastric cancer.

Eur J Cancer 2002; 38: 728-7351 6 Ohta M, Inoue H, Cotticelli MG, Kastury K, Baffa R, Palazzo

J, Siprashvili Z, Mori M, McCue P, Druck T, Croce CM,

Huebner K. The FHIT gene, spanning the chromosome 3p14.

2 fragi le si te and renal carcinoma-associated t (3 ; 8)

breakpoint, is abnormal in digestive tract cancers. Cell 1996;

84 : 587-597

1 7 Chang KW, Kao SY, Tzeng RJ, Liu CJ, Cheng AJ, Yang

SC, Wong YK, Lin SC. Multiple molecular alterations of

FHIT in betel-associated oral carcinoma. J Pathol 2002; 196 :

300-306

1 8 An Q, Liu Y, Huang J. Comparison of tumor suppressor gene

deletion between squamous cell carcinoma and adenocarci-

noma lung cancer in Chinese. Zhonghua Zhongliu Zazhi 2001;

23 : 470-472

1 9 Ko JY, Lee TC, Hsiao CF, Lin GL, Yen SH, Chen KY, Hsiung

CA, Chen PJ, Hsu MM, Jou YS. Definition of three minimal

deleted regions by comprehensive allelotyping and mutational

screening of FHIT, p16(INK4A), and p19(ARF) genes in na-

sopharyngeal carcinoma. Cancer 2002; 94: 1987-1996

2 0 Wistuba II, Ashfaq R, Maitra A, Alvarez H, Riquelme E,

Gazdar AF. Fragile histidine triad gene abnormalities in the

pathogenesis of gallbladder carcinoma. Am J Pathol 2002;

160: 2073-2079

2 1 Andachi H, Yashima K, Koda M, Kawaguchi K, Kitamura

A, Hosoda A, Kishimoto Y, Shiota G, Ito H, Makino M,

Kaibara N, Kawasaki H, Murawaki Y. Reduced Fhit ex-

pression is associated with mismatch repair deficiency in

human advanced colorectal carcinoma. Br J Cancer 2002;

87 : 441-445

2 2 Zhao P, Lu Y, Hu Y, Zhong M, Li Z, Li X. Loss of fragile

histidine triad expression in colorectal carcinoma. Zhonghua

Xiao YP et al. FHIT gene and EBV infection in gastric cancer 3215

Binglixue Zazhi 2002; 31: 124-127

2 3 Otterson GA, Xiao GH, Geradts J, Jin F, Chen WD, NiklinskaW, Kaye FJ, Yeung RS. Protein expression and functional analy-

sis of the FHIT gene in human tumor cells. J Natl Cancer Inst

1998; 90 : 426-4322 4 Etoh T, Kanai Y, Ushijima S, Nakagawa T, Nakanishi Y, Sasako

M, Kitano S, Hirohashi S. Increased DNA methyltransferase

1 (DNMT1) protein expression correlates significantly withpoorer tumor differentiation and frequent DNA hypermethylation

of multiple CpG islands in gastric cancers. Am J Pathol 2004;

164: 689-6992 5 Kijima Y, Ishigami S, Hokita S, Koriyama C, Akiba S, Eizuru

Y, Aikou T. The comparison of the prognosis between Epstein-

Barr virus (EBV)-positive gastric carcinomas and EBV-nega-tive ones. Cancer Lett 2003; 200: 33-40

2 6 Shibata DK. Epstein-Barr virus and gastric carcinoma. Jpn J

Cancer Res 1996; 87: Inside front cover

2 7 Sudo M, Chong JM, Sakuma K, Ushiku T, Uozaki H, NagaiH, Funata N, Matsumoto Y, Fukayama M. Promoter hyperm-

ethylation of E-cadherin and its abnormal expression in

Epstein-Barr virus-associated gastric carcinoma. Int J Cancer2004; 109 : 194-199

2 8 zur Hausen A, Crusius JB, Murillo LS, Alizadeh BZ, Morre

SA, Meijer CJ, van den Brule AJ, Pena AS. IL-1B promoterpolymorphism and Epstein-Barr virus in Dutch patients with

gastric carcinoma. Int J Cancer 2003; 107: 866-867

2 9 Thompson MP, Kurzrock R. Epstein-Barr virus and cancer.Clin Cancer Res 2004; 10: 803-821

3 0 Chang MS, Lee HS, Kim HS, Kim SH, Choi SI, Lee BL, Kim

CW, Kim YI, Yang M, Kim WH. Epstein-Barr virus andmicrosatellite instability in gastric carcinogenesis. J Pathol 2003;

199: 447-452


Science Editor Zhu LH and Guo SY Language Editor Elsevier HK


Expression of some tumor associated factors in human carcinogenesis

and development of gastric carcinoma

Ming-Dong Zhao, Xue-Mei Hu, Dian-Jing Sun, Qun Zhang, Yu-Hao Zhang, Wei Meng

EL SEVIER




Ming-Dong Zhao, Dian-Jing Sun, Department of Radiology,Affiliated Hospital of Binzhou Medical College, Binzhou 256603,Shandong Province, ChinaXue-Mei Hu, Wei Meng, Department of Immunology of BinzhouMedical College, Binzhou 256603, Shandong Province, ChinaQun Zhang, Yu-Hao Zhang, Medical School of Shanghai JiaotongUniversity, Shanghai 200030, ChinaSupported by the Natural Science Foundation of ShandongProvince, No. Y2001C15Correspondence to: Dr. Xue-Mei Hu, Medical School of ShanghaiJiaotong University, Shanghai 200030, China. [email protected]: +86-21-62932910 Fax: +86-21-62832528Received: 2003-12-28 Accepted: 2004-01-08

Abstract

AIM: To study the effect of IGF-1/IGF-1R and gastrin/CCK-BR on carcinogenesis and development of humangastric carcinoma and to explore its mechanism andprovide a credible theoretical foundation for early diagnosisand molecular therapy of gastric carcinoma.

METHODS: mRNA expression levels of IGF-1/IGF-1R andgastrin/CCK-BR were assessed by RT-PCR method ingastric cancer tissues, adjacent mucosa, and tumor-freetissues from 56 patients with gastric carcinoma andnormal gastric mucosae from 56 healthy controls. Tissuespecimens were obtained by biopsy and confirmed byhistological evaluation.

RESULTS: The mRNA levels of IGF-1/IGF-1R wereincreased in gastric cancer tissues compared with normaltissues from healthy controls and successively increasedin tumor-free tissues, adjacent mucosa, and gastriccancer tissues. The mRNA levels of gastrin/CCK-BR wereincreased in gastric cancer tissues compared with normaltissues from healthy controls. There was a significantdifference between gastric cancer tissues and adjacentmucosa and tumor-free tissues, but the mRNA levels ofgastrin were not significantly increased in adjacentmucosa and gastric cancer tissues compared with tumor-free tissues. The mRNA levels of CCK-BR were increasedin gastric cancer tissues and adjacent mucosa comparedwith tumor-free tissues, but not significantly increased inadjacent mucosa and gastric cancer tissues comparedwith gastric cancer tissues.

CONCLUSION: Overexpression of IGF-1/IGF-1R andgastrin/CCK-BR promotes the disorderly proliferation ofgastric mucosa epithelia and it is of great significance inthe carcinogenesis and development of gastric carcinoma.


Key words: Gastric carcinoma; mRNA; IGF-1; IGF-1R;Gastrin; CCK-BR; Protein expression

Zhao MD, Hu XM, Sun DJ, Zhang Q, Zhang YH, Meng W.Expression of some tumor associated factors in humancarcinogenesis and development of gastric carcinoma. WorldJ Gastroenterol 2005; 11(21): 3217-3221


INTRODUCTION

Gastric cancer is one of the most frequent neoplasmsand a leading cause of death worldwide. It is still the focusof study to explore the mechanism of gastric carcinoma.With the development in molecular biology technology,research on the mechanism of gastric carcinoma has gonedeep into the molecular levels. Carcinogenesis is acomplicate process, which includes many steps, manygene abnormities may be brought on this process. Someresearchers considered that the effect of protooncogenes,the inactivation of many antioncogenes, the regulation ofmany growth factors and their receptors, the accumulationof gene mutations and the imperfect ion of DNArehabilitation system might play important roles in thecarcinogenesis and development of gastric carcinoma.There is evidence that the upregulation of certain growthfactors could play an important role in the promotion anddevelopment of gastric cancer[1,2].

The insulin-like growth factor system is widely involvedin human carcinogenesis[3]. The type 1 insulin-like growthfactor receptor (IGF-1R) is a transmembrane protein tyrosinekinase, which mediates the biological effects of IGF-1[4],and plays an important role in both normal and abnormalgrowth, particularly in anchorage independent growth. Someinvestigators also provided evidence that insulin-like growthfactor-1 (IGF-1) and its receptor (IGF-1R) emerged as keyregulators of mitogenesis and tumorigenicity. It has beenwell established that a functional IGF-1R is required forcell growth and plays a crucial role in survival of varioustransformed cells in vitro and in vivo[5]. When IGF-1 combineswith its receptor (IGF-1R), it has an important effect onhuman metabolism of proteins and carbohydrates, andstimulates cell proliferation, differentiation and apoptosis.These changes of cell activity are the characteristics ofcarcinoma cells. Durrant et al[6], have reported that IGF-1could facilitate the growth of three cell strains of gastriccarcinoma in vitro. Peters et al[7], had found that IGF-1 and


its membrane receptors played a critical role in thecarcinogenesis of several tumors, such as colorectal cancer.More recently, numerous studies have demonstrated thatIGF-1R can play a critical role in regulation of carcinomametastasis and invasion, and that overexpression of IGF-1R is an important component controlling the proliferationof cervical carcinoma cells[8-10]. However, the mechanismunderlying gastric cancer and the exact role of IGF-1/IGF-Rin human gastric carcinogenesis and development remainpoorly understood.

Gastrin is one of the most extensively researchedgastrointestinal hormones and is of great significance insustaining normal physiological functions of gastrointestinaltract. Research has demonstrated that gastrin can acceleratethe growth of cultured gastric carcinoma cells[11] andtransplanted human gastric carcinoma in naked mice[12] canincrease the synthesis of DNA and proteins. There isevidence that expression of gastrin mRNA is increased ingastric cancer and release of gastrin is increased in plasmaand gastric lumen of patients with gastric cancer[13]. So itmay be a link between gastrin and gastric cancer. The roleof gastrin in the carcinogenesis and development of gastriccancer needs to be explored deeply.

Cholecystokinin B/gastrin receptors (CCK-BR) can stimulatethe secretion of gastric acid and cell proliferation[14,15]. Theexpression of CCK-BR has been widely reported in colorectalcancer[16,17]. However, the role of gastrin/CCK-BR in thecarcinogenesis and development of human gastric carcinomais still largely unknown.

The aim of the present study was to evaluate theeffect of IGF-1/IGF-1R and gastrin/CCK-BR on thecarcinogenesis and development of human gastric carcinoma,and to explore its mechanism and provide a credibletheoretical foundation for early diagnosis and moleculartherapy of gastric carcinoma.


Collection of tissue specimensFresh tissue specimens of gastric cancer tissues, adjacentmucosa and tumor-free tissues were obtained from 56patients with gastric carcinoma. Specimens of normal gastricmucosae were from 56 healthy controls. The specimenswere immediately frozen in liquid nitrogen and stored at-80 ℃. The diagnosis of specimens was based on thepathological features of tumors and confirmed by pathologicalhistological evaluation.

Extraction of total RNAThe extraction of total RNA from tissues was carried outas previously described[1]. Briefly, total RNA was extractedusing a guanidium isothiocyanate/phenol chloroformsingle step extraction kit from Stratagene (Promega, USA)based on the method previously described[18]. Followingprecipitation, RNA was resuspended in RNase-freewater and its concentration was estimated by absorbanceat 260 nm wavelength. Furthermore, the quality of eachRNA sample was determined by agarose-formaldehydeelectrophoresis. RNA samples were stored at -80 ℃ untilanalysis. The nucleotide sequences of primers are shownin Table 1.

Table 1 Specification of primer sets for polymerase chain reactionanalysis

Primer Sequence PCR product (bp)

IGF-1 5’-CAACAAGCCCACAGGGTATGGC-3’

3’-GGAAACGAGACGTGCTCAATGGACA-5’ 312

IGF-1R 5’-ATGCTGTTTGAACTGATGCGCA-3’

3’-GCCCCCGGCGTTCTTGCTCGCC-5’ 354

Gastrin 5’-GTCTATGTGCTGATCTTTGCACTG-3’

3’-CTTGGTTCGAAGTCTCGGATCGGT-5’ 323

CCK-BR 5’-GTGGCCTACGGGCTTATCTCTCGCGAGCTC

TACTTA-3’

3’-GACACAACCAACGGTCAAATATCACGG 357

TTGTGCA-5’

-actin 5’-GGCGGCACCACCATGTACCCT-3’

3’-TCATACTGCTCAGGCCGGGGA-5’ 202

The primers were synthesized and purified by CellBiology Institute, Chinese Academy of Sciences.

RT-PCR analysisRT-PCR analysis was done routinely according to instructionof reagent box, using an access RT-PCR system (AmericanPromega Company). -actin was used as an inner-controland the template dosage of cDNA was standardized. Thereaction conditions of RT-PCR were as follows.

IGF-1: denaturation at 94 ℃ for 30 s; annealing at 57 ℃for 30 s; Extension at 72 ℃ for 2 min; 35 circles at 72 ℃for 7 min and stored at 4 ℃.

IGF-1R: denaturation at 94 ℃ for 30 s; annealing at 54 ℃for 30 s; extension at 72 ℃ for 1 min; 35 circles at 72 ℃for 7 min and stored at 4 ℃.

Gastrin: denaturation at 94 ℃ for 30 s; annealing at 59 ℃for 30 s; extension at 68 ℃ for 1 min; 35 circles at 72 ℃for 7 min and stored at 4 ℃.

CCK-BR: denaturation at 94 ℃ for 30 s; annealing at55 ℃ for 30 s; extension at 72 ℃ for 1 min; 35 circles at72 ℃ for 7 min and stored at 4 ℃.

ElectrophoresisTen microliters of the PCR products of IGF-1/IGF-1R andgastrin/CCK-BR and -actin was detected by electrophoresison an 1.8% agarose gel. The results were scanned andphotographed by an automatic gel image analysis system(Biotechnology Limited Corporation, Coldspring Harbor,USA). The result was expressed as investigated PCR-productof target factor/-actin mRNA ratio.

Data analysisData were presented as mean±SE. Statistical analysis wasperformed using Student’s t test. P<0.05 was consideredstatistically significant.

RESULTS

Quality and content of RNAThe extracted RNA showed two pieces of bands 18 and28 s in the agarose gel electrophoresis. After RNA wasdetected by an ultraviolet spectrophotometer, the A260/A280

ratio surpassed 1.7.

Zhao MD et al. Tumor associated factors in gastric carcinoma 3219

Expression levels of mRNA in gastric carcinoma tissues andnormal gastric mucosa from healthy controlsThe mRNA expression levels of IGF-1/IGF-1R andgastrin/CCK-BR in gastric cancer tissues were all increasedsignificantly compared with normal mucosa from controls(P<0.01). The result is shown in Table 2 and Figure 1.

Table 2 mRNA expression of IGF-1/IGF-1R and gastrin/CCK-BR ingastric cancer tissues and normal mucosa from controls (mean±SE)

Type of samples IGF-1/ IGF-1R/ Gastrin/ CCK-BR/specimen -actin -actin -actin -actin

Cancer tissues 56 0.305±0.032b 0.129±0.011b 0.293±0.031b 0.159±0.018b

Controls 56 0.154±0.013 0.027±0.004 0.169±0.017 0.058±0.006

bP<0.01 vs normal mucosa from controls.

Figure 1 mRNA expression of IGF-1/IGF-1R and gastrin/CCK-BR in gastriccancer tissues and normal mucosa from control bP<0.01 vs control.

mRNA expression levels of IGF-1/IGF-1R and gastrin/CCK-BRin gastric cancer tissues, adjacent mucosa and tumor-freetissues from patients with gastric carcinomaThe mRNA expression levels of gastrin were successively

increased in tumor-free tissues, adjacent mucosa and gastriccancer tissues. There was a significant difference betweengastric cancer tissues and adjacent mucosa and tumor-freetissues (P<0.05), but there was no significant differencebetween adjacent mucosa and tumor-free tissues (P>0.05).The mRNA expression levels of CCK-BR were alsosuccessively increased in tumor-free tissues, adjacent mucosaand gastric cancer tissues. There was significant differencein gastric cancer tissues and adjacent mucosa comparedwith tumor-free tissues (P<0.05), but there was no significantdifference between gastric cancer tissues and adjacentmucosa (P>0.05, Table 3).

Table 3 mRNA expression of IGF-1/IGF-1R and gastrin/CCK-BR inthree kinds of tissues from 56 patients with gastric carcinoma(mean±SE)

Test factor/-actin Cancer tissue Adjacent mucosa Tumor free

IGF-1/-actin 0.305±0.028c 0.220±0.023a 0.149±0.012

IGF-1R/-actin 0.129±0.011c 0.089±0.007a 0.047±0.006

Gastrin/-actin 0.284±0.024c 0.182±0.014 0.133±0.043

CCK-BR/-actin 0.169±0.016a 0.144±0.013a 0.049±0.014

aP<0.05 vs tumor-free tissues. cP<0.05 vs adjacent mucosa.

The RT-PCR amplified products of IGF-1, IGF-1R,gastrin, CCK-BR and -actin in three kinds of tissues frompatients with gastric carcinoma were detected by electrophoresison an 1.8% agarose gel. The results are shown in Figure 2.

DISCUSSION

IGF-1 is a member of IGF family. It is a single chainpolypeptide (MW 7.65 ku) containing 70 amino acids and6 exons[19]. Its biological responses are transmitted by IGF-1R. The results of some studies showed that IGF-1 could

Figure 2 RT-PCR amplified products of IGF-1/-actin. A: IGF-1R/-actin; B:gastrin/-actin; C: and CCK-BR/-actin; D: detected by electrophoresis onan 1.8% agarose gel. Lane 1: gastric cancer tissues; lane 2: adjacent mucosa;

lane 3: tumor-free tissues; lane 4: healthy controls; M: standard molecularweight of DNA.

Test

fact

or/-a

ctin

Gastic cancer

Control

0.8

0.6

0.4

0.2

0.0IGF-1 IGF-1R Gastrin CCK-BR

M 1 2 3 4

←IGF-1R (312 bp)

←-actin (202 bp)

331

242

190

M 1 2 3 4

←IGF-1R (354 bp)

←-actin (202 bp)

404

331

242

190

←Gastrin (323 bp)

←-actin (202 bp)

M 1 2 3 4

331

190←CCK-BR (357 bp)

←-actin (202 bp)

M 1 2 3 4

331

190

A

C D

B

b

b

b

b

stimulate numerous types of tumor cells proliferatingthrough binding to IGF-1R[20]. IGF-1R is a glycoproteintetramer located in cell membranes and involves 2 subunits(MW 100-135 ku) with binding sites for ligands and 2 subunits (MW 90-95 ku) containing transmembrane PTKactive areas[21]. IGF-1 not only has an important effect onin vivo metabolism of proteins and carbohydrates throughbinding to the cell-surface IGF-1 receptors (IGF-1R) butalso regulates cell activity including cell proliferation,differentiation and apoptosis and these changes are thecharacteristics of carcinoma cells. Experiments showed thatIGF-1 could stimulate cell DNA synthesis, upregulateexpression of cyclin D1 and motivate cell mitosis fromphase G1 to phase S in vitro. At the same time, it couldupregulate Bcl-2 and Bcl-xL levels and downregulate Baxto inhibit cell apoptosis and stimulate cell proliferation[22].The function of IGF-1R is similar to IGF-1 but it couldaffect cell conversion. Other studies showed that IGF-1Rwas overexpressed and the activity of IGF-1R was increasedin breast cancer[23,24]. Up to now, only a few studies on IGF-1/IGF-1R mRNA expression in gastric carcinoma tissueare available. In this study, we measured the expression ofIGF-1 and its receptors at mRNA level in order to analyzethe possible correlation between the activity of these genesand cell proliferation in human gastric tumors. The resultsshowed that the mRNA expression levels of IGF-1/IGF-1R were higher in cancer tissues than in normal gastrictissues. We consider that IGF-1 overexpression could resultin overexpression of IGF-1R. The overexpressed IGF-1Rwas bound to IGF-1 to stimulate gastric excess mucosa cellproliferation, abnormal conversion and apoptosis, resultingin gastric mucosa canceration. Our results clearly demonstratedthe important role of IGF-1/IGF-1R in the pathogenesisof gastric cancer, including that the overexpression of IGF-1/IGF-1R plays an important role in the carcinogenesisand development of gastric carcinoma. In addition, itsupports the hypothesis that autocrine/paracrine stimulationof cell growth by IGF-1, which may be an importantmechanism in the pathogenesis of invasive and metastaticgastric cancer. The simultaneous targeting of growth factorreceptors in IGF-1-producing and -dependent cancer cellsmight be a therapeutic strategy.

In an additional attempt to evaluate the mechanism ofIGF-1/IGF-1R potential contributions to gastric cancergrowth or progression, we detected the expression level oftumor-free tissues, adjacent mucosa and gastric cancertissues. The result showed that the mRNA expression levelwas successively increased in tumor-free tissues, adjacentmucosa to gastric cancer tissues. These findings suggestthat there must be a molecular change during the transitionfrom normal to malignant gastric cells that allows IGF-1or/and IGF-1R to play a stimulatory role. One possibilitywas the activation or inactivation of a regulatory ‘switch’molecule that alters cellular physiology in a way that favorsIGF-1/IGF-1R carcinogenesis role. But we do not know atwhich step the overexpression of IGF-1/IGF-1R occursand which factors can regulate it. The mRNA expressionlevel of IGF-1/IGF-1R was obviously higher in gastriccancer tissues and adjacent mucosa than in normal tissue.So we deduced that the overexpression of IGF-1/IGF-1R

might be used as an indicator for early diagnosis of gastriccarcinoma.

Gastrin is a member of gastrin/CCK family. It containsthree exons. Aside from the function of regulating thesecretion of gastric acid, we have found that it plays animportant role in the carcinogenesis. CCK-BR is a gastrinreceptor[25] and belongs to the G-protein correlative receptorsuperfamily. It could activate a sequence of enzymicreaction, and call Ca2+ inside cells, and finally activate proteinkinase C[26]. Gastrin/CCK-BR could also promote thegrowth of gastric carcinoma[27,28], and proliferate gastriccarcinoma cells[29].

The present study found that mRNA of gastrin/CCK-BR was expressed both in gastric carcinoma tissues and innormal controls, but it was increased in gastric carcinomatissues compared with controls (P<0.01). This finding isconsistent with previous reports by Konturek et al[30]. It issupposed that a self-secretive circle of gastrin-CCK-BR mayexist in gastric mucosa, which regulates the normal secretionof gastric acid and proliferation of gastric mucosa cells. Ingastric carcinoma, overexpression of gastrin stimulates theexpression of CCK-BR. After combined with gastrin/CCK-BR, proliferation of cells is gradually strengthened, thengoes into a disorderly state, and the synthesis of DNA andproteins is increased abnormally, at last the formation ofcarcinoma is accelerated. Therefore, it is preliminarilyconsidered that overexpression of gastrin/CCK-BR takespart in the carcinogenesis and development of gastriccarcinoma. However, its mechanism should be furtherstudied.

With the research of gastric carcinoma deepended, it isthe focus to find out pathological changes in the prophaseof carcinoma and signs of early pathological changes.However, the highly specific and sensitive method has notbeen found until now. The present study detected the mRNAexpression levels of gastrin/CCK-BR in gastric cancertissues, adjacent mucosa and tumor-free tissues frompatients with gastric carcinoma. The results showed thatthe levels were increased successively in tumor-free tissues,adjacent mucosa and gastric cancer tissues. Moreover, themRNA expression of gastrin was increased in adjacentmucosa tissues compared with tumor-free tissues (P>0.05).After analyzing the above results, we believe that gastrinand CCK-BR both take part in the carcinogenesis of gastriccarcinoma, but the increase of CCK-BR expression mayappear earlier than gastrin expression. As for the reasons, itcould be that many factors influence the carcinogenesis ofgastric carcinoma and the expression of CCK-BR is alsoregulated by other members of gastrin/CCK-BR family,such as CCK, so the change of CCK-BR expression is aresult of very complicated mutual regulation betweenreceptors and ligands. Early changes in mRNA expressionof CCK-BR may be of great significance in estimating theearly carcinogenesis of gastric carcinoma.

REFERENCES

1 Konturek PC, Konturek SJ, Sulekova Z, Meixner H, Bielanski

W, Starzynska T, Karczewska E, Marlicz K, Stachura J, HahnEG. Expression of hepatocyte growth factor, transforming

growth factor alpha, apoptosis related proteins Bax and Bcl-


2, and gastrin in human gastric cancer. Aliment Pharmacol

Ther 2001; 15 : 989-9992 Han SU, Lee JH, Kim WH, Cho YK, Kim MW. Significant

correlation between serum level of hepatocyte growth factor

and progression of gastric carcinoma. World J Surg 1999; 23:1176-1180

3 Torrisi R, Mezzetti M, Johansson H, Barreca A, Pigatto F,

Robertson C, Decensi A. Time course of fenretinide-inducedmodulation of circulating insulin-like growth factor(IGF)-i,

IGF-II and IGFBP-3 in a bladder cancer chemoprevention trial.

Int J Cancer 2000; 87: 601-6054 Blakesley VA, Stannard BS, Kalebic T, Helman LJ, LeRoith

D. Role of the IGF-I receptor in mutagenesis and tumor

promotion. J Endocrinol 1997; 152: 339-3445 Baserga R. The IGF-I receptor in cancer research. Exp Cell Res

1999; 253: 1-6

6 Durrant LG, Watson SA, Hall A, Morris DL. Co-stimulationof gastrointestinal tumour cell growth by gastrin, transform-

ing growth factor alpha and insulin-like growth factor-I. Br J

Cancer 1991; 63: 67-707 Peters G, Gongoll S, Langner C, Mengel M, Piso P, Klempnauer

J, Ruschoff J, Kreipe H, von Wasielewski R. IGF-1R, IGF-1 and

IGF-2 expression as potential prognostic and predictive mark-ers in colorectal-cancer. Virchows Arch 2003; 443: 139-145

8 Long L, Rubin R, Brodt P. Enhanced invasion and liver colo-

nization by lung carcinoma cells overexpressing the type 1insulin-like growth factor receptor. Exp Cell Res 1998; 238:

116-121

9 Steller MA, Delgado CH, Bartels CJ, Woodworth CD, ZouZ. Overexpression of the insulin-like growth factor-1 receptor

and autocrine stimulation in human cervical cancer cells. Cancer

Res 1996; 56 : 1761-17651 0 Long L, Rubin R, Baserga R, Brodt P. Loss of the metastatic

phenotype in murine carcinoma cells expressing an antisense

RNA to the insulin-like growth factor receptor. Cancer Res1995; 55 : 1006-1009

1 1 Ishizuka J, Martinez J, Townsend CM, Thompson JC. The

effect of gastrin on growth of human stomach cancer cells.Ann Surg 1992; 215: 528-534

1 2 Sumiyoshi H, Yasui W, Ochiai A, Tahara E. Effects of gas-

trin on tumor growth and cyclic nucleotide metabolism inxenotransplantable human gastric and colonic carcinomas in

nude mice. Cancer Res 1984; 44: 4276-4280

1 3 Konturek PC, Konturek SJ, Bielanski W, Karczewska E,Pierzchalski P, Duda A, Starzynska T, Marlicz K, Popiela T,

Hartwich A, Hahn EG. Role of gastrin in gastric cancerogenesis

in Helicobacter pylori infected humans. J Physiol Pharmacol 1999;50 : 857-873

1 4 Bordi C, D’Adda T, Azzoni , C, Pi lato FP, Caruana P.

Hypergastrinemia and gastric enterochromaffin-like cells. AmJ Surg Pathol 1995; 19 Suppl 1: S8-S19

1 5 Hellmich MR, Rui XL, Hellmich HL, Fleming RY, Evers BM,

Townsend CM. Human colorectal cancers express a constitu-

tively active cholecystokinin-B/gastrin receptor that stimu-lates cell growth. J Biol Chem 2000; 275: 32122-32128

1 6 Upp JR, Singh P, Townsend CM, Thompson JC. Clinical sig-

nificance of gastrin receptors in human colon cancers. CancerRes 1989; 49: 488-492

1 7 Smith JP, Stock EA, Wotring MG, McLaughlin PJ, Zagon IS.

Characterization of the CCK-B/gastrin-like receptor in hu-man colon cancer. Am J Physiol 1996; 271: R797-R805

1 8 Chomczynski P, Sacchi N. Single-step method of RNA isola-

tion by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal Biochem 1987; 162: 156-159

1 9 Hoyt EC, Hepler JE, Van Wyk JJ, Lund PK. Structural charac-

terization of exon 6 of the rat IGF-I gene. DNA Cell Biol 1992;11 : 433-441

2 0 Pavelic K, Kolak T, Kapitanovic S, Radosevic S, Spaventi S,

Kruslin B, Pavelic J. Gastric cancer: the role of insulin-likegrowth factor 2(IGF2) and its receptors (IGF1R and M6-P/

IGF2R). J Pathol 2003; 201: 430-438

2 1 Czech MP. Signal transmission by the insulin-like growthfactors. Cell 1989; 59: 235-238

2 2 Parrizas M, LeRoith D. Insulin-like growth factor-1 inhibi-

tion of apoptosis is associated with increased expression ofthe bcl-xL gene product. Endocrinology 1997; 138: 1355-1358

2 3 Surmacz E, Guvakova MA, Nolan MK, Nicosia RF, Sciacca

L. Type I insulin-like growth factor receptor function in breastcancer. Breast Cancer Res Treat 1998; 47: 255-267

2 4 Resnik JL, Reichart DB, Huey K, Webster NJ, Seely BL. El-

e v a t e d i n s u l i n - l i k e g r o w t h f a c t o r I r e c e p t o rautophosphorylation and kinase activity in human breast

cancer. Cancer Res 1998; 58: 1159-1164

2 5 Kopin AS, Lee YM, McBride EW, Miller LJ, Lu M, Lin HY,Kolakowski LF, Beinborn M. Expression cloning and charac-

terization of the canine parietal cell gastrin receptor. Proc Natl

Acad Sci USA 1992; 89 : 3605-36092 6 Seva C, Dickinson CJ, Yamada T. Growth-promoting effects

of glycine-extended progastrin. Science 1994; 265: 410-412

2 7 Kaise M, Muraoka A, Seva C, Takeda H, Dickinson CJ,Yamada T. Glycine-extended progastrin processing interme-

diates induce H+,K(+)-ATPase alpha-subunit gene expres-

sion through a novel receptor. J Biol Chem 1995; 270: 11155-11160

2 8 Watson S, Durrant L, Morris D. Gastrin: growth enhancing

effects on human gastric and colonic tumour cells. Br J Cancer1989; 59 : 554-558

2 9 Eden PA, Taylor JE. Somatostatin receptor subtype gene ex-

pression in human and rodent tumors. Life Sci 1993; 53: 85-903 0 Konturek PC, Kania J, Kukharsky V, Ocker S, Hahn EG,

Konturek SJ. Influence of gastrin on the expression of

cyclooxygenase-2, hepatocyte growth factor and apoptosis-related proteins in gastric epithelial cells. J Physiol Pharmacol

2003; 54 : 17-32

Science Editor Wang XL and Li WZ Language Editor Elsevier HK

Zhao MD et al. Tumor associated factors in gastric carcinoma 3221


Relationship between matrix metalloproteinase-2 mRNA

expression and clinicopathological and urokinase-type plasminogen

activator system parameters and prognosis in human gastric

cancer

Feng Ji, Yue-Liang Chen, En-Yun Jin, Wei-Lin Wang, Zi-Li Yang, You-Ming Li

EL SEVIER




Feng Ji, Yue-Liang Chen, En-Yun Jin, Wei-Lin Wang, Zi-LiYang, You-Ming Li, Department of Gastroenterology, FirstAffiliated Hospital of Medical College, Zhejiang University,Hangzhou 310003, Zhejiang Province, ChinaCorrespondence to: Dr. Feng Ji, Department of Gastroenterology,First Affiliated Hospital of Medical College, Zhejiang University,Qingchun Road 79, Hangzhou 310003, Zhejiang Province,China. [email protected]: +86-571-87236568Received: 2004-06-11 Accepted: 2004-07-22

Abstract

AIM: To investigate the relationship between matrixmetalloproteinase-2 (MMP-2) mRNA expression andclinicopathologic and urokinase-type plasminogen activator(uPA) system parameter and prognosis in human gastriccancer.

METHODS: Expression of MMP-2 mRNA, uPA, and uPA-RmRNA in tumor tissues and ≥5 cm adjacent normal tissuesfrom 67 cases of gastric cancer was studied using RT-PCR and Northern blot respectively. Survival analyses weredone using the Kaplan-Meier method.

RESULTS: The expression rates of MMP-2 mRNA, uPAand uPA-R mRNA in tumor tissues (31%, 41%, and 51%,respectively) were significantly higher than those in ≥5 cmadjacent tissues (19%, 11%, and 9%; 2 = 4.59, 43.58,and 53.24 respectively, P<0.05, 0.0001, and 0.0001,respectively). Expression of MMP-2 mRNA was significantlycorrelated with lymph node metastasis (metastasis:61.9%, no metastasis: 39.1%, 2 = 7.61, P<0.05), Lauren’sclassification of diffuse/mixed types: 54.2%, intestinaltype: 26.3%, 2 = 4.25, P<0.05, expression of uPA anduPA-R mRNA (uPA+: 55.1%, uPA-: 22.2% and uPA-R+:54.9%, uPA-R-: 18.8%, 2 = 5.72 and 6.40 respectively,P<0.05). Kaplan-Meier survival analysis of MMP-2 mRNAexpression did not show significant difference in all 67cases, but revealed an association of the expression ofMMP-2 mRNA, uPA, and uPA-R mRNA with worse prognosis(P = 0.0083, 0.0160, and 0.0094, respectively).

CONCLUSION: MMP-2 may play an important role in thedevelopment of invasion and metastasis of gastric cancer.


Key words: Gastric cancer; Matrix metalloproteinase-2;Urokinase-type plasminogen activator

Ji F, Chen YL, Jin EY, Wang WL, Yang ZL, Li YM. Relationshipbetween matrix metalloproteinase-2 mRNA expression andclinicopathological and urokinase-type plasminogen activatorsystem parameters and prognosis in human gastric cancer.World J Gastroenterol 2005; 11(21): 3222-3226


INTRODUCTION

Gastric cancer is one of the leading malignancies in manycountries. In spite of radical surgeries, such as sub-total ortotal gastrectomy combined with other modalities, its curerate is quite low because of local invasion and metastasis,which are known to be associated with increased activities ofseveral proteolytic enzymes, including matrix metalloproteinase(MMP) and plasminogen activators. MMP-2 (72 ku typeIV collagenase) is a member of the MMP gene family whichdegrades the macromolecules of connective tissues andECM, such as collagen, proteoglycans, laminin and fibronectin.Thus MMP-2 is believed to play an important role in tumorinvasion and metastasis[1]. Our studies have shown thatMMP-2 mRNA and protein are overexpressed in gastriccancer and related to the clinicopathologic parameters ofcancer. In this context evaluation of MMP-2 expression inesophageal cancer, ovarian cancer, meningiomas and othertumors appears as a useful prognostic indicator[2-7]. MMP-2has been detected preferentially on cells from advancedgastric carcinoma by immunohistochemistry and anassociation of MMP-2 with poor prognosis of cancerpatients has been suggested[7].

There are two types of plasminogen activators, urokinase-type plasminogen activator (uPA) and tissue-type plasminogenactivator. In particular, the uPA and its specific cell surfacereceptor uPA-R, play important roles in tumor invasion andmetastasis. Tissue levels of uPA, uPA-R are higher in severalmalignant tumors than those of the corresponding adjacentnormal tissues, such as gastric cancer and esophageal squamouscell carcinoma[8-10]. Many studies have shown that inhibitionof uPA activity or uPA binding to uPA-R results in thesuppression of tumor growth and reduces or abolishesformation of metastasis[11].

The current study was designed to examine the possible

association between the expression of MMP-2 mRNA andclinicopathologic and uPA system parameters and prognosisin human gastric cancer.


SamplesThe samples of tumor tissue and ≥5 cm adjacent normaltissues from 67 gastric cancer patients were obtained fromthe Surgery Department of our hospital and People’sHospital of Yunhe County, Zhejiang. Gastric tissues from10 benign ulcer patients after partial gastrectomy were usedas controls. The histological diagnosis was made by thepathologists of these two hospitals. Patients’ clinical featuresare shown in Table 1. The mean age was 62.2 years (SD 9.3,range 23-78 years), the male/female ratio was 1.79 (43/24).All samples were quenched in liquid nitrogen immediatelyafter operation and then stored at -70 ℃ for study.

Table 1 Relationship between MMP-2 mRNA expression and clini-copathologic and uPA system parameters

Variable Case number Expression of 2 P MMP-2 mRNA, n (%)

Depth of invasion

Early cancer 11 3 (27.3) 1.91 >0.05

Advanced cancer 56 28 (50.0)

Differentiation

Well-moderate 16 6 (43.8) 0.65 >0.05

Poor 51 25 (47.1)

Lymph node metastasis

Positive 21 13 (61.9) 7.61 <0.01

Negative 46 18 (39.1)

Liver metastasis

Positive 8 6 (75.0) 3.01 >0.05

Negative 59 25 (42.4)

TNM stage

I+II 13 3 (23.1) 3.49 >0.05

III+IV 54 28 (51.9)

Lauren’s classification

Diffuse/mixed types 48 26 (54.2) 4.25 <0.05

Intestinal type 19 5 (26.3)

uPA mRNA

Positive 49 27 (55.1) 5.72 <0.05

Negative 18 4 (22.2)

uPA-R mRNA

Positive 51 28 (54.9) 6.40 <0.05

Negative 16 3 (18.8)

RT-PCR analysis of MMP-2 mRNAdNTP, RNAsin and MMLV reverse transcriptase and TaqDNA were provided by Stratagene, La Jolla, CA, USA.MMP-2 primer pair was synthesized by Shanghai CellResearch Institute, Chinese Academy of Sciences and itssense and anti-sense were 5’-ACAAAGAGTGGCAGTG-CAA-3’ and 5’-CACGAGCAAAGGCATCATCC-3’respectively. The expected size of MMP-2 product was302 bp. Total RNA was extracted from frozen tissuesby cesium chloride purifying method. A total amount of20 L reaction solution contained 5 g RNA sample tissue,1 mmol/L dNTP, 10 U RNAsin, 100 mmol/L Tris-HClpH 8.4, 50 mmol/L KCl, 2.5 mmol/L MgCl2, 200 mg/mL

BSA, 100 pole random six-polyoligonucleotide and 100 UMMLV reverse transcriptase. The reverse transcriptionalcondition was at 37 ℃ for 1 h, and at 95 ℃ for 5 min.Twenty microliters of cDNA reverse transcriptase productwas put in PCR reaction solution containing 100 mmol/LMgCl2, 200 mg/mL BSA, 30 pmoL sense and anti-senseprimers, and then 2 U Taq DNA polymerase was addedin the solution. The PCR amplification conditions were:denaturation at 95 ℃ for 1 min, annealing at 65 ℃ for1 min and extension at 72 ℃ for 1 min for 35 cycles. Tenmicroliters of DNA amplified product was subjected toelectrophoresis in 4% agarose gel, stained with ethidiumbromide and observed under ultraviolet light. The photographsof PCR results were used to measure the level of opticaldensity (A) of MMP-2 cDNA bands by densitometry(Backman CD 2000).

Northern blot analysis of uPA and uPA-R mRNAThe probes of uPA and uPA-R cDNA encoding the PGEMrecombinant plasmid of human uPA cDNA 387 bp Acc I-BgLII and uPAR cDNA 585 bp BamHI respectively wereprovided by Shanghai Sangon Biotechnology and -actinDNA probe (1.0 kb) was provided by Huamei Biotechnology.All probes used in Northern blot analysis were labeled with-32P-dCTP in Shanghai Sangon Biotechnology. Total RNAwas isolated from frozen tumor tissue and ≥5 cm adjacentnormal tissues using a guanidine isothiocyanate method[12].Twenty-five micrograms of total RNA was fractionated in0.8% agarose gel containing 1% formaldehyde at 30 Vovernight, transferred to a nylon membrane and fixed byUV cross-linking. The filter was hybridized at 80 ℃ for 2 hwith a radioactive labeled probe in ExpressHyb solution(Clontech), washed with 2×SSC/0.05% SDS for 40 min atroom temperature and then with 0.1×SSC/0.1% SDS for40 min at 50 ℃. The probe was removed from the blot byincubating with 0.5% SDS in H2O at 90 ℃ for 10 min. Thefilter was then re-equilibrated in the ExpressHyb solutionand reprobed with a new sequence. The hybridizationsignals were quantitated by scanning the autoradiogramswith a laser densitometer (Computing Densitometer ModelQTM970), and normalized to the quantity of mRNA andthe specific activity of different probes.

Statistical analysisThe significance of differences in expression rates and Avalues among groups was determined by 2 test andStudent’s t-test respectively. Kaplan-Meier analysis was usedto evaluate group oriented life-table curves which wereconfirmed by log-rank statistics. P<0.05 was consideredstatistically significant. All statistical analyses were performedusing SPSS software.

RESULTS

Expression of MMP-2, uPA, and uPA-R mRNA in tumor and

adjacent tissuesIn 67 cases of gastric cancer, the positive rate of MMP-2mRNA expression was significantly higher in tumor tissues(expressed in 31 cases) than in ≥5 cm adjacent normalones (expressed in 19) (2 = 4.59, P<0.05, Figure 1). The A

Ji F et al. MMP-2 and uPA in human gastric cancer 3223

values of MMP-2 cDNA in 10 normal controls were verylow and considered to be negative. The average A value ofMMP-2 cDNA was 4.05 times higher in tumor tissues thanin ≥5 cm adjacent normal tissues (t = 3.437, P<0.01). Thepositive rates of uPA and uPA-R mRNA expression weresignificantly higher in tumor tissues (expressed in 49 and 52cases respectively) than in ≥5 cm adjacent normal(expressed in 11 and 9 respectively), (2 = 43.58 and 53.24respectively, P<0.001). The average IOD value of uPAand uPA-R was 5.1 and 5.5 times higher in tumor tissuesthan in ≥5 cm adjacent normal ones (t = 3.841 and 4.026,P<0.001, Figure 2).

Figure 1 Expression of MMP-2 mRNA in gastric cancerous tissues and tumoradjacent tissues. Lane M: DNA marker; lanes 1 and 2: gastric canceroustissues where MMP-2 mRNA is overexpressed; lanes 3 and 4: tumor adjacenttissues; lane 5: normal control.

Figure 2 Expression of uPA and uPA-R mRNA in gastric cancerous tissuesand tumor adjacent tissues. Lanes 1 and 4: normal controls; lanes 2 and 5:tumor adjacent tissues; lanes 3 and 6: gastric cancerous tissues where uPA anduPA-R mRNA are overexpressed; lanes 7: empty control.

Relationship between MMP-2 mRNA expression andclinicopathologic and uPA system parameters (Table 1)Although the expression rates of MMP-2 mRNA were lowerin cases with early cancer, MMP-2 mRNA expression intumor tissues correlated neither with depth of invasion,differentiation and liver metastasis nor with TNM stage. Asignificant correlation was seen, however, between lymphnode metastasis, Lauren’s classification and positiveexpression of uPA and uPA-R mRNA (P<0.05).

Association between MMP-2mRNA expression and prognosisof patientsKaplan-Meier survival analysis of MMP-2 mRNA detectiondid not show significant differences in 31 positive cases with

a mean survival time (MST) of 30.41 mo and in 36 negativecases (MST: 46.51 months, P = 0.1321, Figure 3). Amongthe 48 cases of Lauren’s diffuse/mixed types, MST of 26positive cases (25.05 mo) was significantly lower than thatof 22 negative cases (51.77 mo, P = 0.0083). Among the49 positive cases of uPA mRNA, MST of 27 positive cases(29.79 mo) was significantly lower than that of 22 negativecases (49.07 mo, P = 0.0160). Among the 51 positive casesof uPA-R mRNA, MST of 28 positive cases (25.82 mo) wassignificantly lower than that of 23 negative cases (52.11 mo,P = 0.0094).

Figure 3 No signif icant differences between posit ive cases and negativecases in Kaplan–Meier survival analysis of MMP-2 mRNA.

DISCUSSION

Studies have shown that MMP-2 is mainly expressed inmembrane of tumor cells while it cannot be detected innormal gastric mucosal cells and that MMP-2 positive cellsare more numerous in poorly differentiated and advancedgastric cancers than in well differentiated and early gastriccancers[13-15]. Our previous study also revealed that MMP-2mRNA and protein overexpressions are more significantin poorly differentiated and advanced gastric cancer cellsthan in well differentiated and early gastric cancer cells. Inthe current study, MMP-2 mRNA could not be detected in10 cases of normal controls, demonstrating that in normalgastric tissues, MMP-2 is rarely expressed or the mRNAlevel is too low to be detected. Schwartz et al[16], reportedthat MMP-2 mRNA is expressed in invasive SK-GT1, SK-GT5 and SK-GT6 cell lines but not in noninvasive SK-GT2 and SK-GT4 cell lines. In ultrastructural study, MMP-2mRNA is expressed markedly in cancer cells with rich falsefeet and rapid movement in culture, but insignificantlyexpressed in cancer cells with few false feet from unmetastaticand uninvasive gastric cancerous tissues, indicating thatMMP-2 secretion is correlated with the invasion and metastasisof gastric cancer[17,18]. Studies have shown that downregulationof MMPs or reduction of MMP-2 expression results ininhibition of tumor growth and reduces or abolishes formationof metastasis[19,20]. In our study, the rates of positive MMP-2mRNA expression were low in early gastric cancer with noliver metastasis and stages I and II gastric cancer, but therewas no significant difference between MMP-2 mRNAexpression and the degree of invasion, differentiation, livermetastasis and TNM stage of gastric cancer. However, the

M 1 2 3 4 5

←302 bp

1 2 3 4 5 6 7

←2.5 kb

←1.4 kb

←2.1 kb

uPA

uPAR

-actin

Surv

ival (%

)

0 5 10 15 20 25 30 35 40 45 50 55 60 65 Time (mo)

100908070605040302010

MMP-2 mRNA (-)

MMP-2 mRNA (+)


rates significantly increased in lymph node metastasis anddiffuse/mixed types. This phenomenon implies that gastriccancer cells with more malignant and metastatic potentialmay secrete much more MMP-2 protein. Sier et al [21],reported that MMP-2 expression is significantly enhancedin gastric cancerous tissues compared with that in adjacentnormal mucosal tissues. In our previous studies, adjacentnormal mucosal tissues had lower MMP-2 mRNA positiveexpression and lower MMP-2 cDNA A than gastriccancerous tissues. This study also showed that MMP-2mRNA expression and MMP-2 A were higher in gastriccancerous tissues than in ≥5 cm adjacent tissues. Althoughthe levels of MMP-2 cDNA signals in tumor-adjacent tissueswere lower than in tumor tissues, MMP-2 mRNA wasoverexpressed in tumor-adjacent tissues, suggesting that bothgastric cancer cells and adjacent mesenchymal cells, includingfibrocytes, endothelium cells, macrophages, and lymphocyteshave the ability to secrete MMP-2. There may be informationexchange between cancer cells and these mesenchymalcells through the dissolvable intercellular substances andmembrane cement factors, and such information exchangemay regulate the production of MMP-2. This may be veryimportant in elucidating the mechanism of invasion andmetastasis of cancer cells[22].

The role of MMP-2 protein and mRNA evaluation inthe prognostic judgment of gastric cancer is still controversial.Mori et al[14], concluded that the expression of MT1-MMPmay influence prognosis via tumor invasion of gastric walland lymph node metastasis, and activation of MMP-2 maybe clinically relevant to the progression of gastric carcinomatumors. Caenazzo et al[15], suggested that the ratio of MT1-MMP and MMP-2 mRNA of gastric carcinoma tissue is anew preoperative molecular level prognostic factor forgastric carcinoma. Allgayer et al[5], showed that Kaplan-Meier survival analysis of immunohistochemical MMP-2detection does not show significant differences in disease-free and overall survival of curatively resected patients. Indiffuse types, however, a significant association of MMP-2with disease-free and overall survival is revealed in curativelyresected patients. These results demonstrate that there isan association of MMP-2 with prognosis of cancer patients.For diffuse gastric cancers, MMP-2 is a significant prognosticparameter; however, it is of no independent impact. In ourstudy, the average survival period of 31 MMP-2 mRNApositive patients was shorter than that of negative ones,but the difference did not show statistical significance. Indiffuse/mixed type, the average survival period wassignificantly shorter than negative ones, which was similarto the immunohistochemical results of Allgayer’s[5].

The uPA/uPA-R system not only takes part in tumorformation, but also plays an important role in tumor invasionand metastasis[23-26]. In this study, there was a significantdifference in uPA and uPA-R mRNA expression betweengastric cancer and adjacent tissues, and the IOD wassignificantly higher in cancer tissues. Some studies reportedthat the uPA and uPA-R protein activity in tumor center,tumor border and adjacent normal tissue determined byELISA and immunohistochemistry decreases gradually,which is similar to the results of our study[23]. These studiesshow that either the protein or the mRNA level of uPA

and/or uPA-R tends to decline following the decline ofmalignant degree of tumors. uPA-R as the membrane-boundcenter of the uPA system is able to concentrate on uPAactivity by focusing on receptor-bound uPA and enzymesin the proteolytic cascade like MMP-2 may be activated,resulting in stroma protein hydrolysis and tumor cell invasionand metastasis[26-28]. Thus, MMP-2 and uPA/uPA-R systemco-operate during tumor invasion and metastasis. Allgayeret al[5], reported a significant correlation between MMP-2immunohistochemical detection and prognosis in cancerswith uPA-R but not uPA overexpressed. While in our study,MMP-2 mRNA level in uPA and uPA-R positive patientsincreased significantly. In 49 uPA and 51 uPA-R mRNApositive patients, the survival time of MMP-2 positivepatients was significantly shorter than that of negative ones,suggesting that MMP-2 can be designated as a prognosticfactor when MMP-2 activated enzymes such as uPA/uPA-R are overexpressed[5,29]. In conclusion, MMP-2 mRNAexpression may play important roles in gastric cancerformation, invasion, and metastasis.

REFERENCES1 Allgayer H, Babic R, Grutzner KU, Beyer BC, Tarabichi A,

Schildberg FW, Heiss MM. Tumor-associated proteases and

inhibitors in gastric cancer: analysis of prognostic impact andindividual risk protease patterns. Clin Exp Metastasis 1998;

16 : 62-73

2 Yamashita K, Tanaka Y, Mimori K, Inoue H, Mori M. Differ-ential expression of MMP and uPA systems and prognostic

relevance of their expression in esophageal squamous cell

carcinoma. Int J Cancer 2004; 110: 201-207

3 Schmalfeldt B, Prechtel D, Harting K, Spathe K, Rutke S,Konik E, Fridman R, Berger U, Schmitt M, Kuhn W, Lengyel

E. Increased expression of matrix metalloproteinases (MMP)-

2, MMP-9, and the urokinase-type plasminogen activator isassociated with progression from benign to advanced ova-

rian cancer. Clin Cancer Res 2001; 7: 2396-2404

4 Siddique K, Yanamandra N, Gujrati M, Dinh D, Rao JS,Olivero W. Expression of matrix metalloproteinases, their

inhibitors, and urokinase plasminogen activator in human

meningiomas Int J Oncol 2003; 22: 289-2945 Allgayer H, Babic R, Beyer BC, Grutzner KU, Tarabichi A,

Schildberg FW, Heiss MM. Prognostic relevance of MMP-2

(72-kD collagenase IV) in gastric cancer. Oncology 1998; 55:152-160

6 Knappe UJ, Hagel C, Lisboa BW, Wilczak W, Ludecke DK,

Saeger W. Expression of serine proteases and metalloproteinasesin human pituitary adenomas and anterior pituitary lobe

tissue. Acta Neuropathol 2003; 106: 471-478

7 Monig SP, Baldus SE, Hennecken JK, Spiecker DB, Grass G,Schneider PM, Thiele J, Dienes HP, Holscher AH. Expression

of MMP-2 is associated with progression and lymph node

metastasis of gastric carcinoma. Histopathology 2001; 39: 597-602

8 Kaneko T, Konno H, Baba M, Tanaka T, Nakamura S. Uroki-

nase-type plasminogen activator expression correlates withtumor angiogenesis and poor outcome in gastric cancer. Cancer

Sci 2003; 94; 43-49

9 Park IK, Kim BJ, Goh YJ, Lyu MA, Park CG, Hwang ES,Kook YH. Co-expression of urokinase-type plasminogen

activator and its receptor in human gastric-cancer cell lines

correlates with their invasiveness and tumorigenicity. Int JCancer 1997; 71: 867-873

1 0 Choi YK, Yoon BI, Kook YH, Won YS, Kim JH, Lee CH, Hyun

BH, Oh GT, Sipley J, Kim DY. Overexpression of urokinase-type plasminogen activator in human gastric cancer cell line

(AGS) induces tumorigenicity in severe combined immuno-

Ji F et al. MMP-2 and uPA in human gastric cancer 3225

deficient mice. Jpn J Cancer Res 2002; 93: 151-156

1 1 Holst-Hansen C, Johannessen B, Hoyer-Hansen G, Romer J,Ellis V, Brunner N. Urokinase-type plasminogen activation in

three human breast cancer cell lines correlates with their in

vitro invasiveness. Clin Exp Metastasis 1996; 14; 297-3071 2 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A

Laboratory Manual. 2nd Ed. New York: Cold Spring Harbor

Laboratory Press 1989: 366-4891 3 Cai H, Kong ZR, Chen HM. Matrix metalloproteinase-2 and

angiogenesis in gastric cancer. Aizheng 2002; 21: 25-28

1 4 Mori M, Mimori K, Shiraishi T, Fujie T, Baba K, KusumotoH, Haraguchi M, Ueo H, Akiyoshi T. Analysis of MT1-MMP

and MMP-2 expression in human gastric cancers. Int J Cancer

1997; 74: 316-3211 5 Caenazzo C, Onisto M, Sartor L, Scalerta R, Giraldo A,

Nitt i D, Garbisa S. Augmented membrane type 1 matrix

metalloproteinase (MT1-MMP): MMP-2 messenger RNA ra-tio in gastric carcinomas with poor prognosis. Clin Cancer Res

1998; 4 : 2179-2186

1 6 Schwartz GK, Wang H, Lampen N, Altorki N, Kelsen D,Albino AP. Defining the invasive phenotype of proximal gas-

tric cancer cells. Cancer 1994; 73: 22-27

1 7 Grigioni WF, D’Errico A, Fortunato C, Fiorentino M, ManciniAM, Stetler-Stevenson WG, Sobel ME, Liotta LA, Onisto M,

Garbisa S. Prognosis of gastric carcinoma revealed by interac-

tions between tumor cells and basement membrane. ModPathol 1994; 7 : 220-225

1 8 Allgayer H, Heiss MM, Schildberg FW. Prognostic factors in

gastric cancer. Br J Surg 1997; 84: 1651-16641 9 Zhang H, Morisaki T, Matsunaga H, Sato N, Uchiyama A,

Hashizume K, Nagumo F, Tadano J, Katano M. Protein-

bound polysaccharide PSK inhibits tumor invasiveness bydown-regulation of TGF-beta1 and MMPs. Clin Exp Metasta-

sis 2000; 18: 343-352

2 0 Denkert C, Siegert A, Leclere A, Turzynski A, HauptmannS. An inhibitor of stress-activated MAP-kinases reduces in-

vasion and MMP-2 expression of malignant melanoma cells.

Clin Exp Metastasis 2002; 19: 79-852 1 Sier CF, Kubben FJ, Ganesh S, Heerding MM, Griffioen G,

Hanemaaijer R, van Krieken JH, Lamers CB, Verspaget HW.

Tissue levels of matrix metalloproteinases MMP-2 and MMP-

9 are related to the overall survival of patients with gastric

carcinoma. Br J Cancer 1996; 74: 413-4172 2 Mizutani K, Kofuji K, Shirouzu K. The significance of MMP-

1 and MMP-2 in peritoneal disseminated metastasis of gas-

tric cancer. Surg Today 2000; 30: 614-6212 3 Cho JY, Chung HC, Noh SH , Roh JK, Min JS, Kim BS. High

level of urokinase-type plasminogen activator is a new prog-

nostic marker in patients with gastric carcinoma. Cancer 1997;79 : 878-883

2 4 Plebani M, Herszenyi L, Carraro P, De Paoli M, Roveroni G,

Cardin R, Tulassay Z, Naccarato R, Farinati F. Urokinase-type plasminogen activator receptor in gastric cancer: tissue

expression and prognostic role . Clin Exp Metastasis 1997; 15:

418-4252 5 Herouy Y, Aizpurua J, Stetter C, Dichmann S, Idzko M,

Hofmann C, Gitsch G, Vanscheidt W, Schopf E, Norgauer J.

The role of the urokinase-type plasminogen activator (uPA)and its receptor (CD87) in lipodermatosclerosis. J Cutan Pathol

2001; 28 : 291-297

2 6 Kruger A, Soeltl R, Lutz V, Wilhelm OG, Magdolen V, RojoEE, Hantzopoulos PA, Graeff H, Gansbacher B, Schmitt M.

Reduction of breast carcinoma tumor growth and lung

colonization by overexpression of the soluble urokinase-typeplasminogen activator receptor (CD87). Cancer Gene Ther 2000;7: 292-299

2 7 Heiss MM, Allgayer H, Gruetzner KU, Babic R, Jauch KW,Schildberg FW. Clinical value of extended biologic staging bybone marrow micrometastases and tumor-associated pro-teases in gastric cancer. Ann Surg 1997; 226: 736-744; discus-sion 744-745

2 8 Le DM, Besson A, Fogg DK, Choi KS, Waisman DM, GoodyerCG, Rewcastle B, Yong VW. Exploitation of astrocytes byglioma cells to facilitate invasiveness: a mechanism involvingmatrix metalloproteinase-2 and the urokinase-type plasmino-gen activator-plasmin cascade J Neurosci 2003; 23: 4034-4043

2 9 Heiss MM, Babic R, Allgayer H, Gruetzner KU, Jauch KW,Loehrs U, Schildberg FW. Tumor- associated proteolysis andprognosis: new functional risk factors in gastric cancer de-fined by the urokinase-type plasminogen activator system. J

Clin Oncol 1995; 13: 2084-2093




Correlative studies on bFGF mRNA and MMP-9 mRNA expressions

with microvascular density, progression, and prognosis of gastriccarcinomas

Zhong-Sheng Zhao, Ji-Lin Zhou, Gen-You Yao, Guo-Qing Ru, Jie Ma, Jun Ruan

EL SEVIER




Zhong-Sheng Zhao, Guo-Qing Ru, Jie Ma, Department ofPathology, Zhejiang Provincial Hospital, Hangzhou 310014, ZhejiangProvince, ChinaJi-Lin Zhou, Gen-You Yao, Jun Ruan, College of Medical Sciences,Zhejiang University, Hangzhou 310031, Zhejiang Province, ChinaCorrespondence to: Dr. Zhong-Sheng Zhao, Department ofPathology, Zhejiang Provincial Hospital, Hangzhou 310014, ZhejiangProvince, ChinaReceived: 2004-05-27 Accepted: 2004-06-17

Abstract

AIM: To investigate the mRNA expressions of bFGF andMMP-9 in gastric carcinomas so as to reveal their correlationswith tumor microvascular density (MVD), invasion,metastasis, and prognosis.

METHODS: In situ hybridization and immunohistochemicaltechniques were used to detect the expressions ofbFGFmRNA and MMP-9mRNA and the proteins of CD34 in105 specimens of gastric carcinomas.

RESULTS: In situ hybridization study showed that positiverates of bFGF mRNA and MMP-9mRNA expressions were60.95% and 59.19%; the mean MVD was 46.09±11.52and 43.75±13.41, respectively in piece/0.72 mm2 in tumorswith bFGFmRNA and MMP-9mRNA positive expressions,which were significantly higher than those with negativeexpression (29.41±12.47; 33.45±13.92 piece/0.72 mm2,respectively). The positive expression rates of bFGFmRNAand MMP-9mRNA were correlated to the tumor invasiondepth (rs = 0.211, P = 0.031; rs = 0.335, P = 0.001), growingpattern (rs = 0.324, P = 0.001; rs = 0.267, P = 0.006), vesselinvasion (rs = 0.579, P = 0.001; rs = 0.209, P = 0.032),lymph node metastasis (rs = 0.405, P = 0.001; rs = 0.343,P = 0.001) and distant metastasis (rs = 0.474, P = 0.001;rs = 0.468, P = 0.001), but not correlated to tumortype (rs = 0.134, P = 0.173; rs = 0.103, P = 0.145) anddifferentiations (rs = 0.096, P = 0.332; rs = 0.102, P = 0.298).The mean MVD was much higher in the tumors withinfiltrating growth at stage T3–T4, with vessel invasion,lymph node metastasis and distant metastasis than thosewith expanding growth type (t = 10.105, P = 0.001) atstage T1–T2 (t = 5.961, P = 0.001), with non-vesselinvasion (t = 7.394, P = 0.001), non-lymph node metastasis(t = 3.819, P = 0.01) and non-distant metastasis (t = 10.578,P = 0.001). Positive correlation was observed betweenMVD and the expressions of bFGFmRNA and MMP-9mRNA(t = 3.207, P = 0.002; t = 7.035, P = 0.001, respectively).The mean survival time and 5-year survival rate were

lower in cases with MVD over 39.5 and the positiveexpressions of bFGFmRNA and MMP-9mRNA than thosewith MVD less than 39.5 and the negative expressions ofbFGFmRNA and MMP-9mRNA.

CONCLUSION: bFGF and MMP-9 promote the angiogenesisof the gastric cancers. Detection of the expressions ofbFGF and MMP-9 can serve as a useful index to determinethe angiogenesis, invasion, metastasis, and prognosis ofgastric cancers.


Key words: Gastric neoplasm; bFGF; MMP-9; Microvasculardensity; Prognosis

Zhao ZS, Zhou JL, Yao GY, Ru GQ, Ma J, Ruan J. Correlativestudies on bFGF mRNA and MMP-9 mRNA expressions withmicrovascular density, progression and prognosis of gastriccarcinomas. World J Gastroenterol 2005; 11(21): 3227-3233


INTRODUCTION

The growth of solid carcinomas depends on the angiogenesis.Induction of angiogenesis is the premise of the proliferation,infiltration and metastasis of carcinomas. Among all knownregulating factors, bFGF is one of the most potent inducersof the angiogenesis of carcinomas[1-7]. Matrix metalloproteinase-9 (MMP-9) expression and distribution is also being observedin carcinoma angiogenesis[8-15]. In some epithelial carcinomas,MMP-9 can indirectly induce angiogenesis of carcinomas andis correlated with carcinoma progression. Microvascular density(MVD) is a quantitative index for carcinoma angiogenesisand could serve as a marker for carcinoma prognosis[16-18].Simultaneous study of bFGF and MMP-9 is of practical valueto reveal the mechanism and progression of gastric carcinomaangiogenesis and its relationship to MVD using in situhybridization and immunohistochemical techniques, weobserved the expressions of bFGF and MMP-9 in gastriccarcinomas so as to explore the relationship of the carcinomaangiogenesis with its filtration, metastasis, and other carcinomabiological behaviors as well as the prognosis.


Patients and tumor tissuesOne hundred and five gastric carcinoma samples werecollected in the hospital from October 1986 to November


1998. All the samples were fixed with formaldehyde andparaffin embedded. Complete over 5-year follow-up dataare available for all these cases (follow-up ended in October2002). Survival rate that was calculated from the day ofoperation to the end of the follow-up or the date of deathwas used due to the recurrence and metastasis. bFGF andMMP-9 mRNA in situ hybridization and CD34 immunohist-ochemistry were carried out in all samples. The average age ofthe cases was 57.6 years (38-78 years) and the ratio of male tofemale was 2:1 (70:35). According to the classification standardof WHO in 1997, 17 cases had papillary adenocarcinomaswhile 37, 34, 9, and 8 had the tubular adenocarcinoma, poorly-differentiatied adenocarcinomas, mucinous adenocarcinomas,signet-ring cell carcinomas. Highly and intermediatelydifferentiated carcinomas were found in 63 cases whilepoorly and undifferentiated carcinomas in 42 cases. Forty-eight cases had expansive growth carcinomas while 57 caseshad infiltrative growth carcinomas, and 20, 24, 32, and 29cases had T1, T2, T3, and T4 carcinomas, respectively.Carcinomas with vascular invasion were found in 76 caseswhile non-vascular invasion carcinomas in 29 cases. Seventycases had lymph node metastasis while 35 cases had nolymph node metastasis. Distant metastasis carcinomas werefound in 42 cases (liver metastasis 18 cases, peritoneummetastasis 24 cases) while no distant metastasis in 63 cases.Twenty control samples were collected from the samegastric mucosa 5 cm away from the carcinoma tissues.

Histological treatmentIn order to avoid the RNase contamination, all the glass slides,slide covers and stain containers were treated with 0.1%DEPC for 24 h. Gloves must be used when handling tissuecutting and 10% SDS was used to clean the cutter. All thesections were spread with 0.1% DEPC treated ddH2O.The tissues were cut into 5-7 µmol/L in thickness and keptat 4 ℃, and foil covered for HE stain, immunohisto-chemistry and in situ hybridization.

Reagents(1) bFGF probes: Digoxin label oligonucleotides bFGFprobes were from Boshide Biological Technology LimitedCompany, Wuhan, China, No. MK1054. The sequenceswere 5’-GCCGT CGGGG TGGAT GCGCA GGAAGAAGCC-3’; 5’-TTGAT AGACA CAACT CCTCT CTCTTCTGCT-3’; 5’-ACCGG TAAGT ATTGT AGTTA TTAGATTCCA-3’ (2) MMP-9 probes: Digoxin label nucleotidesMMP-9 probes were from Boshide Biological TechnologyLimited Company, Wuhan, China, No. MK1540. Thesequence were: 5’-TCCCT GCCCG AGACC GGTGAGCTGG ATAGC-3’; 5’-CAACT CGGCG GGAGA CTGTGCGTC TTCCC-3’; 5’-CCAGG TGGAC CAAGTGGGCT ACGTG ACCTA-3’ (3) Immunohistochemicalreagents: CD34 (mouse anti-human) and Sp kit were fromZhongshan Biotech Co., Beijing, China. The workingconcentration of CD34 was 1:100.

In situ hybridizationAll the slides, cover-slips and other containers wereautoclaved and treated with 0.1% DEPC ddH2O for 24 h.All the buffers ware also treated with 0.1% DEPC. The

tissues were routinely treated before in situ hybridization.DEPC (0.1%) treated ddH2O was used to spread out thesections, and the moderate temperature was used for dryingthe sections, gradient ethanol was used for dehydrationwith 3% H2O2 incubation for 10 min at room temperature.Digestion was enabled with pepsin at 37 ℃ for 20 min,0.5 mol/L PBS wash thrice at 5 min each, 20 mL hybridizationwas used for each group with Probes, sealed and incubatedat wet chamber for 20 h at 45 ℃. Then the slides werewashed with 2×SSC for 5 min×3 min, and followed by20 mL hybridization stabilization solution (2 mL A solution,18 mL B solution) at 45 ℃ for hours incubation at wetchamber. Post-hybridization washing was employed with2×SSC-0.05×SSC for 2 h, following which the slides wereblocked with normal serum at 37 ℃ for 30 min. Afterdirectly adding mouse-anti-digoxin antibody for 1 h at 37 ℃,slides were washed with 0.5 mol/L PBS for 5 min×3 min,then added SABC at 37 ℃ for 20 min and biotin-peroxidaseat 37 ℃ for 20 min. At last, the slides were washed with0.5 mol/L PBS for 5 min×3 min, stained with DAB for10 min and counter-stained with hematein for 8 min. Noprobes hybridization solution and RNase treated sampleserved as negative controls.

ImmunohistochemistrySP method was adopted according to the manual includingbriefly, paraffin sectioning, antigen recovering, 3% H2O2

treatment to block endogenous peroxidase, goat serum forblocking nonspecific reaction, 1st and 2nd antibodies followedby streptavidin conjugated to horseradish with DAB as thesubstrate. The negative is PBS used as the 1st antibody, andthe positive is from the kit.

Results evaluationThe cytoplasm of the bFGF and MMP-9mRNA appearedas brown in color. Two hundred cells were chosen undermicroscope to evaluate the stained cell number against thetotal cell number in the field. Based on the positive cellnumber, the criteria were set as follows: the negative (-)having the positive cell number <10% or without positivestaining (-); (+) having 11-50% positive cells; (++) having51-75% positive cells; and (+++) having >75% positivecells. The MVD was calculated in the carcinoma tissues asfollows: first find the clear area under microscope withendothelial cells and carcinoma cells, good backgroundcontrast; among the carcinoma cells, the brown color stainingsingle cell or endothelial cell plexus is considered as onevessel, then in ×200 fields, choose five unrepeated areas tocount the vessel number CD 34 positive vessels were usedas MVD expressed in mean±SD.

Statistical analysisStatistical evaluation was performed using 2 test or Fisher’sexact test to differentiate the rates of different groups, t-testwas used to analyze quantitative data, rank sum correlationwas analyzed with Spearman’s test. The survival rate wasestimated by the Kaplan-Meier method and analyzed bymeans of log-rank test. P<0.05 was considered statisticallysignificant. SPSS 11.0 software for windows was employedto analyze all the data.

Zhao ZS et al. bFGF mRNA and MMP-9 mRNA expressions of gastric carcinomas 3229

RESULTS

bFGF mRNA expression and its correlation with pathological

parameters of gastric carcinomaTwo (10%) of the 20 cases of non-cancer gastric mucosahad bFGF mRNA expression, and the light positive stainingwas mainly located in the cytoplasm of the epitheliumaround the neck area of gastric crypt, while 64 (61%) ofthe 105 cases of gastric carcinoma had positive expressionwith significant difference between the two groups(Figure 1, 2 = 9.25, P = 0.025), The carcinoma cells hadbrown staining in the cytoplasm and invaded the muscularlayer, peritoneum and greater omentum (Figure 1).According to the clinicopathological parameters of gastric

cancer progression, bFGFmRNA positive expression haddifferent expressions in the different stages of the gastriccarcinomas (Table 1). No correlation was found betweenbFGFmRNA positive expression and the histological typesof the carcinomas (rs = 0.134, P = 0.173), differentiation(rs = 0.096, P = 0.332).

MMP-9mRNA expression and its correlation with gastriccarcinoma pathological parametersAmong the 105 gastric carcinoma cases, 61 cases showedMMP-9mRNA positive expression cases where, accountingfor 58.1%, negative result was found in normal gastricmucosa. The early stage of gastric carcinomas had positiveMMP-9mRNA expression (Figure 2), and the positive

Table 1 Correlation of bFGF and MMP-9 mRNA expression and pathological parameters in 105 gastric carcinoma cases

bFGFmRNA MMP-9mRNAGroups n rs P rs P

– + ++ +++ – + ++ +++

Growth pattern 0.324 0.001 0.267 0.006

Expansive 48 27 8 8 5 27 12 9 0

Infiltrative 57 14 7 20 16 17 13 21 6

Invasive depth 0.211 0.031 0.335 0.001

T1–T2 44 31 5 5 3 26 11 6 1

T3–T4 61 10 10 23 18 18 14 24 5

Vessel invasion 0.579 0.001 0.209 0.032

Absent 29 25 2 2 0 17 7 4 1

Present 76 16 13 26 21 27 18 26 5

Lymph node metastasis 0.405 0.001 0.343 0.001

Absent 35 25 4 4 2 21 6 7 1

Present 70 16 11 24 19 23 19 23 5

Distant metastasis 0.474 0.001 0.468 0.001

Absent 63 37 14 8 4 40 9 10 4

Present 42 4 1 20 17 4 16 20 2

Figure 1 Expression of bFGFmRNA in gastric carcinoma tissues. A: Positiveexpression (+++) of bFGFmRNA in the plasma of gastric adenocarcinoma, ISH×250; B: Positive expression (++) of bFGFmRNA in the plasma of gastricadenocarcinoma, inf ilt rat ing stomach muscularis, ISH ×180; C : Posit ive

expression (++) of bFGFmRNA in the plasma of gastric adenocarcinoma,infiltrating greater omentum, ISH ×250; D: Negative expression of bFGF mRNAin normal gastric mucosa, ISH ×120.

A

C D

B

carcinoma cells were usually located near the edge of thecarcinoma filtration areas, and the involved greateromentum and peritoneum were usually positive in MMP-9mRNA expression (Figure 2). The correlation betweenMMP-9mRNA positive expression and the pathologicalparameters of gastric carcinoma is shown in Table 1. Nostatistical correlation was revealed between MMP-9mRNApositive expression and the carcinoma types (rs = 0.103,P = 0.145) and differentiation (rs = 0.102, P = 0.298).

Correlation of MVD with gastric carcinoma pathologicalparameters (Table 2 and Figure 3)

Table 2 MVD in different gastric carcinoma pathological param-eters (number/0.72 mm2, mean±SD)

Groups n MVD t P

Tumor differentiation 0.965 0.337

High-moderate 63 38.33±14.83

Low-undifferentiated 42 41.09±13.97

Growth pattern 10.105 0.001

Expansive 48 34.70±15.23

Infiltrative 57 43.42±12.64

Invasive depth 5.961 0.001

T1–T2 44 30.84±13.66

T3–T4 61 45.64±11.69

Vessel invasion 7.394 0.001

Absent 29 25.69±10.11

Present 76 44.68±12.33

Lymph node metastasis 3.819 0.01

Absent 35 27.07±11.33

Present 70 45.62±11.69

Distant metastasis 10.578 0.001

Absent 63 31.30±12.97

Present 42 52.19±6.42

Correlation of MVD with bFGFmRNA, MMP-9mRNA expression(Table 3 and Figure 3)

Table 3 Correlation of MVD with bFGFmRNA , MMP-9mRNA expres-sion in 105 cases of gastric cancer

Groups n MVD (number/0.72 mm2) t P

bFGFmRNA 3.207 0.002

+-+++ 64 46.09±11.52

- 41 29.41±12.47

MMP-mRNA 7.305 0.001

+-+++ 61 43.75±13.41

- 44 33.45±13.92

Correlation of bFGFmRNA and MMP-9mRNA expressionPositive correlation was observed between bFGFmRNAand MMP-9mRNA expression (rs = 0.298, P = 0.045).

Correlation of MVD, bFGF, and MMP-9mRNA expression withsurvival rate (Table 4 and Figure 4)

Table 4 Correlation of MVD, bFGF, and MMP-9mRNA expressionwith survival rate

Groups n Mean survival Five-year P time (mo) survival rate (%)

MVD 0.035

<39.5 67 70.42±5.82 63.30 (42/67)

≥39.5 38 18.57±3.76 16.95 (6/38)

bFGFmRNA 0.001

- 41 118.04±6.52 87.06 (38/41)

+-+++ 64 33.06±3.57 16.21 (10/64)

MMP-mRNA 0.002

- 44 107.28±7.20 81.82 (36/44)

+-+++ 61 42.42±8.25 16.02 (9/61)

Figure 2 Expression of MMP-9mRNA in gastric carcinoma tissues. A: Positiveexpression (+++) of MMP-9mRNA in the plasma of early gastric adenocarcinoma,ISH ×100; B: Positive expression (++) of MMP-9mRNA in the plasma of gastricadenocarcinoma, inf ilt rat ing stomach muscularis, ISH ×120; C : Posit ive

expression (++) of MMP-9mRNA in the plasma of gastric adenocarcinoma inperitoneum cancer nodule, ISH ×180; D: Negative expression of MMp-9mRNAin normal gastric mucosa, ISH ×180.

A

C D

B


DISCUSSIONCarcinoma angiogenesis is induced by some angiogenesisfactors secreted by the carcinoma cells. bFGF is a patentinducer for the mitosis of endothelial cells of vessels andincreases the chemiotaxis. Experiments confirmed that oncethe carcinoma reached 2 mm in diameter (>1 million cells),continued growth depends on the vascularization of thecarcinoma tissues to get fresh nutrients from the host, andthe newly formed vessels are infiltrative in nature[19-26]. Thenewly formed vessels make the basal membrane incomplete,forming broken spaces, and immature, resulting in carcinomacell metastasis. Our present study revealed that higherexpression of bFGF in carcinoma tissues than in the controlgastric mucosa correlated with the pathological parametersof the tumor. Positive correlation was observed betweenhigh expression of bFGF and short survival, indicating thatthe angiogenesis of carcinoma is positively correlated withthe malignant biological behaviors. Also, the positivecorrelation was found between bFGF expression and MVD,indicating that bFGF is one of the important angiogenesisfactors for angiogenesis of carcinoma. Our data also showedthat in the primary carcinoma tissues and stroma aroundthe carcinomas, the average MVD was 44.68 in the 76 casesof gastric carcinoma with vascular invasion, which was muchhigher than that without vascular invasion (25.69), indicatingthat angiogenesis of the carcinoma tissues is one of themain biological behaviors of the carcinomas. We have found

that bFGF is mainly distributed in the cytoplasm of thecarcinoma cells, indicating that the carcinoma cells cansecrete bFGF. Further experiments demonstrate that bFGFmay be transmitted through the following routes to invadethe vessels and metastasize: (1) promote the proliferationof the endothelial cells with faster blood supply to thecarcinoma tissues; (2) directly act on the carcinoma cellsand the cancer cell secretes all the enzymes to make themetastasis easy[27]; (3) bFGF-mediated basal membrane isimmature and deficient[28] with higher permeability, makingit possible for the carcinoma cells to shed off and metastasizeinto the blood system.

MMP-9 is one of the MMP members and plays animportant role in the degradation of extracellular matrix(ECM). However, the degradation of the basal membraneand matrix is important to immigration of the endothelialcells in the angiogenesis. We believe MMP is a key factor inthe carcinoma angiogenesis[29]. MMPs can degrade ECM,and participate in carcinoma angiogenesis. The carcinomaangiogenesis must degrade not only the basal membrane,but also the ECM. The carcinoma cells can secrete angiogenesisfactors such as bFGF, inducing the formation of MMPs.Our study indicated that MVD is high when MMP-9 mRNAwas positive. The infiltration and metastasis is accompaniedwith higher expression of MMP-9mRNA and higherangiogenesis capability. In our study, the non-cancer gastrictissue presented negative MMP-9 mRNA, but when the

Figure 3 Expression of CD34 protein in gastric carcinoma tissues. A: Positiveexpression of CD34 in vascular endothelial cells of gastric adenocarcinoma. SP

×400; B: NO neovascularization and negative expression of CD34 protein innormal gastric mucosa. SP ×280.

A B


Figure 4 Correlative studies on bFGF mRNA and MMP-9 mRNA expressionswith microvascular density, progression and prognosis of gastric carcinoma.A : Kaplan-Meier survival curves of groups with posit ive and negativebFGFmRNA expression in gastric adenocarcinoma (P<0.05); B: Kaplan-Meier

survival curves of groups with positive and negative MMP-9mRNA expressionin gastric adenocarcinoma (P<0.05); C: Kaplan-Meier survival curves of groupswith MVD ≥ 39.5 and MVD<39.5 in gastric adenocarcinoma (P<0.05).

Surv

ival ra

te (

%)

0 20 40 60 80 100 120 140 Time after surgery (mo)

1.2

1.0

0.8

0.6

0.4

0.2

0.0

bFGF mRNA (-)

bFGF mRNA (+)

Surv

ival ra

te (

%)


1.2

1.0

0.8

0.6

0.4

0.2

0.0

MMP-9 mRNA (-)

MMP-9 mRNA (+)

Surv

ival ra

te (

%)


1.2

1.0

0.8

0.6

0.4

0.2

0.0

MVD<39.5

MVD≥39.5

A CB

carcinoma metastasized into peritoneum and liver, MMP-9mRNA became more highly expressed than those withoutmetastasis. MVD was higher in 61 carcinoma cases withpositive MMP-9 mRNA expression than in the 41 caseswith negative MMP-9 mRNA, indicating that MMP-9mRNA correlated with MVD and MMP-9 induced carcinomaangiogenesis. MMP-9 positive expression is the basis ofcarcinoma infiltration and metastasis. All these showed thatMMP-9mRNA positive expression correlated not only withthe filtration, but also with the degradation of ECM barrierto invade blood vessels and metastasis, and MMP-9 can beused as a marker of carcinoma metastasis and prognosis.

The solid carcinoma growth reached silent state whenits diameter reached 1.0-2.0 mm, when the growth and deathof the carcinoma cells reached a balanced state. But whenthe angiogenesis begins, the carcinoma cells grow unlimitedly,the blood vessels provided the nutrients that the carcinomacells need, which resulted in the faster infiltration andmetastasis. Our study showed that MVD was positivelycorrelated with carcinoma infiltrative growth, metastasis tothe muscular layers, lymph nodes, liver, and peritoneum,indicating the infiltration and metastasis are related toangiogenesis. MVD can be used as an prognosis markerwhich corresponded to the study of Tomanek[30]. We alsofound the positive correlation between bFGFmRNA andMMP-9mRNA in gastric carcinoma tissues, both promotingcarcinoma angiogenesis. That is, bFGF promotes angiogenesiswhile the endothelial cells secret enzymes such as MMP topromote metastasis.

The Kaplan-Meier survival curve was drawn andlog-rank test indicated that bFGF and MMP-9 positiveexpression was different from negative expression. No reporthas been seen as to the relationship between bFGF, MMP-9,and MVD and gastric carcinoma prognosis. The 41bFGFmRNA negative cases in our study showed that themean survival rate was longer than that of 64 positive cases.Statistical difference was revealed in the five-year survivalrate between the two groups. The 44 MMP-9 mRNA negativecarcinoma cases had longer survival rate than the 61 MMP-9mRNA positive cases, indicating that bFGF and MMP-9mRNA positive expression and MVD value ≥39.5 will resultin worse prognosis and can be used as an independentprognosis marker.

REFERENCES1 Poon RT, Ng IO, Lau C, Yu WC, Fan ST, Wong J. Correlation

of serum basic fibroblast growth factor levels with clinico-

pathologic features and postoperative recurrence in hepato-

cellular carcinoma. Am J Surg 2001; 182: 298-3042 Chao Y, Li CP, Chau GY, Chen CP, King KL, Lui WY, Yen SH,

Chang FY, Chan WK, Lee SD. Prognostic significance of vas-

cular endothelial growth factor, basic fibroblast growth factor,and angiogenin in patients with resectable hepatocellular car-

cinoma after surgery. Ann Surg Oncol 2003; 10: 355-362

3 El-Assal ON, Yamanoi A, Ono T, Kohno H, Nagasue N. Theclinicopathological significance of heparanase and basic fi-

broblast growth factor expressions in hepatocellular

carcinoma. Clin Cancer Res 2001; 7: 1299-13054 Rasmuson T, Grankvist K, Jacobsen J, Ljungberg B. Impact

of serum basic fibroblast growth factor on prognosis in hu-

man renal cell carcinoma. Eur J Cancer 2001; 37: 2199-22035 Ruotsalainen T, Joensuu H, Mattson K, Salven P. High

pretreatment serum concentration of basic fibroblast growth

factor is a predictor of poor prognosis in small cell lung cancer.

Cancer Epidemiol Biomarkers Prev 2002; 11: 1492-14956 Bentas W, Beecken WD, Glienke W, Binder J, Schuldes H.

Serum levels of basic fibroblast growth factor reflect dissemi-

nated disease in patients with testicular germ cell tumors.Urol Res 2003; 30: 390-393

7 Sezer O, Jakob C, Eucker J, Niemoller K, Gatz F, Wernecke K,

Possinger K. Serum levels of the angiogenic cytokines basicfibroblast growth factor (bFGF), vascular endothelial growth

factor (VEGF) and hepatocyte growth factor (HGF) in mul-

tiple myeloma. Eur J Haematol 2001; 66: 83-888 Ria R, Loverro G, Vacca A, Ribatti D, Cormio G, Roccaro

AM, Selvaggi L. Angiogenesis extent and expression of ma-

trix metalloproteinase-2 and -9 agree with progression of ova-rian endometriomas. Eur J Clin Invest 2002; 32: 199-206

9 Guo W, Chen G, Zhu C, Wang H. Expression of matrix

metalloproteinase-2, 9 and it’s tissue inhibitor-1, 2 in endome-trial carcinoma .Zhonghua Fuchanke Zazhi 2002; 37: 604-607

1 0 Zhang Y, Wu XH, Cao GH, Li S. Relationship between ex-

pression of matrix metalloproteinase-9 (MMP-9) and angio-genesis in renal cell carcinoma. Aizheng 2004; 23: 326-329

1 1 Ribatti D, Surico G, Vacca A, De Leonardis F, Lastilla G,

Montaldo PG, Rigillo N, Ponzoni M. Angiogenesis extent andexpression of matrix metalloproteinase-2 and -9 correlate with

progression in human neuroblastoma. Life Sci 2001; 68: 1161-

11681 2 Albo D, Shinohara T, Tuszynski GP. Up-regulation of matrix

metalloproteinase 9 by thrombospondin 1 in gastric cancer. J

Surg Res 2002; 108: 51-601 3 Nagakawa Y, Aoki T, Kasuya K, Tsuchida A, Koyanagi Y.

Histologic features of venous invasion, expression of vascu-

lar endothelial growth factor and matrix metalloproteinase-2and matrix metalloproteinase-9, and the relation with liver

metastasis in pancreatic cancer. Pancreas 2002; 24: 169-178

1 4 Yabushita H, Shimazu M, Noguchi M, Kishida T, NarumiyaH, Sawaguchi K, Noguchi M. Vascular endothelial growth

factor activating matrix metalloproteinase in ascitic fluid

during peritoneal dissemination of ovarian cancer. Oncol Rep2003; 10 : 89-95

1 5 Cai H, Kong ZR, Chen HM. Matrix metalloproteinase-2 and

angiogenesis in gastric cancer. Aizheng 2002; 21: 25-281 6 Olewniczak S, Chosia M, Kolodziej B, Kwas A, Kram A,

Domagala W. Angiogenesis as determined by computerised

image analysis and the risk of early relapse in women withinvasive ductal breast carcinoma. Pol J Pathol 2003; 54: 53-59

1 7 Offersen BV, Borre M, Overgaard J. Quantification of angio-

genesis as a prognostic marker in human carcinomas: a criti-cal evaluation of histopathological methods for estimation of

vascular density. Eur J Cancer 2003; 39: 881-890

1 8 van Hinsbergh VW, Collen A, Koolwijk P. Role of fibrin ma-trix in angiogenesis. Ann N Y Acad Sci 2001; 936: 426-437

1 9 Keyes KA, Mann L, Cox K, Treadway P, Iversen P, Chen YF,

Teicher BA. Circulating angiogenic growth factor levels inmice bearing human tumors using Luminex Multiplex

technology. Cancer Chemother Pharmacol 2003; 51: 321-327

2 0 Guo ZH, Mei H, Huang J, Li SY. Vascular endothelial growthfactor (VEGF) and basic fibroblast growth factor (bFGF) ex-

pression in superficial transitional cell bladder carcinoma.

Aizheng 2003; 22 : 307-3092 1 Pavlakovic H, Havers W, Schweigerer L. Multiple angiogen-

esis stimulators in a single malignancy: implications for anti-

angiogenic tumour therapy. Angiogenesis 2001; 4: 259-2622 2 Straume O, Akslen LA. Importance of vascular phenotype

by basic fibroblast growth factor, and influence of the angio-

genic factors basic fibroblast growth factor/fibroblast growthfactor receptor-1 and ephrin-A1/EphA2 on melanoma

progression. Am J Pathol 2002; 160: 1009-1019

2 3 Davidson B, Goldberg I, Kopolovic J, Gotlieb WH, Givant-Horwitz V, Nesland JM, Berner A, Ben-Baruch G, Bryne M,

Reich R. Expression of angiogenesis-related genes in ovarian

carcinoma-a clinicopathologic study. Clin Exp Metastasis 2000;


18 : 501-507

2 4 Li Z, Shimada Y, Uchida S, Maeda M, Kawabe A, Mori A,

Itami A, Kano M, Watanabe G, Imamura M. TGF-alpha as

well as VEGF, PD-ECGF and bFGF contribute to angiogenesis

of esophageal squamous cell carcinoma. Int J Oncol 2000; 17:

453-460

2 5 Yoshiji H, Kuriyama S, Yoshii J, Ikenaka Y, Noguchi R, Hicklin

DJ, Huber J, Nakatani T, Tsujinoue H, Yanase K, Imazu H,

Fukui H. Synergistic effect of basic fibroblast growth factor

and vascular endothelial growth factor in murine hepatocel-

lular carcinoma. Hepatology 2002; 35: 834-842

2 6 Sugamoto T, Tanji N, Sato K, Fujita H, Nishio S, Sakanaka

M, Yokoyama M. The expression of basic fibroblast growth

factor and vascular endothelial growth factor in prostatic

adenocarcinoma: correlation with neovascularization. Anti-cancer Res 2001; 21: 77-88

2 7 Komorowski J, Pasieka Z, Jankiewicz-Wika J, Stepien H.Matrix metalloproteinases, tissue inhibitors of matrixmetalloproteinases and angiogenic cytokines in peripheralblood of patients with thyroid cancer. Thyroid 2002; 12: 655-662

2 8 Riedel F, Gotte K, Schwalb J, Bergler W, Hormann K. Expres-sion of 92-kDa type IV collagenase correlates with angiogenicmarkers and poor survival in head and neck squamous cellcarcinoma. Int J Oncol 2000; 17: 1099-1105

2 9 Fidler IJ. Angiogenesis and cancer metastasis. Cancer J 2000;6 Suppl 2: S134-S141

3 0 Tomanek RJ, Schatteman GC. Angiogenesis: new insightsand therapeutic potential. Anat Rec 2000; 261: 126-135




Relationship between Epstein-Barr virus-encoded proteins with

cell proliferation, apoptosis, and apoptosis-related proteins in

gastric carcinoma

Yun Wang, Bing Luo, Li-Ping Yan, Bao-Hua Huang, Peng Zhao

EL SEVIER




Yun Wang, Bing Luo, Li-Ping Yan, Department of Microbiology,Qingdao University Medical College, Qingdao 266021, ShandongProvince, ChinaBao-Hua Huang, Department of Oncology, Yantai YuhuangdingHospital, Yantai 264002, Shandong Province, ChinaPeng Zhao, Department of Pathology, Affiliated Hospital ofQingdao University Medical College, Qingdao 266003, ShandongProvince, ChinaCorrespondence to: Professor Bing Luo, Department ofMicrobiology, Qingdao University Medical College, Number 38 ofDengzhou Road, Qingdao 266021, Shandong Province,China. [email protected]: +86-532-3812423 Fax: +86-532-3812423Received: 2004-07-12 Accepted: 2004-09-19

Abstract

AIM: To investigate the interrelationship between Epstein-Barr virus (EBV)-encoded proteins and cell proliferation,apoptosis and apoptosis-related proteins in gastric carcinoma,and to explore their role in gastric carcinogenesis.

METHODS: Tissues from 13 cases of EBV-associatedgastric carcinoma (EBVaGC) and 45 cases of matchedEBV-negative gastric carcinoma (EBVnGC) were collected,and then subjected to analysis for apoptotic index (AI)using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end-labeling (TUNEL) assay.Nuclear cell proliferation-associated antigen ki-67 index(KI), bcl-2, and p53 expression were examined byimmunohistochemistry. p53 mutation in exons 5-8 of 13EBVaGC cases was determined by single-strand conformationpolymorphism (SSCP) and DNA sequencing. RT-PCR andSouthern hybridization were used to detect the expressionof nuclear antigens (EBNAs) 1 and 2, latent membraneprotein (LMP) 1, immediately early gene BZLF1 and earlygenes BARF1 and BHRF1 in 13 EBVaGC cases.

RESULTS: The percentage of AI, KI and p53 overexpressionwas significantly lower in the EBVaGC group than in theEBVnGC group. However, bcl-2 expression did not showsignificant difference between the two groups. p53 genemutations were not found in 13 EBVaGCs. Transcripts ofEBNA1 were detected in all 13 EBVaGCs, while both EBNA2and LMP1 mRNA were not detected. Six of the thirteencases exhibited BZLF1 transcripts and two exhibited BHRF1transcripts. BARF1 mRNA was detected in six cases.

CONCLUSION: Lower AI and KI may reflect a low biologicalactivity in EBVaGC. EBV infection is associated with p53

abnormal expression but not bcl-2 protein in EBVaGC.BZLF1, BARF1, and BHRF1 may play important roles ininhibiting cell apoptosis and tumorigenesis of EBVaGCthrough different pathways.


Key words: Epstein-Barr virus; Gastric carcinoma; Apoptosis;Bcl-2; p53; Ki-67

Wang Y, Luo B, Yan LP, Huang BH, Zhao P. Relationshipbetween Epstein-Barr virus-encoded proteins with cellproliferation, apoptosis and apoptosis-related proteins in gastriccarcinoma. World J Gastroenterol 2005; 11(21): 3234-3239


INTRODUCTION

The correlation between Epstein-Barr virus (EBV) infectionand gastric carcinoma is well known. EBV infection is foundin 2-16% of ordinary gastric adenocarcinoma cases and80-100% gastric lymphoepithelioma-like carcinoma cases[1-4].However, the pathogenic role of EBV in gastric carcinogenesisremains to be elucidated. Recent studies have shown thatthe form and expression of EBV encoded genes in gastriccarcinoma are different from those in Burkitt’s lymphomaand nasopharyngeal carcinoma (NPC), suggesting that theoncogenic mechanism of EBV in gastric carcinoma maybe unique[5,6]. In this study, we checked the expression ofEBV-encoded genes in EBV-associated gastric carcinoma(EBVaGC) and compared cell proliferation and apoptosisand expression of apoptosis-related proteins (bcl-2 and p53)in EBVaGC with those of matched EBV-negative gastriccarcinoma (EBVnGC). Our aim was to investigate therelationship between EBV-encoded proteins with cellproliferation and apoptosis and apoptosis-related proteinsin gastric carcinoma, which might facilitate the understandingof gastric carcinogenesis.


Specimens and casesBetween January 2001 and December 2002, 185 surgicallyresected specimens of gastric carcinoma were collected fromthe Affiliated Hospital of Qingdao University Medical College,Qingdao Municipal Hospital and Yantai YuhuangdingHospital. Tumor tissues from each surgical specimen were

separately dissected. DNA was extracted by the standardproteinase K-sodium dodecyl sulfate (SDS) method andpurified with phenol-chloroform. Total RNA was extractedwith TRIzol reagent (Gibco BRL, Gaithersburg, MD, USA)according to the manufacturer’s instructions. The sectionswere used for histopathological diagnosis, in situ hybridization(ISH), immunohistochemical and TUNEL analysis. Thecases positive for EBV DNA by PCR-Southern assay werefurther confirmed by ISH for EBER1 as previouslydescribed[4,5,7]. The cases having EBER1 positive signals wereclassified as EBVaGC group. EBVnGC cases with similarclinicopathological data were chosen as the control group.

RT-PCR and Southern hybridization analysis for EBV genesexpressionThe sequence and genome coordinate of primers and probesused to detect EBV transcripts are given in Table 1[5,7-9].The probes were labeled with DIG-ddUTP by DIGoligonucleotide 3’-end labeling kit (Roche Diagnostics,Germany). Approximately 1 g RNA (treated withDNAase I) of EBV-positive samples was subjected to cDNAsynthesis with reverse transcription system (Promega, USA).PCR was performed as described previously[5]. The amplifiedproducts were electrophoresed in 2% agarose gel, transferredonto a Hybond N+ nylon membrane (Amersham PharmaciaBiotec, Ireland) and subjected to hybridization with 3’-end-DIG-labeled oligonucleotide probes. The hybridized signalswere detected by alkaline phosphatase (AP) conjugated anti-DIG antibodies. The substrate of AP was CSPD (RocheDiagnostics, Germany). cDNAs from EBV-immortalizedlymphoblastoid cell lines (LCL) were used as positive controls,and those from EBV-negative Ramos cells as negativecontrols. The integrity of RNA was checked by parallelamplification of endogenous control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.

Detection of cell apoptosis by TUNEL assayIn order to observe cell apoptosis, paraffin embeddedsections of tissues from EBVaGC cases and EBVnGC cases

were checked by TUNEL assay with the Apop-TagTM

peroxidase kit (Zhongshan Biotechnology Company,Beijing). Cell apoptosis was determined using the definedmorphological criteria[10,11]. TUNEL signals were detectedin nuclei of carcinoma cells with brown staining. Apoptoticindex (AI) was determined as the percentage of TUNEL-positive carcinoma cells in comparison with the totalnumber of carcinoma cells in each specimen. Microscopicmagnification was 10×40. At least 1 000 tumor cells from10 randomly selected fields were quantified.

ImmunohistochemistryParaffin embedded sections of tissues from EBVaGC casesand EBVnGC cases were immunostained by the standardstreptavidin-biotin-peroxidase method. The primary antibodies,Do-7, sc-7382 and Ki-S35 (Santa Cruz Biotechnology, Inc.),were anti-human mouse monoclonal antibodies against p53,bcl-2 and ki-67, respectively. Phosphate buffered saline(PBS), instead of the primary antibody, was used for negativecontrol sections. The sections of breast carcinoma tissuewith highly expressed p53 served as the positive control forp53 staining while the sections of tonsil tissue expressingboth bcl-2 and ki-67 were used as positive control for bcl-2and ki-67. The percentage of positively stained tumorcells in each tumor section was evaluated by counting atleast 1 000 cells in 10 randomly selected high-power fields.Brown staining for p53 and ki-67 was located in nuclei,staining for bcl-2 protein was located in cytoplasm. Thesection was considered as expressing the protein if cellularstaining was ≥5%[11,12]. p53 positivity was divided into twogrades: 5-50% positive cells (+) as lower expression, 50-100%positive cells (++) as overexpression. Ki-67 index (KI) wasobtained as the percentage of ki-67-positive carcinoma cellsin comparison with the total number of carcinoma cells ineach specimen[10].

p53 mutation analysis by SSCP and DNA sequencingp53 mutations were deter mined by single-strandconformation polymorphism (SSCP) analysis with primers

Table 1 Sequence and co-ordinate of primers and probes for RT-PCR analysis

Transcript Oligonucleotide sequence (5’-3’) Product size (bp) Genome coordinate

EBNA1 5’ primer GATGAGCGTTTGGGAGAGCTGATTCTGCA 273 67 510-67 539

3’ primer TCCTCGTCCATGGTTATCAC 108 075-108 056

probe AGACCTGGGAGCAGATTCAC 67 608-67 627

EBNA2 5’ primer GCTGCTACGCATTAGAGACC 339 47 892-47 911

3’ primer TCCTGGTAGGGATTCGAGGG 48 616-48 597

probe CAGCACTGGCGTGTGACGTGGTGTAAGTT 48 391-48 420

LMP1 5’ primer TCCTCCTCTTGGCGCTACTG 490 169 383-169 364

3’ primer TCATCACTGTGTCGTTGTCC 168 740-168 759

probe GAACAGCACAATTCCAAGGAACAATGCCTG 169 061-169 090

BZLF1 5’ primer ATTGCACCTTGCCGCCACCTTTG 608 103 194-103 180

3’ primer CGGCATTTTCTGGAAGCCACCCGA 102 486-102 463

probe CACTGCTGCTGCTGTTTGAACAGT 102 772-102 795

BARF1 5’ primer GGCTGTCACCGCTTTCTTGG 203 165 560-165 579

3’ primer AGGTGTTGGCACTTCTGTGG 165 762-165 743

probe CTGGTTTAAACTGGGCCCAGGAGAGGAGCA 165 644-165 673

BHRF1 5’ primer GTCAAGGTTTCGTCTGTGTG 211 53 830-53 849

3’ primer TTCTCTTGCTGCTAGCTCCA 54 480-54 461

probe ATGCACACGACTGTCCCGTATACAC 54 435-54 411

Wang Y et al. EBV, AI, KI, bcl-2, and p53 in gastric carcinoma 3235

of exons 5-8[13]. Samples with putative mutations wereconfirmed by DNA sequencing.

Statistical analysisQualitative data were analyzed by 2 test or the Fisher’sexact test (two-tail). Quantificative data were expressed asmean±SD and compared between the two groups byStudent’s t-test or t’-test. P <0.05 was considered statisticallysignificant. Software SAS 6.12 was employed to processthe data.

RESULTS

Clinicopathological features of EBVaGC and EBVnGCThere were 13 cases of EBVaGC among 185 cases of gastriccarcinoma (7.03%), 45 cases of EBVnGC with similarclinicopathological data were chosen as the control group.No statistical difference was found in age, sex, tumor location,histological subtype, stage, or lymph node metastasis betweenthe two groups (Table 2).

Table 2 Comparison of clinicopathological data between EBVaGCand EBVnGC patients

EBVaGC EBVnGC P (n = 13) (n = 45)

Age (yr) (mean±SD)1 59.76±10.17 57.31±14.05 0.5613 (t = 0.5844)

Sex

Male 13 35 0.1466 (2 = 2.1070)

Female 0 10

Tumor location

Cardia/body 9 21 0.1516 (2 = 2.0566)

Antrum 4 24

Histological subtype

Adenocarcinoma 12 41 0.6704 (2 = 0.1811)

Signet ring carcinoma 1 4

Tumor differentiation

Moderate 1 7 0.7890 (2 = 0.0716)

Poor 12 38


Present 10 33 0.9999 (2 = 0.0098)

Absent 3 12

Tumor stage2

Early 0 1 1.0000

Advanced 13 44

1Age was compared using Student’s t test; 2Tumor stage was compared using two-

tailed Fisher’s exact test; the remainders, using 2-test.

Expression of EBV-associated genes in EBVaGCWe investigated the expression of EBV-associated genes in13 EBVaGC cases by RT-PCR and Southern hybridizationanalysis (Figure 1). The transcripts of EBNA1 were detectedin all 13 cases, while both EBNA2 and LMP1 mRNA werenot detected. Six of the thirteen cases exhibited BZLF1transcripts and two exhibited BHRF1 transcripts. BARF1mRNA was detected in six cases. GAPDH mRNA wasamplified to check pertinent RNA extraction. The resultshowed that the RNA was integrity.

TUNEL for apoptosis and immunohistochemisty of ki-67, p53,

and bcl-2Cell apoptosis by TUNEL and immunostaining of ki-67,p53, and bcl-2 are shown in Figure 2. Both the mean valuesof AI and KI were significantly lower in the EBVaGC groupthan in the EBVnGC group (Table 3). The bcl-2 and p53expression was 53.9% (7/13) and 84.6% (11/13), and p53overexpression was15.4% (2/13) in EBVaGC group, whilethey were 48.9 (22/45), 86.7% (39/45), and 57.8% (26/45)respectively in EBVnGC group. The difference in p53overexpression between EBVaGC and EBVnGC wassignificant. However the difference in bcl-2 and p53 expressionbetween the two groups was not significant (Table 4).

p53 gene mutationsNo mutation of p53 gene from exons 5-8 in tissues of 13EBVaGC cases was detected by PCR-SSCP and DNAsequencing analysis.

Figure 1 Detection of EBV-associated gene expression by RT-PCR andSouthern hybridization in EBVaGC. M: DIG-labeled DNA molecular weight markerVIII (Roche); lane 1: EBV-positive LCL (positive control); lane 2: EBV-negativeRamos cells (negative control); lanes 3-13: EBV-positive gastric carcinomasamples.

M 1 2 3 4 5 6 7 8 9 10 11 12 13

←608 bp BZLF1

←203 bp BARF1

←211 bp BHRF1

←273 bp EBNA1

←339 bp EBNA2

←490 bp LMP1

←450 bp GAPDH

bp1 114→

900→682→501→404→320→242→190→

bp1 114→

900→682→501→404→320→242→190→

bp1 114→

900→682→501→404→320→242→190→147→124→

bp1 114→

900→682→501→404→320→242→190→147→124→

bp1 114→

900→682→501→404→320→242→190→

bp1 114→

900→682→501→404→320→242→190→147→124→


Table 3 Apoptotic index and ki-67 index in EBVaGC and EBVnGC(mean±SD)

AI KI

EBVaGCs (n = 13) 0.97±0.411 28.25±6.282

EBVnGCs (n = 45) 2.03±0.60 37.86±14.52

1t = 5.9795, P = 0.00001<0.01; 2t’ = 3.4579, P = 0.0012<0.01.

Table 4 bcl-2 and p53 expression in EBVaGC and EBVnGC

bcl-2 p53 p53expression overexpression

n+ – + – + –

EBVaGC 13 7 6 11 2 2 11

EBVnGC 45 22 23 39 6 26 19

2 0.0991 0.0716 7.2593

P value 0.7529 0.7912 0.0085

DISCUSSION

EBV is encountered in a subset of tumors but its role ingastric carcinogenesis is not quite understood. Several invivo studies explored the mechanisms by which EBV mightcontribute to gastric carcinogenesis[10,11,14-17]. Methylation iscurrently regarded as an alternative mechanism for silencingtumor suppressor genes. In a recent publication morefrequent CpG islands methylation were found in EBV-positive gastric carcinomas than EBV-negative carcinomas,suggesting that aberrant methylation might be an importantmechanism of EBV-related gastric carcinogenesis[14]. Otherstudies focused on the relationship between EBV andoncogenes or tumor suppressor genes in EBVaGC, but noconclusive results have been reported[10-12,16,17]. In this study,

EBVaGC had a lower rate of p53 overexpression thanEBVnGC, indicating that abnormal p53 expression isassociated with EBV infection. However, bcl-2 expressiondid not correlate with the presence of EBV in EBVaGC. Inaddition, the low rate of cell apoptosis and proliferationmay reflect a low biological activity in EBVaGC. The resultsare inconsistent with previous studies[11,16,17]. For example,Kume et al[16], found no correlation between p53 and EBVinfection, but found a lower rate of cell apoptosis and higherbcl-2 expression in EBVaGC compared to EBVnGC,suggesting that bcl-2 protein is the main inhibitor ofapoptosis in EBVaGC. Ishii et al[11], studied cell apoptosis,bcl-2, and p53 expression in early and advanced stage ofEBVaGC and EBVnGC, and found p53 overexpression inEBVaGC is significantly lower than in EBVnGC at earlystage. Cell apoptosis and bcl-2 expression between twogroups have no significant difference at advanced and earlystages. No correlation between bcl-2 and p53 expressionand presence of EBV is found in other study[17].

Some in vitro studies have shown that EBV-encodedproteins during different replication phase play different rolesin regulating cell cycle and inhibiting cell apoptosis, whichincludes LMP1, EBNA, BZLF1, BHRF1, and BARF1[18-22].EBV-encoded proteins can interact with various kinds ofcell regulation factors, making regulation mechanism verycomplicated. EBNA and LMP1 are the essential genes forcell transformation. LMP1 can induce expression of bcl-2and block p53-mediated apoptosis through the inductionof A20 gene in vitro[18,23]. EBV nuclear antigen leader proteins(EBNA-LP) and EBNA2 are the earliest expressed proteinsin EBV-immortalized lymphoblastoid cells, and activate cellcycle by inducing transcription of cyclin D2 and promotingthe induction of bcl-2 expression by LMP1[19,24]. Our studyand other studies failed to detect LMP1 and EBNA2 mRNA

Figure 2 TUNEL for Cell apoptosis and immunohistochemistry of p53, bcl-2,and ki-67. A: Apoptotic cells; B: Expression of p53; C: Expression of bcl-2; D:

Expression of ki-67. (Original magnification ×400).

A

C D

B


in EBVaGC[5-7], suggesting that LMP1 and EBNA2 maynot be essential for tumor formation and not related withcell proliferation and apoptosis, bcl-2, and p53 expressionin EBVaGC.

p53 protein is known as a tumor suppressor. The wild-type p53 controls cell proliferation and survival by inducingG1/G2 cell cycle arrest and apoptosis. p53 abnormalitiesplay a critical role in oncogenesis. Several studies showedthat EBV-encoding proteins EBNA5 and BZLF1 can bindto p53, possibly resulting in increased p53 half-life andinterference with p53 function[25,26]. BZLF1 regulates p53function through multiple mechanisms in vitro. For example,BZLF1 increases the level of cellular p53 by activating p53transcription. However, BZLF1 can inhibit the function ofp53 by preventing induction of p53-dependent cellulartarget genes, such as p21 and MDM2[27,28]. In the presentstudy, p53 overexpression was lower in EBVaGC thanin EBVnGC. Most EBVaGC cases showed a weak p53expression, but most EBVnGC cases showed strongexpression. Some previous studies also found lower levelexpression of p53 in EBVaGC than in EBVnGC[12,29],suggesting that the mechanism of p53 abnormal expressionin EBVaGC is different from that in EBVnGC. No p53mutation was detected in 13 EBVaGC cases. However,six cases exhibited BZLF1 mRNA, indicating the p53accumulation in EBVaGC might not be a consequence ofmutation but a manifestation of upregulation on p53 byEBV protein such as BZLF1. This viewpoint has beenproposed as an explanation for the overexpression of p53in nasopharyngeal carcinomas in which p53 gene mutationis uncommon[30,31]. Very few papers reported that p53 is notinactivated by EBV[29,32]. van Rees et al[32], found an inversecorrelation between EBV positivity and loss of heterozygosity(LOH) at chromosomal arm 17p, and also none of theEBV-positive carcinomas showing p53 immunopositivityin contrast to 39% of EBV-negative carcinomas (P<0.01),indicating that p53 is not or differently inactivated in EBV-related gastric carcinoma. It is conceivable that bindingwith EBV proteins, instead of genetic alteration of p53gene, lead to an accelerated degradation of p53 protein.Further analysis of EBVnGC is needed to identify whetheroverexpression of p53 is mutated or is derived from otherpathways.

bcl-2 is a protein best known for its suppression ofapoptosis. In vitro studies have shown that LMP1 andEBNA2 can induce bcl-2 expression, but clinical studieshave failed to confirm this mechanism in vivo[11,17,30,33]. Ourstudy of gastric carcinoma showed that bcl-2 expressiondid not appear to correlate with the presence of EBV orviral LMP1 and EBNA2 expression. The possible explanationsare as follows. bcl-2 expression may not be necessary forcancer cells in vivo as indicated by in vitro experiments. bcl-2might localize at different cellular organelles in cancerdevelopment, which makes it undetectable by lightmicroscopy. It is the balance between anti-apoptic and pro-apoptic members of the bcl-2 family that determine theoutcome. Therefore, it may be necessary to carry out furtherstudies to detect the expression of bcl-2-related proteins[11].Early gene BHRF1 shows partial sequence homologous tothe human bcl-2 proto-oncogene, which is involved in

inhibiting cell apoptosis. BHRF1 protein can inhibitapoptosis of B lymphocytes and epithelial cells and promotecell growth and transformation[21,34]. BARF1 shareshomology with the cellular proto-oncogene c-fms and isable to immortalize epithelial cells and fibroblast cells andB lymphocyte in vitro[6,35,36]. Furthermore, it can activate theexpression of bcl-2[22]. We demonstrated that six of 13EBVaGC cases exhibited BARF1 mRNA and two exhibitedBHRF1 mRNA. Zur Hausen et al[6], also detected nineBARF1-positive cases and two BHRF1-positive cases in 10EBV-related gastric adenocarcinomas. Because EBVaGClacks the expression of LMP1[5-7], BARF1, and BHRF1might provide an alternative way for the pathogenesis ofEBVaGC independent of LMP1.

In summary, this study showed that the mechanism bywhich EBV inhibits cell apoptosis is not through the inductionof bcl-2 expression by EBNA2 or LMP1. BZLF1, BARF1and BHRF1 may play important roles in inhibiting cellapoptosis and tumorigenesis of EBVaGC through differentpathways.

REFERENCES1 Wu MS, Shun CT, Wu CC, Hsu TY, Lin MT, Chang MC,

Wang HP, Lin JT. Epstein-Barr virus-associated gastric

carcinomas: relation to H pylori infection and geneticalterations. Gastroenterology 2000; 118: 1031-1038

2 Lee MA, Hong YS, Kang JH, Lee KS, You JY, Lee KY, Park

CH. Detection of Epstein-Barr virus by PCR and expressionof LMP1, p53, CD44 in gastric cancer. Korean J Intern Med

2004; 19 : 43-47

3 Andal N, Shanthi P, Krishnan KB, Taralaxmi V. The Epstein-

Barr virus and gastric carcinoma. Indian J Pathol Microbiol2003; 46 : 34-36

4 Wang Y, Luo B, Wang XF, Yan LP. Detection of Epstein-Barr

virus (EBV) and expression of EBV lytic genes in EBV-posi-tive gastric carcinomas. Zhongguo Aizheng Zazhi 2004; 3: 217-

221

5 Hoshikawa Y, Satoh Y, Murakami M, Maeta M, Kaibara N,Ito H, Kurata T, Sairenji T. Evidence of lytic infection of

Epstein-Barr virus (EBV) in EBV-positive gastric carcinoma.

J Med Virol 2002; 66: 351-3596 zur Hausen A, Brink AA, Craanen ME, Middeldorp JM, Meijer

CJ, van den Brule AJ. Unique transcription pattern of Epstein-

Barr virus (EBV) in EBV-carrying gastric adenocarcinomas:expression of the transforming BARF1 gene. Cancer Res 2000;

60 : 2745-2748

7 Sugiura M, Imai S, Tokunaga M, Koizumi S, Uchizawa M,Okamoto K, Osato T. Transcriptional analysis of Epstein-

Barr virus gene expression in EBV-positive gastric carcinoma:

unique viral latency in the tumour cells. Br J Cancer 1996; 74:625-631

8 Oudejans JJ, van den Brule AJ, Jiwa NM, de Bruin PC,

Ossenkoppele GJ, van der Valk P, Walboomers JM, Meijer CJ.BHRF1, the Epstein-Barr virus (EBV) homologue of the BCL-

2 protooncogene, is transcribed in EBV-associated B-cell lym-

phomas and in reactive lymphocytes. Blood 1995; 86: 1893-1902

9 Kelleher CA, Paterson RK, Dreyfus DH, Streib JE, Xu JW,

Takase K, Jones JF, Gelfand EW. Epstein-Barr virus replica-tive gene transcription during de novo infection of human

thymocytes: simultaneous early expression of BZLF-1 and its

repressor RAZ. Virology 1995; 208: 685-6951 0 Ohfuji S, Osaki M, Tsujitani S, Ikeguchi M, Sairenji T, Ito H.

Low frequency of apoptosis in Epstein-Barr virus-associated

gastric carcinoma with lymphoid stroma. Int J Cancer 1996;68 : 710-715

1 1 Ishii H, Gobe G, Kawakubo Y, Sato Y, Ebihara Y. Interrela-


tionship between Epstein-Barr virus infection in gastric carci-

nomas and the expression of apoptosis-associated proteins.Histopathology 2001; 38: 111-119

1 2 Leung SY, Chau KY, Yuen ST, Chu KM, Branicki FJ, Chung

LP. p53 overexpression is different in Epstein-Barr virus-as-sociated and Epstein-Barr virus-negative carcinoma. Histo-

pathology 1998; 33: 311-317

1 3 Chan WY, Chan EK, Chow JH. Epstein-Barr virus-associatedgastric lymphomas are distinct from mucosa-associated lym-

phoid tissue-type lymphomas: genetic abnormalities of p53

gene. Diagn Mol Pathol 2001; 10: 153-1601 4 Kang GH, Lee S, Kim WH, Lee HW, Kim JC, Rhyu MG, Ro JY.

Epstein-barr virus-positive gastric carcinoma demonstrates

frequent aberrant methylation of multiple genes and consti-tutes CpG island methylator phenotype-positive gastric

carcinoma. Am J Pathol 2002; 160: 787-794

1 5 Zur Hausen A, van Rees BP, van Beek J, Craanen ME,Bloemena E, Offerhaus GJ, Meijer CJ, van den Brule AJ.

Epstein-Barr virus in gastric carcinomas and gastric stump

carcinomas: a late event in gastric carcinogenesis. J Clin Pathol2004; 57 : 487-491

1 6 Kume T, Oshima K, Shinohara T, Takeo H, Yamashita Y,

Shirakusa T, Kikuchi M. Low rate of apoptosis andoverexpression of bcl-2 in Epstein-Barr virus-associated gas-

tric carcinoma. Histopathology 1999; 34: 502-509

1 7 Gulley ML, Pulitzer DR, Eagan PA, Schneider BG. Epstein-Barr virus infection is an early event in gastric carcinogenesis

and is independent of bcl-2 expression and p53 accumulation.

Hum Pathol 1996; 27: 20-271 8 Sheu LF, Chen A, Lee HS, Hsu HY, Yu DS. Cooperative

interactions among p53, bcl-2 and Epstein-Barr virus latent

membrane protein 1 in nasopharyngeal carcinoma cells. PatholInt 2004; 54: 475-485

1 9 Matsuda G, Nakajima K, Kawaguchi Y, Yamanashi Y, Hirai

K. Epstein-Barr virus (EBV) nuclear antigen leader protein(EBNA-LP) forms complexes with a cellular anti-apoptosis

protein Bcl-2 or its EBV counterpart BHRF1 through HS1-

associated protein X-1. Microbiol Immunol 2003; 47: 91-992 0 Wu FY, Chen H, Wang SE, ApRhys CM, Liao G, Fujimuro M,

Farrell CJ, Huang J, Hayward SD, Hayward GS. CCAAT/

enhancer binding protein alpha interacts with ZTA and medi-ates ZTA-induced p21 (CIP-1) accumulation and G(1) cell

cycle arrest during the Epstein-Barr virus lytic cycle. J Virol

2003; 77 : 1481-15002 1 Dawson CW, Dawson J, Jones R, Ward K, Young LS. Func-

tional differences between BHRF1, the Epstein-Barr virus-en-

coded Bcl-2 homologue, and Bcl-2 in human epithelial cells. JVirol 1998; 72: 9016-9024

2 2 Sheng W, Decaussin G, Sumner S, Ooka T. N-terminal do-

main of BARF1 gene encoded by Epstein-Barr virus is essen-tial for malignant transformation of rodent fibroblasts and

activation of BCL-2. Oncogene 2001; 20: 1176-1185

2 3 Zhang X, Hu L, Fadeel B, Ernberg IT. Apoptosis modulationof Epstein-Barr virus-encoded latent membrane protein 1 in

the epithelial cell line HeLa is stimulus-dependent. Virology

2002; 304 : 330-3412 4 Spender LC, Cornish GH, Rowland B, Kempkes B, Farrell PJ.

Direct and indirect regulation of cytokine and cell cycle pro-

teins by EBNA-2 during Epstein-Barr virus infection. J Virol2001; 75 : 3537-3546

2 5 Zhang Q, Gutsch D, Kenney S. Functional and physical inter-

action between p53 and BZLF1: implications for Epstein-Barrvirus latency. Mol Cell Biol 1994; 14: 1929-1938

2 6 Szekely L, Selivanova G, Magnusson KP, Klein G, Wiman

KG. EBNA-5, an Epstein-Barr virus-encoded nuclear antigen,binds to the retinoblastoma and p53 proteins. Proc Natl Acad

Sci USA 1993; 90 : 5455-5459

2 7 Dreyfus DH, Nagasawa M, Kelleher CA, Gelfand EW. Stableexpression of Epstein-Barr virus BZLF-1-encoded ZEBRA

protein activates p53-dependent transcription in human Jurkat

T-lymphoblastoid cells. Blood 2000; 96: 625-6342 8 Mauser A, Saito S, Appella E, Anderson CW, Seaman WT,

Kenney S. The Epstein-Barr virus immediate-early protein

BZLF1 regulates p53 function through multiple mechanisms.J Virol 2002; 76: 12503-12512

2 9 Chapel F, Fabiani B, Davi F, Raphael M, Tepper M,

Champault G, Guettier C. Epstein-Barr virus and gastric car-cinoma in Western patients: comparison of pathological pa-

rameters and p53 expression in EBV-positive and negative

tumours. Histopathology 2000; 36: 252-2613 0 Murono S, Yoshizaki T, Park CS, Furukawa M. Association

of Epstein-Barr virus infection with p53 protein accumula-

tion but not bcl-2 protein in nasopharyngeal carcinoma. His-topathology 1999; 34 : 432-438

3 1 Effert P, McCoy R, Abdel-Hamid M, Flynn K, Zhang Q,

Busson P, Tursz T, Liu E, Raab-Traub N. Alterations of thep53 gene in nasopharyngeal carcinoma. J Virol 1992; 66: 3768-

3775

3 2 van Rees BP, Caspers E, zur Hausen A, van den Brule A,Drillenburg P, Weterman MA, Offerhaus GJ. Different pat-

tern of allelic loss in Epstein-Barr virus-positive gastric cancer

with emphasis on the p53 tumor suppressor pathway. Am JPathol 2002; 161: 1207-1213

3 3 Tao Q, Srivastava G, Loke SL, Ho FC. Lack of correlation

between expression of Epstein-Barr virus (EBV) latent mem-brane protein and bcl-2 oncoprotein in vivo. J Clin Pathol 1994;

47 : 589-591

3 4 Huang Q, Petros AM, Virgin HW, Fesik SW, Olejniczak ET.Solution structure of the BHRF1 protein from Epstein-Barr virus,

a homolog of human Bcl-2. J Mol Biol 2003; 332: 1123-1130

3 5 Wei MX, de Turenne-Tessier M, Decaussin G, Benet G, OokaT. Establishment of a monkey kidney epithelial cell line with

the BARF1 open reading frame from Epstein-Barr virus.

Oncogene 1997; 14: 3073-30813 6 Sheng W, Decaussin G, Ligout A, Takada K, Ooka T. Malig-

nant transformation of Epstein-Barr virus-negative Akata cells

by introduction of the BARF1 gene carried by Epstein-Barrvirus. J Virol 2003; 77: 3859-3865




Mechanism and clinical significance of cyclooxygenase-2 expression

in gastric cancer

Bao-Can Wang, Chang-Qing Guo, Chao Sun, Qiao-Ling Sun, Guo-Yong Liu, Ding-Guo Li

EL SEVIER




Bao-Can Wang, Chao Sun, Qiao-Ling Sun, Ding-Guo Li,Digestive Department, Xinhua Hospital, Shanghai Second MedicalUniversity, Shanghai 200092, ChinaChang-Qing Guo, Guo-Yong Liu, Digestive Department, the FirstAffiliated Hospital of Zhengzhou University, Zhengzhou 450052,Henan Province, ChinaCorrespondence to: Ding-Guo Li, Digestive Department, XinhuaHospital, Shanghai Second Medical University, 1665 Kongjiang Road,Shanghai 200092, China. [email protected]: +86-21-65790000 Fax: +86-21-65795173Received: 2004-03-23 Accepted: 2004-06-11

Abstract

AIM: To determine the correlation between methylationstatus of 5’ CpG island of cyclooxygenase-2 (COX-2)gene and protein expression in gastric cancer tissuesfor distinguishing the molecular characters of gastriccancers.

METHODS: Methylation status of 5’ CpG island of COX-2gene was studied by PCR amplification after HpaII andHha I restrictive enzyme digestion; COX-2 expression wasevaluated by immunohistochemical method.

RESULTS: Hpa II and HhaI site were all methylated in 12normal gastric mucosa tissues, whereas they weredemethylated in 77.27% (34/44) and 84.09% (37/44)gastric cancer tissues, respectively. Expression of COX-2was detected in 68.18% (30/44) gastric cancer tissues,but no expression was found in normal gastric mucosatissues. In gastric cancer tissues, COX-2 expressionwas correlated significantly with HpaII site demethylation(29/30 vs 5/14, P<0.001 and HhaI site demethylation(28/30 vs 9/14, P<0.05).

CONCLUSION: The demethylation of 5’ CpG island ofgene is necessary for COX-2 expression in human gastriccancer. The expression status of COX-2 may providetheoretical basis for COX-2 targeting gastric cancertreatments.


Key words: Gastric cancer; Methylation; Cyclooxygenase-2

Wang BC, Guo CQ, Sun C, Sun QL, Liu GY, Li DG. Mechanismand clinical significance of cyclooxygenase-2 expressionin gastric cancer. World J Gastroenterol 2005; 11(21):3240-3244


INTRODUCTIONCyclooxygenase (COX) is a rate-limiting enzyme involvedin the conversion of arachidonic acid to prostaglandins.COX-1 is constitutively expressed in a variety of tissues;COX-2 is induced by cytokines, growth factors, mitogens,oncoproteins, etc.[1-4]. Overexpression of COX-2 has beenreported in various types of tumors and some precanceroustissues[5-11]. Many epidemiological studies indicate that theuse of nonsteroidal anti-inflammatory drugs (NSAIDs) overone year reduces the risk of esophageal[12], gastric[13] andcolorectal cancers[14]. Inhibiting COX-2 activity reduces thegrowth of polyps in APC△716 knockout mice[15]. Sulindacand Celecoxib cause regression of colorectal adenomas inpatients with familial adenomatous polyposis (FAP)[16,17]. Theeffects of NSAIDs will bring about a new approach to theprevention and treatment of cancers, especially digestivecancers. Unfortunately, the mechanisms of COX-2expression have not been defined.

Aberrant DNA methylation exists in carcinomauniversally and is manifested as wide DNA hypomethylationand local CpG island hypermethylation (mainly in thepromoter region). CpG island demethylation facilitates genetranscription, resulting in oncogene activation[18],chromosome instability[19,20], mutation hotspots[21,22], andretrotransposon replacement[23]. CpG island hypermethylationin the promoter is one of the predominant mechanisms ofinactivating various tumor suppressor genes in tumorigenesis.Thus aberrant DNA methylation is regarded as ‘the thirdtumorigenesis pathway’. In recent years, it was reported thatsome cancer cell lines without COX-2 expression exhibithypermethylation of CpG island in the promoter or exon 1region, and methylation-inhibiting agents restore expressionof COX-2[24,25], suggesting that COX-2 expression may berelated to the methylation status of 5’- CpG island of COX-2 gene. Accordingly, we attempted to compare the methylationstatus of 5’ CpG island around the transcriptional startingsite of COX-2 gene in the normal gastric mucosa and gastriccancer in order to clarify the mechanisms for COX-2expression, distinguish the molecular characteristics of gastriccancers, and provide the theoretical basis for COX-2 in theprevention and treatment of gastric cancer.


MaterialsForty-four primary gastric cancer tissue specimens wereobtained from patients undergoing gastrectomy in the FirstAffiliated Hospital of Zhengzhou University and LuoyangOriental Hospital. The age of patients ranged from 35 to

71 years (a mean of 55.7 years). Twelve normal gastricmucosal specimens adjacent to cancer were used as controls.None of the patients received chemotherapy or radiationtherapy. All tissues were immediately frozen in liquidnitrogen and stored at -80 ℃. Genomic DNA was isolatedby proteinase-K digestion and phenol-chloroform extractionmethods and stored at -20 ℃.

MethodsCOX-2 gene methylation status analysis DNA methylationstatus of CpG island at the 5’ end of COX-2 gene wasdetermined by restriction enzyme PCR as describedpreviously[26]. This method for distinguishing methylatedfrom unmethylated alleles in a gene is based on cutting bymethylation-sensitive restrictive enzymes (HpaII, HhaI)and subsequently amplifying the gene fragment by PCRusing primers specific to sequences flanking the restrictiveenzyme cut sites. Design of COX-2 primers was based onthe following published sequences (D28235, AF044206):5’-CAGCTTCCTGGGTTTCCGATT-3’ (sense) and 5’-TTTGCTGTCTGAGGGCGTCT -3’ (antisense), 292 bpproduct. One microgram genomic DNA was cut by 12 UHpaII or HhaI (TaKaRa) in 20 L volume for 8h at 37 ℃.PCR was performed using primer pairs described above,under the following conditions: 25 L volume, PCR mixcontaining 1× GC buffer, deoxynucleotide triphosphates(0.3 mmol/L each), primers (1 mol/L each), enzyme-cutDNA 200 ng, and 1.5 U LA Taq DNA polymerase (TaKaRa).Amplification was carried out for 30 cycles at 94 ℃ for45 s, at 56 ℃ for 30 s, at 72 ℃ for 30 s, final extension at72 ℃ for 5 min. Positive control was performed usinggenomic DNA lacking enzyme digestion. Four microlitersof PCR products were loaded onto 20 mg/L agarose gel,stained with ethidium bromide, and visualized under UVillumination.

ImmunohistochemistryParaffin-embedded gastric tumor tissues were cut into 4 msections, then deparaffinized in xylene and rehydratedthrough a series of alcohol and water. The slides were placedin 10 mmol/L citrate buffer (pH 6.0) and microwaved for15 min to enhance antigen exposure. The sections wereincubated in 30 mL/L hydrogen peroxide for 10 min toquench endogenous peroxidase activity. Slides were then

washed in PBS (pH 7.6) and incubated with PBS containingnormal rabbit serum for 30 min, followed by incubationwith primary goat antibody to COX-2 (SantaCruz) at 4 ℃overnight. Sections were then incubated with a secondbiotinylated antibody for 30 min before they were reactedwith DAB solution. In control slides, PBS was used insteadof the primary antibody. On the basis of the intensity andthe number of cells stained, expression of COX-2 wasdefined as moderate to strong staining affecting more than30% of the tumor area. The COX-2 staining was reviewedby two immunohistochemistry experts independently.

Statistical analysis2 or Fisher’s exact test was used, P<0.05 was consideredstatistically significant. All analyses were performed usingSPSS 10.0 software.

RESULTS

Demethylation of HpaII and HhaI site was found in 34(77.27%) and 37 (84.09%) of 44 gastric cancer tissuespecimens, respectively. Both sites were methylated in 12normal gastric mucosa specimens (Figure 1). Expressionof COX-2 was negative in normal gastric mucosa specimensbut positive in 30 (68.18%) of 44 gastric cancer tissuespecimens. COX-2 protein was located in cytoplasm ofcancer cells (Figure 2).

Figure 2 Immunohistochemical analysis of COX-2 in gastric cancer. A: Negativestaining for histological normal gastric mucosa (×100); B: COX-2 expression in

Figure 1 Methylation status of 5’ CpG island of COX-2 gene in normalgastric mucosa and gastric cancer. Lanes 1-3: normal gastric mucosa;lanes 4-6: gastric cancer tissue; lanes 1 and 4: positive control; lanes 2 and5: HpaI I digestion; lanes 3 and 6: HhaI digestion, lane 7: ΦX174-HaeI I Imarker.

high differentiated cancer (×200); C: poorly differentiated cancer (×400).

A CB

1 2 3 4 5 6 7

Wang BC et al. Methylation of COX-2 expression in gastric cancer 3241

The study showed that demethylation of HpaII and HhaIsite was not significantly correlated with the tumor celldifferentiation degree, TNM staging, and lymph node(LN) metastasis (P>0.05). COX-2 expression wassignificantly higher in III/IV stage group than in I/II stagegroup(24/31 vs 6/13, P<0.05). In gastric cancer with LNmetastasis, COX-2 expression was statistically higher thanthat without LN metastasis (22/27 vs 8/17, P<0.05). Therewas no significant difference in COX-2 expression betweenhigh/moderate and poor differentiation groups (16/21 vs14/23, P<0.05, Table 1).

Among the 30 cases of 44 gastric cancers with positiveCOX-2 expression, 28 had demethylation of both HpaIIand HhaI site, one had methylation of HhaI site, and onehad methylation of both HpaII and HhaI site. In 14COX-2 negative gastric cancer tissue specimens, four hadmethylation of HpaII and HhaI site, five had demethylationof HhaI site and HpaII site, one had demethylation ofHpaII site and methylation of HhaI site, and four haddemethylation of both HhaI and HpaII site. Demethylationof DNA at HpaII and HhaI site was correlated significantlywith COX-2 expression in gastric cancer tissue (P<0.001,P<0.05, Table 2).

Table 1 Relationship between HpaII and HhaI demethylation, COX-2expression and clinical parameters in gastric cancers

HpaII HhaI COX-2 expressionn

D M D M + –

Differentiation

High/moderate 21 18 3 19 2 16 5

Poor 23 16 7 18 5 14 9

TNM staging

I/II 13 8 5 9 4 6 7

31 26 5 28 3 24 7a


No 17 11 6 12 5 8 9

Yes 27 23 4 25 2 22 5c

aP <0.05 vs I/II stage group, cP<0.05 vs no LN metastasis group, D: demethylation,

M: methylation.

Table 2 Correlation of HpaII and HhaI site demethylation and COX-2expression

COX-2 HpaII HhaIexpression

D M D M

+ 29 1 28 2

- 5 9b 9 5a

aP<0.05 vs HhaI, bP<0.001 vs HpaII, D: demethylation, M: methylation.

DISCUSSION

The present study indicates that the demethylation of 5’CpG islands of COX-2 gene may be a major cause forCOX-2 expression in human gastric cancer. Human COX-2gene is located in 1q25.2-25.3, consisting of 10 exons and 9

introns. In the 5’-flanking region, there is a CpG islandcontaining many transcription factor binding sites includingcAMP response element (CRE), NF-B, Sp-1, TATA box,etc.[27]. We chose a 292 bp region in the up- and downstreamof the transcriptional starting codon from -194 to +98(containing 14 CpG sites with G+C content of 51% andan observed/expected presence of CpG of 0.75), whichmeets the established criteria for a CpG island[28,29].According to our results, unlike that being fully methylatedin normal gastric mucosa specimens, the 5’ CpG island ofCOX-2 was demethylated in most gastric cancer tissuespecimens. Moreover, the demethylation was correlatedsignificantly with COX-2 expression. Song et al[25], reportedthat CpG island is completely methylated in human gastriccarcinoma cell line SUN-601, and treatment of thedemethylating agent 5-aza-deoxycitidine reactivates theexpression of COX-2 and restores IL-1 sensitivity.Akhtar et al [30], found that gastric carcinoma cell linesASG and KATO III, possessing methylated promoters,do not express COX-2, and have no response to H pyloristimulation, but treatment with 5-aza-cytidine and H pylorisubsequently causes significant COX-2 expression. Theseresults suggest that 5’ CpG island demethylation may be aprerequisite factor for expression of COX-2 gene. It hasbeen suggested that many stimulators can regulate theexpression of COX-2 gene through complex signaltransduction pathways acting on transcriptional-regulatoryelements, or improving COX-2 mRNA stability throughbinding to AU-rich element in 3' untranslated region[31,32].These results lead us to assume that in the early stage ofgastric cancer, COX-2 gene is firstly demethylated byunknown mechanisms and then begins to transcript underthe co-effects of many transcriptional factors. In our study,5’ CpG island of COX-2 gene was partially or completelydemethylated in 10 cancer tissue specimens withoutCOX-2 expression, but was methylated in two cancertissue specimens with COX-2 expression, suggesting thatthe interaction between suppressive effects of CpG islandmethylation and activation effects of transcriptionalfactors may influence the transcription of COX-2, namely,a COX-2 gene with demethylated CpG island, if thereis no activation of transcriptional factors, may also be intranscriptional silencing.

We found that in 22.73% (10/44) gastric cancer tissuespecimens, COX-2 gene exhibited a methylated CpG island.Toyota et al[33,34], reported that a subset of gastric andcolorectal cancers present a CpG island methylatorphenotype (CIMP), which is characterized by simultaneousmethylation of multiple CpG islands of many genes,including p16, THBS1, and hMLH1. It was suggested thatCpG island methylation of COX-2 is strongly correlatedwith CIMP+ in gastric cancer[24]. Interestingly, K-rasmutations are frequently found in CIMP+ colorectal cancer,compared with CIMP– cases having higher P53 mutations[35],and P53 could suppress the expression of COX-2[36].Furthermore, overexpression of COX-2 is less frequent ingastric cancer with microsatellite instability (MSI) than inthat without MSI[37] which is mainly resulted frommethylation of hMLH1

[38]. These findings suggest that theCOX-2 expression status represents different pathways of


gastric carcinogenesis. COX-2 unexpressed cases haveabnormally high methylating potential of CpG island ofmany genes, including COX-2 gene.

Based on this research, we propose to divide gastriccancer into two groups according to the expression statusof COX-2. The clinical treatment targeting COX-2correspondingly need different strategies. Most gastriccancers are COX-2 positive, COX-2 inhibitors may getfavorable curative effects[16,17]. The other cases are COX-2negative, which mainly resulted from transcriptionalsilencing caused by 5’ CpG island methylation of the gene.Demethylating agents may exert beneficial therapeuticeffects[39], but further study is needed to address thesedeductions.

REFERENCES1 Sheng H, Shao J, Dixon DA, Williams CS, Prescott SM, DuBois

RN, Beauchamp RD. Transforming growth factor-beta1 en-

hances Ha-ras-induced expression of cyclooxygenase-2 in in-testinal epithelial cells via stabilization of mRNA. J Biol Chem

2000; 275 : 6628-6635

2 Ramsay RG, Friend A, Vizantios Y, Freeman R, Sicurella C,Hammett F, Armes J, Venter D. Cyclooxygenase-2, a colorectal

cancer nonsteroidal anti-inflammatory drug target, is regu-

lated by c-MYB. Cancer Res 2000; 60: 1805-18093 De Lorenzo MS, Yamaguchi K, Subbaramaiah K, Dannenberg

AJ. Bryostatin-1 stimulates the transcription of cyclooxygenase-

2: evidence for an activator protein-1-dependent mechanism.Clin Cancer Res 2003; 9: 5036-5043

4 Jung YJ, Isaacs JS, Lee S, Trepel J, Neckers L. IL-1beta-medi-

ated up-regulation of HIF-1alpha via an NFkappaB/COX-2

pathway identifies HIF-1 as a critical link between inflamma-tion and oncogenesis. FASEB J 2003; 17: 2115-2117

5 Yip-Schneider MT, Barnard DS, Billings SD, Cheng L,

Heilman DK, Lin A, Marshall SJ, Crowell PL, Marshall MS,Sweeney CJ. Cyclooxygenase-2 expression in human pancre-

atic adenocarcinomas. Carcinogenesis 2000; 21: 139-146

6 Tanji N, Kikugawa T, Yokoyama M. Immunohistochemical

study of cyclooxygenases in prostatic adenocarcinoma; rela-

tionship to apoptosis and Bcl-2 protein expression. Anticancer

Res 2000; 20 : 2313-2319

7 Chan G, Boyle JO, Yang EK, Zhang F, Sacks PG, Shah JP,

Edelstein D, Soslow RA, Koki AT, Woerner BM, Masferrer JL,

Dannenberg AJ. Cyclooxygenase-2 expression is up-regulated

in squamous cell carcinoma of the head and neck. Cancer Res

1999; 59 : 991-994

8 Kulkarni S, Rader JS, Zhang F, Liapis H, Koki AT, Masferrer

JL, Subbaramaiah K, Dannenberg AJ. Cyclooxygenase-2 is

overexpressed in human cervical cancer. Clin Cancer Res 2001;

7: 429-434

9 van der Woude CJ, Jansen PL, Tiebosch AT, Beuving A,

Homan M, Kleibeuker JH, Moshage H. Expression of

apoptosis-related proteins in Barrett's metaplasia-dysplasia-

carcinoma sequence: a switch to a more resistant phenotype.

Hum Pathol 2002; 33: 686-6921 0 Yoshimura N, Sano H, Okamoto M, Akioka K, Ushigome H,

Kadotani Y, Yoshimura R, Nobori S, Higuchi A, Ohmori Y,

Nakamura K. Expression of cyclooxygenase-1 and -2 in hu-man breast cancer. Surg Today 2003; 33: 805-811

1 1 Kim HS, Youm HR, Lee JS, Min KW, Chung JH, Park CS.

Correlation between cyclooxygenase-2 and tumor angio-genesis in non-small cell lung cancer. Lung Cancer 2003; 42:

163-170

1 2 Corley DA, Kerlikowske K, Verma R, Buffler P. Protectiveassociation of aspirin/NSAIDs and esophageal cancer: a sys-

tematic review and meta-analysis. Gastroenterology 2003; 124:

47-56

1 3 Akre K, Ekstrom AM, Signorello LB, Hansson LE, Nyren O.

Aspirin and risk for gastric cancer: a population-based case-

control study in Sweden. Br J Cancer 2001; 84: 965-9681 4 Bertagnolli MM. The potential of non-steroidal anti-inflam-

matory drugs (NSAIDs) for colorectal cancer prevention. J

Surg Oncol 2003; 84: 113-1191 5 Seno H, Oshima M, Ishikawa TO, Oshima H, Takaku K,

Chiba T, Narumiya S, Taketo MM. Cyclooxygenase 2- and

prostaglandin E (2) receptor EP (2)-dependent angiogenesisin Apc(Delta716) mouse intestinal polyps. Cancer Res 2002;

62 : 506-511

1 6 Giardiello FM, Yang VW, Hylind LM, Krush AJ, PetersenGM, Trimbath JD, Piantadosi S, Garrett E, Geiman DE,

Hubba rd W, Of fe rha us GJ , Ha mil t on SR. Pr i mary

chemoprevention of familial adenomatous polyposis withsulindac. N Engl J Med 2002; 346: 1054-1059

1 7 Steinbach G, Lynch PM, Phillips RK, Wallace MH, Hawk E,

Gordon GB, Wakabayashi N, Saunders B, Shen Y, FujimuraT, Su LK, Levin B, Godio L, Patterson S, Rodriguez-Bigas

MA, Jester SL, King KL, Schumacher M, Abbruzzese J, DuBois

RN, Hittelman WN, Zimmerman S, Sherman JW, Kelloff G.The effect of celecoxib, a cyclooxygenase-2 inhibitor, in famil-

ial adenomatous polyposis. N Engl J Med 2000; 342: 1946-

19521 8 Tao L, Yang S, Xie M, Kramer PM, Pereira MA. Hypomethylation

and overexpression of c-jun and c-myc protooncogenes and

increased DNA methyltransferase activity in dichloroaceticand trichloroacetic acid-promoted mouse liver tumors. Can-

cer Lett 2000; 158: 185-193

1 9 Gaudet F, Hodgson JG, Ede n A, Jac kson-Grusby L,Dausman J, Gray JW, Leonhardt H, Jaenisch R. Induction of

tumors in mice by genomic hypomethylation. Science 2003;

300 : 489-4922 0 Xu GL, Bestor TH, Bourc’his D, Hsieh CL, Tommerup N,

Bugge M, Hulten M, Qu X, Russo JJ, Viegas-Pequignot E.

Chromosome instability and immunodeficiency syndromecaused by mutations in a DNA methyltransferase gene. Na-

ture 1999; 402: 187-191

2 1 Chen RZ, Pettersson U, Beard C, Jackson-Grusby L, JaenischR. DNA hypomethylation leads to elevated mutation rates.

Nature 1998; 395: 89-93

2 2 Feng Z, Hu W, Rom WN, Beland FA, Tang MS. N-hydroxy-4-aminobiphenyl-DNA binding in human p53 gene: sequence

preference and the effect of C5 cytosine methylation. Biochem-

istry 2002; 41: 6414-64212 3 Florl AR, Lower R, Schmitz-Drager BJ, Schulz WA. DNA

methylation and expression of LINE-1 and HERV-K provirus

sequences in urothelial and renal cell carcinomas. Br J Cancer

1999; 80 : 1312-1321

2 4 Toyota M, Shen L, Ohe-Toyota M, Hamilton SR, Sinicrope

FA, Issa JP. Aberrant methylation of the Cyclooxygenase 2CpG island in colorectal tumors. Cancer Res 2000; 60: 4044-

4048

2 5 Song SH, Jong HS, Choi HH, Inoue H, Tanabe T, Kim NK,

Bang YJ. Transcriptional silencing of Cyclooxygenase-2 by

hyper-methylation of the 5’ CpG island in human gastric

carcinoma cells. Cancer Res 2001; 61: 4628-4635

2 6 Hattori M, Sakamoto H, Satoh K, Yamamoto T. DNA

demethylase is expressed in ovarian cancers and the expres-

sion correlates with demethylation of CpG sites in the pro-

moter region of c-erbB-2 and survivin genes. Cancer Lett 2001;

169: 155-164

2 7 Appleby SB, Ristimaki A, Neilson K, Narko K, Hla T. Struc-

ture of the human cyclo-oxygenase-2 gene. Biochem J 1994;

302(Pt 3): 723-727

2 8 Gardiner-Garden M, Frommer M. CpG islands in vertebrate

genomes. J Mol Biol 1987; 196: 261-282

2 9 Brown WR, Bird AP. Long-range restriction site mapping of

mammalian genomic DNA. Nature 1986; 322: 477-481

3 0 Akhtar M, Cheng Y, Magno RM, Ashktorab H, Smoot DT,

Meltzer SJ, Wilson KT. Promoter methylation regulates

Helicobacter pylori-stimulated cyclooxygenase-2 expression in

gastric epithelial cells. Cancer Res 2001; 61: 2399-2403

Wang BC et al. Methylation of COX-2 expression in gastric cancer 3243

3 1 Dixon DA, Kaplan CD, McIntyre TM, Zimmerman GA,

Prescott SM. Post-transcriptional control of cyclooxygenase-

2 gene expression. The role of the 3’-untranslated region. J Biol

Chem 2000; 275: 11750-11757

3 2 Dixon DA, Tolley ND, King PH, Nabors LB, McIntyre TM,

Zimmerman GA, Prescott SM. Altered expression of themRNA stability factor HuR promotes cyclooxygenase-2

expression in colon cancer cells. J Clin Invest 2001; 108 :

1657-16653 3 Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai

K, Baylin SB, Issa JP. Aberrant methylation in gastric cancer

associated with the CpG island methylator phenotype. CancerRes 1999; 59 : 5438-5442

3 4 Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB,

Issa JP. CpG island methylator phenotype in colorectal cancer.Proc Natl Acad Sci USA 1999; 96: 8681-8686

3 5 Toyota M, Ohe-Toyota M, Ahuja N, Issa JP. Distinct genetic

profiles in colorectal tumors with or without the CpG islandmethylator phenotype. Proc Natl Acad Sci USA 2000; 97 :710-715

3 6 Subbaramaiah K, Altorki N, Chung WJ, Mestre JR, SampatA, Dannenberg AJ. Inhibition of cyclooxygenase-2 gene ex-pression by p53. J Biol Chem 1999; 274: 10911-10915

3 7 Yamamoto H, Itoh F, Fukushima H, Hinoda Y, Imai K.Overexpression of cyclooxygenase-2 protein is less frequentin gastric cancers with microsatellite instability. Int J Cancer1999; 84 : 400-403

3 8 Momparler RL, Ayoub J. Potential of 5-aza-2’-deoxycytidine(Decitabine) a potent inhibitor of DNA methylation for therapyof advanced non-small cell lung cancer. Lung Cancer 2001; 34Suppl 4: S111-S115

3 9 Karpf AR, Moore BC, Ririe TO, Jones DA. Activation of thep53 DNA damage response pathway after inhibition of DNAmethyltransferase by 5-aza-2’-deoxycytidine. Mol Pharmacol

2001; 59 : 751-757

Science Editor Wang XL Language Editor Elsevier HK


• COLORECTAL CANCER •

Increased proliferation activity measured by immunoreactive Ki67

is associated with survival improvement in rectal/recto sigmoid

cancer

Eeva Salminen, Salla Palmu, Tero Vahlberg, Peter J. Roberts, Karl-Owe Söderström

EL SEVIER




Eeva Salminen, Salla Palmu, Department of Oncology andRadiotherapy, Turku University Hospital, 20510 Turku, FinlandTero Vahlberg, Department of Biostatistics, University of Turku,20510 Turku, FinlandPeter J. Roberts, Department of Surgery, Turku UniversityHospital, 20510 Turku, FinlandKarl-Owe Söderström, Department of Pathology, Turku UniversityHospital, 20510 Turku, FinlandSupported by the Emil Aaltonen Foundation and Turku UniversityResearch FoundationCorrespondence to: Dr. Eeva Salminen, Department of Oncologyand Radiotherapy, POB 52, Fin-20510 Turku, Finland. [email protected]: +358-2-3332809Received: 2004-08-13 Accepted: 2004-09-30

Abstract

AIM: To assess the expression of Ki67 as prognosticatorin rectal/recto sigmoid cancer.

METHODS: Samples from 146 patients with rectal andrecto sigmoid cancer were studied for expression of Ki67and its prognostic significance in comparison with clinico-pathological predictors of survival. Formalin-fixed,paraffin-embedded tissues from 6 (4.1%) patients withT1, 26 (17.8%) with T2, 94 (64.4%) with T3, and 20(13.7%) with T4 tumors were studied. Ki67 expressionwas determined immunohistochemically. Samples weredivided according to mean value into high (>40%) andlow (≤40%) expression. Areas of extensive proliferation(>50%) were defined as ‘hot spot’ areas.

RESULTS: Hot spot areas were present in samplesregardless of histopathological grade. Lower TNM andDukes stage and higher expression of Ki67 and presenceof Ki67 hot spot areas in histopathological samples wereassociated with better survival, whereas no associationwas observed with histopathological grade (P = 0.78). InCox multivariate regression analysis, significant prognosticfactors were Dukes stage (P<0.001), presence of lymphnode metastases (P = 0.015), age (P = 0.035) andpresence of Ki67 hot spot areas (P = 0.044).

CONCLUSION: Proliferative activity as measured by Ki67in rectal cancer is associated with survival improvementcompared with patients with low Ki67. Areas of prognosticallysignificant increased proliferation were found independentlyof histopathological tumor grade.


Key words: Rectal cancer; Stage; Grade; Proliferativeactivity; Ki67

Salminen E, Palmu S, Vahlberg T, Roberts PJ, SöderströmKO.In creased prol i f era t ion act iv ity measured byimmunoreactive Ki67 is associated with survival improvementin rectal/recto sigmoid cancer. World J Gastroenterol 2005;11(21): 3245-3249


INTRODUCTION

Colorectal cancer is the third most common cancer in theWestern world and constitutes the second leading cause ofcancer deaths[1]. Its incidence has been increasing steadily duringrecent years. The tumor biology of rectal adenocarcinomais different from that of upper colon cancers. Rectal canceris characterized by particular biological and genetic featuresand clinical behavior[2].

Ki67 is a proliferation antigen which is expressedduring all phases of the cell cycle except for the resting ofcells in G0[3]. Ki67 can be detected in proliferating cells inboth frozen and paraffin-embedded tissue[4]. This specificimmunoreactivity is associated with tumor proliferation[3]

and the Ki67 labeling index has prognostic significance invarious types of carcinomas. In many cancers, includingcancer of the breast, malignant lymphomas and astrocytomas,a high proliferation rate expressed by Ki67 antigen has beenshown to have prognostic significance[5-8].

In colorectal cancer, contradictory results have beenreported on associations of Ki67 with prognosis andsurvival. Palmqvist and collaborators[9] reported colorectaltumors with a low proliferation index in Dukes B tumors tobe associated with survival impairment compared to thosewith high values. Willett and associates[10] measuredproliferative activity after preoperative irradiation in rectalcancer. They observed that patients whose tumors showedhigher proliferative activity after radiation treatmentsurvived better compared to those with tumors of lowerproliferation. In contrast, Kimura and collaborators[11]

reported poor prognosis in colorectal tumors with a highproliferative index. The reasons for these discrepancies haveremained open.

As reports on proliferative activity and survival in rectalcancer are scant and the association of low proliferationwith poor survival is limited to Dukes B tumors, we undertookto study the association of Ki67 in all stages of rectal tumors


to clarify its prognostic role for patients with rectal or rectosigmoid cancers.


One hundred and forty-six patients with recto sigmoid andrectal cancer who were treated for primary (135 patients,92%) or recurrent (11 patients, 8%) cancer at the UniversityHospital in Turku in 1992-2002 were included in this study.Criteria for inclusion were as follows: histologically provenrecto sigmoid or rectal carcinoma with the upper lever below24 cm, no preoperative chemo- or radiotherapy. Twenty-one tumors (14%) were located in the rectosigma (17-24 cmfrom anus) and 125 (86%) in the rectum (<17 cm). Allpatients had been operated on for cancer, either with anteriorresection or rectum amputation. Most patients receivedpostoperative adjuvant radiotherapy given with a linearaccelerator using conventional fractionation and doseplanning to a mean dose of 50.4 Gy to the tumor area.

TNM classification (UICC 1997)[12] and Dukes staging[13]

were used for staging. The samples were re-evaluated by anexperienced pathologist who graded the tumors from I toIII, depending on the degree of anaplasia and nuclear sizeaccording to the World Health Organization[14].

Immunohistochemical staining and scoring of Ki67From paraffin-embedded blocks, 5-m-thick sections werecut, deparaffinized with xylene and rehydrated through agraded series of alcohol. For antigen retrieval, the sampleswere boiled for 10 min in a microwave oven in 10 mmol/Lsodium citrate buffer (pH 6.0). An automated processor(TechMate 500, DAKO) was used for immunohistochemicalstaining. Steps were performed in the immunostainer usingthe avidin-biotin-peroxidase staining method. Mousemonoclonal Ki67 antibody MIB-1 antibody (DAKO,Denmark) was diluted 1:100 and applied for 27 min. Thepercentage of immunoreactive nuclei of Ki67 was countedfor each tumor slide. The reaction was considered positivewhen 10% or more of the cancer cells showed staining.The cut-off point was chosen to indicate cases with clearpositive staining. As a negative control the primary antibodywas omitted from each staining. No significant backgroundstaining was detectable.

The expression of Ki67 was evaluated by two observers(SP and KOS) independently and they were blinded to theclinical data at this stage. A consensus was sought fordifferences in opinion. The total expression of Ki67 wasevaluated in the whole sample. The amount of positivelystained cells was counted in different areas and the totalexpression then estimated in percentages. Areas of extensiveproliferation (>50%) were defined as ‘hot spot’ areas. Ahot spot area was described as an area seen with a 10×objective with the highest number of Ki67 positively stainedcells.

Statistical analysisUnivariate associations between variables were evaluatedby 2 test or Fisher’s exact test. The Kaplan-Meier survivalcurves were compared using log-rank test. Univariate andmultivariate associations between risk factors and survival

were analyzed with Cox proportional hazard models. P valuesless than 0.05 were considered statistically significant.Statistical computations were made with SAS System forWindows, release 8.02.

RESULTS

Patient characteristics are presented in Table 1. The meanage of the patients was 66 years (range 36-86 years). Six(4%) presented with T1 tumors, 26 (18%) with T2, 94 (64%)with T3 and 20 (14%) with T4 tumors, corresponding toDukes A in 27 patients (18%), with B in 86 patients (57%),with C in 25 patients (17%) and with D in 12 patients (8%).Histological sample re-evaluation for grade according tothe WHO classification indicated 24 tumors (16%) of grade1, 89 (61%) of grade 2 and 33 (23%) of grade 3. Based ontumor growth to surgical margins or the presence of lymphnode metastases, radiotherapy was given to 91 (62%) patientsat a median dose of 50.4 Gy (range 48-67 Gy). One patientreceived only a dose of 25 Gy.

Table 1 Patient characteristics

Number of patients (%)

Total number of eligible patients 146 (100)

Sex

Male 87 (60)

Female 59 (40)

Age (yr)

Mean 66

Range 36–86

Performance status (WHO)

0 11 (15)

1 53 (72)

2 10 (14)

Tumor histology

Grade 1 24 (16)

Grade 2 89 (61)

Grade 3 33 (23)

Tumor localization

Rectum 125 (86)

Recto sigmoid 21 (14)

T stage

T1 6 (4)

T2 26 (18)

T3 94 (64)

T4 20 (14)

Dukes

A 26 (18)

B 85 (58)

C 25 (17)

D 10 (7)

N stage

0 98 (67)

1 26 (18)

2 22 (15)

Primary tumor 135 (93)

Recurrent tumor 11 (8)

Radiotherapy

Given to N patients (%) 91 (62)

Median dose (range) Gy1 50 (48–67)

1One patient treated only to 25 Gy.

Salminen E et al. Ki67 and survival in rectal cancer 3247

Associations of clinical variables with Ki67 expressionHot spot areas were found in tumor samples regardless ofthe degree of average Ki67 proliferation, similarly amongtumors with overall low, higher and highest degree ofproliferation, e.g., under and above the cut-off level of40% or 50%, which represented the median values insamples. The significance of associations of Ki67proliferation with clinico-pathological factors was tested by2 test. The associations with N-stage, Dukes and hot spotareas were significant (P = 0.020, P = 0.012 and P<0.001,respectively) (Table 2). No statistically significant associationswere observed with sex, age (cut point 65 years), grade, T-stage, radiotherapy or primary vs. recurrent tumor.

Table 2 Association of Ki67 expression with N-stage, Dukes andpresence of hot spot areas in rectal cancer

Ki67 expressionP

≤40 >40

n (%) n (%)

N-stage 0.020

0 50 (63) 48 (73)

1 12 (15) 14 (21)

2 18 (23) 4 (6)

Dukes 0.012

1 9 (11) 17 (26)

2 53 (66) 32 (48)

3 10 (13) 15 (23)

4 8 (10) 2 (3)

Hot spot <0.001

≤50 65 (81) 10 (15)

>50 15 (19) 56 (85)

SurvivalThe follow-up time of the surviving patients estimated fromthe time of operation ranged from 42 to 156 mo, with amedian of 99 mo (Figure 1). The median survival time ofthe patients was 72 mo.

In Figure 2 survival by T-stage is presented showing adecrease in survival with increasing T-stage (P<0.001), andsimilarly in Figure 3 by Dukes stage (P<0.001) and Figure 4by lymph node status (P<0.001). In all of these figureslower presentation indicated better survival.

Figure 5 shows better survival among patients withhigher proliferation Ki67 compared to those with lowervalues (P = 0.039).

Figure 6 shows survival by presence or absence of Ki67hot spot areas, with significantly better survival seen amongpatients with higher hot spot presentation (P = 0.001).

No statistically significant association with survivalwas observed by sex (P = 0.56), age with a cut-off point at65 years (P = 0.05), histopathological grade (P = 0.78) ortumor localization (P = 0.42).

Cox’s proportional hazard model was used to quantifythe independent contribution of clinical factors and Ki67to survival. The results are presented in Table 3. The significantprognosticators in the multivariate model were Dukes stage(P<0.001), N-stage (P = 0.015), age (P = 0.035) and presenceof Ki67 hot spot areas (P = 0.044).

Figure 1 Kaplan-Meier survival curve for the whole patient population (n = 146).Five-year median survival 53%, 10-year survival 41%.

Figure 2 Kaplan-Meier survival by UICC 1997 T-stage (T1 n = 6, T2 n = 26,T3 n = 94, T4 n = 20).

Figure 3 Kaplan-Meier survival by N-stage, N0 = no lymph node metastases(N0 n = 98, N1 n = 26, N2 n = 22). N1 = documented lymph node metastases,2 = NX, lymph node status undefined.

Figure 4 Kaplan-Meier survival by Dukes stage (Dukes A n = 26, Dukes Bn = 85, Dukes C n = 25, Dukes D n = 10).

Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

T-stage

1

2

3

4Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

N-stage

0

1

2

P<0.001

P<0.001

Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

Dukes

1

2

3

4

P<0.001

DISCUSSIONCancer of the rectum and recto sigmoid area belongs tothe commonest cancers in the Western world, with relativelypoor prognosis. They show a common tendency to bothlocal recurrences and distant metastases[15]. The constantincrease in the incidence of these cancers both among menand women in recent years makes characterization of tumortypes and identification of new prognosticators important.Histopathological characterization differs from that in othertumors and contradictory observations on the prognosticrole of Ki67 proliferative activity have been reported[9,11].The results of this current study indicate that higherexpression of the proliferative antigen indicates bettersurvival in rectal and recto sigmoid cancer.

The survival of patients with colorectal cancer dependson the extent of the tumor and metastatic spread atpresentation; patients with advanced stage and/or metastaticlymph nodes at presentation have poor prognosis comparedto those with locally limited tumors, as also reflected in the

current results. Adjuvant treatment improves disease controlin locally advanced carcinoma, and it has been the standardtreatment over the period of this study. The overall survivalof 60% at 5 years and 45% at 10 years observed in thepresent series is within the range for this patient group[16].When used as a continuous variable, age was not associatedwith survival, though with the cut-off at 65 years the youngerpatients showed significantly better survival when comparedto older ones. T-stage and Dukes classification are known to bevaluable prognostic tools in the characterization of colorectaltumors. They describe the extent of growth and correlatewith survival similarly, as seen in the present results. Thespread of cancer to lymph nodes is often an independent signof poorer prognosis, regardless of other tumor characteristics.

Pre-treatment evaluation of tumors is difficult due totheir location. Contrary to what is seen in many tumors, incolorectal cancer histopathological grade alone does notcharacterize tumor prognosis. In tumors at this location,the presentation of tumors of the same stage can beheterogeneous when measured by proliferation. In thepresent study, Ki67 acted independently of histopathologicalgrade and as independent prognostic factor produced moreprognostic information for survival than grade. Histologicalgrade was not an independent prognosticator, results beingsimilar to those of Palmqvist and coworkers[9].

Possible explanations for deviation/discrepancies fromwhat is seen with other tumors in the role of Ki67 as acancer prognosticator have been suggested, includingpreoperative procedures and tumor growth type. In rectaltumor samples, preoperative colon cleaning with laxativesand enemas has been shown to induce mucosal proliferativeactivity[17]. Preoperative cleaning was used routinely duringthe time of operation of the patients in the present series.Another explanation suggests that ulcerative processes mayincrease proliferation at the luminal border[9], resulting inhigher Ki67 expression. This could explain the connectionamong larger tumor size, advanced stage, and higherproliferative activity without impairment to survival. It hasalso been argued that the true proliferation rate of cancercannot be measured immunohistochemically, because it is afunction of both growth fraction and the time required forcompletion of the cell cycle[18-20]. Duchrow and colleagues[20]

have presented a comparison of expression of pKi67mRNA and protein in colorectal cancer and shown thattumors with a high pKi67 protein level but low mRNAexpression may proliferate more slowly than estimated ifonly their Ki67 staining index is taken into account, which mayexplain the patients’ improved outcome. They suggest thatmassive expression of pKi67 in tumor cells possibly inducesgrowth arrest and contributes to its own stabilization[20]. Arole for Ki67 determination as a tool in selecting andmonitoring colorectal cancer patients for radiotherapy hasbeen suggested[21]. However, a recent study has failed toshow an association between Ki67 and response inpreoperative chemo-radiotherapy in rectal cancer[22].

The prognostic value of Ki67 determination in colorectalcancer may vary depending on how the sample is taken[18].Kimura and coworkers[11] observed that samples taken forKi67 determination at the site of the deepest tumor showedpoor prognosis for patients with high Ki67 values. Systematic

Figure 5 Kaplan-Meier curve for risk of death for all patients by expression ofKi67 (n = 146), cut-off level 40% (≤40 n = 80, >40 n = 66).

Figure 6 Kaplan-Meier curve for risk of death for all patients by expression ofKi67 hot spot areas, cut-off level 50% (≤50 n = 75, >50 n = 71).

Table 3 Cox univariate and multivariate regression analysis

Univariate analysis Multivariate analysisVariable

HR (95%CI) P HR (95%CI) P

Age (>65 vs <65 yr) 1.54 (0.99–2.39) 0.056 1.62 (1.04–2.52) 0.035

T-stage (3+4 vs 1+2) 2.24 (1.21–4.23) 0.010 1.61 (0.86–3.03) 0.139

N-stage (1+2+3 vs 0) 2.42 (1.57–3.74) <0.001 1.82 (1.12–2.94) 0.015

Dukes (4 vs 1+2+3) 11.42 (5.34–24.43) <0.001 6.32 (2.78–14.39) <0.001

Ki67 (>40 vs ≤40) 0.63 (0.41–0.98) 0.040 1.26 (0.67–2.39) 0.469

Ki67 Hot spot 0.48 (0.31–0.75) 0.001 0.51 (0.27–0.98) 0.044

(>50 vs ≤50)

Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

Ki67

≤40

>40

P<0.039

Surv

ival (%

)

0 10 20 30 40 50 60 70 80 90 100 110 120 Time (mo)

100

80

60

40

20

0

Host spot

≤50

>50P<0.001


heterogeneity in colorectal samples with higher proliferativeactivity at the luminal border compared with the invasivemargin has been observed and reported[9]. We herestandardized the samples by systematic evaluation of hotspot areas as the parameter of observation to overcomeheterogeneity in the samples. Hot spot areas could beobserved throughout the study samples independently ofhistopathological grade, which in most other tumors isassociated with the degree of proliferation activity. Asignificant association between hot spot presentation of Ki67and improved survival was recorded in both uni- andmultivariate analysis, and provides new insight regardingthe biological behavior of these tumors.

The present finding of an association between highproliferation rate and survival improvement is concordantto earlier observations noted in more highly selected patientseries[9,10]. Palmqvist and coworkers[9] showed that a lowertumor proliferation rate at the invasive margin was associatedwith poor prognosis in Dukes B colorectal cancer. To ourknowledge the present is the first report on Ki67 as aprognosticator in all Dukes stages in rectal cancer.

Tumors with high proliferative activity are known to be mostresponsive to radiotherapy. Willett and collaborators[10]

showed that radiation eradicates preferentially rapidlydividing cells in rectal cancer, whereas populations with slowproliferation show greater radioresistance. Their conclusionwas that more than minimal proliferative activity in T3and T4 tumors indicates a survival improvement withradiotherapy. Thus, although survival is reduced with theincrease in T or D stage in general, within each tumor stagethose with higher proliferation had better disease-free survivaland response to conventional radiotherapy/chemotherapy.No association was shown in a recent microarray studybetween Ki67 expression and distant metastases in rectalcancer[23]. Tumors with lower proliferative activity may needdifferent adjuvant approaches or sensitizers, which couldmake them more responsive to treatment.

In conclusion, determination of immunohistochemicalKi67 hot spot areas, which act as independent prognosticators,contributes to the prognostic evaluation of patients withrectosigmoid and rectal cancer and in considering them forpostsurgical treatment.

REFERENCES

1 WHO: The World Health Report. Geneva, World HealthOrganization, 1997

2 Kapiteijn E, Liefers GJ, Los LC, Kranenbarg EK, Hermans J,

Tollenaar RA, Moriya Y, van de Velde CJ, van Krieken JH.Mechanisms of oncogenesis in colon versus rectal cancer. J

Pathol 2001; 195: 171-178

3 Isola JJ, Helin HJ, Helle MJ, Kallioniemi OP. Evaluation of cellproliferation in breast carcinoma. Comparison of Ki-67 im-

munohistochemical study, DNA flow cytometric analysis and

mitotic count. Cancer 1990; 65: 1180-11844 Garrido MC, Cordell JL, Becker MH, Key G, Gerdes J, Jones

M, Gatter KC, Mason DY. Monoclonal antibody JC1: new

reagent for studying cell proliferation. J Clin Pathol 1992; 45:860-865

5 Kirla R, Salminen E, Huhtala S, Nuutinen J, Talve L,

Haapasalo H, Kalimo H. Prognostic value of the expression

of tumor suppressor genes p53, p21, p16 and prb, and Ki-67

labelling in high grade astrocytomas treated with radiotherapy.J Neurooncol 2000; 46: 71-80

6 Pollack A, DeSilvio M, Khor LY, Li R, Al-Saleem TI,

Hammond ME, Venkatesan V, Lawton CA, Roach M, ShipleyWU, Hanks GE, Sandler HM. Ki-67 staining is a strong pre-

dictor of distant metastasis and mortality for men with pros-

tate cancer treated with radiotherapy plus androgendeprivation: Radiation Therapy Oncology Group Trial 92-02.

J Clin Oncol 2004; 22: 2133-2140

7 Bui MH, Visapaa H, Seligson D, Kim H, Han KR, Huang Y,Horvath S, Stanbridge EJ, Palotie A, Figlin RA, Belldegrun

AS. Prognostic value of carbonic anhydrase IX and KI67 as

predictors of survival for renal clear cell carcinoma. J Urol2004; 171 : 2461-2466

8 Tisell LE, Oden A, Muth A, Altiparmak G, Molne J, Ahlman

H, Nilsson O. The Ki67 index a prognostic marker in medul-lary thyroid carcinoma. Br J Cancer 2003; 89: 2093-2097

9 Palmqvist R, Sellberg P, Öberg Å, Tavelin B, Rutegård J,

Stenling R. Low tumour cell proliferation at the invasive mar-gin is associated with a poor prognosis in Dukes' stage B

colorectal cancers. Br J Cancer 1999; 79: 577-581

1 0 Willett CG, Warland G, Hagan MP, Daly WJ, Coen J, ShellitoPC, Compton CC. Tumor proliferation in rectal cancer

following preoperative irradiation. J Clin Oncol 1995; 13 :

1417-14241 1 Kimura T, Tanaka S, Haruma K, Sumii K, Kajiyama G,

Shimamoto F, Kohno N. Clinical significance of MUC1 and E-

cadherin expression, cellular proliferation, and angiogenesisat the deepest invasive portion of colorectal cancer. Int J Oncol

2000; 16 : 55-64

1 2 UICC International Union Against cancer: TNM Classifica-tion of malignant tumours.5th edition, WHO, Geneva, 1997

1 3 Beahrs OH. Colorectal cancer staging as a prognostic feature.

Cancer 1982; 50: 2615-26171 4 Miller AB, Hoogstraten B, Staquet M, Winkler A. Reporting

results of cancer treatment. Cancer 1981; 47: 207-214

1 5 Kockerling F, Reymond MA, Altendorf-Hofmann A, DworakO, Hohenberger W. Influence of surgery on metachronous

distant metastases and survival in rectal cancer. J Clin Oncol

1998; 16 : 324-3291 6 Pahlman L. Rectal carcinoma, type of surgery and the role of

adjuvant radiation therapy. Ann Chir Gynaecol 1993; 82: 153-

1581 7 Lehy T, Abitbol JL, Mignon M. Influence of rectal preparation

by enema on cell proliferation in the normal rectal mucosa in

man. Gastroenterol Clin Biol 1984; 8: 216-2211 8 Jansson A, Sun XF. Ki-67 expression in relation to clinicopatho-

logical variables and prognosis in colorectal adenocarcinomas.

APMIS 1997; 105: 730-7341 9 van Oijen MG, Medema RH, Slootweg PJ, Rijksen G. Positiv-

ity of the proliferation marker Ki-67 in noncycling cells. Am J

Clin Pathol 1998; 110: 24-312 0 Duchrow M, Ziemann T, Windhövel U, Bruch HP, Broll R.

Colorectal carcinomas with high MIB-1 labelling indices butlow pKi67 mRNA levels correlate with better prognosticoutcome. Histopathology 2003; 42: 566-574

2 1 Porschen R, Lohe B, Hengels KJ, Borchard F. Assessment of

cell proliferation in colorectal carcinomas using the mono-clonal antibody Ki-67. Correlation with pathohistologic crite-ria and influence of irradiation. Cancer 1989; 64: 2501-2505

2 2 Reerink O, Karrenbeld A, Plukker JT, Verschueren RC, Szab¨®BG, Sluiter WJ, Hospers GA, Mulder NH. Molecular prognos-tic factors in locally irresectable rectal cancer treated preop-eratively by chemo-radiotherapy. Anticancer Res 2004; 24 :1217-1221

2 3 Fernebro E, Bendahl PO, Dictor M, Persson A, Ferno M,Nilbert M. Immunohistochemical patterns in rectal cancer:application of tissue microarray with prognostic correlations.

Int J Cancer 2004; 111: 921-928


Salminen E et al. Ki67 and survival in rectal cancer 3249

• COLORECTAL CANCER •

Link between colorectal cancer and polymorphisms in the

uridine-diphosphoglucuronosyltransferase 1A7 and 1A1 genes

Kung-Sheng Tang, Hui-Fen Chiu, Hong-Hwa Chen, Hock-Liew Eng, Chia-Jung Tsai, Hsiu-Chen Teng, Ching-Shan Huang

EL SEVIER




Kung-Sheng Tang, Department of Medical Technology, FooyinUniversity, Kaohsiung, Taiwan; Graduate Institute of Medicine,Kaohsiung Medical University, Kaohsiung, Taiwan, ChinaHui-Fen Chiu, Graduate Institute of Medicine and Departmentof Pharmacology, Kaohsiung Medical University, Kaohsiung,Taiwan, ChinaHong-Hwa Chen, Department of Colorectal Surgery, Chang GungMemorial Hospital, Kaohsiung, Taiwan, ChinaHock-Liew Eng, Chia-Jung Tsai, Department of Pathology, ChangGung Memorial Hospital, Kaohsiung, Taiwan, ChinaHsiu-Chen Teng, Department of Medical Management, FooyinUniversity, Kaohsiung, Taiwan, ChinaChing-Shan Huang, Department of Medical Technology, FooyinUniversity, Kaohsiung, Taiwan; Department of Laboratory Medicine,Cathay General Hospital, Taipei, Taiwan, ChinaSupported by a Grant From the National Science Council (NSC93-3112-B-242-001), Taipei, Taiwan, ChinaCorrespondence to: Professor Ching-Shan Huang, Departmentof Medical Technology, Fooyin University, 151 Chin-Hsueh Road,Ta-Liao Hsiang, Kaohsiung Hsien 831, Taiwan; Department ofLaboratory Medicine, Cathay General Hospital, 280, Jen Ai-Road,Section 4, Taipei 106, Taiwan, China. [email protected]: +886-22-6360450 Fax: +886-28-7725983Received: 2004-10-29 Accepted: 2004-12-01

Abstract

AIM: To investigate the relationship between single nucleotidepolymorphisms in the uridine-diphosphoglucurono-syltransferase (UGT) UGT1A7 and UGT1A1 genes andpatients suffering from colorectal cancer (CRC).

METHODS: A case-control study was designed in orderto investigate the genotypes of the UGT1A7 and UGT1A1genes, which were identified by the polymerase chainreaction-restriction fragment length polymorphism (RFLP)method, for 268 CRC patients and 441 healthy controls.

RESULTS: The results of simple logistical regressionsrevealed odds ratios (ORs) of 1.97 (P<0.001), 1.91(P<0.001), and 2.03 (P<0.001) for patients who carriedthe UGT1A7*1/*3 genotype, UGT1A7*3 allele, andvariant-211 UGT1A1 allele. The interaction of UGT1A7*3allele and variant-211 UGT1A1 allele produced an additiveeffect on the risk for the development of CRC [observedOR (2.34) greater than expected OR (1.59)]. For the 268patients, the results of simple logistical regressionsindicated that the OR of developing metastases was 4.90(P<0.001) and 4.89 (P<0.001) for the individualspossessing UGT1A7*3 allele and variant-211 UGT1A1allele, respectively. The results of multivariate logisticalregressions confirmed these findings (OR = 2.51, P = 0.01;

and OR = 2.71, P = 0.01, respectively). The interactionof these two variants resulted in an additive effect on therisk for metastases amongst patients [observed OR (6.83)greater than expected OR (4.56)].

CONCLUSION: In conclusion, carriage of the UGT1A7*3allele, as well as variant-211 UGT1A1 allele represents arisk factor for the development of, and a determinant for,metastases associated with CRC patients.


Key words: Colorectal cancer; UGT1A7*3 allele; Variant-211 UGT1A1 allele; Metastases

Tang KS, Chiu HF, Chen HH, Eng HL, Tsai CJ, Teng HC, HuangCS. Link between colorectal cancer and polymorphisms inthe uridine-diphosphoglucuronosyltransferase 1A7 and 1A1genes. World J Gastroenterol 2005; 11(21): 3250-3254


INTRODUCTION

The uridine-diphosphoglucuronosyltransferase (UGT)superfamily is a detoxification pathway[1]. Two subfamilies,UGT 1 and UGT 2, have been identified in human bodies[2].The study concerns the single nucleotide polymorphisms(SNPs) in the UGT 1 subfamily. Recently, in determiningthe full sequence of the UGT1A1 and UGT1A7 genes, wehave observed that the allele frequencies of both the genesfor our populations differed from the corresponding figuresfor Caucasians[3]. We also found that carriage of the variantUGT1A1 gene at nucleotide 211 [211 G to A (G71R)] washighly associated with the carriage of UGT1A7*3 allele.The UGT1A7*3 allele in Caucasian populations has beenshown to be a risk factor in cancer of oral cavity[4], liver[5],colon[6] and pancreas[7], which are included as leading causesof cancer mortality in Taiwan[8]. This study is a case-controlled research of the variants for the UGT1A7 andUGT1A1 genes in patients from Taiwan with colorectalcancer (CRC). This is probably the first report conductedto research the relative risk for the development of CRCsimultaneously for these two genes.


Patients and controlsThe study subjects consisted of 268 pathologically-identifiedCRC patients collected between January 2004 and July 2004

and 441 healthy controls who attended our institution forthe purpose of a physical examination during the sameperiod. All study-participating individuals provided theirwritten consent as regards their participation. All the 268CRC patients underwent surgery followed by subsequentpathological examination for tumor residue/presence withina period of about 2 mo subsequent to initial diagnosis atwhich time the suspicious symptoms were first noticed. Thetumor was diagnosed by pathological observation andcategorization into one of the several tumor-developmentalstages A-D, according to the criteria of the modified Dukesclassification scale: stage A, limited to mucosa; stage B,extension into, R/O through muscularis propria, no nodalinvolvement; stage C, limited or substantial extensionthrough bowel wall, metastases in the lymph nodes; andstage D, distant metastases[9].

Determination of UGT1A7 and UGT1A1 genotypesTotal genomic DNA was isolated from peripheral bloodcells (K3EDTA as anticoagulant) using the blood DNAisolation kit (Maxim Biotech Inc., San Francisco, CA, USA).PCR amplification was performed in a thermal cycler(Perkin-Elmer Cetus, Norwalk, CT, USA) applying 35cycles of denaturation for 60 s at 94 ℃, annealing for60 s at 55 ℃, primer extension for 60 s at 72 ℃, and afinal extension for 10 min at 72 ℃. The genotypes ofUGT1A7 were identified by determining nucleotides -57and 387 with the restriction fragment length polymorphism(RFLP) method, using enzymes HpyCH4 IV and AflII asdescribed previously. If the result is a homozygous Gvariation at nucleotide -57, the genotype is UGT1A7*3/*3.The detection of nucleotide 387, following the determinationof nucleotide -57, can be used as a marker to identify thegenotypes of UGT1A7 in subjects carrying genes other thanUGT1A7*3/*3. For the situation for the wild type ofUGT1A7 gene at nucleotide -57, the genotypes areUGT1A7*1/*1, *1/*2, and *2/*2 when the results fornucleotide 387 show it to be wild, heterozygous variation,and homozygous variation. For the situation, where thereexists heterozygous variation at nucleotide -57, the genotypesare, respectively, UGT1A7*1/*3 and *2/*3 when the resultsfor nucleotide 387 reveal heterozygous and homozygousvariations. For the determination of the UGT1A1 gene, thepromoter area and nucleotides 211, 686, 1 091, and 1 456 wereanalyzed using the RFLP method as described previously[10].In brief, the restriction enzymes AvaII, BsrI, BclI, and AvaIIwere utilized in order to determine whether heterozygous andhomozygous variations occur at nucleotides 211, 686, 1 091,and 1 456; while the A(TA)6TAA and A(TA)7TAA of thepromoter area were differentiated directly by the size of theproduced PCR fragments (77 and 79 bp, respectively) on theelectrophoresed agarose gel. The DNAs of UGT1A7*1/*1,*1/*2, 1/*3, *2/*2*, *2/*3, *3/*3, and the five known variants(promoter area and nucleotides 211, 686, 1 091, and 1 456)in the UGT1A1 gene (heterozygous and homozygous), whichhad been found and identified by the DNA sequencing method,respectively[3], were run as controls in each performance ofgenotyping assays by the RFLP method.

Statistical analysisThe 2 test and Student’s t-test were used, as appropriate,

in order to compare parameters corresponding to the caseand control groups. To evaluate the contribution of eachgenetic allele, simple and multivariate logistical regressions,as appropriate, were used for the calculation of the relevantodds ratio (OR) and the 95%CI for CRC. The respectiveORs for developing metastases (stages C and D) CRCs forthe subjects carrying CRC-related UGT1A alleles werecompared with the corresponding values for patients notbearing those alleles. Interaction effects between suspectedrisk factors were evaluated using the logistical regressionmodels. The evaluation of the dimension of interactionwas then performed by comparing observed with expectedORs under the assumptions derived from the applicationof additive models[11]. A P value <0.05 or a 95%CI for theOR above or below 1.0 was defined as constituting statisticalsignificance. All data were analyzed using the StatisticalPackage for Social Sciences software (SPSS, version 10.0;SPSS Inc., Chicago, IL, USA).

RESULTS

For both the case and control groups, the male/female ratiowas identical (140/128 vs 237/204, P = 0.70 by 2 test,data not shown in the tables), whilst the mean age wassignificantly different (65±11.2 years, range 31-92 yearsvs 47.0±12.3 years, range 20-79 years, P<0.001 by Student’st-test, data not shown in the tables). Six genotypes and threealleles of the UGT1A7 gene were found in both case andcontrol groups, as shown in Table 1. Table 1 also revealsthat about half decreased and two-fold increased in therisk of individuals developing CRC existed for subjects whocarried the UGT1A7*1/*1 (wild type) and UGT1A7*1/*3genotypes, respectively (OR = 0.55, P<0.001; and OR =1.97, P<0.001), whilst the ORs for those possessing genotypesUGT1A7*1/*2, UGT1A7*2/*2, UGT1A7*2/*3, andUGT1A7*3/*3 did not prove to be meaningful. Table 2shows that the frequency distribution of UGT1A7genotypes in our control group followed the Hardy-Weinbergequilibrium. Four of the five variant alleles determined forthe UGT1A1 gene were found in both the case and controlgroups, whilst the allele for the variation at nucleotide1 456 was neither observed in the case nor in the controlgroup, as shown in Table 3. The incidence for variantUGT1A1 gene was not significantly different between thecase and control groups (P = 0.78). Table 3 also shows thatthe frequency distribution of UGT1A1 genotypes in ourcontrol group followed the Hardy-Weinberg equilibrium.The analysis for the genetic alleles, as listed in Tables 1 and4, indicated that only the ORs of UGT1A7*3 allele andvariant-211 allele in the UGT1A1 gene were statisticallysignificant between the case and control groups (1.91,P<0.001; and 2.03, P<0.001, respectively). Since the meanage was significantly different between the case and controlgroups, the multivariate logistical regressions were notperformed to analyze the adjusted ORs for age, gender,and the CRC-related UGT1A alleles. The interaction ofUGT1A7*3 allele and variant-211 UGT1A1 allele revealedan additive effect on the risk for the development of CRC,as the observed OR (2.34) was greater than the expectedOR (1.59) between the case and control groups, as shown

Tang KS et al. UGT1A7 gene, UGT1A1 gene, and colorectal cancer 3251

in Table 5. Table 6 illustrates the relationship between thestage of CRC and the presence of the CRC-related UGT1Aalleles. The two stage-D patients possessed both UGT1A7*3and variant-211 UGT1A1 alleles, whilst 59 (64.8%) and 53(58.2%) of the 91 stage-C patients carried UGT1A7*3 alleleand variant-211 UGT1A1 allele, respectively, and relativelyfewer proportion of patients featuring stages A and B borethese two variants [28.0% (49/175) for UGT1A7*3 alleleand 22.8% (40/175) for variant-211 UGT1A1 allele,respectively]. Compared to the number of CRC patientsfeaturing stages A and B tumors (non-metastases), the ORfor developing stages-C and -D CRCs (metastases) for thesubjects carrying UGT1A7*3 allele and variant-211UGT1A1 allele was 4.90 (P<0.001) and 4.89 (P<0.001),respectively. The results of multivariate logistical regressionsconfirmed that the metastases of CRC was associated withthe presence of UGT1A7*3 allele or variant-211 UGT1A1allele (OR = 2.51, P = 0.01; and OR = 2.71, P = 0.01,respectively), but was independent of age and gender ofCRC patients, as shown in Table 7. Table 8 shows that theinteraction between the UGT1A7*3 allele and variant-211UGT1A1 allele resulted in an additive effect on the risk ofmetastases (stages C and D) for CRC patients, as theobserved OR (6.83) was greater than the expected OR(4.56) for the development of metastases.

DISCUSSION

Since CRC is a disease of late onset[8], the mean age of ourCRC-suffering patient group was relatively greater

(mean = 65 years, range 31-92 years) than was the case forthe control group (mean = 47 years, range 27-79 years),similar to what was reported for German CRC patients(mean = 63 years, range 38-85 years) and controls (mean =48 years, range 19-85 years) from a study investigating therelationship between the SNPs of the UGT1A7 gene andCRC[6]. The association between the SNPs of certaincarcinogen metabolizing enzymes and human cancerrepresents a model combining genetic predisposition andenvironmental exposure[12]. UGTs are the most importantenzymes of phase-II detoxification proteins; therefore, itappears logical that their SNPs are worthy of studies forthe development of cancers and evaluation of specific drugtherapy regimens for cancer treatment[12]. The studyinvestigating the development of CRC amongst Germanindividuals reported that a highly significant associationbetween the presence of UGT1A7*3 allele and CRC wasobserved (OR = 2.75, 95%CI 1.60-4.71)[6]. Contrasting this,however, the results of a study concerning the treatmentof Japanese patients with irinotecan, a drug commonly used

Table 1 OR and 95%CI for CRC with UGT1A7 genotypes andalleles

Number (%)UGT1A7 genotypeor allele Cases Controls OR (95%CI) P

(n = 268) (n = 441)

UGT1A7*1/*1 76 (28.4) 184 (41.7) 0.55 (0.40–0.77) <0.001

UGT1A7*1/*2 73 (27.2) 117 (26.5) 1.04 (0.74–1.46) 0.84

UGT1A7*1/*3 77 (28.7) 75 (17.0) 1.97 (1.37–2.83) <0.001

UGT1A7*2/*2 9 (3.4) 22 (5.0) 0.66 (0.30–1.46) 0.31

UGT1A7*2/*3 23 (8.6) 32 (7.3) 1.20 (0.69–2.10) 0.52

UGT1A7*3/*3 10 (3.7) 11 (2.5) 1.52 (0.64–3.62) 0.35

UGT1A7*1 226 (84.3) 376 (85.3) 1.08 (0.71–1.64) 0.74

UGT1A7*2 105 (39.2) 171 (38.8) 1.02 (0.75–1.39) 0.92

UGT1A7*3 110 (41.0) 118 (26.8) 1.91 (1.38–2.63) <0.001

Table 2 The comparisons between the observed percentage withthe expected percentage of control subjects carrying UGT1A7*1/*2, UGT1A7*1/*3, and UGT1A7*2/*3 genotypes

Control subjects (n = 441)

Observed Expectedpercentage (%) percentage (%)1 2 P

UGT1A7*1/*2 26.5 28.9 0.081 0.960

UGT1A7*1/*3 17.0 20.4

UGT1A7*2/*3 7.3 7.1

1The expected percentage was calculated by the Hardy–Weinberg equilibrium.

For example, expected percentage of UGT1A7*1/*2 = 2× (frequency of

UGT1A7*1/*1 )1/2×(frequency of UGT1A7*2/*2)1/2 = 2×41.71/2×5.01/2 = 28.9%.

Table 3 The comparison of UGT1A1 genotypes between case andcontrol groups

Case group Control group P (2 test) (n = 268) (n = 441)

UGT1A1 genotypeNumber % Number %

Wild type 121 45.2 218 49.4 0.78

Heterozygous variation 118 44.0 186 42.23

6/71 37 96

211 G to A/normal 76 79

1 091 C to T/normal 5 11

Compound heterozygous 23 8.6 34 7.7

variation

6/7, 211 G to A/normal 13 6

6/7, 686 C to A/normal 8 20

6/7, 1 091 C to T/normal 0 2

6/7, 211 G to A/normal, 1 2

686 C to A/normal

6/7, 686 C to A/normal, 1 0

1 091 C to T/normal

211 G to A/normal, 0 4

1 091 C to T/normal

Homozygous variation 6 2.2 3 0.7

7/72 1 0

211 G to A/211 G to A 4 3

7/7, 211 G to A/normal 1 0

16/7 and 27/7 represent A(TA)6TAA/A(TA)7TAA and A(TA)7TAA/A(TA)7TAA

in the promoter area of UGT1A1 gene, respectively. 3The expected frequency is

40.7% calculated by Hardy–Weinberg equilibrium: [2×(frequency of wild type)1/2×

(frequency of compound heterozygous variation plus frequency of homozygous

variation)1/2 = 2×49.41/2×(7.7+0.7)1/2 = 40.7]. The observed frequency (42.2%) is not

significantly different from the expected frequency (40.7%) (P = 0.89 by 2 test).

Table 4 OR and 95%CI for CRC with UGT1A1 alleles

Number (%)UGT1A1 allele

Cases Controls OR (95%CI) P (n = 268) (n = 441)

A(TA)7TAA 62 (23.1) 126 (28.6) 0.75 (0.52–1.05) 0.09

Variant-211 95 (35.4) 94 (21.3) 2.03 (1.45–2.84) <0.001

Variant 686 10 (3.7) 22 (5.0) 0.74 (0.34–1.58) 0.44

Variant 1091 6 (2.2) 17 (3.8) 0.57 (0.22–1.47) 0.25


for the treatment of CRC patients, suggested that thedetermination of UGT1A7 genotypes would not be usefulfor predicting severe toxicity amongst CRC sufferers[13]. Onthe other hand, the determination of variation in thepromoter area of UGT1A1 gene was found to be clinicallyuseful for predicting the potential for severe toxicity as aconsequence of the use of irinotecan amongst Caucasiansand Japanese[14-16]. Nevertheless, the UGT1A1 gene hasnever been investigated as regarding whether or not it is arisk factor for developing CRC.

In this study, for the first time, the variation of theUGT1A1 gene was considered to constitute one of the riskfactors for causing CRC. It was interesting to find that thevariation at nucleotide 211 of the UGT1A1 gene, the mostcommon variant of the UGT1A1 gene amongst ourpopulations[3], as well as the presence of the UGT1A7*3allele or UGT1A7*3 allele plus variant-211 UGT1A1allele, was involved in the development of CRC. Thevariant-211 UGT1A1 gene has been observed to be thekey UGT1A1-gene defect for the development of neonatalhyperbilirubinemia amongst Asians[10,17-19], as opposed to thehomozygous variation in the promoter area, which has beenreported to be the responsible region amongst Caucasians[20,21].In an in vitro gene expression study, the UGT1A1 enzymeactivities of the 211 A for G substitution for the heterozygousand homozygous state appeared to have reduced to,respectively, 60.2% and 32.2% of normal values[22]. Suchdecreased enzyme activity is thought, by some, to result inthe delayed elimination of bilirubin[22]. We hypothesize thatsuch a functional defect may also occur for the eliminationof carcinogen (s), which induces the development of CRC.Another explanation for being a risk factor in thedevelopment of CRC is that variant-211 UGT1A1 allele isassociated with UGT1A7*3 allele. For example, in ourprevious study, we found that 81 (90.0%) of the 90 subjectsfeaturing the heterozygous G for A substitution at nucleotide

211 of the UGT1A1 gene and all of the 100 subjects bearingthe homozygous G 211 UGT1A1 gene were carriages ofUGT1A7*3, respectively. In this current study, a similarresult was observed: 73 (77.6%) of the 94 controls and 82(86.3%) of the 95 CRC patients featuring variant-211UGT1A1 alleles were the possessors of UGT1A7*3 alleles(Table 5). These results indicate that homozygous variationof UGT1A1 gene at nucleotide 211 and UGT1A7*3 werein complete linkage disequilibrium, whilst heterozygousvariant-211 UGT1A1 gene was highly associated withUGT1A7*3 allele. UGT1A7*3 represents the allele thatfeatures the least benzopyrene (a carcinogen)-metaboliteglucuronidation activity[6], and therefore it is thought by anumber of researchers to be a risk factor for the developmentof CRC[6,13]. Interestingly, the 211 G to A variation has beenfound amongst Asians[3,10,17-19], but not for Caucasians[23],suggesting that the clinical significance of the associationbetween variant-211 UGT1A1 and UGT1A7*3 alleles ismore important for Asian people.

Another novel finding in our study was that the risk fordeveloping metastases amongst the study-participating CRCpatients possessing the UGT1A7*3 allele or variant-211UGT1A1 allele was greater than that for those who did notpossess these variants. Moreover, an additive interactioneffect upon metastases was observed for those patients whofeatured the UGT1A7*3 allele plus the variant-211UGT1A1 allele. The pathological stage of a tumor upondiagnosis is typically determined by the extent of delay totreatment and the degree of tissue differentiation of certaininvolved tissue present[9]. Since all of our CRC patientsunderwent colorectal surgery within 2 mo of initial diagnosis,it would appear unlikely that the delayed tumor treatmentfor the patients possessing the UGT1A7*3 allele or variant-211 UGT1A1 allele would be the reason for causingmetastases. Our finding may indicate that the degree oftissue differentiation in the colorectum for CRC sufferers

Table 5 The interaction effect of the UGT1A7*3 allele and variant-211 UGT1A1 allele upon the development of CRC

Number (%)UGT1A7*3/variant-211 UGT1A1 Cases Controls OR (95%CI) P

(n = 268) (n = 441)

Absent/absent 145 (54.1) 302 (68.5) 1.00

Present/absent 28 (10.4) 45 (10.2) 1.30 (0.78–2.16) 0.39

Absent/present 13 (4.8) 21 (4.8) 1.29 (0.63–2.65) 0.33

Present/present 82 (30.6) 73 (16.5) 2.34 (1.61–3.40) <0.001

Expected by additive1 1.59

1Expected OR under no-interaction additive model.

Table 6 OR and 95%CI of stages-C and -D CRCs with CRC-relatedUGT1A alleles

Stage of CRCCRC-relatedallele C and D A and B OR (95%CI) P

(n = 93) (n = 175)

UGT1A7*3 611 (65.6%) 49 (28.0%) 4.90 (2.86–8.41) <0.001

Variant-211 551 (59.1%) 40 (22.9%) 4.89 (2.84–8.41) <0.001

UGT1A1

1All the subjects were stage-C patients, except two were stage-D patients.

Table 7 Adjusted odds ratios (AOR) and 95%CI for the differentstages of CRC with age, gender, and CRC-related UGT1A alleles

CRC stageFactor OR (95%CI) P

C and D A and B (n = 93) (n = 175)

Age >51/≤50 yr 79/14 155/20 0.68 (0.31–1.53) 0.35

Gender male/female 55/38 85/90 1.44 (0.82–2.51) 0.20

UGT1A7*3 61 (65.6%) 49 (28.0%) 2.51 (1.23–5.13) 0.01

Variant-211 UGT1A1 55 (59.1%) 40 (22.9%) 2.71 (1.31–5.58) 0.01

Table 8 The interaction effect of the UGT1A7*3 allele and variant-211 UGT1A1 allele upon the stage of CRC

CRC stageUGT1A7*3/ OR (95%CI) Pvariant-211 UGT1A1 C and D A and B

(n = 93) (n = 175)

Absent/absent 27 (29.0%) 118 (67.4%) 1.00

Present/absent 11 (11.8%) 17 (9.7%) 2.83 (1.19–6.72) 0.02

Absent/present 5 (5.4%) 8 (4.6%) 2.73 (0.83–9.01) 0.10

Present/present 50 (53.8%) 32 (18.3%) 6.83 (3.71–12.56) <0.001

Expected by additive1 4.56

1Expected OR under no-interaction additive model.

Tang KS et al. UGT1A7 gene, UGT1A1 gene, and colorectal cancer 3253

is more severe, perhaps even as much as is in the developmentof metastases, amongst individuals who feature the presenceof the UGT1A7*3 allele or variant-211 UGT1A1 allelethan is the case for CRC patients who do not possess thosealleles. Clearly, further investigation is warranted in orderto evaluate those hypotheses, the results of which shouldprovide useful information for clinical utilization in thisrealm, because CRC is still currently a life-threatening diseasein Taiwan featuring a mortality rate of 16.5 per hundred-thousands[8].

In conclusion, carriage of the UGT1A7*3 allele, as wellas the variant-211 UGT1A1 allele, is a risk factor for thedevelopment of CRC, and also is a determinant of theparticular pathological stage of CRC (metastases or not).The risk associating the development and metastases ofCRC in the individuals possessing both UGT1A7*3 andvariant-211 UGT1A1 alleles is higher than those carryingeither one of these two variants. The determination of thespecific nature of the UGT1A1 and UGT1A7 genes maybe helpful to improve the chances of prevention of CRCor a reduction in the severity of CRC for certain at-riskgroups.

REFERENCES1 Radominska-Pandya A, Czernik PJ, Little JM, Battaglia E,

Mackenzie PI. Structural and functional studies of UDP-

glucuronosyltransferases. Drug Metab Rev 1999; 31: 817-899

2 Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A,Belanger A, Fournel-Gigleux S, Green M, Hum DW, Iyanagi

T, Lancet D, Louisot P, Magdalou J, Chowdhury JR, Ritter

JK, Schachter H, Tephly TR, Tipton KF, Nebert DW. The UDPglycosyltransferase gene superfamily: recommended nomen-

clature update based on evolutionary divergence. Pharmaco-

genetics 1997; 7: 255-2693 Huang CS, Luo GA, Huang ML, Yu SC, Yang SS. Variations

of the bilirubin uridine-diphosphoglucuronosyl transferase

1A1 gene in healthy Taiwanese. Pharmacogenetics 2000; 10 :539-544

4 Zheng Z, Park JY, Guillemette C, Schantz SP, Lazarus P.

Tobacco carcinogen-detoxifying enzyme UGT1A7 and its as-sociation with orolaryngeal cancer risk. J Natl Cancer Inst 2001;

93 : 1411-1418

5 Vogel A, Kneip S, Barut A, Ehmer U, Tukey RH, Manns MP,Strassburg CP. Genetic link of hepatocellular carcinoma with

polymorphisms of the UDP-glucuronosyltransferase UGT1A7

gene. Gastroenterology 2001; 121: 1136-11446 Strassburg CP, Vogel A, Kneip S, Tukey RH, Manns MP.

Polymorphisms of the human UDP-glucuronosyltransferase

(UGT) 1A7 gene in colorectal cancer. Gut 2002; 50: 851-8567 Ockenga J, Vogel A, Teich N, Keim V, Manns MP, Strassburg

CP. UDP glucuronosyltransferase (UGT1A7) gene polymor-phisms increase the risk of chronic pancreatitis and pancre-atic cancer. Gastroenterology 2003; 124: 1802-1808

8 Department of Health, Taiwan. Leading cause of death from

cancer, Taiwan area. In: Department of Health, Taiwan, editor.Health and vital statistics. Taipei: 2002: 73-77

9 Lynch HT, Smyrk TC, Watson P, Lanspa SJ, Lynch JF, LynchPM, Cavalieri RJ, Boland CR. Genetics, natural history, tumor

spectrum, and pathology of hereditary nonpolyposis colorectal

cancer: an updated review. Gastroenterology 1993; 104: 1535-1549

1 0 Huang MJ, Kua KE, Teng HC, Tang KS, Weng HW, Huang

CS. Risk factors for severe hyperbilirubinemia in neonates.Pediatr Res 2004; 56: 682-689

1 1 Hosmer DW, Lemeshow S. Confidence interval estimation of

interaction. Epidemiology 1992; 3: 452-4561 2 T u k e y R H , S t r a s s b u r g C P . H u m a n U D P -

glucuronosyltransferases: metabolism, expression, and

disease. Annu Rev Pharmacol Toxicol 2000; 40: 581-6161 3 Ando M, Ando Y, Sekido Y, Ando M, Shimokata K, Hasegawa

Y. Genetic polymorphisms of the UDP-glucuronosyltransferase

1A7 gene and irinotecan toxicity in Japanese cancer patients.Jpn J Cancer Res 2002; 93: 591-597

1 4 Ando Y, Saka H, Asai G, Sugiura S, Shimokata K, Kamataki

T. UGT1A1 genotypes and glucuronidation of SN-38, theactive metabolite of irinotecan. Ann Oncol 1998; 9: 845-847

1 5 Iyer L, Hall D, Das S, Mortell MA, Ramirez J, Kim S, Di

Rienzo A, Ratain MJ. Phenotype-genotype correlation of in vitro

SN-38 (active metaboli te of irinotecan) and bi lirubin

glucuronidation in human liver tissue with UGT1A1 pro-

moter polymorphism. Clin Pharmacol Ther 1999; 65: 576-582

1 6 Ando Y, Saka H, Ando M, Sawa T, Muro K, Ueoka H, Yokoyama

A, Saitoh S, Shimokata K, Hasegawa Y. Polymorphisms of UDP-

glucuronosyltransferase gene and irinotecan toxicity: a pharma-

cogenetic analysis. Cancer Res 2000; 60: 6921-6926

1 7 Akaba K, Kimura T, Sasaki A, Tanabe S, Ikegami T, Hashimoto

M, Umeda H, Yoshida H, Umetsu K, Chiba H, Yuasa I,

Hayasaka K. Neonatal hyperbilirubinemia and mutation of

the bilirubin uridine diphosphate-glucuronosyltransferase gene:

a common missense mutation among Japanese, Koreans and

Chinese. Biochem Mol Biol Int 1998; 46: 21-26

1 8 Huang CS, Chang PF, Huang MJ, Chen ES, Chen WC. Glucose-

6-phosphate dehydrogenase deficiency, the UDP-glucuronosyl

transferase 1A1 gene and neonatal hyperbilirubinemia. Gastro-

enterology 2002; 123: 127-133

1 9 Huang CS, Chang PF, Huang MJ, Chen ES, Hung KL, Tsou

KI. Relationship between bilirubin UDP-glucuronosyl trans-

ferase 1A1 gene and neonatal hyperbilirubinemia. Pediatr Res

2002; 52 : 601-605

2 0 Kaplan M, Renbaum P, Levy-Lahad E, Hammerman C, Lahad

A, Beutler E. Gilbert syndrome and glucose-6-phosphate de-

hydrogenase deficiency: a dose- dependent genetic interac-

tion crucial to neonatal hyperbilirubinemia. Proc Natl Acad Sci

USA 1997; 94 : 12128-12132

2 1 Bancroft JD, Kreamer B, Gourley GR. Gilbert syndrome accel-

erates development of neonatal jaundice. J Pediatr 1998; 132:

656-660

2 2 Yamamoto K, Sato H, Fujiyama Y, Doida Y, Bamba T. Con-

tribution of two missense mutations (G71R and Y486D) of

the bilirubin UDP glycosyltransferase (UGT1A1) gene to

phenotypes of Gilbert’s syndrome and Crigler-Najjar syn-

drome type II. Biochim Biophys Acta 1998; 1406: 267-273

2 3 Bosma PJ, Chowdhury JR, Bakker C, Gantla S, de Boer A,

Oostra BA, Lindhout D, Tytgat GN, Jansen PL, Oude Elferink

RP. The genetic basis of the reduced expression of bilirubin

UDP-glucuronosyltransferase 1 in Gilbert’s syndrome. N Engl

J Med 1995; 333: 1171-1175



• Helicobacter pylori •

Deletion of cagA gene of Helicobacter pylori by PCR products

Xun Zeng, Li-Hua He, Yan Yin, Mao-Jun Zhang, Jian-Zhong Zhang

EL SEVIER




Xun Zeng, Li-Hua He, Yan Yin, Mao-Jun Zhang, Jian-ZhongZhang, Department of Diagnostics, National Institute ofCommunicable Disease Control and Prevention, Chinese Center forDisease Control and Prevention, Beijing 102206, ChinaSupported by the National Natural Science Foundation, No.30370078Correspondence to: Dr. Jian-Zhong Zhang, Department ofDiagnostics, National Institute of Communicable Disease Control andPrevention, Chinese Center for Disease Control and Prevention, POBox 5, Changping, Beijing 102206, China. [email protected]: +86-10-6173-9456 Fax: +86-10-6173-9439Received: 2004-12-28 Accepted: 2005-02-18

Abstract

AIM: Cytotoxin-associated protein (antigen) A (CagA)plays an important role in Helicobacter pylori (H pylori)pathogenesis. Our aim was to obtain cagA- mutant strainsby a new mutation method so as to better understandthe mechanism of CagA in epithelial cells.

METHODS: In contrast with the traditional methodusing suicide plasmid, we constructed cagA– mutantstrains directly with PCR products. The constructed mutantclones grew on selective media and allelic exchange wasconfirmed by Southern blot. Furthermore, two differenttransformation methods, electroporation, and naturaltransformation, were compared with regard to theefficiency of recombination.

RESULTS: The mutation by PCR products could becompleted within 3-5 d, and the recombination rate byelectroporation and natural transformation was 4.02×10-8

and 1.03×10-9 respectively. Mutation rate by electroporation(4.02×10-8) was far higher than by natural transformation(1.03×10-9) (P = 0.000<0.005).

CONCLUSION: cagA– mutant strains have been constructed,which is important for further study on the function ofCagA in epithelial cells. A mutation method by directlyusing PCR products has been proved successful with amuch higher mutation rate, and is easier, especially whenin combination with electroporation. This method couldbe widely used in gene deletion of H pylori.


Key words: H pylori; CagA; Deletion

Zeng X, He LH, Yin Y, Zhang MJ, Zhang JZ. Deletion ofcagA gene of Helicobacter pylori by PCR products. World JGastroenterol 2005; 11(21): 3255-3259


INTRODUCTIONHelicobacter pylori (H pylori), a Gram-negative bacterialpathogen, is highly successful in that it has colonized thehuman stomach in at least half of the world population.Epidemiological studies suggest that H pylori have closerelationship with chronic gastritis, peptic ulcer, gastriccancer, and gastric mucosa-associated lymphoid tissuelymphomas and some of them have been confirmed byanimal experiments[1-4]. H pylori strains are divided into twocategories, type I and type II[5]. Clinical isolates of H pylorifrom gastric diseases indicate that the pathogenesis of typesI and II strains is different[6]. Compared with type II strains,type I strains are more closely associated with duodenitis,duodenal ulcers, and gastric cancer[7]. Type I strains expressCagA protein which is encoded by a gene located in the cagpathogenicity island (cag PAI). The cag PAI is a 40-kb DNAsegment which encodes for type IV secretion apparatus fordelivering virulent proteins[8]. In contrast, type II strains lackthe entire cag PAI and do not possess the CagA and haveno cytotoxin in vitro[1,9]. It is clear that CagA is transferredinto gastric epithelial cells through type IV secretion systemand phosphorylated by src family protein tyrosine kinasesof host cells. Then, the phosphorylated CagA may lead tocell skeleton rearrangement and hummingbird phenotypeof epithelial cells[10-15]. Recent studies have shown that themain difference of CagA of clinical isolates betweendifferent gastric diseases is the amount of EPIYA motifthat can be phosphorylated at C-terminals of CagA[16,17].Other researches showed that the sequences near theEPIYA motif also had important functions, which mightaffect the function of the EPIYA motif[17,18]. Moreover,some research found that EPIYA motif of CagA had itsown functions[19].

However, the function of CagA is very complicatedand the roles of CagA in host cells are still unclear. Tobetter understand the mechanisms involved in the inductionof host cell responses to CagA and the signal transduction,it is important to construct cagA mutated strains in an easierway. Here, we report a simple mutation method by PCRproducts to directly construct cagA knockout strains with ahigh recombination rate.


Bacterial strainsH pylori 26695 was grown on Columbia agar plates, whichcontain sheep blood (5%) supplemented with vancomycin(10 g/mL), nystatin (1 g/mL), and trimethoprim (5 g/mL)for 2 d at 37 ℃ in an anaerobic jar consisting of 5% O2,100 mL/L CO2, and 85% N2. Chloramphenicol (20 g/mL)was added for the mutated strains selection.


Polymerase chain reaction (PCR)The method of one-step deletion of H pylori gene was asdescribed previously with slight modifications[20]. Briefly, thestrategy for constructing fragments with chloramphenicolresistance gene and gene allelic replacement by PCR is shownin Figure 1. H pylori genomic DNA was extracted by usingBioDev genomic DNA extraction kits (BioDev, China) asper the manufacturer’s instructions. By use of primersdesignated as C1 and C2, chloramphenicol resistance genewas amplified from plasmid pBSC103, which containedchloramphenicol resistance gene cassette (Cmr). Two pairsof primers specific for cagA gene were designed, P1-P2and P3-P4, which amplified the up- and downstream regionsof cagA gene respectively. Primers P2 and P3 were designedwith leaders at 5’ ends which were complemented with C1and C2, respectively. In addition, primers B1 and B2 weredesigned to detect whether cagA had been deleted. A pairof primers of cagE gene, E1 and E2, was selected as positivecontrol. All the primers are shown in Table 1.

Figure 1 Strategy for constructing fragments with chloramphenicol resistancegene and gene allelic replacement by PCR. Primers P1-P2, P3-P4 and C1-C2were amplified and each PCR products were purified. Each three PCR productswere mixed and amplified by primer P1 and P4. Then, the PCR product P1-4was acquired containing three fragments.

Table 1 Primers for amplifying Cmr and up- and downstream regionsof cagA

Primer Sequence (5’–3’) Expected product size

C1 GAT ATA GAT TGA AAA GTG GAT[20] 742

C2 TTA TCA GTG CGA CAA ACT GGG[20]

P1 GCC ACT ACT ACC ACC GAC AT 364

P2 ATC CAC TTT TCA ATC TAT ATC TAT GAC T

AA GCC ACT GCC GT

P3 CCC AGT TTG TCG CAC TGA TAA TCA AAT A 484

CA CCA ACG CCT

P4 GCA TCC CTA TTA GCC TCT T

B1 ATT AGA CAA CTT GAG CGA G 276

B2 ACA AAC ATC ACG CCA TC

E1 ATG CGA GCC TAT AAT GAG AAG C 841

E2 GAA GCG TGA TAA AAG AGC AAT GTT

Lineated sequences are complementary to C1 and C2. E1, E2 are positive controls

for cagE gene.

Each PCR product was purified by DNA purificationsystem (Promega, USA). Templates mixture containing 1 geach of three purified PCR products (P1-2, P3-4, C1-2)

were then amplified using primers P1 and P4 in a singlereaction to generate the linear product with Cmr. The hot-start PCR conditions are as follows: the templates mixturewere amplified five cycles without primers P1 and P4, at94 ℃ for 1 min, 45 ℃ for 1 min, and 72 ℃ for 5 min,followed by 40 cycles with primers P1 and P4, at 94 ℃ for45 s, 40 ℃ for 1 min, and 72 ℃ for 3 min. Then, the PCRproducts were extracted by Qiagen gel extraction kits (Qiagen,Germany).

H pylori DNA transformation by electroporation and naturaltransformationH pylori were harvested after 2 d’ cultivation and washedthrice by deionized water with 12% glycerol. They werethen suspended in 0.1 mL deionized water with 12%glycerol and 0.5 g PCR product was added and mixedwell. To calculate the transformation rate, 9.7×109 H pyloriwere used. For electroporation, the mixture was added intoelectroporation cuvette (Equibio, USA) and after thatsubjected to two-pulse electroporation and scraped ontoColumbia agar plates. The condition is as follows: first pulse:2500 V, 25 F, delay 10 s; second pulse: 120 V, 150 F.For natural transformation, the mixture was spotted ontoColumbia agar plates directly. After incubated for 24 h,cells were scraped onto selective Columbia agar platescontaining 20 g/mL chloramphenicol and incubated for3-5 d.

Southern blotThe transformants were harvested from selective Columbiaagar plates and genomic DNA was extracted. In order toconfirm that the correct chromosome rearrangementoccurred, transformants were initially screened by diagnosticPCR using primers B1 and B2. To prepare the blot probes,the PCR products of C1-2 were purified and labeled usingDIG DNA labeling and detection kits (Roche, Germany).The genomic DNA of transformants was digested by EcoRIfor 4 h. The protocol of Southern blot was performedfollowing instructions of DIG DNA labeling and detectionkits.

Statistical analysis2 test was used to calculate the difference of two mutationmethods. P<0.05 was taken as significant.

RESULTS

PCR products with chloramphenicol resistance genePCR products C1-2, P1-2, P3-4 and the mixture productsP1-4 are shown in Figure 2. The 1.6-kb PCR productssuggested that the three parts of PCR products C1-2, P1-2, P3-4 were linked by primers P1 and P4.

Construction and identification of transformantsH pylori transformed by the 1.6-kb PCR products P1-4 werecultivated on selective Columbia agar plates. After 3-5 d,single clones were isolated. In comparison between the twodifferent mutation methods, 39 clones were isolated byelectroporation and one clone was isolated by naturaltransformation from 9.7×109 bacteria. The mutation rates by

cagA gene of 26 695

P1 P2 P3 P4B1 B2

PCR PCR

PCR C2C1

P1 P4

P3-4C1-2P1-2

PCR

PBSC103 Cmr

Zeng X et al. Gene deletion of H pylori by PCR products 3257

electroporation and natural transformation were 4.02×10-8

and 1.03×10-9, respectively (2 test: P = 0.000<0.005). Allclones (26695△cagA) were diagnosed by primers B1, B2and E1, E2 as positive control (Figures 3A and B). Theresults suggested that the flanking region of cagA gene, wedesigned to delete in all the clones, had been replaced.Southern blot using probes labeled with chloramphenicolresistance gene further confirmed that the chloramphenicolresistance gene had only one copy in the genomic DNA ofH pylori except clones 3, 5, and 9 (Figure 3C). Consequently,the allelic exchange occurred only in the cagA gene just aswe designed in all clones except clones 3, 5, and 9.

DISCUSSION

The correlation between the expression of CagA and H pylori

virulence was described long time ago[21]. Early studiesfound that a 145-ku host protein was phosphorylated inepithelial cells after being infected by H pylori[22]. Recentinvestigations demonstrated that the phosphorylated 145-kuprotein was CagA which was delivered by type IV secretionsystem[23,24]. Then, the phosphorylated CagA, binding withSHP-2, led to rearrangements of the actin cytoskeletonand hummingbird phenotype[25,26]. The further consequenceof phosphorylated CagA is tyrosine dephosphorylation ofseveral cell proteins of 120 and 85 ku[23,27-29]. However,the precise function of this protein is still not understoodwell. To study the mechanism of CagA, we constructedCagA mutant strains.

Because H pylori has higher mutation ratio than otherbacteria, it is suitable to use PCR products as the allelicfragments to disrupt genes. The normal method for genemutation is by suicide plasmid[29] or PCR products withplasmid expressing recombinase[29]. Compared with thesetechniques, our method was much more simple and efficient.Suicide plasmid has potential disadvantage in that it mayhave many false clones without mutation. The mechanismis as shown in Figure 4. The suicide plasmid with PCRproducts to be exchanged firstly recombines with one allelicfragment and then recombines with another allelic fragment.If the second recombination does not occur, it would forma loop without flanking regions deletion. Thus, someinvestigations disrupting genes with suicide plasmid normallyuse two screening markers to confirm the flanking regionsdeletion. Another method, by recombination of PCRproducts with plasmid expressing recombinase, requires thephage Red recombinase, which is synthesized under thecontrol of an inducible promoter of an easily curable, lowcopy number plasmid. In this way, allelic fragments of PCRproducts are very short, less than 50 bp. However, phage Red recombinase may lead to other unwanted recombinationof events which can hardly be under control. Moreover,phage Red recombinase system is mainly used in E.coli.Its application in other bacteria still needs to be proved.Allelic exchange directly by PCR products has no such

Figure 2 PCR amplification for constructing fragments with chloramphenicolresistance gene and gene allelic replacements. The length of cagA/P1-4, a 1.7-kbfragment, is equal to the sum of the length of cagA/P1-2, cagA/P3-4, and cam.

Figure 3 A: Result of PCR amplified for diagnosing homologous recombinationstrains of cagA gene. Lanes 1-12 are 12 clones selected from chloramphenicol-resistant plates. Control is 26695 wild type. Twelve clones were all negative fordiagnostic primers B1-2 while control is positive, suggesting that the flanking regionof cagA gene of all the selected clones was deleted; B: Result of PCR amplified forpositive control of homologous recombination strains of cagE gene. Lanes 1-12 are12 clones selected from chloramphenicol-resistant plates. Control is 26695 wildtype. Twelve clones were all positive of cagE gene; C: Result of Southern blot fordiagnosing homologous recombination strains of cagA gene. Lanes 1-12 are 12clones selected from chloramphenicol-resistant plates. Control is 26695 wildtype. All the 12 clones except 3, 5, and 9 were positive hybridizat ion withprobes of chloramphenicol-resistant gene while control was negative.

Figure 4 Mechanism of allelic fragments recombination used by suicideplasmid. The recombination consists of two steps. In the first step, suicideplasmid with PCR products to be exchanged recombined with one allelicfragment and formed a loop. Then, the suicide plasmid recombined with anotherallelic fragment.

Mar

ker

cagA

/P1-

2

cagA

/P3-

4

cagA

/P1-

4

cam

2 000

1 000

800

600

400

200

Marker 1 2 3 4 5 6 7 8 9 10 11 12 Control

500300200

Marker 1 2 3 4 5 6 7 8 9 10 11 12 Control

900800500300100

Marker 1 2 3 4 5 6 7 8 9 10 11 12 Controlbp

21 2275 1484 2683 5302 027

A

C

B

Allelic fragment Flanking fragment Allelic fragment

cat

Chromosome

Suicideplasmid

Suicideplasmid

Suicideplasmid

Allelic fragment Flanking fragment Allelic fragment

cat

catAllelic fragment Allelic fragment

Flanking fragment

problems because it is linear DNA and cannot form theloop. In our study, we successfully deleted virB4, virB10,virB11, and cag PAI (data not shown). To confirm whetherthe flanking regions were replaced, the detective PCR wasused and results proved that the flanking fragment we wantedto replace by resistant gene was disrupted. On the otherhand, PCR for detecting chloramphenicol resistance geneindicated that all the mutated strains contained the resistantgene except the control. In addition, Southern blot usingprobes for resistant gene further confirmed that no othergene replacement occurred except in our designed region.However, the results of Southern blot suggested that genereplacement of clones 3, 5, and 9 did not happen in ourdesigned region. This could suggest that unwantedreplacement also occurred.

Disrupting H pylori chromosome gene by PCR productswas firstly described by Chalker et al[20]. However, detailswere improved by which electroporation was used in thisstudy. Normally, bacteria can take up free DNA directlyfrom their environment. This process is called transformation.However, natural transformation rate is far lower. Onefactor that affects the efficiency of transformation rate isthe size of DNA to be transformed. Natural transformationis more sensitive to the size of DNA. Compared withnatural transformation, electroporation can increase thetransformation rate by high electric shock opening the cellmembrane, through which DNA can move into cells. Duringthis process, the size of DNA has minor effects on itsmovement. Moreover, another advantage of electroporationis that it can transform not only the linear DNA such asPCR products, but also circular plasmids or phage DNA.Natural transformation cannot transform circular DNAefficiently because natural transformation requires breakageof the double-stranded DNA and degradation of one ofthe two strands so that a linear single strand can enter thecells. So, natural transformation is more suitable for up-taking PCR products which are linear. Our data indicatedthat, in H pylori, at least in 26695, the efficiency oftransformation rate of electroporation was 4.02×10-8,far higher than natural transformation, 1.03×10-9 (2 test:P = 0.000<0.005).

In conclusion, we have successfully constructed the26695 cagA- strain which is very important for investigationof mechanism of CagA. Moreover, we have developed anew mutation method which can be wildly used in genemutation of H pylori.

REFERENCES1 Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R.

Helicobacter pylori virulence and genetic geography. Science 1999;

284 : 1328–13332 Marchetti M, Arico B, Burroni D, Figura N, Rappuoli R,

Ghiara P. Development of a mouse model of Helicobacter py-

lori infection that mimics human disease. Science 1995; 267:1655-1658

3 Rossi G, Fortuna D, Pancotto L, Renzoni G, Taccini E, Ghiara

P, Rappuoli R, Del Giudice G. Immunohistochemical studyof lymphocyte populations infiltrating the gastric mucosa of

beagle dogs experimentally infected with Helicobacter pylori.

Infect Immun 2000; 68 : 4769-47724 Euler AR, Zurenko GE, Moe JB, Ulrich RG, Yagi Y. Evalua-

tion of two monkey species (Macaca mulatta and Macaca

fascicularis) as possible models for human Helicobacter pylori

disease. J Clin Microbiol 1990; 28: 2285-22905 Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P,

Borodovsky M, Rappuoli R, Covacci A. cag, a pathogenicity

island of Helicobacter pylori, encodes type I-specific and dis-ease-associated virulence factors. Proc Natl Acad Sci USA

1996; 93 : 14648–14653

6 Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, RappuoliR, Covacci A. Analysis of expression of CagA and VacA

virulence factors in 43 strains of Helicobacter pylori reveals that

clinical isolates can be divided into two major types and thatCagA is not necessary for expression of the vacuolating

cytotoxin. Infect Immun 1995; 63: 94–98

7 Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, MacchiaG, Massone A, Papini E, Xiang Z, Figura N. Molecular charac-

terization of the 128-kDa immunodominant antigen of

Helicobacter pylori associated with cytotoxicity and duode-nal ulcer. Proc Natl Acad Sci USA 1993; 90 : 5791-5795

8 Segal ED, Cha J, Lo J, Falkow S, Tompkins LS. Altered states:

involvement of phosphorylated CagA in the induction of hostcellular growth changes by Helicobacter pylori. Proc Natl Acad

Sci USA 1999; 96: 14559-14564

9 Censini S, Stein M, Covacci A. Cellular responses inducedafter contact with Helicobacter pylori. Curr Opin Microbiol 2001;

4: 41–46

1 0 Stein M, Rappuoli R, Covacci A. Tyrosine phosphoryla-tion of the Helicobacter pylori CagA antigen after cag-driven

host cell translocation. Proc Natl Acad Sci USA 2000; 97 :

1263-12681 1 Backert S, Moese S, Selbach M, Brinkmann V, Meyer TF.

Phosphorylation of tyrosine 972 of the Helicobacter pylori CagA

protein is essential for induction of a scattering phenotype ingastric epithelial cells. Mol Microbiol 2001; 42: 631-644

1 2 Selbach M, Moese S, Hurwitz R, Hauck CR, Meyer TF, Backert

S. The Helicobacter pylori CagA protein induces cortactin de-phosphorylation and actin rearrangement by c-Src inactivation.

EMBO J 2003; 22: 515-528

1 3 Tsutsumi R, Higashi H, Higuchi M, Okada M, HatakeyamaM. Attenuation of Helicobacter pylori CagA x SHP-2 signaling

by interaction between CagA and C-terminal Src kinase. J Biol

Chem 2003; 278: 3664-36701 4 Stein M, Bagnoli F, Halenbeck R, Rappuoli R, Fantl WJ,

Covacci A. c-Src/Lyn kinases activate Helicobacter pylori CagA

through tyrosine phosphorylation of the EPIYA motifs. MolMicrobiol 2002; 43: 971-980

1 5 Selbach M, Moese S, Hauck CR, Meyer TF, Backert S. Src is

the kinase of the Helicobacter pylori CagA protein in vitro and

in vivo. J Biol Chem 2002; 277: 6775-6778

1 6 Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda

AR. Variants of the 3’ region of the cagA gene in Helicobacter

pylori isolates from patients with different H pylori-associ-

ated diseases. J Clin Microbiol 1998; 36: 2258-2263

1 7 Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M,

Azuma T, Hatakeyama M. Biological activity of the Helicobacter

pylori virulence factor CagA is determined by variation in the

tyrosine phosphorylation sites. Proc Natl Acad Sci USA 2002;

99 : 14428-14433

1 8 Asahi M, Tanaka Y, Izumi T, Ito Y, Naiki H, Kersulyte D,

Tsujikawa K, Saito M, Sada K, Yanagi S, Fujikawa A, Noda

M, Itokawa Y. Helicobacter pylori CagA containing ITAM-like

sequences localized to lipid rafts negatively regulates VacA-

induced signaling in vivo. Helicobacter 2003; 8: 1-14

1 9 Mimuro H, Suzuki T, Tanaka J, Asahi M, Haas R, Sasakawa

C. Grb2 is a key mediator of helicobacter pylori CagA protein

activities. Mol Cell 2002; 10: 745-755

2 0 Chalker AF, Minehart HW, Hughes NJ, Koretke KK, Lonetto

MA, Brinkman KK, Warren PV, Lupas A, Stanhope MJ,

Brown JR, Hoffman PS. Systematic identification of selective

essential genes in Helicobacter pylori by genome prioritization

and allelic replacement mutagenesis. J Bacteriol 2001; 183:

1259–1268

2 1 Telford JL, Covacci A, Rappuoli R, Chiara P. Immunobiology


of Helicobacter pylori infection. Curr Opin Immunol 1997; 9 :

498-503

2 2 Segal ED, Lange C, Covacci A, Tompkins LS, Falkow S.

Induction of host signal transduction pathways by Helicobacter

pylori. Proc Natl Acad Sci USA 1997; 94: 7595-7599

2 3 Odenbreit S, Puls J, Sedlmaier B, Gerland E, Fischer W,

Haas R. Translocation of Helicobacter pylori CagA into gas-

tric epithelial cells by type IV secretion. Science 2000; 287:1497-1500

2 4 Selbach M, Moese S, Meyer TF, Backert S. Functional analy-

sis of the Helicobacter pylori cag pathogenicity island reveals

both VirD4-CagA-dependent and VirD4-CagA-independent

mechanisms. Infect Immun 2002; 70: 665-671

2 5 Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T,

Asaka M, Hatakeyama M. SHP-2 tyrosine phosphatase as an

intracellular target of Helicobacter pylori CagA protein. Science2002; 295 : 683-686

2 6 Tsutsumi R, Higashi H, Higuchi M, Okada M, HatakeyamaM. Attenuation of Helicobacter pylori CagA x SHP-2 signalingby interaction between CagA and C-terminal Src kinase. J BiolChem 2003; 278: 3664-3670

2 7 Selbach M, Moese S, Backert S, Jungblut PR, Meyer TF. TheHelicobacter pylori CagA protein induces tyrosine dephospho-rylation of ezrin. Proteomics 2004; 4: 2961-2968

2 8 Puls J, Fischer W, Haas R. Activation of Helicobacter pyloriCagA by tyrosine phosphorylation is essential for dephos-phorylation of host cell proteins in gastric epithelial cells. MolMicrobiol 2002; 43: 961-969

2 9 Datsenko KA, Wanner BL. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products.

Proc Natl Acad Sci USA 2000; 97: 6640-6645


Zeng X et al. Gene deletion of H pylori by PCR products 3259

• BRIEF REPORTS •

Relationship between serum cytokine levels and histopathological

changes of liver in patients with hepatitis B

Nusret Akpolat, Seyfettin Yahsi, Ahmet Godekmerdan, Kutbettin Demirbag, Mehmet Yalniz

EL SEVIER




Nusret Akpolat, Seyfettin Yahsi, Departments of Pathology,Faculty of Medicine, Flrat University, Elazlg, TurkeyAhmet Godekmerdan, Departments of Immunology, Faculty ofMedicine, Flrat University, Elazlg, TurkeyKutbettin Demirbag, Departments of Infection Diseases, Facultyof Medicine, Flrat University, Elazlg, TurkeyMehmet Yalniz, Departments of Gastroenterology, Faculty ofMedicine, Flrat University, Elazlg, TurkeyCorrespondence to: Dr. Nusret Akpolat, Flrat Üniversitesi, TlpFakültesi, Patoloji AD, 23200 Elazlg, Turkey. [email protected]: +90-424-2335221 Fax: +90-424-2387688Received: 2004-05-31 Accepted: 2004-07-08

Abstract

AIM: To investigate whether there was a relationshipbetween the liver functions and fibrosis scores of hepatitisB patients and their TNF-, IFN-, IL-4, and TGF-1 serumlevels based on the studies of liver biopsies.

METHODS: Thirty patients with chronic hepatitis B (CHB)receiving no treatment and 30 healthy individuals withnegative hepatitis serology and normal values of liverbiochemistry were studied. After serum samples of thepatients were collected, liver needle biopsy was performedon each patient. Cytokine levels were studied by ELISA.The biopsy materials were scored based on Knodell’shistological activity index.

RESULTS: In comparison of cytokine levels between CHBpatients and control group, TNF-, IL-4, and TGF-1 levelsof the patients were higher in CHB patients than in thecontrols, while IFN- level was lower in the patients thanin the controls. There were significant differences betweenthe groups in TNF-, IL-4, TGF-1, and IFN- (P<0.005,0.03, 0.002, 0.0001, respectively). There was a negativecorrelation between TGF-1 and IL-4 and IFN- (P<0.05),TNF- and the other cytokines and IFN- and IL-4 werenot correlated (P>0.05). TGF-1 was correlated withfibrosis (P<0.05). Liver necroinflammatory activity andfibrosis and TNF-, IL-4, and IFN- were not correlated(P>0.05).

CONCLUSION: In the course of HBV infection and itschronic progress, cytokines play an important role. IL-4and IFN- are effective in the chronic progression, whileTGF-1 is effective in the development of fibrosis. Serumcytokine levels may be effective tools in the estimation ofchronic progression and fibrosis development.


Key words: Hepatitis B; Cytokine

Akpolat N, Yahsi S, Godekmerdan A, Demirbag K, YalnizM. Relationship between serum cytokine levels andhistopathological changes of liver in patients with hepatitisB. World J Gastroenterol 2005; 11(21): 3260-3263


INTRODUCTION

HBV is a common infection agent leading to variousclinical patterns from subclinic infection to fulminanthepatitis. While most of the hepatitis B cases fully recover,some remain carriers and some suffer from its chroniccomplications such as fibrosis and/or cirrhosis[1-3]. Cytokineshave been claimed to have a role in the management,chronic progress, and fibrosis development in hepatitis Binfections[4,5]. This study aimed to investigate whether therewas a relationship between liver functions and fibrosis scoresof hepatitis B patients and their TNF-, IFN-, IL-4, andTGF-1 serum levels based on the studies of liver biopsies.


PatientsThirty patients (24 males, 6 females; mean age, 26 years)with positive HBsAg longer than 6 mo and chronic hepatitisB (CHB) diagnosis based on their serological resultscomprised the study group. After their serum samples werecollected, they were subjected to liver needle biopsy. Thirtyhealthy subjects (18 males, 12 females; mean age, 22 years)with negative hepatitis serology, normal liver biochemistryvalues, and without acute or chronic infections served as acontrol group of the study.

Cytokine evaluationsThe serum samples of the study and control groups werestudied by ELISA for TGF-1, IFN-, TNF- and IL-4levels with cytokine kits (Biosource, CA, USA).

Liver biopsy and histopathologic examinationEcho-guided percutaneous liver biopsy was undertaken usingan 18-G needle and when enough tissues were obtained(length of the specimen >2 cm), the biopsy samples werefixed in buffered formaldehyde for 24 h and then processedby routine tissue procedures. The tissue samples were thenembedded into paraffin blocks and sliced into 4-m-thicksections.

Each biopsy was analyzed simultaneously by two

pathologists (NA, SY) with two hematoxylin and eosin (HE)stained sections and periodic-acid Schiff with diastasestain for necroinflammatory activity (NIA). The Masson’strichrome and Sweet’s reticulin stains were reviewed forfibrosis and structural change. The biopsy samples werescored for NIA (grade) and fibrosis (stage) according to themodified Knodell’s histological activity index[6].

Statistical analysisStatistical analyses of the data were conducted with ‘SPSSfor Windows (ver.10.1)’. Student’s t test was used in thecomparison of the study and control groups, and Spearman-Pearson correlation test was used in the evaluations of therelation among cytokines, and between cytokines andother parameters (NIA, fibrosis). P<0.05 was consideredstatistically significant.

RESULTS

Age-genderIn the study group, there were 24 males (80%) and 6 females(20%) with their age ranging from 16 to 55 years (meanage: 26 years). The control group consisted of 18 males(60%) and 12 females (40%) with their age ranging from21 to 38 years (mean age: 22 years) (Table 1).

Table 1 Demographic features of the study and the control groups

Patients Control

n 30 30

Sex

Male (%) 24 (80) 18 (60)

Female (%) 6 (20) 12 (40)

Age (yr)

Age interval 16-55 21-38

Median age 26 22

Cytokine levelsIn comparison of cytokine levels between patients and controls,TNF-, IL-4, TGF-1, and IFN- levels were significantlyhigher in the patients than in the controls (P<0.005, 0.03,0.002, 0.0001, respectively) (Table 2).

Table 2 Cytokine results of the study and control groups (mean±SD)

Patients Control P

IFN- 1.57±0.59 3.44±0.41 <0.0001

IL-4 2.51±0.67 1.01±3.88 <0.030

TGF-1 822.8±121.24 419.33±37.78 <0.002

TNF- 17.7±4.98 3.1±1.21 <0.005

There was a significant correlation between IL-4 andTGF-1 (P<0.05), while TGF-1 and IFN- were negativelycorrelated (P<0.05). TNF- and other cytokines, and IFN-and IL-4 were not correlated (P>0.05).

NIA and fibrosisIn the evaluation of the liver functions of the patients, 13

patients had minimal (Figure 1A), 7 mild, 5 moderate, and5 severe (Figure 1B) NIA (Table 3). In the stage (fibrosis)evaluation, the results were as follows: 3 patients had nofibrosis, 11 had mild fibrosis, 14 had severe fibrosis, and 2had cirrhosis (Figure 2). The histopathologic values of thepatients are shown in Table 2.

Figure 1 Mild degree NIA (A) (HE, ×100) and severe NIA (B) (HE, ×40).

Figure 2 Porto-central bridging necrosis and severe fibrosis, reticuline, ×40.

Table 3 NIA and fibrosis results of the patients

NIAFibrosis Total

Minimal Mild Moderate Severe

Absent 3 0 0 0 3

Mild 6 4 1 0 11

Severe 4 3 4 3 14

Cirrhosis 0 0 0 2 2

Total 13 7 5 5 30

Cytokine, activity and fibrosisFibrosis and TGF-1 were significantly correlated (P<0.05).

A

B

Akpolat N et al. Serum cytokine levels and changes of liver in hepatitis B patients 3261

However, the other cytokines and fibrosis had no significantcorrelation (P>0.05).

DISCUSSION

Viral dissemination is mainly limited by cellular immunity.Cytotoxic T lymphocytes (Tc) play a most important role inthe host defense against viruses. T-cell receptors are activatedby the complex of HLA class I or II and viral proteins,during which CD4+ and CD8+ T lymphocytes play a role.Cytotoxic T lymphocytes exert their effects either by formingdirect cytolysis and/or apoptosis or by cytokine secretion.In the control of immune response, CD4+ cells assume thecentral role in cytokine secretions, and CD8+ cells producecytokines[5,7-9].

High levels of TNF-, a chief mediator in manyinflammatory processes, have been detected in experimentalliver damages and CHB. TNF- is known to play a keyrole in liver regeneration, proliferative response, and toreduce type I collagen, thus antagonizing the fibrogeniceffects of TGF-1. In vitro studies have shown that TNF-increased HBV mRNA demolition and inhibited HBVreplication[5,10].

In CHB, serum levels of TNF- and its secretion fromperipheral blood mononuclear cells were elevated in in vitrostudies. In addition, by intense secretion of TNF- frommononuclear blood cells in CHB patients under IFN-treatment increased transaminases were detected, andelevated TNF- levels were claimed to indicate HBVelimination[11].

In this study, TNF- values of the patients weresignificantly higher than those of the controls (P<0.005),which may indicate that TNF- can inhibit viral replicationand ongoing process of HBV elimination[11].

In the management and elimination of HBV infection,increased IFN- secretion has been reported. IFN- levelswere found to be lower in CHB patients than in the controlgroup and even lower in the decompensation phase.Furthermore, a correlation between IFN- levels and activitywas reported[7,12,13].

In comparison of serum IFN- (Th1 response) levelsbetween the study and control groups, the IFN- (Th1response) levels of the study group was significantly lowerthan those of the controls (P<0.001). However, they werenot correlated with NIA (P>0.05). Lower IFN- levels inCHB patients than in the controls may be attributed to thereduction and/or loss of IFN- efficiency during chronicprogression of the infection.

The number of IL-4 secreting Th cells has been reportedto be higher in CHB patients than in healthy individuals,and IL-4 elevation has been attributed to the persistent HBVinfection[13-15]. Similarly, in our patients, serum IL-4 (Th2response) levels were significantly higher than those in thecontrols (P<0.01).

TGF-1 (Th3 response) has an important stimulatingeffect on CHB and pathogenesis of fibrosis in patients withcirrhosis. Besides its immunosuppressive effect, its strongcorrelation with the histological degree of lobular necrosisand activity has been reported[5,7,16]. TGF-1 may also reducehepatocyte regeneration, enhance stellate cell activation, and

trigger fibrogenesis. It could stimulate extracellular matrixproteins such as collagen and fibronectin, and activation oftype I collagen and its secretion by stellate cells[17,18]. TGF-1

level was reported to reflect the histological stage and theactivation of latent TGF-1 was reported to be the startingpoint of fibrogenesis[19,20].

The serum TGF-1 levels in CHB patients in this studywere significantly higher than those in the controls (P>0.01).Furthermore, TGF-1 was significantly correlated withfibrosis (P<0.05). Thus, our findings support the findingsthat TGF-1 secretion is the most important starting pointof pathogenesis of fibrosis.

IL-4 and TGF-1 levels were significantly correlated(P<0.05), while TGF-1 and IFN- levels were negativelycorrelated (P<0.01). Lower IFN- levels in CHB aresuggestive of chronic progression. TGF-1 elevation, however,is suggestive of it as the only important immune mechanismin the development of fibrosis.

In conclusion, compared with the levels of healthyindividuals, the TGF-1, IL-4, and TNF- levels in HBVpatients are significantly higher and IFN- levels are lower.The differences are statistically significant. The positivecorrelation between serum TGF-1 levels and fibrosis suggeststhat TGF-1 may be a reliable marker for the developmentof fibrosis (cirrhosis). Evaluation of cytokine levels maycontribute to the early detection of fibrosis development,thus enabling treatment at an earlier phase. The measurementof cytokine levels in blood is a convenient and non-invasivemethod. However, it has some disadvantages. Since the timemany of the cytokines remain in blood is very short, theirdetection in blood is difficult, because many cytokines donot have endocrine effects, and do not pass into the blood.In HBV patients accompanying acute/chronic diseases,blood cytokine levels may not be a reliable marker.

Because of the reasons stated above, the measurementof cytokines at tissue level should prove more reliable inthe estimation of the course of the disease.

REFERENCES1 Crawford JM. The liver and the biliary tract. In: Cotran SR,

Kumar V, Collins T Robbins Pathologic Basis of Disease. 6thed. Philadelphia: WB Saunders Company 1999: 845-901

2 Lee RG. Diagnostic Liver Pathology, 1st ed. St Luois, Mosby

Company 1994: 57-793 Koff RS. Viral Hepatitis, Diseases of the liver, 7.th edition

(eds. Schiff L and Shiff ER). Philadelphia, J B Lippincott Com-

pany 1993: 492-5774 Gramantieri L, Casali A, Trere D, Gaiani S, Piscaglia F, Chieco

P, Cola B, Bolondi L. Imbalance of IL-1 beta and IL-1 recep-tor antagonist mRNA in liver tissue from hepatitis C virus(HCV)-related chronic hepatitis. Clin Exp Immunol 1999; 115:515-520

5 Koziel MJ. Cytokines in viral hepatitis. Semin Liver Dis 1999;19 : 157-169

6 Desmet VJ, Gerber M, Hoofnagle JH, Manns M, Scheuer PJ.Classification of chronic hepatitis: diagnosis, grading and

staging. Hepatology 1994; 19: 1513-15207 Ben-Ari Z, Mor E, Papo O, Kfir B, Sulkes J, Tambur AR, Tur-

Kaspa R, Klein T. Cytokine gene polymorphisms in patientsinfected with hepatitis B virus. Am J Gastroenterol 2003; 98:

144-1508 Jung MC, Pape GR. Immunology of hepatitis B infection.

Lancet Infect Dis 2002; 2: 43-509 Guidotti LG. The role of cytotoxic T cells and cytokines in the


control of hepatitis B virus infection. Vaccine 2002; 20 Suppl

4: A80-A821 0 Zeuzem S, Carreno V. Interleukin-12 in the treatment of

chronic hepatitis B and C. Antiviral Res 2001; 52: 181-188

1 1 Bradham CA, Plümpe J, Manns MP, Brenner DA, TrautweinC. Mechanisms of hepatic toxicity. I. TNF-induced liver injury.

Am J Physiol 1998; 275: G387-G392

1 2 Schlaak JF, Tully G, Löhr HF, Gerken G, Meyer zumBuschenfelde KH. HBV-specific immune defect in chronic

hepatitis B (CHB) is correlated with a dysregulation of pro-

and anti-inflammatory cytokines. Clin Exp Immunol 1999;115: 508-514

1 3 Jiang R, Feng X, Guo Y, Lu Q, Hou J, Luo K, Fu N. T helper

cells in patients with chronic hepatitis B virus infection. ChinMed J (Engl) 2002; 115: 422-424

1 4 Kobayashi K, Ishii M, Igarashi T, Satoh T, Miyazaki Y, Yajima

Y, Ukai K, Suzuki H, Kanno A, Ueno Y, Miura T, Toyota T.Profiles of cytokines produced by CD4-positive T lympho-

cytes stimulated by anti-CD3 antibody in patients with chronic

hepatitis C. J Gastroenterol 1998; 33: 500-5071 5 Atsukawa K, Saito H, Tsukada N, Akiba Y, Toda K, Kumagai

N, Ohishi T, Kamegaya Y, Ishii H. Th1 and Th2 cytokines

differentially regulate the transformation of Kupffer cells into

multinucleated giant cells but similarly enhance the Kupffercell-induced hepatic stellate cell proliferation. Hepatol Res 2001;20 : 193-206

1 6 Hirohashi S, Ishak KG, Kojiro M, Wangless IR, Theise ND,Tsukuma H. Hepatocel lular Carcinoma. Hamilton SR,Aaltonen LA. Pathology and Genetics Tumours of the Diges-tive System. First edition. Lyon: IARC 2000: 159-172

1 7 Schürch W, Gurley AM, Roth SI. Myofibroblast. SternbergSS. Histology for Pathologists. Second edition. Philadelphia:Lippincott Raven 1997: 129-166

1 8 Kweon YO, Goodman ZD, Dienstag JL, Schiff ER, BrownNA, Burchardt E, Schoonhoven R, Brenner DA, Fried MW.Decreasing fibrogenesis: an immunohistochemical study ofpaired liver biopsies following lamivudine therapy for chronichepatitis B. J Hepatol 2001; 35: 749-755

1 9 Neuman MG, Benhamou JP, Bourliere M, Ibrahim A,Malkiewicz I, Asselah T, Martinot-Peignoux M, Shear NH,Katz GG, Akremi R, Benali S, Boyer N, Lecomte L, Le BretonV, Le Guludec G, Marcellin P. Serum tumour necrosis factor-alpha and transforming growth factor-beta levels in chronichepatitis C patients are immunomodulated by therapy.Cytokine 2002; 17 : 108-117

2 0 Mann DA, Smart DE. Transcriptional regulation of hepaticstellate cell activation. Gut 2002; 50: 891-896

Science Editor Ma JY, Wang XL and Guo SY Language Editor Elsevier HK

Akpolat N et al. Serum cytokine levels and changes of liver in hepatitis B patients 3263


Interplay between nitric oxide and VIP in CCK-8-induced phasic

contractile activity in the rabbit sphincter of Oddi

Attila Pálvölgyi, Réka Sári, József Németh, Annamária Szabolcs, István Nagy, Péter Hegyi, János Lonovics, Zoltán Szilvássy

EL SEVIER




Attila Pálvölgyi, Réka Sári, Annamária Szabolcs, István Nagy,Péter Hegyi, János Lonovics, First Department of Medicine,Faculty of Medicine, University of Szeged, H-6720 Szeged, Korányifasor 8-10, HungaryJózsef Németh, Department of Pharmacology, Medical Universityof Pécs, H-7643 Pécs, Szigeti u. 12, HungaryZoltán Szilvássy, Department of Pharmacology, Medical Universityof Debrecen, H-4032 Debrecen, Nagyerdei krt. 98, HungarySupported by The Wellcome Trust (Grant No. 022618), by theHungarian Scientific Research Fund (D42188, T43066 and T042589)and by the GVOP-3.2.2.-2004-07-0001/3.0Correspondence to: Réka Sári PhD, First Department of Medicine,University of Szeged, H-6701, PO Box 469,Hungary. [email protected]: +36-62-545200 Fax: +36-62-545185Received: 2004-06-16 Accepted: 2004-07-27

Abstract

AIM: The sphincter of Oddi (SO) plays an important role indelivery of bile into the duodenum. To establish whethervasoactive intestinal polypeptide (VIP) and nitric oxide (NO)were involved in phasic contractile activity of the rabbitSO stimulated by cholecystokinin-octapeptide (CCK-8).

METHODS: Isolated SO muscle rings were cleaned of fatand mounted horizontally on two small L-shaped hooksone of which was connected to a force transducer for themeasurement of isometric tension. The experiments werecarried out in a thermostatically controlled (37±0.2 ℃)organ bath (5 mL) containing Krebs solution. The organfluid was gassed with 95% O2 and 50 mL/L CO2 to keepthe pH at 7.40±0.05. Contractile responses to CCK-8(1 mol/L) were evaluated in the presence and absenceof NG-nitro-L-arginine (LNNA), an inhibitor of NO synthase(100 mol/L), and (p-chloro-D-Phe6-Leu17)-VIP (VIPa,30 mol/L), a VIP receptor antagonist.

RESULTS: CCK-8 stimulated the phasic activity of the SO.NO synthase inhibition increased the frequency and amplitudeof contractions with a slight increase in developed tension.Pre-incubation with VIPa also attenuated this CCK-8 effect.The combined application of LNNA and VIPa abolishedthe phasic activity of the muscle rings with a marked increasein tension in response to CCK-8.

CONCLUSION: VIP and NO together contribute to anincrease in phasic activity of SO.


Key words: Sphincter of Oddi; CCK; VIP; NO; LNNA

Pálvölgyi A, Sári R, Németh J, Szabolcs A, Nagy I, Hegyi P,Lonovics J, Szilvássy Z. Interplay between nitric oxide andVIP in CCK-8-induced phasic contractile activity in the rabbitsphincter of Oddi. World J Gastroenterol 2005; 11(21):3264-3266


INTRODUCTION

The sphincter of Oddi (SO) plays an important role in deliveryof bile into the duodenum. In animals like rabbits, opossumsand guinea pigs, the partially extraduodenal sphincter operateslike a peristaltic pump that actively squeezes bile into theduodenum[1]. Thus, contraction and relaxation mechanismsare of equal importance in controlling normal sphincterfunction. Regulation of the relaxation function of thissphincter is mainly executed by non-adrenergic, non-cholinergic(NANC) nerves[2]. With regard to the neurotransmitters involved,evidence favors a role for vasoactive intestinal polypeptide(VIP)[2] and nitric oxide (NO) in various species including guineapigs[3], rabbits[4], and humans[5]. In the rabbit SO the NANCrelaxation is completely blocked by NG-nitro-L-arginine methylester (L-NAME), an inhibitor of NO-synthase[4]. The inhibitoryeffect of L-NAME can be reversed by concurrent incubationwith L-arginine but not D-arginine indicating the response tobe essentially nitrergic. It is widely accepted that NO evokessmooth muscle relaxation through formation of cyclic GMPwithin muscle cells[6]. Nevertheless, NO has been shown tostimulate the release of VIP from enteric nerve terminals, aneffect to enhance or contribute to its ‘per se’ relaxant effect[7].

Much less is known about the influence of endogenoussubstances that promote the peristaltic pump-like sphincterfunction through generating phasic contractions. Cholecystokinin(CCK) is generally regarded as the major hormone regulatingpostprandial SO motility. CCK has been shown to initiateVIP and acetylcholine release at both pre- and post-junctionalsites in enteric nervous system through CCKA receptors,whereas CCKB receptors seem to mediate NO release at post-junctional sites[8]. Nevertheless, the contribution of NO andVIP release to CCK-induced stimulation of phasic contractileactivity of the SO has not been explored. The present workwas therefore concerned with the possibility that an interplaybetween NO and VIP would contribute a significant degreeto CCK-induced phasic contractions in the SO of rabbits.


EthicsThe experiments in the present work conformed to European

Guiding Principles for Care and Use of ExperimentalAnimals. In addition, the experimental protocol applied wasapproved by the local ethical board of University of Szegedand University of Debrecen, Hungary.

Isometric tension measurementsThese measurements were described in detail elsewhere[4].Biliary SO muscle rings of approximately 6 mm in lengthfrom adult male New Zealand white rabbits weighing 3 500-4 000 g were prepared. The papilla Vateri was eliminatedand the ampullary part of the muscle rings of approximately3 mm in length were mounted horizontally on two small L-shaped glass hooks of which one was connected to a forcetransducer (SG-O2, Experimetria, Budapest, Hungary)attached to a six channel polygraph (R61 6CH, Mikromed,Budapest, Hungary) for measurement and recording ofisometric tension as described[4]. One muscle ring was preparedfrom one animal. The experiments were carried out in anorgan bath (5 mL) containing Krebs bicarbonate buffer (mM:NaCl 118.1, KCl 4.7, MgSO4 1.0, KH2PO4 1.0, CaCl2 2.5,NaHCO3 25.0, glucose 11.1) which was maintained at37 ℃ and aerated continuously with carbogen (50 mL/L CO2

in oxygen, Ph. Eur. III.). The initial tension was set at 10mN and the rings were allowed to equilibrate for over anhour. Cholecystokinin octapeptide (CCK-8, 0.01-10 mol/L),atropine (1 mol/L), tertrodotoxin (TTX, 1 mol/L), (p-chloro-D-Phe6, Leu17)-VIP (VIPa, 30 mol/L), and NG-nitro-L-arginine (LNNA, 100 mol/L) were added directlyto the organ bath in 50-150 L volume.

Experimental protocolThe muscle rings underwent brief experimental protocolsas follows. Protocol 1: the preparations with a resting tensionof 10 mN were exposed to cholecystokinin-octapeptide(CCK-8) (0.1 mol/L, the EC50 for the peptide in thispreparation) subsequent to an equilibration period of over60 min. After a stable contractile response was obtained,the preparations were washed until tension returned toprevious baseline level. Protocols 2 and 3 were to study theeffect of atropine and TTX (1 mol/L for both) on CCK-8-induced increase in phasic activity. Atropine and TTXwere applied either prior to CCK-8 or at maximum increasein phasic contractions, respectively. Protocols 4 and 5 wereto study the effect of NO synthase inhibition (100 mol/LLNNA) and neutralization of VIP action on CCK-8-inducedresponses. The preparations were pre-incubated with either

100 mol/L LNNA or 30 mol/L VIPa for over 20 min,and then CCK-8 (0.1 mol/L) was given. In protocol 6,LNNA and VIPa were applied together prior to CCK-8.Except for protocol 3, baseline contractile patterns werere-gained subsequent to washout; in case of TTX, however,the decrease in baseline contractile amplitudes could not beovercome even by extensive washout.

Drugs and chemicalsAtropine, TTX, LNNA, and CCK-8 were obtained fromSigma Chemical Company (St. Louis, USA). Polyclonal VIPawas a generous gift from Joseph Nemeth (DepartmentPharmacology, Medical University of Pecs). The compoundswere dissolved in Krebs solution and added directly to theorgan bath except for LNNA which was dissolved in ethanoland then diluted with Krebs solution.

Data and statistical analysisParameters producing the data for evaluation were as follows.The amplitude of contractions (mN) was referred to as thedifference between peak contractions and relaxations. Theaverages of the amplitudes were calculated for every minute(results are expressed as mean±SE, n = number of freque-ncies in a minute). The frequencies of contractions (cpm) werecalculated for every minute. Statistical analysis was performedfor every 10 min of the experiments using either Student’st-test (when the data consisted of two groups) or ANOVA(when three or more data groups were compared). Resultswere expressed as mean±SE, n = 5, P<0.05 was acceptedas statistically significant.

RESULTS

Effect CCK-8 on isolated SO motilityCCK (0.1 mol/L) increased frequency and amplitude ofcontractions, and elevated the developed tension of themuscle rings (Figures 1A-C).

Effect of atropine and TTX on CCK8-stimulated SO contractionsCCK-8-stimulated SO contractions were blocked by TTX(1 mol/L). Atropine in the same concentration (1 mol/L)also abolished agonist-induced contractile activity.

Effect of LNNA and VIPa on CCK-8-stimulated SO motilityNO synthase inhibition by LNNA markedly increased thefrequency and amplitude of contractions with a slight increase

Figure 1 Effects of LNNA and VIPa on CCK-8-stimulated mechanical activityof rabbit SO in vitro. A: Summary of the effect of LNNA, VIPa and combinedapplication of these substances on CCK-8-induced change of tension. Data aremean±SD, n = 6, aP<0.05 vs baseline. B: Summary of the effect of LNNA, VIPa

and combined application of these substances on CCK-8-induced change ofamplitudes. Data are mean±SD, n = 6, aP<0.05 vs baseline. C: Summary of theeffect of LNNA, VIPa and combined application of these substances on CCK-8-stimulated contractile frequency. Data are mean±SD, n = 6, aP<0.05 vs baseline.

Tension (mN) Amplitude (mN) Frequency (cpm)

VIPa+LNNA+

CCK-8VIPa+CCK-8

LNNA+CCK-8

CCK-8

BASELINE

VIPa+LNNA+

CCK-8

VIPa+CCK-8

LNNA+CCK-8

CCK-8

VIPa+LNNA+

CCK-8

VIPa+CCK-8

LNNA+CCK-8

CCK-8

a

a

a

a

a

a

a

a

a

0 0

BASELINE BASELINE

0 5 10 15 20 25 30 0 5 10 15 20 25 30 0 5 10 15 20 25 30 35 40 45

A CB

Pálvölgyi A et al. No and VIP in SO 3265

in developed tension. Pre-incubation with polyclonal VIPaattenuated each CCK-8 effect. Combined application of LNNAand VIPa significantly increased the tension of CCK-8, butabolished the phasic contractile activity of the muscle rings(Figures 1A-C). Separate application of LNNA and VIPapotentiated the effect of CCK-8-induced phasic contractions,while combined application of these substances completelyabolished the phasic activity of the muscle rings with a markedincrease in tension in response to CCK-8. These resultsindicated that VIP and NO together are mediators of theCCK-8-stimulated phasic contractions in rabbit SO.

DISCUSSION

The results showed that the CCK-8-induced increase in phasiccontractile activity characterized by an amplification offrequency of contractions superimposed on an increase intension was augmented by NO synthase inhibition. Theamplitude of contractions, exhibited only a tendency toincrease when the effect of CCK-8 on rings pre-exposed toLNNA was studied. Neutralization of VIP yielded an increasein tension and a reduction of contractile amplitude with noeffect on frequency of contraction. NO synthase inhibitiontogether with neutralizing VIP completely blocked any phasicactivity after CCK-8 with a substantial increase in tensioni.e., this combined treatment converted the phasic activitystimulating effect of CCK-8 to a pure increase in toniccontraction.

As far as the mechanism of action of CCK on the SO isconcerned, previously it has been postulated that CCK atleast in the dog sphincter exerts the majority of its effectthrough stimulation of receptors on smooth muscle cells[9].Nevertheless, results by Behar and Biancani[10] revealed thatblockade of action potential propagation by TTX abolishesthe inhibitory effect of CCK on sphincter mechanics convertingits action to stimulation. This evokes the concept of theinvolvement of neural inhibitory mechanisms in the CCKeffect that interact with stimulatory impulses targeted tosmooth muscle receptors. Regarding neural inhibition onSO of rabbits, we have shown that it is primarily of nitrergicorigin[4]. NO besides producing smooth muscle relaxationmay enhance the release of VIP, which in turn may furtherstimulate NO formation[7]. Moreover, CCK A receptorshave been found to stimulate VIP and acetylcholine releasefrom enteric nerve terminals at pre-and post-junctional sites,whereas CCK B receptors seem to elicit NO release at post-junctional sites[8]. The results that neither LNNA nor VIPawas able to block the phasic activity stimulating effect ofCCK-8 but combined application of these substances resultedin conversion of CCK-8 effects to a full contractile oneseem to support the assumption that an interplay betweenVIP and NO is of crucial importance in the developmentof phasic activity by CCK-8 in the rabbit SO. Moreover,since both TTX and atropine could block the effect ofCCK-8, the majority of the effects of CCK-8 seem to bemediated by cholinergic impulses.

To the best of our knowledge this report is the first todescribe that the integrity of neural nitrergic and VIP-

mediated processes are pre-requisites for the ability of CCK-8 to stimulate sphincter motility. Since in rapacious animals,the peristaltic pump-like sphincter activity actively squeezesbile into the duodenum, and this sphincter activity is underlainby neurotransmitter release from either intrinsic or sensoryneurons, it is not surprising that diseases that deterioratethese nerves impair sphincter function as well[11,12]. Of course,based on the present results it is not possible to estimatewhether or not the neural responses participate in CCK-8-induced responses. However, that VIP and NO togethercomprise the principle neural effectors of relaxationinterrupting tonic contractions evoked by CCK-8 in therabbit SO seem to be supported by the data obtained. Similarly,the present work has not elucidated the precise role ofcholinergic impulses implicated in either contractile orrelaxant effects of CCK-8. Nevertheless, since similar to thatseen with TTX, atropine also blocked the CCK-8 effects,thus it is possible that cholinergic nerves besides elicitingcontractions may facilitate relaxation through releasing NOor VIP or other currently undefined relaxants.

REFERENCES1 Toouli J, Baker RA. Innervation of the sphincter of Oddi:

physiology and considerations of pharmacological interven-tion in biliary dyskinesia. Pharmacol Ther 1991; 49: 269-281

2 Pauletzki JG, Sharkey KA, Davison JS, Bomzon A, Shaffer EA.Involvement of L-arginine-nitric oxide pathways in neural relax-

ation of the sphincter of Oddi. Eur J Pharmacol 1993; 232: 263-2703 Wiley JW, O’Dorioso TM, Owyang C. Vasoactive intestinal

polypeptide mediates cholecystokinin-induced relaxation of

the sphincter of Oddi. J Clin Invest 1988; 81: 1920-19244 Lonovics J, Jakab I, Szilvássy J, Szilvássy Z. Regional differ-

ences in nitric oxide-mediated relaxation of the rabbit sphinc-ter of Oddi. Eur J Pharmacol 1994; 255: 117-122

5 Slivka A, Chuttani R, Carr-Locke DL, Kobzik L, Bredt DS,Loscalzo J, Stamler JS. Inhibition of sphincter of Oddi func-tion by the nitric oxide carrier S-nitroso-N-acetylcysteine inrabbits and humans. J Clin Invest 1994; 94: 1792-1798

6 Moncada S, Palmer RM, Higgs EA. Nitric oxide: physiology,pathophysiology, and pharmacology. Pharmacol Rev 1991;43 : 109-142

7 Allescher HD, Kurjak M, Huber A, Trudrung P, Schusdziarra

V. Regulation of VIP release from rat enteric nerve terminals:evidence for a stimulatory effect of NO. Am J Physiol 1996;271: G568-G574

8 Vergara P, Woskowska Z, Cipris S, Fox-Threlkeld JE, Daniel

EE. Mechanisms of action of cholecystokinin in the caninegastrointestinal tract: role of vasoactive intestinal peptide andnitric oxide. J Pharmacol Exp Ther 1996; 279: 306-316

9 Lonovics J, Lenart Z, Velosy B, Nemeth J, Varro V, Thompson

JC. Differences in the mechanism cholecystokinin, substanceP, and vasoactive intestinal polypeptide induced sphincter ofOddi relaxation in dogs. In: Peptides Chemistry, biology, inter-action with proteins. Penke B, Torok A, ed. New York: Walter

de Gruyter 1988: 171-1741 0 Behar J, Biancani P. Effect of cholecystokinin and the octapep-

tide of cholecystokinin on the feline sphincter of Oddi and gallbladder.Mechanisms of action. J Clin Invest 1980; 66: 1231-1239

1 1 Szilvassy Z, Nagy I, Szilvassy J, Jakab I, Csati S, Lonovics J.Impaired nitrergic relaxation of the sphincter of Oddi ofhyperlipidaemic rabbits. Eur J Pharmacol 1996; 301: R17-R18

1 2 Szilvassy Z, Sari R, Nemeth J, Nagy I, Csati S, Lonovics J.

Improvement of nitrergic relaxation by farnesol of the sphinc-ter of Oddi from hypercholesterolaemic rabbits. Eur J Pharmacol1998; 353: 75-78




Predictors of common bile duct lithiasis in laparoscopic era

George Sgourakis, Georgia Dedemadi, Athanasios Stamatelopoulos, Emmanuel Leandros, Dionysius Voros, Konstantinos

Karaliotas

EL SEVIER




George Sgourakis, Georgia Dedemadi, Athanas iosStamatelopoulos, Emmanuel Leandros, Dionysius Voros,Konstantinos Karaliotas, 2nd Surgical Department of Korgialenio-Mpenakio Red Cross Hospital, Athens, Greece; SurgicalDepartment of Hippocration, University Hospital of Athens,Greece; Surgical Department of Areteion, University Hospital ofAthens, GreeceCorrespondence to: George Sgourakis, MD, PhD, 11 Mantzaroustr., Neo Psychiko, 15451 Athens, Greece. [email protected]: +30-210-6716015Received: 2004-05-25 Accepted: 2004-07-12

Abstract

AIM: To analyze retrospectively the records of 294conse-cutive patients operated upon for gallbladderstones, to determine the predictive factors of synchronouscommon bile duct (CBD) stones and validate prospectivelythe generated model.

METHODS: The prognostic estimation of a biochemicaltest and ultrasonography alone to differentiate between theabsence and presence of choledocholithiasis was assessedusing receiver operating characteristics curve analysis.Multivariate analysis was employed using discriminant analysisfor establishment of a best model. Prospective validationof the model was made.

RESULTS: Discriminant forward stepwise analysisdisclosed that high values (≥ 2×normal) of SGOT, ALP,conjugated bilirubin and CBD diameter on ultrasound ≥10 mm were all prognostic factors of CBD lithiasis inunivariate and multivariate analysis, P<0.01. History wasnot included in the model. Prospective validation of themodel was performed by multivariate analysis using VisualGeneral Stepwise Regression. Positive predictive value,when considering all these predictors, was 93.3%, whilethe negative predictive value was 88.8%. Sensitivity of themodel was 96.5% and specificity 80%.

CONCLUSION: The above model can be objectively appliedto predict the presence of CBD stones.


Key words: CBD lithiasis; Predictors of CBD stones;Laparoscopic CBD exploration

Sgourakis G, Dedemadi G, Stamatelopoulos A, Leandros E,Voros D, Karaliotas K. Predictors of common bile duct lithiasisin laparoscopic era. World J Gastroenterol 2005; 11(21):3267-3272


INTRODUCTION

Evolving laparoscopic techniques of common bile duct (CBD)exploration aroused interest on the debate of the optimalmanagement of patients with suspected CBD stones, whounderwent laparoscopic cholecystectomy. CBD stones arepresent in 10-15% of patients, though the incidence declinesin recent years after the widespread acceptance of laparoscopiccholecystectomy. Further inquiry of the usefulness of CBDstone predictors is, therefore, highly necessary. The recordsof 294 consecutive patients operated upon laparoscopicallyfor gallbladder stones from June 1993 until June 1994 weretaken into analysis retrospectively.

Forty-two patients were documented to have CBD lithiasis,based on the data of intraoperative cholangiography, whichwas technically feasible in 263 patients.

An optimal model ïf CBD stone prediction was establishedbased on these data and validated prospectively by VisualGeneral Stepwise Regression (VGSR) in a subsequent seriesof patients undergoing laparoscopic cholecystectomy.


All patients admitted for extrahepatic biliary tree pathology,were evaluated with ultrasonography and liver enzyme profilein addition to a detailed history. Enrollment to this study wasstrictly limited to the patients who fulfilled at least one of theprognostic factors for CBD lithiasis found in a preliminaryretrospective study.

The records of 294 consecutive patients operated uponlaparoscopically for gallbladder stones from June 1993 to June1994 were taken into analysis retrospectively.

Among the 294 patients, only 280 had a complete recordwith detailed histories (present and past), ultrasound, liverenzyme profile at admission (except for GT and SGPT) andintraoperative cholangiography. Biochemical results wereconsidered abnormal for a patient with any of the followings:direct bilirubin >1 mg/100 mL, alkaline phosphatase >300 U/L, alanine aminotransferase >35 U/L. Dilatationof CBD was considered if a diameter of >6 mm was measuredin its midportion. The suspicion of presence of CBD stonesseen on ultrasound was also recorded.

Forty-two patients (14%) were documented to have CBDlithiasis according to the data of intraoperative cholangiographywhich was technically feasible in 263 (94%) patients.

Predictors of CBD lithiasis were defined for better patientselection in a prospective randomized trial comparing laparo-scopic CBD exploration and cholecystectomy vs ERCP, endo-scopic sphincterotomy and laparoscopic cholecystectomy[1].

From April 1997 to August 2000, all the patients presentedwith, at least one of the predictors, as dictated by the preliminary


retrospective study were enrolled in the protocol. Excludedfrom the study were patients:·With physical status ASA ≥III·Who did not sign the informed consent·Who had past abdominal procedures which should

exclude laparoscopy·Suffering from malignancy or other pathology,

affecting life expectancy·With recurrence of CBD lithiasis·Who had to be operated upon for concurrent pathology·With coagulation disorders·Presented with multiple intrahepatic lithiasis·Who had concurrent pathology of the extrahepatic

biliary tree (fistulas, choledochal cysts, etc.).The remaining patients were assigned into two groups

(laparoscopic CBD exploration, group A and combinedapproach, group B), by opening a sealed envelope. The timeinterval between the onset of acute symptoms and interventionwas 24-48 h.

Demographic characteristics, mean values and standarddeviations of liver function tests and ultrasonographic findingsof the 78 patients are depicted in Tables 1-3, respectively.

After confirming CBD lithiasis with intraoperative chola-ngiography, patients of group A were addressed laparoscopically,either with direct CBD exploration or with trancystic ductstone extraction and cholecystectomy. Patients of group Bwere referred for ERCP and potential ES and stone extractionthrough the ampulla, and laparoscopic cholecystectomy wasdone later (24 or 48 h).

Table 1 Clinicopathologic characteristics of patients of both groups

Group A Group B

Number 36 42

Female 21 25

Male 15 17

Age (yr) 43-88 46-89

Positive history

Fever 3 3

Jaundice 8 9

Chills 1 1

Pancreatitis 1 1

Total 13 14

Ultrasonographic CBD diameter ≥ 10 mm 33 37

SGOT ≥ 2 normal 21 26

dBil ≥ 2 normal 15 17

ALP ≥ 2 normal 18 22

Table 2 Mean values and standard deviation of liver function tests

Group A Group B

SGOT

Mean 197 U/L 189 U/L

Standard deviation 38 U/L 35 U/L

Bilirubin

Mean 5.2 mg/100 mL 4.1 mg/100 mL

Standard deviation 2.2 mg/100 mL 1.8 mg/100 mL

ALP

Mean 540 U/L 469 U/L

Standard deviation 87 U/L 81 U/L

Laparoscopic direct common bile duct exploration[2-5]

Selection of the flexible choledochoscope was made betweenone of the medium size (10 Fr, 3.3 mm) and the other of thelarge size (15 Fr, 5.5 mm). The small size choledochoscopesare not proper for this method because of inefficient vision,inadequate lavage facilities and the need for large basketsfor sizable stone pick up.

The rest of the equipment included 30o laparoscope,curved pair of scissors, knife, a Semm forceps, irrigation-suction device, and a pair of laparoscopic needle holders(alternatively an endostitch apparatus). CBD suturing wasmade by 4/0 coated vicryl or 4/0 polysorb threads.

In addition to the classical sites of port placement inlaparoscopic cholecystectomy, a fifth 11 mm port was putat right of the midline (in the immediate proximity) to thexiphoid for the insertion of the choledochoscope and cholan-giography was performed.

It was important that the continuity of the cystic ductwith both the CBD and the gall bladder was maintainedsince this enables fixation of the CBD by lateral and upwardtraction of the gall bladder. After that, we were able to proceedto the anterior dissection of the supraduodenal segment ofthe CBD in about a 2-cm long and 1-cm wide area, whilethe duodenal bulb was mobilized downward. Mobilizationof hepatic artery or its right branch is necessary if theseentities cross the bile duct in this region.

Choledochotomy procedure: the opening should notexceed 1.0 cm at first instance. External massage andmanipulations of the lower bile duct is surprisingly efficaciousand should always be tried as the first measure. After that,a biliary balloon catheter was inserted through the subxiphoidport into the bile duct. Blind biliary balloon stone dislodgmentwas successful in some of our patients. Smaller stones canalso be removed using the sucker tip.

Visually guided extraction with the flexible choledochoscopeby wire baskets or long balloon catheters of Fogarty typewas successful in the vast majority of our patients. Uponcompletion of the procedure, the entire biliary tract (proximaland distal) was inspected and shown to be free of calculi anddebris and a cholangiogram was also done to ensure completeduct clearance.

Drainage of the extrahepatic biliary tree was done througha T-tube insertion or through the cystic duct stump withprimary closure of the bile duct. Closure is accomplished withinterrupted 4/0 absorbable sutures. After cholecystectomy,a subhepatic drain was inserted.

Cholangiography was performed on the 8th postoperativeday and the T-tube or the cystic duct cannula was removed2 d later.

Table 3 Ultrasonographic findings

Group A Group B

CBD diameter <10 3 5

CBD diameter ≥ 10 33 37

CBD diameter

Median 10.5 11

Range 5-21 5-23

Choledocholithiasis

Positive 11 14

Suspected 18 21

Sgourakis G et al. CBD lithiasis in LC 3269

Laparoscopic trancystic duct exploration[6]

Flexible choledochoscope must have an outside diameterof no larger than 3 mm.

Not infrequently, the duct was cleared before the scopehad been completely prepared by noncholedochoscopicmaneuvers such as pharmacologic relaxation of the sphincterof Oddi, administration of 1-2 mg of intravenous glucagon,flushing of the cholangiocatheters with saline, balloon andhelical or straight basket techniques.

Three tools are available to dilate the cystic duct forcholedochoscope entry: curved forceps, mechanical graduateddilators and pneumatic high pressure balloon dilators. Thecholedochoscope was inserted through the midclavicularport into the cystic duct. Choledochoscopic stone retrievalwas most commonly achieved using a basket inserted throughthe channel of the scope.

Balloon-tipped catheters were also used. These cathetersgenerally do not fit in the working channel of the newersmall-diameter scopes, so they must be inserted adjacent tothe scope. In cases that scope or stone passage was notfeasible, the cystic duct wall was cut longitudinally towardsthe common duct. If the incision included or abut the cysticduct-CBD junction, some stitches were sewn. Most oftenthis was accomplished without the placement of a T-tubeunless there was a good reason for doing so.

Patients were followed every 3 mo by phone and every6 mo by personal conference and if mandatory, laboratorytests and ultrasonography were prescribed. There were noviolations of the protocol.

Statistical analysisThe corresponding proportion and total number of patientswere expressed for each clinical predictor. When distributednormally, continuous variables were described using meanand standard deviation, if not they were expressed as medianand range. All parameters were analyzed as categorical variables.

A sensitivity analysis of all possible predictors wasconducted through an ST Neural Network. The prognosticestimation of a biochemical test alone to differentiate betweenthe absence and presence of choledocholithiasis was assessedusing receiver operating characteristics (ROC) curve analysis.For each test, one cut-off value was chosen by determiningthe point closest to an ideal test with 100% specificity andsensitivity (the upper most left corner of the graph).

Discriminant forward stepwise analysis, using the idealcut-offs determined at ROC curve analysis, was employedto retrospective data to establish the model that could bestpredict the presence of a CBD stone. Positive and negativepredictive values were determined for all predictors. Prospectivevalidation of the model that predicts choledocholithiasis wasdone by VGSR. In addition, the parameter coefficients ofthe initial model were compared with those obtained fromthe data of the prospective study.

Statistical analysis was made using the Statistica (StatSoft)software. Results with P values less than 0.05 were consideredto be statistically significant.

RESULTSRetrospective studyEight potential prognostic factors (positive history, past and

present; abnormal values of LDH; amylase; SGOT; dBil;ALP and CBD diameter on ultrasound) were consideredfor evaluation as predictors of choledocholithiasis. A sensitivityanalysis was conducted through an ST Neural Network.Variables pruned because of training, and verification ratiosbelow the threshold were: past history, amylase and lactatedyhydrogenase, and were removed from the underdevelopmentmodel of predictors. The “rank” on sensitivity datasheetwas CBD diameter = 1, ALP =2 , dBil = 3, SGOT = 4. Thebest network found had good performance: correct classificationrate 0.894737 and area under ROC curve 0.946328. ROCcurve was used to select an optimum decision threshold(value that equalizes the probability of this classification ofeither class of false positive and false negative). Diameterof the supraduodenal CBD documented by ultrasonographywas categorized into two cut-off values: >6 and ≥10 cm.The ideal cut-off was 10 mm. History was categorized aspositive (presence of fever, jaundice, chills, pancreatitis) ornegative. Categorical classification of liver enzymes was doneby two values: simply elevated and equal or above twice normal.The ideal cut-off value was twice as normal.

In 42 patients with choledocholithiasis, positive historieswere present in 36%, CBD diameter ≥10 mm on ultrasoundin 95% and more or equal twice normal values of SGOTin 59%, dBil in 42%, and ALP in 50%. In the remaining238 patients without evidence of CBD lithiasis in intraoperativecholangiography, positive histories were present in 5%, CBDdiameter ≥10 mm in 15% and more or equal twice normalvalues of SGOT in 11%, dBil in 7% and ALP in 7%.

Discriminant forward stepwise analysis disclosed thathigh values (≥2×normal) of SGOT, ALP, conjugatedbilirubin and CBD diameter on ultrasound ≥10 mm wereall prognostic factors of CBD lithiasis in univariate andmultivariate analysis at a level of P<0.01. History was notincluded in the model.

Positive predictive value (PPV), when considering allpredictors was 93%, while the negative predictive value(NPV) was 95%.

Prospective studyFrom April 1997 to August 2000, 97 patients fulfilled thecriteria of enrollment in the protocol as dictated by thepreliminary retrospective study.The following 19 patients were excluded from the study:·Physical status ≥ASA III (seven patients)·Did not sign the informed consent (six patients)·Past procedures which should exclude laparoscopy

(two patients)·Recurrence of CBD lithiasis (one patient)·Huge esophageal hernia (one patient)·Von Willebrand disease (one patient)·Choledochal cyst (one patient).There were no statistically significant differences regarding

demographic and clinicopathological characteristics, ultraso-nography and liver function tests among patients of bothgroups (Mann-Whitney U test was applied). Postoperativefollow-up was made for 7-36 mo (median 22.36 mo).

Group A: Twenty-eight of thirty-six patients of group A hadCBD lithiasis, 12 patients had direct CBD exploration and,the trancystic duct approach was applied in the remaining 16.

The application of direct CBD exploration was unsuccessfulin three patients: there was conversion to open in one patientand the rest two patients were referred for endoscopic stoneextraction. We had only one failure in the application of thetrancystic duct approach and the patient was also referredfor endoscopy.

The median duration of laparoscopic CBD explorationwas 90 min (range 70-310 min). Median hospital stay was7.4 d (5 d for trancystic duct approach and 11 d for directCBD exploration).

Group B: Thirty-two of forty-two patients of group B hadCBD lithiasis. In five patients, endoscopic stone extraction wasunsuccessful and all were referred for open choledochotomy.Median hospital stay was 9 d. Duration of ERCP and ESin addition to the time spent for LC was 60-255 min (median105 min).

The short-and long-term results from the application ofthe above-mentioned laparoscopic and endoscopic proceduresare shown in Table 4.

Table 4 Short and long term results

Group A Group B

Number of patients 36 42

Patients with CBD lithiasis 28 (121, 162) 32

Successful stone extraction 24/28 (85.7%) 27/32 (84.3%)

Method failure 4/28 (14.3%) 5/32 (15.7%)

Conversion to other procedure 4/28 (14.3%) 5/32 (15.7%)

Total morbidity 5/28 (17.8%) 6/32 (18.7%)

Death 13 14

Mean hospital stay (d) 7, 4 (52, 111) 9

Stones remaining during follow up 1 1

CBD stenosis 0 1

1Direct CBD exploration. 2Trancystic duct CBD exploration. 3On the 40th

postoperative day at home. 4Acute myocardial infarction 2 d after endoscopy.

Table 5 Complications

Group A Group B

Cholangitis 0 1

Mild pancreatitis 0 2

Bile collection 0 1

Biliary fistula 11 0

Pulmonary embolism 1 0

Death 12 13

Sepsis 0 1

Abdominal wall hematoma 2 0

Upper G.I. hemorrhage 0 1

Cardiovascular 1 0

1After direct CBD exploration. 2On 40th postoperative day at home. 3Acute

myocardial infarction 2 d after endoscopy.

Complications encountered among patients of bothgroups are depicted in Table 5.

Rank sum test disclosed that there was not a statisticallysignificant difference among patients of both groupsconcerning morbidity (P = 0.87), mortality (P = 0.70) andhospital stay (P = 0.07). On the contrary, there was statisticallysignificant difference regarding hospital stay in favor ofpatients that underwent the trancystic duct approach (P<0.01).

To compare long-term results, we applied the Gehan’sWilcoxon test but a statistically significant difference wasnot found (P = 0.70).

Prospective validation of multivariate modelIn order to validate prospectively the multivariate model,we used the VGSR module to build a model for our designwith multiple degrees of freedom effects for categorical predictorvariables.

The best model for predicting bile duct stones includedthe following independent predictors: CBD diameter ≥10 mm(dichotomized, using a cut-off value of 10 mm) andelevated values (≥2 normal) of SGOT, dBil, ALP(dichotomized using a cut-off value of equal to twice normal).

All the above were predictors on univariate analysis evenafter using the Bonferroni-Holm method to adjust formultiple comparisons. Level of significance in univariateanalysis for CBD diameter ≥ 10 mm, and elevated values(≥2 normal) of SGOT, dBil, ALP was P<0.01 for eachof them. Table 6 shows the performance of each possiblepredictor of CBD lithiasis analyzed including positive andNPVs. Table 7 depicts the model building via forwardstepwise regression.

There were no significant differences between observedand predicted probabilities in the subgroups of patients whenbroken down according to the different possible predictorcombinations.

The respective coefficients for each of the predictorswere: CBD diameter ≥10 mm (0.314982024), SGOT(0.227198578), dBil (0.244231286), ALP (0.207177395).

Prediction equation for choledocholithiasis was: CBDlithiasis = -0.03912693+0.314982024×CBD ≥10 mm+0.227198578×SGOT+0.244231286×BIL+0.207177395×ALPin which CBD diameter ≥ 10 = 1 if yes or = 2 and if not,values of SGOT, dBil, ALP = 1 if ≥2 normal or 2 iflower. Presence of CBD stone in a given case, is to beexpected if the result of the equation is ≤1.5, the oppositeis true if the result is >1.5. Consequently, parametercoefficients of the model did not vary significantly whenretrospective and prospective data were combined. PPV,when considering all these predictors, was 93.3%, while theNPV was 88.8%. Sensitivity of the model was 96.5% andspecificity 80%.

Table 6 Performance of predictors in univariate analysis

Predictor Number of patients (%) PPV (%) NPV (%)

CBD ≥ 10 mm 70/78 (89.7) 74 87.5

SGOT ≥ 2 normal 32/78 (41) 46 97

dBil ≥ 2 normal 33/78 (42.3) 48 97

ALP ≥ 2 normal 40/78 (51.2) 42 95

DISCUSSION

Laparoscopic cholecystectomy and evolving laparoscopictechniques of CBD exploration renewed interest on thedebate of the optimal management of patients with suspectedCBD stones who underwent cholecystectomy[7,8].


CBD stones are present in 10-15% of patients undergoingcholecystectomy[9] though the incidence declines in recentyears after the widespread acceptance of LC, possibly due toearlier presentation in the natural course of symptomaticgallstone disease.

Criteria for selective endoscopic cholangiography orintraoperative cholangiography before LC have not beenadequately defined.

Laparoscopic CBD exploration poses doubt about theeffectiveness of ES in CBD clearance and its potential adva-ntages in terms of morbidity or mortality. Several strategieshave emerged to manage synchronous CBD stones: i.e.,open CBDE, laparoscopic CBDE or postoperative ERCPwith stone extraction. An inadvertently discovered CBDstone at the time of LC has to be addressed laparoscopicallyif this technique is mastered by the surgeon, otherwiseposing the dilemma between converting to an open procedureor relying on postoperative ERCP for stone retrieval.

Routine preoperative cholangiography and sphincterotomyin the presence of stones is not a cost-effective prospective,taking also into account the relevant morbidity of 5-10%and mortality rate of 1-3%[9]. Intraoperative cholangiographyis successful in 88% of patients, who have a PPV of 63-92%[10], delineates the intra- and extra-hepatic biliary anatomyand potentially prevents bile duct injury. Routine use ofIOC lengthens the operative time and has a sizable falsepositive rate ranging from 21% to 67%, which should obviateunnecessary CBD exploration or conversion to open surgery.

In a public institution with limited resources, a choiceshould be made to limit the number of negative ERCs, andIOCs is mandatory. It is well known that the higher theincrease of liver function tests, the increase in patients who

have CBD stones. Although ultrasonography could producea good chance of prediction, a dilated CBD alone is an unreliableindicator. Combination of CBD diameter with high valuesof LFT, increases its PPV, perhaps by reflecting ongoing biliaryobstruction[11].

We believe that the high percentage of CBD lithiasisamong those patients is due to the fact that the vast majorityof admissions were on an emergency basis as well as that thesocioeconomic status of the major area is low.Strengths of the present study lie in the use of:·ST Neural Network to avoid a poorly adapted statistical

technique with highly intercorrelated clinical predictors.LDH, amylase and past history were removed fromthe model. Increased levels of serum amylase and ahistory of pancreatitis according to bibliography arenot significant predictors of a CBD stone[11,12]. Clinicalpractice suggests that unsustained increase of serumamylase reflects recent stone passage across the sphincterof Oddi.

·ROC curve analysis for optimal prediction of serumliver function tests and ultrasonographic CBD-diameter,cut off values.

·Multivariate model and the assessment of homogenouspopulation in terms of enrollment in a randomizedtrial protocol, avoiding inclusion of patients with retainedor recurrent stones because such a population subsethas a different biological behavior.

·A relatively long follow-up, which can prevent in partthe underestimation of the true NPV.

·The ability of the model to predict the presence andparticularly the absence of a CBD stone.

·A prospective validation of the model.

Table 7 Building the model via forward stepwise regression

Summary of stepwise regression; variable: lithiasis. Forward stepwise P to enter: 0.05, P to remove: 0.05

Steps Degrees of F to remove P to remove F to enter P to enter Effect status freedom

History Step 1 1 0.18442 0.6688 Out

CBD_10 1 15.9619 0.0001 Out

SGOT 1 48.4107 1.05E-09 Out

Bil 1 63.4082 1.3E-11 Entered

ALP 1 55.3074 1.31E-10 Out

Bil Step 2 1 63.4082 1.29624E-11 In

CBD_10 1 10.6347 0.0016 Entered

SGOT 1 9.16433 0.0033 Out

History 1 3.33518 0.0717 Out

ALP 1 7.98087 0.0060 Out

Bil Step 3 1 54.81658 1.61316E-10 In

CBD_10 1 10.6347 0.0016709 In

SGOT 1 8.23132 0.0053 Entered

History 1 0.31224 0.5779 Out

ALP 1 6.52043 0.0127 Out

Bil Step 4 1 17.77605 6.94475E-05 In

CBD_10 1 9.667935 0.0026617 In

SGOT 1 8.231323 0.0053630 In

History 1 0.39927 0.5294 Out

ALP 1 4.50211 0.0372 Entered

Bil Step 5 1 5.631729 0.0202726 In

CBD_10 1 8.529480 0.0046459 In

SGOT 1 6.148871 0.0154574 In

ALP 1 4.502116 0.0372471 In

History 1 0.62724 0.4309 Out

Sgourakis G et al. CBD lithiasis in LC 3271

·Giving answers about the identification of the optionalmethod of cholangiography (ERCP pre-LC vs IOC)by focusing on percentages of undetected stones,morbidity and mortality. This is very important inthe minimally invasive surgery era.

·A prediction equation that gives answer to thequestion of presence or absence of CBD stone for anindividual patient.

The policy of selective preoperative ERC before laparos-copic cholecystectomy has been proposed in some reports[13,14]

Stain et al, performed preoperative ERCP in all patients withan elevation of more than twice as normal in one of LFTmeasurements. Approximately, 57.6% of those had stones[15].In this study, only laboratory data were assessed and ultraso-nographic criteria were not included in the establishmentof the predictive model.

Barkun et al, determined optimal cut-off values usingROC curve analysis upon retrospective data. Independentpredictors were age (cut-off 55 years), bilirubin (over30 mol/L), presence of a dilated CBD on ultrasonography>6 mm and suspected or detected bile duct stone (at ultraso-nography). The model was validated prospectively. A CBDstone was predicted with a probability ranging from 19% to38%, when none or only one criterion was present to 49-94%, when three or four criteria were fulfilled[16].

In the current series of patients enrolled according tothe selection criteria, a total of 60 out of 78 patients (28 of36 patients in group A and 32 of 42 patients in group Baccounting for 76.9%), were found to have CBD stones,which in our opinion is a well acceptable result.

We conclude that selection criteria such as equal orgreater than twice normal values of dBil, ALP, SGOT andCBD diameter ≥ 10 mm on ultrasound can be objectivelyapplied to predict the presence of CBD stones.

REFERENCES1 Sgourakis G, Karaliotas K. Laparoscopic common bile duct

exploration and cholecystectomy versus endoscopic stone ex-

t r a c t i o n a n d l a p a r o s c op i c c h ol e c y s t e c t o m y f o rcholedocholithiasis. A prospective randomized study. Minerva

Chir 2002; 57: 467-474

2 Petelin JB. Laparoscopic approach to common duct

pathology. Surg Laparosc Endosc 1991; 1: 33-41

3 Ferzli GS, Massaad A, Ozuner G, Worth MH. Laparoscopicexploration of the common bile duct. Surg Gynecol Obstet 1992;

174: 419-421

4 Stoker ME, Leveillee RJ, McCann JC, Maini BS. Laparoscopiccommon bile duct exploration. J Laparoendosc Surg 1991; 1:

287-293

5 Petelin JB. Laparoscopic approach to common ductpathology. Am J Surg 1993; 165: 487-491

6 Hunter JG. Laparoscopic transcystic common bile duct

exploration. Am J Surg 1992; 163: 53-56; discussion 57-587 Corder AP, Scott SD, Johnson CD. Place of routine operative

cholangiography at cholecystectomy. Br J Surg 1992; 79 :

945-9478 Cranley B, Logan H. Exploration of the common bile duct-

the relevance of the clinical picture and the importance of

peroperative cholangiography. Br J Surg 1980; 67: 869-8729 Fletcher DR. Changes in the practice of biliary surgery and

ERCP during the introduction of laparoscopic cholecystec-

tomy to Australia: their possible significance. Aust N Z J Surg1994; 64 : 75-80

1 0 Madhavan KK, Macintyre IM, Wilson RG, Saunders JH, Nixon

SJ, Hamer-Hodges DW. Role of intraoperative cholangiogra-phy in laparoscopic cholecystectomy. Br J Surg 1995; 82 :

249-252

1 1 Reiss R, Deutsch AA, Nudelman I, Kott I. Statistical valueof various clinical parameters in predicting the presence ofcholedochal stones. Surg Gynecol Obstet 1984; 159: 273-276

1 2 Hauer-Jensen M, Karesen R, Nygaard K, Solheim K, AmlieEJ, Havig O, Rosseland AR. Prospective randomized studyof routine intraoperative cholangiography during opencholecystectomy: long term follow-up and multivariate analy-sis of predictors of choledocholithiasis. Surgery 1993; 113:318-323

1 3 Lillemoe KD, Yeo CJ, Talamini MA, Wang BH, Pitt HA, GadaczTR. Selective cholangiography. Current role in laparoscopiccholecystectomy. Ann Surg. 1992; 215: 669-674; discussion674-676

1 4 Barkun JS, Fried GM, Barkun AN, Sigman HH, Hinchey EJ,Garzon J, Wexler MJ, Meakins JL. Cholecystectomy withoutoperative cholangiography. Implications for common bile ductinjury and retained common bile duct stones. Ann Surg 1993;218: 371-377; discussion 377-379

1 5 Stain SC, Marsri LS, Froes ET, Sharma V, Parekh D. Laparoscopiccholecystectomy: laboratory predictors of choledocholithiasis.Am Surg 1994; 60 : 767-771

1 6 Barkun AN, Barkun JS, Fried GM, Ghitulescu G, SteinmetzO, Pham C, Meakins JL, Goresky CA. Useful predictors ofbile duct stones in patients undergoing laparoscopiccholecystectomy. McGill Gallstone Treatment Group. AnnSurg 1994; 220 : 32-39




Helicobacter pylori serology in a birth cohort of New Zealanders

from age 11 to 26

J. Paul Fawcett, Gill O. Barbezat, Richie Poulton, Barry J. Milne, Harry H.X. Xia, Nicholas J. Talley

EL SEVIER




J. Paul Fawcett, School of Pharmacy, University of Otago, Dunedin,New ZealandGill O. Barbezat, Dunedin School of Medicine, University of Otago,Dunedin, New ZealandRichie Poulton, Barry J. Milne, Dunedin Multidisciplinary Healthand Development Research Unit, Dunedin School of Medicine,University of Otago, Dunedin, New ZealandHarry H.X. Xia, Department of Medicine, The University of HongKong, Queen Mary Hospital, Hong Kong, ChinaNicholas J. Talley, Department of Medicine, The University ofSydney, Nepean Hospital, NSW 2751, AustraliaCorrespondence to: Dr. J.Paul Fawcett, School of Pharmacy,University of Otago, PO Box 56, Dunedin,New Zealand. [email protected]: +64-3-479-7290 Fax: +64-3-479-7034Received: 2004-07-09 Accepted: 2004-11-04

Abstract

AIM: To determine seroprevalence of Helicobacter pylori(H pylori) in the Dunedin Multidisciplinary Health andDevelopment Study (DMHDS) at age 26 in order toinvestigate seroconversion and seroreversion from age11 to 26 and the association of seropositivity with riskfactors for H pylori infection.

METHODS: Participants in the DMHDS at age 26 and retro-spectively at age 21 were tested for H pylori antibodiesusing two commercially available ELISA kits. Gender, soci-oeconomic status (SES), smoking, educational attainmentand employment at age 26 were tested for associationwith H pylori seropositivity.

RESULTS: At ages 21 and 26, seroprevalence of H pyloriusing one or other kit was 4.2% (n = 795) and 6.3% (n = 871)respectively. Seroreversion rate was lower than serocon-version rate (0.11% vs 0.53% per person-year) in contrastto the period from age 11 to 21 when seroreversion rateexceeded seroconversion rate (0.35% vs 0.11% perperson-year). Serology in those tested at ages 11, 21,and 26 remained unchanged in 93.6% of the sample.Seroprevalence at age 26 was lower among those with asecondary school qualification (P = 0.042) but was notassociated with gender, SES, smoking or employment status.

CONCLUSION: H pylori seroprevalence in a New Zealandbirth cohort remains low between ages 11 and 26. H pyloriinfection remains stable from childhood to adulthood althoughseroreversion seems to be more common in the adolescentyears than in young adults.


Key words: H pylori; Seroprevalence; Cohort

Fawcett JP, Barbezat GO, Poulton R, Milne BJ, Xia HHX,Talley NJ. Helicobacter pylori serology in a birth cohort ofNew Zealanders from age 11 to 26. World J Gastroenterol2005; 11(21): 3273-3276


INTRODUCTION

Helicobacter pylori (H pylori) is one of the most common bacterialinfections in the world[1] and is now recognized as the mainacquired factor in the pathogenesis of duodenal ulcer disease[2].H pylori acquisition (i.e., seroconversion) occurs at any agebut chiefly during childhood[3]. Infection in adulthood appearsto be stable and is unlikely to be resolved unless suitableantimicrobial treatment is sought[4,5]. Thus, although age is arisk factor for H pylori infection[6], the apparent increase inseroprevalence in a given population mainly arises from acohort effect (increasing risk of exposure associated withearlier year of birth)[5,7]. H pylori infection appears to bedeclining in developed countries probably due to a decreasingrate of childhood infections associated with improved hygieneand socioeconomic circumstances.

Of the many factors that have been investigated fortheir possible association with H pylori infection, age, lowersocioeconomic status (SES), and possibly ethnicity are important,but gender, alcohol, and cigarette use are of less significance[2].The natural history of H pylori infection remains poorlycharacterized particularly in relation to the question ofspontaneous seroreversion. In our study of the DMHDS birthcohort, seroprevalence of H pylori antibodies was low, decreasingfrom 6.6% at age 11 to 4.1% at age 21[8,9]. We were interested todetermine if this decline in seroprevalence continued on intoearly adulthood and accordingly studied H pylori seroprev-alence as the birth cohort turned 26 in 1998-1999.


ParticipantsThe Dunedin Multidisciplinary Health and DevelopmentStudy (DMHDS) was established in 1975-1976 when thefamilies of 1 037 children born at Queen Mary Hospital,Dunedin in 1972-1973 agreed to participate[10]. Cohort familiesrepresented the full range of SES in the general populationof New Zealand’s South Island and were predominantlyCaucasians. The cohort has been studied every 2 years fromage 3 to 15 and again at ages 18, 21, and 26 but bloodcollection was only carried out at ages 11, 21, and 26. Of


the total sample remaining at age 26 (n = 1 019; 525 males,494 females), 980 study members (499 males, 481 females)were seen around the time of their 26th birthday. Approvalto collect blood was obtained from 882 of these study members(452 males, 430 females), a consent rate of 90%. The studywas approved by the Ethics Committee of the Otago DistrictHealth Board, and each study member gave informed consentfor the donation of a blood sample.

H pylori testingSerum was collected and stored at -80 ℃ until tested foranti-H pylori IgG antibodies using two commercial ELISAkits: the Cobas Core Anti-H pylori EIA (Roche SA, Basel,Switzerland)[11] and the H pylori DTect ELISA (DiagnosticTechnology, Australia)[12]. The Cobas kit was used in our previousstudies[8,9] and has been validated in New Zealand againstthe urea breath test in 123 subjects with dyspepsia (sensitivity100%, specificity 87%)[13]. The pylori DTect kit has beenvalidated in Australia against H pylori status as defined bybiopsy in 209 patients with dyspepsia and reflux symptoms(sensitivity 96%, specificity 94%)[12]. Serum samples fortesting with the Cobas and pylori DTect kits were availablefor 854 and 870 study members respectively. Stored serumsamples collected at age 21 (previously tested with the Cobaskit in 1994) were available for retrospective testing with thepylori DTect kit for 764 study members (402 males, 362females). A total of 755 study members (401 males, 362females) had serology at ages 21 and 26, and 452 (256males, 196 females) had serology at ages 11, 21, and 26.

Statistical analysisData were analyzed using Stata 7.0 (Stata Corporation, CollegeStation, TX, USA) and differences evaluated by Student’st-test or Pearson’s 2-test. Seroprevalence at ages 21 and 26was defined as the number of persons who were seropositiveby one or both tests in recognition of the fact that no singleantigen is recognized by sera from all subjects in a givenpopulation[14]. Level of agreement between tests was indicatedby the statistics, where = 0 reflects agreement at chancelevel and = 1 reflects perfect agreement. Confidenceintervals (95%CI) of prevalence estimates were based onthe binomial distribution. SES was based on the Elley-Irvingcategory of the father when sample members were aged 5(low, unemployed and categories 5 and 6; medium/high,categories 1-4)[15]. Employment status was based on employmentat the time of interview at age 26. Smoking status was basedon the number who had smoked daily for at least 1 mo inthe previous year. Educational attainment was based on thenumber with a secondary school qualification.

RESULTSThe number of seropositive and seronegative males andfemales and the seroprevalences determined by the twokits at ages 21 and 26 are shown in Table 1. At age 26, atotal of 55 study members was seropositive by one or bothkits, a seroprevalence of 6.3% (95%CI 4.7-7.9). The twokits had 34 seropositivities in common, suggesting goodagreement between tests ( = 0.75, 95%CI 0.68-0.82). Atage 21, a total of 33 study members was seropositive byone or both kits, a seroprevalence of 4.2% (95%CI 2.8-5.5).The two kits had 19 seropositivities in common, again suggestinggood agreement (= 0.74, 95%CI 0.67-0.81). Seroprevalenceof H pylori using the Cobas kit was higher than that usingthe pylori DTect kit at both ages, but increase in seroprevalencefrom age 21 to 26 was slightly greater for the DTect kit(2.2%) than for the Cobas kit (1.4%).

Seroprevalence at age 26 in relation to risk factors isgiven in Table 2. Seroprevalence was higher in males, dailysmokers and those in employment but the differences werenot significant. Seroprevalence was not associated with SESbut was significantly lower in those with a secondary schoolqualification than those without the qualification (P = 0.042).

The distributions of DMHDS members (total, male andfemale) among the four categories of serology (stable positivities,stable negativities, seroconverters, and seroreverters) at ages21 and 26 (n = 755) and among the eight categories of serology

Table 1 H pylori serology (as determined with Cobas and pylori DTect ELISA kits), gender, and seroprevalence in the DMHDS at ages 21 and 26

Test Age (yr) n Seropositivity Seronegativity Seroprevalence (95%CI)

Males Females Males Females

Cobas 21 785 24 8 389 364 4.1 (2.7-5.5)

DTect 21 764 15 5 387 357 2.6 (1.5-3.7)

Both tests 21 795 24 9 394 368 4.2 (2.8-5.5)

Cobas 26 854 32 15 412 395 5.5 (4.0-7.0)

DTect 26 870 28 14 422 406 4.8 (3.4-6.2)

Both tests 26 871 35 20 416 400 6.3 (4.7-7.9)

Table 2 Seropositivity of H pylori infection in the DMHDS at age 26in relation to risk factors

n Number of Significanceseropositivities (%) by 2-test

Gender

Male 451 35 (7.8) 0.069

Female 420 20 (4.8)

SES at age 5

High 580 37 (6.4) NS

Low 237 15 (6.3)

Daily smokers

Yes 343 26 (7.6) NS

No 528 29 (5.5)

Secondary school

qualifications

Yes 704 42 (5.6) 0.042

No 112 13 (10.4)

Employment

Yes 654 44 (6.7) NS

No 217 11 (5.1)

Fawcett JP et al. H pylori serology in a birth cohort 3275

at ages 11, 21, and 26 (n = 452) are presented in Table 3.Seroconversion and seroreversion rates from age 21 to 26were 0.53% and 0.11% per person-year respectively. Inthose tested at ages 11, 21, and 26, corresponding rateswere 0.44% and 0.04% per person-year respectively. Fromage 11 to 21, seroconversion and seroreversion rates in thissubset were 0.11% and 0.35% per person-year respectively.

Table 3 Distribution of categories of H pylori serological status (A)in the DMHDS between ages 21 and 26 (n = 755), and (B) acrossages 11, 21, and 26 (n = 452). Seropositive status is indicated by“+”; seronegative status by “-”

A. H pylori serological status between ages 21 and 26 (n, %)

Status at agesMales (n = 401) Females (n = 354) Total (n = 755)

21 26

+ + 20 (5.0) 8 (2.3) 28 (3.7)

+ - 4 (1.0) 0 (0) 4 (0.5)

- + 11 (2.7) 9 (2.5) 20 (2.6)

- - 366 (91.3) 337 (95.2) 703 (93.1)

B. H pylori serological status across ages 11, 21, and 26 (n, %)

Status at ages

Males (n = 256) Females (n = 196) Total (n = 452)

11 21 26

+ + + 11 (4.3) 2 (1.0) 13 (2.9)

+ + - 0 (0) 0 (0) 0 (0)

+ - + 0 (0) 2 (1.0) 2 (0.4)

+ - - 6 (2.3) 8 (4.1) 14 (3.1)

- + + 3 (0.5) 1 (1.2) 4 (0.9)

- + - 1 (0.4) 0 (0) 1 (0.2)

- - + 4 (1.6) 4 (2.0) 8 (1.8)

- - - 231 (90.2) 179 (91.3) 410 (90.7)

The number of individuals who seroreverted from age11 to 21 (16/29) was much higher than from age 21 to 26(1/18). SES, smoking, and employment were not associatedwith either seroconversion or seroreversion. However, bothfemales and those who attained secondary school qualifi-cations were more likely to serorevert between ages 11 and21 (gender: females [10/12, 83.3%], males [6/17, 35%],2 = 6.6, = 1, P<0.05; without qualification [0/4, 0%],with qualification [16/25, 64%], 2 = 5.7, = 1, P<0.05).

DISCUSSION

This study used two commercially available ELISA kits toestimate H pylori seroprevalence in the DMHDS at ages 21and 26. The manufacturers’ recommended cut-off valueswere used to divide positive from negative results. The cut-off values are specifically chosen by the manufacturers toerr on the side of sensitivity rather than specificity in orderto reduce the likelihood of false negative results and enhancethe detection of both previous and current infection[12,13].Seroprevalence was higher with the Cobas kit which probablyreflected the fact that, compared with other kits, Cobas hasbeen shown to have somewhat lower specificity[16]. Despitethe discrepancy between the two kits, it is clear thatseroprevalence in the DMHDRU was very low at age 11and remained low through to age 26.

In the interval from age 21 to 26, the increase in seropre-valence in the DMHDS from 4.2% to 6.3% reversed the

trend downwards in seroprevalence from 6.6% to 4.2% inthe interval from age 11 to 21. Whilst the decrease inseroprevalence from age 11 to 21 may reflect some processpeculiar to the adolescent years, the possibility that thefluctuations simply resulted from measurement error couldnot be ruled out[17]. What is clear is that the vast majority ofstudy members (93.6%) remained stable with respect toserological status from age 11 to 26 in line with the resultsof other studies of paired serum samples showing thatserological status remains essentially constant over manyyears[4-7]. Seroprevalence in a given cohort is thereforemainly determined in childhood and risk of acquisition inadulthood is relatively low[6]. In general practice, this impliesthat patients with H pylori who undergo successful eradicationtherapy but have subsequent gastrointestinal problems areunlikely to benefit from further H pylori testing and eradicationtherapy.

Despite the fact that H pylori infection is generally associatedwith lower SES, this association was weak in the DMHDS.Thus, it was present at age 21[9] but absent at ages 11 and26. However, seropositivity at age 26 was associated withlower educational attainment, which may be considered asa surrogate for lower SES. In contrast, the weak associationwith male sex found in the DMHDS is consistent with otherstudies. Although the number of seropositive males washigher at all ages tested, the difference was only significantat age 21. Similarly, the association with smoking was absentin the DMHDS as has been found in other recent studies[2].

The seroprevalence of H pylori antibodies in the DMHDScan be compared to values determined in two other studiesin New Zealand, which also used the Cobas kit. In onestudy, a group of 11-year-old children of European ethnicityin South Auckland had a seroprevalence of 7%[13] and, inthe other, a group of 18-24-year-old adults of largelyEuropean ethnicity in Christchurch had a seroprevalenceof 4.2%[18]. Interestingly, the large study of active H pyloriinfection in the general population of England and Walesestimated seroprevalence in those born in the 1970s to beabout 7% falling to about 4.3% in those born in the 1980s[5].

In conclusion, our study shows that H pylori infectionremains stable from childhood into adulthood althoughseroreversion seems to be more common in the adolescentyears than in young adults.

ACKNOWLEDGMENTS

We thank the Dunedin study members and their parents,unit research staff, Air New Zealand, and study founder, PhilSilva. The Dunedin Multidisciplinary Health and DevelopmentResearch Unit is supported by the Health Research Councilof New Zealand.

REFERENCES1 Goodman KJ, Correa P. The transmission of Helicobacter pylori.

A critical review of the evidence. Int J Epidemiol 1995; 24 :

875-8872 Brown LM. Helicobacter pylori: epidemiology and routes of

transmission. Epidemiol Rev 2000; 22: 283-297

3 Taylor DN, Blaser MJ. The epidemiology of Helicobacter pyloriinfection. Epidemiol Rev 1991; 13: 42-59

4 Kosunen TU, Aromaa A, Knekt P, Salomaa A, Rautelin H,

Lohi P, Heinonen OP. Helicobacter antibodies in 1973 and 1994

in the adult population of Vammala, Finland. Epidemiol Infect1997; 119: 29-34

5 Vyse AJ, Gay NJ, Hesketh LM, Andrews NJ, Marshall B,

Thomas HI, Morgan-Capner P, Miller E. The burden ofHelicobacter pylori infection in England and Wales. Epidemiol

Infect 2002; 128: 411-417

6 Veldhuyzen van Zanten SJ, Pollak PT, Best LM, BezansonGS, Marrie T. Increasing prevalence of Helicobacter pylori infec-

tion with age: continuous risk of infection in adults rather

than cohort effect. J Infect Dis 1994; 169: 434-4377 Cullen DJ, Collins BJ, Christiansen KJ, Epis J, Warren JR,

Surveyor I, Cullen KJ. When is Helicobacter pylori infection

acquired? Gut 1993; 34: 1681-16828 Fawcett JP, Shaw JP, Brooke M, Walker A, Barbezat GO.

Seroprevalence of Helicobacter pylori in a longitudinal study of

New Zealanders at ages 11 and 21. Aust N Z J Med 1998; 28:585-589

9 Fawcett JP, Shaw JP, Cockburn M, Brooke M, Barbezat GO.

Seroprevalence of Helicobacter pylori in a birth cohort of 21-year-old New Zealanders. Eur J Gastroenterol Hepatol 1996; 8:

365-369

1 0 Silva PA, Stanton WR, eds. From child to adult: The DunedinMultidisciplinary Health and Development Study. Auckland:

Oxford University Press, 1996

1 1 Goossens H, Glupczynski Y, Burette A, Van den Borre C,Butzler JP. Evaluation of a commercially available second-

generation immunoglobulin G enzyme immunoassay for de-

tection of Helicobacter pylori infection. J Clin Microbiol 1992; 30:

176-1801 2 Xia HH, Kalantar JS, Wyatt JM, Adams S, Cheung K, Eslick

GD, Talley NJ. High sensitivity and specificity of a labora-

tory-based serological test, pylori DTect ELISA, for detectionof Helicobacter pylori infection. Diagn Microbiol Infect Dis 2000;

36 : 69-74

1 3 Fraser AG, Scragg R, Metcalf P, McCullough S, Yeates NJ.Prevalence of Helicobacter pylori infection in different ethnic

groups in New Zealand children and adults. Aust N Z J Med

1996; 26 : 646-6511 4 Glupczynski Y. Microbiological and serological diagnostic

tests for Helicobacter pylori: an overview. Br Med Bull 1998; 54:

175-1861 5 Elley WB, Irving JC. Revised socio-economic index for New

Zealand. N Z J Educ Studies 1976; 11: 26-36

1 6 Feldman RA, Deeks JJ, Evans SJ. Multi-laboratory compari-son of eight commercially available Helicobacter pylori serol-

ogy kits. Helicobacter pylori Serology Study Group. Eur J Clin

Microbiol Infect Dis 1995; 14: 428-4331 7 Cockburn M, Cox B. The effect of measurement error on the

determination of Helicobacter pylori prevalence. Epidemiology

1997; 8: 205-2091 8 Collett JA, Burt MJ, Frampton CM, Yeo KH, Chapman TM,

Buttimore RC, Cook HB, Chapman BA. Seroprevalence of

Helicobacter pylori in the adult population of Christchurch:risk factors and relationship to dyspeptic symptoms and iron

studies. N Z Med J 1999; 112: 292-295




Gene expression in Barrett’s esophagus and reflux esophagitis

induced by gastroduodenoesophageal reflux in rats

Peng Cheng, Jun Gong, Tao Wang, Chen Jie, Gui Sheng Liu, Ru Zhang

EL SEVIER




Peng Cheng, Jun Gong, Tao Wang, Chen Jie, Gui Sheng Liu,Ru Zhang, Department of Gastroenterology, the Second Hospital,Xi’an Jiaotong University, Xi’an 710004, Shaanxi Province, ChinaSupported by Ministry of Health Clinical Subject Key Project,No. 20012130Correspondence to: Dr. Peng Cheng, Department of Gastroe-nterology, Second Hospital of Xi’an Jiaotong University, Xi’an710004, Shaanxi Province, China. [email protected]: +86-29-88083495 Fax: +86-29-87231758Received: 2004-7-05 Accepted: 2004-7-22

Abstract

AIM: To investigate the difference of gene expressionprofiles between Barrett’s esophagus and reflux eso-phagitis induced by gastroduodenoesophageal reflux inrats.

METHODS: Eight-week-old Sprague-Dawley rats weretreated esophagoduodenostomy to produce gastroduode-noesophageal reflux, and another group received shamoperation as control. Esophageal epithelial tissues weredissected and frozen in liquid nitrogen immediately forpathology 40 wk after surgery. The expression profiles of4 096 genes in reflux esophagitis and Barrett’s esophagustissues were compared with normal esophageal epitheliumby cDNA microarray.

RESULTS: Four hundred and forty-eight genes in Barrett’sesophagus were more than three times different fromthose in normal esophageal epithelium, including 312 up-regulated and 136 down-regulated genes. Two hundredand thirty-two genes in RE were more than three timesdifferent from those in normal esophageal epithelium, 90up-regulated and 142 down-regulated genes. Comparedto reflux esophagitis, there were 214 up-regulated and142 down-regulated genes in Barrett’s esophagus.

CONCLUSION: Esophageal epithelium exposed excessivelyto harmful ingredients of duodenal and gastric reflux candevelop esophagitis and Barrett’s esophagus gradually.The gene expression level is different between refluxesophagitis and Barrett’s esophagus and the differentiallyexpressed genes might be related to the occurrence anddevelopment of Barrett’s esophagus and the promotionor progression in adenocarcinoma.


Key words: Gastroduodenoesophageal reflux; Esophagitis;Barrett’s esophagus; Gene expression

Cheng P, Gong J, Wang T, Jie C, Liu GS, Zhang R. Geneexpression in Barrett’s esophagus and reflux esophagitisinduced by gastroduodenoesophageal reflux in rats. WorldJ Gastroenterol 2005; 11(21): 3277-3280


INTRODUCTION

The incidence of esophageal adenocarcinoma has increasedconsiderably in the past few years, which may be related tothe increasing incidence of gastroesophageal reflux diseasesand Barrett’s esophagus[1,2]. However, the exact mechanismespecially the molecular biological mechanism of esophagealadenocarcinoma is unknown. In our study, esophagoduod-enostomies were performed on Sprague-Dawley rats to producegastroduodenoesophageal reflux according to Miwa[3] and thechanges of gene expression profiles between Barrett’s esophagusand reflux esophagitis were investigated by cDNA microarray.


Experimental animals and animal modelsOne hundred and twenty healthy Sprague-Dawley ratsweighing about 200-250 g were purchased from the Experi-mental Animal Center of Xi’an Jiaotong University. Therats were housed in rat cages at 22-25 ℃ with free accessto standard rat pellet food and water for 40 wk. Rats weretreated following the guidelines for the care and use oflaboratory animals of National Animal Welfare Committee.Surgical procedures were performed on 90 rats by esopha-goduodenostomy to produce gastroduodenoesophagealreflux, and on 30 rats by sham operation[3]. The animalswere fed with a standard chow.

Tissues and specimensAll the tissue specimens including esophagitis, Barrett’sesophagus were taken from animals 40 wk after esophago-duodenostomy, by which gastroduodenoesophageal refluxanimal models were produced. Normal esophageal epitheliumof sham operation at the same anatomical site served asnormal control. For each sample, the inner part of eachsample was cut and frozen in liquid nitrogen immediatelyafter surgical resection, and outer marginal part was usedfor histopathological examination to ensure that all the frozentissue specimens their corresponding histological appearance.

Chip preparationFour thousand and ninety-six target cDNA clones were usedin cDNA microarray (United Gene Ltd.). These genes were


amplified with PCR using universal primers and then purifiedwith standard method. The quality of PCR was monitoredby agarose gel electrophoresis. The obtained genes weredissolved in 3×SSC spotting solution and then spotted onsilylated slides (TeleChem, Inc.) by Cartesian 7500 spottingrobotics (Cartesian, Inc.). Each target gene was dotted twice.After spotting, the slides were hydrated (2 h) and dried (0.5 h,room temperature). The samples were cross-linked with UVlight and treated with 0.2% SDS, H2O and 0.2% NaNBH4for 10 min. Then the slides were dried in cold conditionand ready for use.

Probe preparationTotal sample RNA was extracted by single step method[5].Briefly, after taken out from liquid nitrogen specimens wereground completely into tiny powder while liquid nitrogenwas added in ceramic mortar and then the powder washomogenized in D solution plus 1% mercaptoethanol. Aftercentrifugation, the supernatant was extracted with phenol:chloroform (1:1) and NaAC and acidic phenol: chloroform(5:1). The aqueous phase was precipitated by an equalvolume of isopropanol and centrifuged. The precipitateswere dissolved with Millie-Q H2O. After further purificationby LiCl precipitating method was obtained RNA, good inquality with UV analysis and electrophoresis. The mRNAswere isolated and purified with Oligotex mRNA Midi kit(Qiagen, Inc.). The fluorescent-labeled cDNA probe wasprepared through retro-transcription, in reference to themethod of Schena[4]. The probes from normal epitheliumwere labeled with Cy3-dUTP, while those from Barrett’sesophagus and esophagitis epithelium with Cy5-dUTP.The probes were mixed (Cy3-dUTP control+Cy5-dUTPBarrett’s esophagus epithelium and Cy3-dUTP control+Cy5-dUTP esophagitis epithelium) and precipitated by ethanol,and then resolved in 20 mL hybridization solution (5×SSC+0.2% SDS).

Hybridization and washingProbes and the chip were denatured in 95 ℃ bath for 5 min,and then the probes were added on to the chip. They werehybridized in a sealed chamber at 60 ℃ for 15-17 h, washedin turns with solutions of 2×SSC+0.2% SDS, 0.1×SSC+0.2%SDS and 0.1% SSC for 10 min each, and then dried at roomtemperature.

Fluorescent scanning and results analysisThe chip was read by Scan Array 3000 Scanner (GeneralScanning Inc.). The overall intensities of Cy3 and Cy5 werenormalized and corrected by a coefficient according to theratios of the located 40 housekeeping genes. Cy3 wasnormalized as Cy3*. The acquired image was furtheranalyzed by Gene Pix Pro 3.0 software with digital computerto obtain the intensities of fluorescent signals and the Cy5/Cy3* ratio. The data was an average of the two repeatedspots. The differentially expressed genes were defined as:(1) Absolute value of the Cy5/Cy3* natural logarithm wasmore than 1.10 (the variation of gene expression was morethan three folds). (2) Either Cy3 or Cy5 signal value wasrequired for more than 800, or both signal values weremore than 200. (3) PCR results were satisfactory.

RESULTSTotal sample RNA extractionTotal sample RNA of normal esophageal epithelium, refluxesophagitis and Barrett’s esophagus was extracted and theD260/D280 was between 2 and 2.6, indicating pure mRNAwas acquired.

Scatter plot of hybridization signals on gene chipThe scatter plot that was plotted with Cy3 and Cy5 fluorescentsignal values displayed quite a dispersed pattern in distribution.Most of the spots gathered around a 45 angle diagonal linein which the blue spots represented the area where the signalintensities varied between 0.33 to 3 folds compared withthat of the control. Some yellow spots distributed beyond orfar from 45 angle diagonal line indicating the existence ofabnormal gene expression in Barrett’s esophagus or esophagitisepithelium and their signal intensities were three times moreor less than that of the control (Figure 1A and B).

Figure 1 Scatter-plot of hybridization signals on gene chip. (A: reflux esophagitisand normal control; B: Barrett’s esophagus and normal control).

Gene expression pattern by scanning analysisIn esophagitis epithelia 232 genes showed expressionvariations more than three times from the control, the upand down-regulated genes numbered 90 and 142 respectively.In Barrett’s esophagus epithelia 448 genes exhibited expressionvariations more than three times than the control, the upand down-regulated genes were 312 and 136 respectively.Difference of gene expression between esophagitis epitheliaand Barrett’s esophagus was acquired by subtracting genes incommon from the total genes expressed differently ofesophagitis epithelia and Barrett’s esophagus. Three hundredgenes expressed differentially in Barrett’s esophaguscompared to those in esophagitis epithelia, and the up and

60 000

50 000

40 000

30 000

20 000

10 000

0

F1 m

idia

n B

1

cy5

cy3

0 10 000 20 000 30 000 40 000 50 000 60 000

F2 midian B2

60 000

50 000

40 000

30 000

20 000

10 000

0

F1 m

idia

n B

1

cy5

cy3

0 10 000 20 000 30 000 40 000 50 000 60 000

F2 midian B2

A

B

Cheng P et al. Gene in Barrett’s esophagus and reflux cliseaase 3279

down-regulated genes were 214 and 86 respectively. Somegenes are listed in Tables 1 and 2. These genes might bedivided into 12 groups (Table 3) according to theirfunctions.

DISCUSSION

Some researchers confirmed that Barrett’s esophagus isrelated to esophageal adenocarcinoma closely. The annualrate of Barrett’s esophagus developing into esophagealadenocarcinoma increased by 0.5% and the former wasregarded as the precancerous lesion of the latter[2]. However,in those reports adenocarcinoma of the gastroesophageal

junction was thought as esophageal adenocarcinoma, whichmixed up the tissue origin of esophageal adenocarcinoma.Some clinical epidemiological data on cardiac and esophagealadenocarcinoma indicated that the two diseases were similarin respects of age, sex, clinical, and pathological characteristicsso that the origin of the two diseases was thought as thesame tissue[5]. And both the diseases were known as adenoc-arcinoma of gastroesophageal junction[6].

Whether Barrett’s esophagus is the precancerous diseaseof esophageal adenocarcinoma is further studied by Miwa’s[3]

research, which suggested that esophageal adenocarcinomaarose from Barrett’s esophagus, which is induced by gastro-duodeno-esophageal reflux. Single gene research on esophagealadenocarcinogenesis has been done[7]. The carcinogenesis isa process involving multiple steps and factors and causedby abnormal expression of tumor-associated genes orinactivation of tumor suppression genes or both. Thereforeclarifying the gene expression differences between malignant,precancerous and normal tissues is the key procedure forthe cancer control study. It is generally accepted that althoughthe number of genes with mutation is limited in a cancer, agreat number of genes in related pathways may be affectedat the expression level, and this aberrant gene transcriptionalexpression network should be essential in the initiation/maintenance of the malignant phenotype. With the advancesof molecular biological techniques, gene chip has been usedto detect gene expression difference in various specimensby parallel analysis on a large scale[8]. In our research, animalmodel of gastro-duodeno-esophageal reflux was made withreference to Miwa[3] and the changes of gene expression profilesbetween Barrett’s esophagus and reflux esophagitis wereinvestigated by cDNA microarray.

Among the up-regulated genes, cell adhesion regulator1, leukemia-associated cytosolic phosphoprotein, glutathionesynthetase, kangai 1, junctional adhesion molecule 1 andS100 calcium-binding protein A9 were all related to thedevelopment of tumor. The transmembrane protein,junctional adhesion molecule 1, causes the protein CagAinto gastric epithelial cells and associates with peptic ulcerdisease and carcinoma[9]. It might be participating in theepithelium in jury by harmful ingredients of duodenal andgastric reflux. Leukemia-associated cytosolic phosphoproteinis supposed to play a role in regulation of cell proliferationor the proliferation-differentiation switch and expressedvigorously in all but one of 85 diverse tumor cell lines and

Table 3 Functional classification of genes expressed differently between Barrett’s esophagus and esophagitis epithelia

Functional classification n Up-regulated Down-regulated

Oncogenes and tumor suppressor genes 14 12 2

Ion channel and transporters 30 16 14

Cell cycle proteins 21 18 3

Extra-pressure reaction proteins 20 18 2

Cell regulatory proteins 13 9 4

Cell apoptosis related proteins 14 10 4

DNA synthesis, repair and recombinant factors 25 17 8

DNA binding, transcription factors 30 22 8

Cell receptors 33 27 8

Immunity-related proteins 29 17 12

Cell signal transduction proteins 40 27 13

Metabolism related proteins 31 21 10

Total 300 214 86

Table 1 Some up or down-regulated genes expressed in Barrett’sesophagus compared to esophagitis

Up-regulated gene

Glutathione synthetase

S100 calcium binding protein A9

alpha-fibrinogen

alpha-1-protease inhibitor

Lyn protein non-receptor kinase

Polymeric immunoglobulin receptor

Prostaglandin D2 synthase 2

Serine protease inhibitor

Kangai 1

Hemopexin

Fibrinogen

DOC-2 p82 isoform

Leukemia-associated cytosolic phosphoprotein

Junctional adhesion molecule 1

Interleukin 1 beta

Cell adhesion regulator

Table 2 Some genes expressed down-regulation in Barrett’s esopha-gus compared to esophagitis

Down-regulated gene

BCL2/adenovirus E1B 19-ku-interacting protein-3

Transforming growth factor stimulated clone-22

Tissue inhibitor of metalloproteinase-3

Phosphoglyceromutase

CD36 antigen

Calsequestrin 2

Transgelin

Mitochondrial adenine nucleotide translocator

Glucocorticoid-induced leucine zipper

Extracellular matrix protein 2

Protein tyrosine phosphatase

primary human malignant tumors examined[10]. Its up-regulated expression indicated over proliferation of Barrett’sesophagus compared with reflux esophagitis. Apoptoticsignaling after genotoxic exposure can be inhibited by theantioxidant activity of glutathione[11]. The up-regulation ofcell adhesion regulator is associated with the progression ofcolorectal tumors, while that of kangai 1 seems to be involvedin the early stage[12]. Up-regulation of the two genes in Barrett’sesophagus illuminated Barrett’s esophagus might be inclined todeveloping into tumor. Up-regulated expression of the hemopexinis involved in enhanced neoplastic cell invasion and migration[13].S100 calcium-binding protein A9 gene expression has beendetected in cultured human adenocarcinoma cells derivedfrom various organs[14].

Among the down-regulated genes, extracellular matrixprotein 2, protein tyrosine phosphatase 2E, tissue inhibitorof metalloproteinase 3, CD36 antigen, transforming growthfactor stimulated clone-22, and BCL2/adenovirus E1B 19-ku-interacting protein-3 were involved in suppressing tumor,indicating the ability of esophagus against tumor decreasedwith normal esophageal epithelium developing into Barrett’sesophagus by over exposure to contents of gastric and duodenalreflux. Extracellular matrix protein 2 mRNA expression levelsdecreased in many metastasis specimens, it might be relatedto invasion and migration of tumor[15]. Protein tyrosine phosp-hatase was associated with the cell signaling control, energymetabolism, proliferation and promotion of MHC-I antigenexpression, mediated by numer-ous hormones (such as epid-ermal growth factor, insulin, insulin-like growth factor 1)[16].The down-regulated PTPase would decrease the antigenexpression on the cell surface, and result in malignant cellsescaping from the immune surveillance. In the present study,the enzyme was also down-regulated in Barrett’s esophagus.Tissue inhibitor of metalloproteinase-3 inhibits the activityof metalloprotease and the latter is an important proteinassociated with tumor invasion and metastasis. In general,the former is down-regulated and the latter up-regulated intumor tissue[17]. CD36 antigen is the cellular receptor forthrombospondin-1 on microvascular endothelium and isnecessary for its anti-angiogenic activity with down-regulationin many tumor tissues. Transforming growth factor beta-stimulated clone-22 mediated inhibition of apoptosis andwas down-regulated in over proliferated tissues. BCL2/adenovirus E1B 19-ku-interacting protein-3 had growthinhibitory effect on cancer cells and was down-regulated inmany tumors.

Many up-regulated or down-regulated genes in Barrett’sesophagus compared to reflux esophagitis indicated that agreat number of genes in related pathways might affect thecarcinogenesis of Barrett’s esophagus. The application ofgene chip technique is a revolution of research method inlife science. Our experiment illustrated that the detection ofgene expression difference between Barrett’s esophagus andreflux esophagitis by gene chip might disclose the molecularmechanism of the onset, promotion and progression ofBarrett’s esophagus into esophageal adenocarcinoma andprovide a new direction for diagnosis, therapy and preventionof esophageal carcinoma.

REFERENCES1 O’Connor JB, Falk GW, Richter JE. The incidence of adeno-

carcinoma and dysplasia in Barrett’s esophagus: report on

the Cleveland Clinic Barrett's Esophagus Registry. Am JGastroenterol 1999; 94: 2037-2042

2 Geboes K. Barrett’s esophagus: the metaplasia-dysplasia-

carcinoma sequence: morphological aspects. Acta GastroenterolBelg 2000; 63: 13-17

3 Miwa K, Sahara H, Segawa M, Kinami S, Sato T, Miyazaki I,

Hattori T. Reflux of duodenal or gastro-duodenal contents inducesesophageal carcinoma in rats. Int J Cancer 1996; 67: 269-274

4 Schena M, Shalon D, Heller R, Chai A, Brown PO, Davis RW.

Parallel human genome analysis: microarray-based expression moni-toring of 1000 genes. Proc Natl Acad Sci USA 1996; 93: 10614-10619

5 Ruol A, Parenti A, Zaninotto G, Merigliano S, Costantini M,

Cagol M, Alfieri R, Bonavina L, Peracchia A, Ancona E. Intes-tinal metaplasia is the probable common precursor of adeno-

carcinoma in barrett esophagus and adenocarcinoma of the

gastric cardia. Cancer 2000; 88: 2520-25286 Byrne JP, Mathers JM, Parry JM, Attwood SE, Bancewicz J,

Woodman CB. Site distribution of oesophagogastric cancer. J

Clin Pathol 2002; 55 : 191-1947 Bektas N, Donner A, Wirtz C, Heep H, Gabbert HE, Sarbia

M. Allelic loss involving the tumor suppressor genes APC

and MCC and expression of the APC protein in the develop-ment of dysplasia and carcinoma in Barrett esophagus. Am J

Clin Pathol 2000; 114: 890-895

8 Huang GS, Yang SM, Hong MY, Yang PC, Liu YC. Differen-tial gene expression of livers from ApoE deficient mice. Life

Sci 2000; 68 : 19-28

9 Amieva MR, Vogelmann R, Covacci A, Tompkins LS, NelsonWJ, Falkow S. Disruption of the epithelial apical-junctional com-

plex by Helicobacter pylori CagA. Science 2003; 300: 1430-1434

1 0 Ghosh PK, Anderson J, Cohen N, Takeshita K, Atweh GF,

Lebowitz P. Expression of the leukemia-associated gene, p18,in normal and malignant tissues; inactivation of expression in

a patient with cleaved B cell lymphoma/leukemia. Oncogene

1993; 8 : 2869-28721 1 Rudin CM, Yang Z, Schumaker LM, VanderWeele DJ, Newkirk

K, Egorin MJ, Zuhowski EG, Cullen KJ. Inhibition of glu-

tathione synthesis reverses Bcl-2-mediated cisplatin resistance.Cancer Res 2003; 63: 312-318

1 2 Mikami T, Ookawa K, Shimoyama T, Fukuda S, Saito H,

Munakata A. KAI1, CAR, and Smad4 expression in the pro-gression of colorectal tumor. J Gastroenterol 2001; 36: 465-469

1 3 Takino T, Miyamori H, Watanabe Y, Yoshioka K, Seiki M,

Sato H. Membrane type 1 matrix metalloproteinase regulatescollagen-dependent mitogen-activated protein/extracellular

signal-related kinase activation and cell migration. Cancer Res

2004; 64 : 1044-10491 4 Arai K, Teratani T, Nozawa R, Yamada T. Immunohistochemi-

cal investigation of S100A9 expression in pulmonary

adenocarcinoma: S100A9 expression is associated with tu-mor differentiation. Oncol Rep 2001; 8: 591-596

1 5 Hao X, Sun B, Hu L, Lahdesmaki H, Dunmire V, Feng Y,

Zhang SW, Wang H, Wu C, Wang H, Fuller GN, SymmansWF, Shmulevich I, Zhang W. Differential gene and protein

expression in primary breast malignancies and their lymph

node metastases as revealed by combined cDNA microarrayand tissue microarray analysis. Cancer 2004; 100: 1110-1122

1 6 Yamamoto Y, Irie K, Asada M, Mino A, Mandai K, Takai Y.

Direct binding of the human homologue of the Drosophiladisc large tumor suppressor gene to seven-pass transmem-

brane proteins, tumor endothelial marker 5 (TEM5), and a

novel TEM5-like protein. Oncogene 2004; 23: 3889-38971 7 Karan D, Lin FC, Bryan M, Ringel J, Moniaux N, Lin MF, Batra

SK. Expression of ADAMs (a disintegrin and metalloproteases)

and TIMP-3 (tissue inhibitor of metalloproteinase-3) in humanprostatic adenocarcinomas. Int J Oncol 2003; 23: 1365-1371

Science Editor Zhu LH Language Editor Elsevier HK



Tissue distribution and excretion of 125I-lidamycin in mice and

rats

You-Ping Liu, Quan-Sheng Li, Yu-Rong Huang, Chang-Xiao Liu

EL SEVIER




You-Ping Liu, National Key Laboratory of Pharmacokinetics andPharmacodynamics, Tianjin Institute of Pharmaceutical Research,308 An-Shan West Road, Tianjin 300193, ChinaYou-Ping Liu, Laboratory of Drug Metabolism Pharmacokinetics,Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang110016, Liaoning Province, ChinaChang-Xiao Liu, Quan-Sheng Li, Yu-Rong Huang, NationalKey Laboratory of Pharmacokinetics and Pharmacodynamics, TianjinInstitute of Pharmaceutical Research, Tianjin 300193, ChinaSupported by the National High Technology Research and DevelopmentProgram of China (863 Program), No. 2003AA2Z347DCorrespondence to: Academician Chang-Xiao Liu, Tianjin Instituteof Pharmaceutical Research, 308 An-Shan West Road, Tianjin 300193,China. [email protected]: +86-22-2300-6863 Fax: +86-22-2300-6860Received: 2004-03-09 Accepted: 2004-04-13

Abstract

AIM: To investigate the tissue distribution, urinary and fecalexcretions of 125I-lidamycin (125I-C-1027) in mice and its biliaryexcretion in rats.

METHODS: The total radioactivity assay (RA method)and the radioactivity assay after precipitation with 200 mL/Ltrichloroacetic acid (TCA-RA method) were used to dete-rminethe tissue distribution, and the urinary and fecal excretionsof 125I-C-1027 in mice and its biliary excretion in rats.

RESULTS: Tissue concentrations reached the peak at thefifth minute after administration of 125I-C-1027 to mice.The highest concentration was in kidney, and the lowestin brain at all test-time points. The organs of the concentr-ations of 125I-C-1027 from high to low were kidney, lung,liver, stomach, spleen, uterus, ovary, intestine, muscle, heart,testis, fat, and brain in mice. The accumulative excretionamounts of 0-24 h, and 0-96 h after administration of125I-C-1027 were 68.36 and 71.64% in urine, and 2.60 and3.21% in feces of mice, respectively, and the accumulativeexcretion amount of 0-24 h was 3.57% in bile in rats.

CONCLUSION: Our results reflect the characteristics ofthe tissue distribution, urinary and fecal excretions of 125I-C-1027 in mice and the biliary excretion of 125I-C-1027and its metabolites in rats, and indicate that 125I-C-1027and its metabolites are mainly distributed in kidney, andexcreted in urine.


Key words: Distribution; Excretion; Lidamycin; C-1027;RA method; TCA-RA method

Liu YP, Li QS, Huang YR, Liu CX. Tissue distribution andexcretion of 125I-lidamycin in mice and rats. World JGastroenterol 2005; 11(21): 3281-3284


INTRODUCTION

Lidamycin (C-1027) is a new kind of macromolecular antitumorantibiotics, produced by Streptomyces globisporus in soil, consistingof a noncovalently bound apoprotein and a labile chromophorewhich is responsible for most of the biological activities[1-5].C-1027 could exert remarkable inhibition on the growth ofhuman liver and colon cancers[6,7], and shows a highly potentcytotoxicity to cultured cancer cells and a marked DNAcleaving ability[8]. The protein moiety of C-1027 has a singlepolypeptide chain cross-linked by two disulfide bonds witha molecular weight of 10 500 Da[9,10]. Like other enediyneagents, antibiotic C-1027 is believed to exert its biologicalactivity through the induction of cellular DNA damage[11-13].Preclinical studies on the pharmacodynamics, pharmacokineticsand toxicology have exhibited that C-1027 appears to be avery promising anticancer candidate, and is entering clinicaltrial in China. The study on the pharmacokinetics of lidamycinhas been finished, and would be reported. In this paper, weinvestigated the distribution and excretion characteristicsof 125I-lidamycin in different organs of mice and rats.


Chemicals and instrumentationC-1027 (Lot: 20020525), with a purity of 95.0%, was producedby the Institute of Medicinal Biotechnology, Chinese Academyof Medical Sciences and Peking Union Medical University(Beijing, China). 125I-C-1027, which was radio-iodinated bythe Iodogen method[14], had a specific radioactivity of 7.45mCi (275.65 MBq)/mg. The radiochemical purity was morethan 95.0%. Iodogen was from the Academy of MilitaryMedical Sciences (Beijing, China). Trichloroacetic acid (analyticalgrade) was provided by the Chemical Company (Beijing,China), and sodium chloride solution (9 g/L) was purchasedfrom Dazhong Pharmaceutical Company (Tianjin, China).Gamma counter (FJ630G/12 model) was produced by theBeijing Nuclear Company (Beijing, China). This chromat-ographic system (LC-6A, Shimadzu, Japan) consists of apump (LC-6AT), a temperature box and a variable wavelengthUV detector (Spectra 100, Shimadzu, Japan). Sephadex G-50 column (300 mm×7.8 mm2 I.D.) was purchased fromPharmacia Company (USA). Distilled water, prepared fromdemineralized water, was used throughout the study.


AnimalsKunming mice (body weight, 17-24 g) and Wistar rats (bodyweight, 190-250 g), males and females, were purchased fromthe Center of Experimental Animals of Tianjin Instituteof Pharmaceutical Research (Certificate No. 20020804,Tianjin, China). They were raised at least 1 wk before theexperiment.

Preparation of 125I-C-1027Iodogen (100 g) in 100 L of chloroform was placed in asample tube and evaporated to dryness with nitrogen gas.Fifty micrograms of C-1027 and 50 µL of Na125I (74 MBq)were pipetted, mixed, and allowed to react at 15 ℃ for30 min[14]. The mixture was chromatographed on SephadexG-50 column. The mobile phase consisted of 0.05 mol/Lsodium dodecyl sulfate phosphate buffer solution (pH 7.0)at a flow rate of 0.8 mL/min. The eluted fractions, detectedby a gamma counter as the same chromatographic behavioras standard C-1027 and Na125I, were the components of125I-C-1027 and Na125I, respectively. The fraction, collectedfrom 10 to 12.5 min, was a single radioactive peak of 125I-C-1027, and was concentrated to a specific activity andapplied for the study.

Sample treatment procedureSerum sample solution (100 µL), which was prepared bydiluting the weighed tissue five times with 0.9% sodiumchloride solution, was directly determined by a gammacounter for radioactivity assay (RA method). To 100 µL ofserum sample, 100 µL of 20% trichloroacetic acid wasadded. The mixed solution was homogenized, precipitated,and centrifuged at 1 500 r/min for 10 min. The supernatantwas removed, and the precipitated fraction was detected bya gamma counter.

Tissue distribution testThe mice were randomly divided into three groups. Each groupcontained six mice. The mice were killed at 5, 30 min and 2,and 6 h after tail vein injection of 125I-C-1027 at the dose of50 µg/kg, respectively. Each of the tissues from heart, liver,spleen, lung, kidney, brain, muscle, intestines, fat, ovary,testis, and uterus was isolated and prepared for the assay.

Urine and feces excretion125I-C-1027 (50 µg/kg) was administered to mice by intra-venous injection. The animals were raised in metabolic cages.The urinary and fecal samples were collected at the fixedtime intervals from 0 to 1, 1 to 2, 2 to 4, 4 to 6, 6 to 8, 8 to 12,12 to 24, 24 to 36, 36 to 48, 48 to 72, and 72 to 96 h,respectively. The total volume of urine was measured. Thefeces was freeze-dried, weighed, and pulverized with a mortaror pestle. All samples were stored at -20 ℃ until analysis.

Bile excretionThe rats, which were anesthetized by i.p. injection of urethan(1.2 g/kg), were operated by the bile duct-cannulationmethod. Then, the animals were administered 125I-C-1027(50 µg/kg) by tail vein injection. The bile samples werecollected at the fixed time intervals from 0 to 1, 1 to 2, 2 to4, 4 to 6, 6 to 8, 8 to 12, and 12 to 24 h. The total volumewas measured, and the samples were kept at -20 ℃ until analysis.

Statistical analysisThe t-test was used to analyze the tissue distribution data.The data were expressed as mean±SD.

RESULTS

Curve equations and linearity rangeStock solution (2.0 mg/L) of 125I-C-1027 (275.65 MBq/L)and C-1027 was prepared in water, and stored at -20 ℃.The stock solution of 125I-C-1027 (2.0 mg/L), containing275.65 MBq/L of 125I-C-1027, was prepared into the serialconcentrations of standard solution of 0.5, 2.5, 5.0, 50.0,200.0, 500.0, and 1 000.0 g/L with 0.9% sodium chloridesolution. The standard solution was used to prepare standardcurves. The serial concentrations of calibration curves wereprepared with blank tissues of mice instead of 0.9% sodiumchloride solution as mentioned above. Quality control (QC)samples were prepared into concentrations of 5.0, 50.0,and 200.0 g/L in tissue. The regression equations, theconcentrations (x) vs response values (y), were as follows:

y = 90.2+1 103.9x (n = 8, r = 0.9997) for the standard125I-C-1 027, where r represents correlation coefficient.

y = 102.4+1 058.1x (n = 8, r = 0.9995) for serum at theconcentration range from 0.5 to 100.0 g/L, and

Heart: y = 67.6+1 235.8x (n = 7, r = 0.9996),Liver: y = 9.60+1 219.9x (n = 8, r = 0.9999),Kidney: y = 48.9+1 237.7x (n = 7, r = 0.9999),Brain: y = 75.4+1 220.9x (n = 7, r = 0.9998),Muscle: y = 39.2+1 225.9x (n = 6, r = 0.9999),Urine: y = 76.0+1 232.4x (n = 7, r = 0.9999),Feces: y = 44.6+1 232.8x (n = 6, r = 0.9999),Bile: y = 57.9+1 278.9x (n = 5, r = 0.9998) for each tissue

at concentration range from 0.5 to 100.0 g/L.

Precision and accuracyThe precision and accuracy of the assay were evaluated byassaying QC samples (5.0, 50.0, and 200.0 g/L) in sixreplicates on three different days.

The precision, which was evaluated by a one-way analysisof variance (ANOVA), was defined as the relative standarddeviation (RSD). The intra-day and inter-day mean squareof variance was used to calculate RSD values. The RSDwas less than 5.0% for intra-day and less than 10.0% for

Table 1 Recovery and precisions for the determination of 125I-C-1027 by TCA-RA method (n = 18, mean±SD)

Precision (%)Nominalconcentration (g/L) Measured concentration (g/L) Recovery (%)

Intra-d Inter-d

5.0 4.91±0.04 98.2 4.12 9.78

50.0 49.64±0.07 99.3 4.05 8.01

200.0 199.3±0.4 99.6 3.18 7.83

Liu YP et al. 125I-lidamycin in mice and rats 3283

the major pathway of radioactive materials.

Excretion of 125I-C-1027 in bileThe results determined after iv. injection of 125I-C-1027(50 µg/kg) to rats by RA method are displayed in Figure 3.The accumulative excretion amount was 3.57% in bile within24 h. It indicated that the bile excretion was a subsidiarypathway of radioactive materials.

DISCUSSION

The tissue distribution experiment showed that 125I-C-1027was widely distributed in most tissues of mice after intravenousadministration of it at the dose of 50 µg/kg. The drugconcentration was the highest in kidney. The concentrationsof 125I-C-1027 in fat, brain, ovary, testis, and uterus tissueswere lower than those in other tissues. The level of 125I-C-1027 could not be detected except in kidney after 36 h of

Figure 2 Excretion curves after iv. injection of 125I-C-1027 (50 g/kg) to miceby RA method (n = 6). A: excretion in urine; and B: excretion in feces. Valueswere expressed as mean±SD.

Figure 3 Bile excretion curve after i.v. injection of 125I-C-1027 (50 g/kg) to ratsby RA method (n = 5). Values were expressed as mean±SD.

inter-day assay at the range from 0.5 to 1 000.0 g/L foreach tissue, urine, feces and bile sample. The accuracy wasexpressed as the recovery (more than 98%) (Table 1). Thevalidation results satisfied the need of bioanalysis[15,16].

Tissue distribution of 125I-C-1027 in mice125I-C-1027 was observed in different tissues of mice afterintravenous administration of 125I-C-1027 (50 µg/kg).Figures 1A and B represent the graphs of the tissuedistribution of radioactivity of 125I-C-1027 by RA and TCA-RA methods after intravenous injection to mice, respectively.The conce-ntrations of 125I-C-1027 were the highest inkidney. The unchanged drug could not be detected exceptin kidney after 36 h. The results, obtained by RA and TCA-RA methods, were analyzed by t-test. There was a significantdifference between RA and TCA-RA methods (P<0.05).The results measured by RA method were higher than thoseby TCA-RA method. The RA method determined the totalradioactivity, and the TCA-RA method detected theprecipitated fractions and could remove the interferenceof decomposed compounds with a small molecular weight.The TCA-RA method was a better method to assay 125I-C-1027 in tissues.

Figure 1 Tissue distribution of radioactivity of 125I-C-1027 (50 ìg/kg) after i.v.injection to mice (n = 6). A: RA method; and B: TCA-RA method. Values wereexpressed as mean±SD.

Excretion of 125I-C-1027 in urine and fecesThe excretion-time curves of urine and feces, assayed byRA method after intravenous injection of 125I-C-1027(50 µg/kg) to mice, are plotted in Figure 2. The accumulativeexcretion percentages were 71.64 and 3.21% from urineand feces within 96 h, respectively. The urine excretion was

300

250

200

150

100

50

0

Conce

ntr

ation (

ng/g

)

5 min

30 min

2 h

6 h

Heart

Live

r

Sple

en

Lung

Kid

ney

Sto

mac

h

Inte

stin

e

Bra

in

Musc

le

Fat

Ovary

Ute

rus

Test

icle

Ser

um

Heart

Live

rSple

en

Lung

Kid

ney

Sto

mac

h

Inte

stin

e

Bra

in

Musc

le

Fat

Ovary

Ute

rus

Test

icle

Ser

um

A

B 250

200

150

100

50

0

Conce

ntr

ation (

ng/g

)

30 min

2 h

6 h

5 min

40

30

20

10

0Acc

um

ula

tive e

xcre

tion

am

ounts

(g/k

g)

0 20 40 60 80 100 Time (h)

80

60

40

20

0

-20 Exc

retion p

erc

enta

ge (

%)

2.0

1.6

1.2

0.8

0.4

0.0

Acc

um

ula

tive e

xcre

tion

am

ounts

(g/k

g)

0 20 40 60 80 100 Time (h)

4.0

3.2

2.4

1.6

0.8

0.0 Exc

retion p

erc

enta

ge (

%)

A

B

3.0

2.4

1.8

1.2

0.6

0.0

Acc

um

ula

tive e

xcre

tion

am

ounts

(g/k

g)

0 4 8 12 16 20 Time (h)

6.0

4.8

3.6

2.4

1.2

0.0 Exc

retion p

erc

enta

ge (

%)

administration. The concentrations in most tissues reachedthe peak values at the fifth min after administration. Theaccumulative excretion percentages were 71.64, 3.21, and3.75% in urine, feces, and bile, respectively. The kidneyhad a high concentration of 125I-C-1027 in our experiment,multi-dosage tissue distribution test was done within 72 h,and we found that there was a little accumulation in kidney.RA method determined the total radioactivity, and couldnot distinguish 125I-C-1027 from its decomposed products.TCA-RA method could remove 125I and its decomposedproducts with a small molecular weight, and has become anaccepted method[17]. TCA-RA method could further reflectthe tissue distribution characteristics of C-1027 comparedwith RA method. So, TCA-RA method is better than RAmethod.

REFERENCES1 Hu JL, Xue YC, Xie MY, Zhang R, Otani T, Minami Y, Yamada

Y, Marunaka T. A new macromolecular antitumor antibiotic,C-1027. I. Discovery, taxonomy of producing organism, fer-

mentation and biological activity. J Antibiot (Tokyo) 1988; 41:

1575-15792 Otani T, Minami Y, Marunaka T, Zhang R, Xie MY. A new

macromolecular antitumor antibiotic, C-1027. II. Isolation

and physico-chemical properties. J Antibiot (Tokyo) 1988; 41:1580-1585

3 Zhen YS, Ming XY, Yu B, Otani T, Saito H, Yamada Y. A new

macromolecular antitumor antibiotic, C-1027. III. Antitumoractivity. J Antibiot (Tokyo) 1989; 42: 1294-1298

4 Matsumoto T, Okuno Y, Sugiura Y. Specific interaction be-

tween a novel enediyne chromophore and apoprotein in mac-

romolecular antitumor antibiotic C-1027. Biochem Biophys ResCommun 1993; 195: 659-666

5 Otani T. Conformation studies on and assessment by spec-

tral analysis of the protein-chromophore interaction of themacromolecular antitumor antibiotic C-1027. J Antibiot (Tokyo)

1993; 46 : 791-802

6 He QY, Jiang B, Li DD, Zhen YS. Effects of lidamycin onapoptotic gene expressions and cytoskeleton in human

hepatoma bel-7402 cells. Aizheng 2002; 21: 351-355

7 Cui DP, Wang Z, Li DD. Effect of lidamycin on the expres-sion of genes involved in invasion regulation in HCT-8 human

colon cancer cells. Yaoxue Xuebao 2001; 36: 246-249

8 Liu JS, Kuo SR, Yin X, Beerman TA, Melendy T. DNA dam-age by the enediyne C-1027 results in the inhibition of DNA

replication by loss of replication protein A function and acti-

vation of DNA-dependent protein kinase. Biochemistry 2001;40 : 14661-14668

9 Shao RG, Zhen YS. Relationship between the molecular com-

position of C1027, a new macromolecular antibiotic withenediyne chromophore, and its antitumor activity. Yaoxue

Xuebao 1995; 30: 336-342

1 0 Zhou CS, Xu LN, Jiang M, Zhen YS. A monoclonal antibodydirected against an enediyne antitumor antibiotic and its pre-

liminary application. Yaoxue Xuebao 1997; 32: 28-32

1 1 Xu YJ, Li DD, Zhen YS. Mode of action of C-1027, a newmacromolecular antitumor antibiotic with highly potent

cytotoxicity, on human hepatoma BEL-7402 cells. Cancer

Chemother Pharmacol 1990; 27: 41-461 2 Wang Z, He Q, Liang Y, Wang D, Li YY, Li D. Non-caspase-

mediated apoptosis contributes to the potent cytotoxicity of

the enediyne antibiotic lidamycin toward human tumor cells.Biochem Pharmacol 2003; 65: 1767-1775

1 3 Totsuka R, Aizawa Y, Uesugi M, Okuno Y, Matsumoto T,

Sugiura Y. RNA cleavage by C-1027 chromophore, an enediyneantitumor antibiotic: high selectivity to an anticodon arm.

Biochem Biophys Res Commun 1995; 208: 168-173

1 4 Tang ZM, Liu XW, Xu LP, Shan CW, Song QS. Pharma-cokinetics and tissue distribution of human recombinant

interleukin-2 in mice. Zhongguo Yaoli Xuebao 1994; 15 :

5 1-5 61 5 Shah VP, Midha KK, Dighe S, McGilveray IJ, Skelly JP, Yacobi

A, Layloff T, Viswanathan CT, Cook CE, McDowall RD.

Analytical methods validation: bioavailability, bioequivalenceand pharmacokinetic studies. Conference report. Eur J Drug

Metab Pharmacokinet 1991; 16: 249-255

1 6 Liu CX, Wei GL, Li QS. Methodology study of validation forbioanalysis in studies on pharmacokinetics and bioavailability.

Asian J Drug Metab Pharcokinet 2001; 1: 279-286

1 7 Pannell R, Gurewich V. Pro-urokinase: a study of its stabil-ity in plasma and of a mechanism for its selective fibrinolytic

effect. Blood 1986; 67: 1215-1223

Science Editor Kumar M and Wang XL Language Editor Elsevier HK



Oncogenic role of clusterin overexpression in multistage colorectal

tumorigenesis and progression

Dan Xie, Jonathan S.T. Sham, Wei-Fen Zeng, Li-Hong Che, Meng Zhang, Hui-Xi Wu, Han-Liang Lin, Jian-Ming Wen, Sze

Hang Lau, Liang Hu, Xin-Yuan Guan

EL SEVIER




Dan Xie, Wei-Fen Zeng, Li-Hong Che, Meng Zhang, Hui-XiWu, Han-Liang Lin, Jian-Ming Wen, Department of Pathology,Zhong Shan Medical College, Sun Yat-Sen University, Guangzhou510089, Guangdong Province, ChinaJonathan S.T. Sham , Sze Hang Lau, Liang Hu, Xin-YuanGuan, Department of Clinical Oncology, The University of HongKong, Hong Kong, ChinaSupported by the Natural Science Foundation of China, No. 30300401,Guangdong Natural Science Foundation, No. 04009327, and the LeungKwok Tze Foundation of Hong Kong, ChinaCo-correspondents: Dan XieCorrespondence to: Dr. Xin-Yuan Guan, Department of ClinicalOncology, The University of Hong Kong, Room 109, School ofChinese Medicine Building, 10 Sassoon Road, Hong Kong,China. [email protected]: +852-25890458 Fax: +852-28169126Received: 2004-07-28 Accepted: 2004-10-13

Abstract

AIM: To investigate the expression pattern of clusterin incolorectal adenoma-carcinoma-metastasis series, and toexplore the potential role of clusterin in multistage colorectaltumorigenesis and progression.

METHODS: A colorectal carcinoma (CRC)-tissue microarray(TMA), which contained 85 advanced CRCs including 43cases of Dukes B, 21 of Dukes C and 21 of Dukes D tumors,were used for assessing the expression of clusterin (clone41D) and tumor cell apoptotic index (AI) by immunohist-ochemistry and TUNEL assay, respectively. Moreover thepotential correlation of clusterin expression with the patient’sclinical-pathological features were also examined.

RESULTS: The positive staining of clusterin in differentcolorectal tissues was primarily a cytoplasmic pattern.Cytoplasmic overexpression of clusterin was detected innone of the normal colorectal mucosa, 17% of the adenomas,46% of the primary CRCs, and 57% of the CRC metastaticlesions. In addition, a significant positive correlation betweenoverexpression of clusterin and advanced clinical (Dukes)stage was observed (P<0.01). Overexpression ofcytoplasmic clusterin in CRCs was inversely correlatedwith tumor apoptotic index (P<0.01), indicating the anti-apoptotic function of cytoplasmic clusterin in CRCs.

CONCLUSION: These data suggests that overexpressionof cytoplasmic clusterin might be involved in the tumorigenesisand/or progression of CRCs. The anti-apoptotic function ofcytoplasmic clusterin may be responsible, at least in part, forthe development and biologically aggressive behavior of CRC.


Key words: Clusterin; Colorectal tumorigenesis

Xie D, Sham JST, Zeng WF, Che LH, Zhang M, Wu HX, Lin HL,Wen JM, Lau SH, Hu L, Guan XY. Oncogenic role of clusterinoverexpression in multistage colorectal tumorigenesis andprogression. World J Gastroenterol 2005; 11(21): 3285-3289


INTRODUCTION

Colorectal carcinoma (CRC) is one of the most commonhuman cancers and a major cause of cancer-related deathin the developed countries[1]. The incidence of CRC in Chinaincluding urban Shanghai, is increasing rapidly particularlyin the last two decades[2]. At present, CRC is the fourth leadingcause of cancer-related death in China. Although CRC hasbeen widely studied and the development of this cancer ismost probably a multistep process involving multiple geneticchanges, the understanding of the precise pathogenicmechanisms by which normal colorectal epithelial cells becomemalignant cells, is far from being thoroughly understood.

Clusterin, also known as apolipoprotein J (ApoJ), is aheterodimeric highly conserved and secreted glycoproteinbeing expressed in a wide variety of tissues and found inmany body fluids. Clusterin has been implicated in diversenormal biological processes such as sperm maturation, lipidtransportation, tissue remodeling, membrane recycling, cell-cell and cell-substratum interactions and cell apoptosis[3-7].Recently, a potential oncogenic role of clusterin in thedevelopment and/or progression of several human cancershas been examined. Increased expression of clusterin wasdetected in prostate, renal cell and lung cancer[8,9]. Expressionof clusterin has been positively associated with the aggr-essive nature of breast cancer, while the expression ofclusterin in normal breast epithelial cells has been undete-ctable[10].

Moreover, increased expression of clusterin in murineand human intestinal neoplasia has been reported[11]. However,to date, the expression pattern of clusterin and its oncogenicrole in the development of human CRC are unclear. In thepresent study, the expression dynamics of clusterin in anarray of human colorectal tissue, normal and pathological,non-neoplastic and neoplastic, were investigated using a tissuemicroarray (TMA) assay. The potential correlation betweenclusterin expression and critical clinical/pathological featuresof CRC were also assessed.


MATERIALS AND METHODSPatients and tissuesEighty-five surgically resected CRC specimens were obtainedfrom the First Affiliated Hospital of Sun Yat-Sen University,Guangzhou, China as previously described[12]. The age of thesepatients ranged from 36 to 85 years at the time of surgery(mean age, 59.6 years) and the male/female ratio was 1.2:1.All cases selected were moderately differentiated adenocar-cinomas. According to Dukes staging system, the distributionfor clinical stage of these CRCs were as follows: Dukes B,43 cases; Dukes C, 21 cases; Dukes D, 21 cases. A previouslyconstructed TMA block containing all 85 CRC cases wasused for immunohistochemical (IHC) and TUNEL assay[12].In this CRC-TMA, six samples from different pathologicand progressive loci were selected from each of the 85advanced CRC cases. Tissue samples from adjacent non-neoplastic mucosa, primary carcinomas in inner layers (confinedto the layer of mucosa and/or submucosa), muscularis layerand serosa layer of the bowel wall were selected for all CRCcases. Tissue samples from matched adenomatous polypswere obtained from 22 cases (tubular, n = 12; tubulo-villous, n = 3; and villous, n = 7) and tissues from matchedlymph node and distant metastases were selected from 21cases.

IHC stainingIHC studies were performed using a standard streptavidin-biotin-peroxidase complex method[12]. In brief, TMA sectionswere deparaffinized and rehydrated. Endogenous peroxidaseactivity was blocked with 0.3% hydrogen peroxide for 20 min.For antigen retrieval, CRC-TMA slides were microwave-treated in 10 mmol/L citrate buffer (pH 6.0) for 10 min.Nonspecific binding was blocked with 10% normal rabbitserum for 10 min. The TMA slides were incubated with amonoclonal anti-clusterin (Clone 41D; Upstate Biotechnology,Lake Placid, NY, USA, 1:200 dilution) and a monoclonalanti-Ki-67 (Dako, Glostrup, Denmark, 1:100 dilution) for60 min at 37 ℃ in a moist chamber, respectively. The slideswere then sequentially incubated with a biotinylated rabbitanti-mouse immunoglobulin at a concentration of 1:100for 30 min at 37 ℃ and subsequently reacted with astreptavidin-peroxdase conjugate for 30 min at 37 ℃ and3’-3’ diaminobenzidine as a chromogen substrate. Thenucleus was counterstained using Meyer’s hematoxylin. The

slides were dehydrated and coverslipped. Negative controlswere performed by replacing the primary antibody with mouseIgG. Known immunostaining positive slides of ovarian cancerwere used as positive controls.

For evaluation of the clusterin IHC staining in differentcolorectal tissues, the positive expression of clusterin in non-malignant and malignant tissues was primarily a cytoplasmicpattern (Figure 1). Both staining intensity and positive areaswere recorded. A staining index (values 0-12), obtained asthe intensity of clusterin positive staining (negative = 0,weak = 1, moderate = 2, or strong = 3 scores) and theproportion of immunopositive cells of interest (<25% = 1;25-50% = 2; >50-75% = 3; >75% = 4 scores), was calculated.The status of Ki-67 nuclear expression was counted as thepercentage of Ki-67 positive staining cells in each case. Theimmunostained slides of TMA were reviewed independentlytwice and intra-observer disagreements (<10%) were revieweda third time, followed by a conclusive judgment.

TUNEL assayThe fluorescent TUNEL staining was performed using adeath detection kit (Roche Diagnostic GmbH, Mannheim,Germany) according to the manufacturer’s instructions.Briefly, the rehydrated TMA section was microwave-treatedin 10 mmol/L citrate buffer (pH 6.0) for 5 min. Afterwashing in phosphate-buffered saline (PBS), the specimenwas incubated with a mixture of TdT solution (enzymesolution) and FITC labeled dUTP solution (label solution)in a humidified chamber in the dark at 37 ℃ for 60 min.After washing, the slide was examined with a Zeiss Axiophotfluorescence microscope. Negative controls were obtainedby replacing the TdT solution with distilled water. Thepresence of clear nuclear staining (TUNEL-positive, greencolor) was indicative of apoptotic cells (Figure 2). Apoptoticbodies were defined as TUNEL-positive, single, relativelylarge (≥ 4 µm diameter) and rounded bodies existing inextra- or intra-tumor cells with intense staining. The numberof TUNEL-positive tumor cell nuclei was counted and theapoptotic index (AI) was determined as the percentage ofapoptotic cells in the tumor. Because the mean value of AIfor all informative samples in this study was 1.9, tumorswere classified into two groups according to their AI: lowAI group (AI≤1.9) and high AI group (AI>1.9).

To investigate the correlation of clusterin expression

Figure 1 Expression of clusterin in different pathological loci of one Dukes Ccolorectal carcinoma with matched lymph node metastasis. Strong cytoplasmicstaining of clusterin was observed in primary carcinoma in the mucosa layer ofthe bowel wall, while its adjacent normal mucosa showed a weak positivity

(A). Strong cytoplasmic staining of clusterin was also observed in carcinomasin muscularis propria (B), and serosa layer (C) and its matched lymph nodemetastasis (D) in the same primary carcinoma (original magnification ×100).

A C DB

Xie D et al. Clusterin in colorectal carcinoma 3287

and cell apoptosis, a simultaneous IHC staining with anti-clusterin antibody and fluorescent TUNEL staining wasperformed. First, clusterin immunostaining was performedas described above. The second antibody was used with aCy3 (orange) labeled goat anti-mouse polyclonal IgG (SC-20009, Santa Cruz Biotechnology, Santa Cruz, CA, USA,1:100 dilution) and incubated with the section, in the dark,at 37 ℃ for 45 min. The slide was washed with PBS andthen counterstained with 1 µg/mL DAPI in an anti-fadesolution, then examined with a Zeiss Axiophot fluorescencemicroscope equipped with a dual band pass filter forsimultaneous visualization of FITC and Spectrum Orangesignals using ×10 and ×40 objectives.

Statistical analysisFor statistical evaluation, 2 test for trend was used to assessthe differential expression of clusterin in different colorectaltissues. 2 test was used to assess the statistical significanceof the association of the expression of clusterin with thepatient’s clinico-pathological parameters and its correlationwith apoptotic indices. Unpaired t test was used to assess thestatistical significance of the differential expression of Ki-67 between groups with and without clusterin overexpression.P values lesser than 0.05 were considered significant.

RESULTS

Clusterin expression in colorectal tissuesThe expression of clusterin was investigated by IHC in aCRC-TMA which contained adjacent normal colorectalmucosa and different colorectal lesions including premalignantcolorectal adenoma, primary CRC, and metastatic CRC.The antibody (clone 41D) used in this study was a monoclonalanti-human clusterin, which recognizes the a subunit of theclusterin heterodimer. The expression pattern of clusterinin epithelial cells of different colorectal tissues was heterogeneouswith different staining indices in the cytoplasm. Becausethe staining index of cytoplasmic expression of clusterin inall 76 informative normal colorectal mucosa was less orequal to 6, we designated the staining index of 0-6 as the normalexpression of clusterin. Overexpression of clusterin wasdefined when staining index was more than 6 (Figure 1B-D).Using this designation, the overexpression of cytoplasmicclusterin was detected in 4/20 (17%) informative colorectal

adenomas, 39/85 (46%) primary CRCs, and 20/35 (57%)lymph node and/or distant metastatic lesions, respectively.The increasing frequencies of clusterin overexpression fromnormal colorectal mucosa, to benign adenomas and primaryCRC, and to CRC metastatic lesion were significant (P<0.01,2 trend test, Table 1). However, no heterogeneous expressionof clusterin was observed among the different layers ofthe bowel wall of CRC.

Table 1 Expression of clusterin in normal colorectal mucosa and inbenign and malignant colorectal tumors1

Clusterin Informative cases

Normal expression Overexpression

Normal mucosa 76 76 (100%) 0 (0)

Adenoma 20 16 (83%) 4 (17%)

Primary carcinoma 85 46 (54%) 39 (46%)

Metastases 35 15 (43%) 20 (57%)

1Values are n (%). A significant increasing frequency of overexpression of clusterin

was observed in adenoma, in primary carcinoma and in metastatic lesion (P<0.01,

2 test for trend.

Association of clusterin expression with clinico-pathologicalfeaturesThe association of cytoplasmic expression of clusterin andpatient’s clinico-pathological features were further studied.The results showed that cytoplasmic overexpression ofclusterin in primary CRC was significantly associated withthe patient’s clinical stage. Overexpression of clusterin wasdetected in 25/42 (60%) CRCs in late clinical stages (DukesC or D stage), which was significantly higher than that inearly stage (Dukes B) (14/43, 33%) (P<0.05, 2 test). Butno significant association was found between clusterinexpression and other clinico-pathological features, such aspatient’s gender, age, and tumor location (data not shown).

Correlation of clusterin expression with cell apoptosisBecause clusterin has been associated with the process ofcell apoptosis[7], the TUNEL assay was used to study thestatus of apoptosis in these CRC cohorts. A high apoptoticindex was detected in 32/83 (39%) of the informativeCRCs. The results showed that the frequency of highapoptotic index was significantly higher in tumors with a

Figure 2 Double fluorescent staining of clusterin and TUNEL in colorectalcarcinoma. A: A colorectal carcinoma with overexpression of cytoplasmicclusterin (red) showed low apoptotic index (AI), where apoptosis (green signalindicated with arrows) was observed in only one tumor cell; B: High AI was

observed in a CRC with negative expression of cytoplasmic clusterin, whereseveral TUNEL positive cells (green nuclei indicated with arrows) were observed.(Left figure: original magnification ×100; Right figure: ×400).

A B

normal expression of clusterin (24/46 cases, 52%) thanthat in cases with overexpression of clusterin (8/37, 22%)(P<0.01, Table 2). In addition, the double fluorescent stainingwith clusterin and TUNEL showed that apoptosis was morelikely to occur in tumor cells with low level expression ofclusterin, but not in tumor cells with high level of expressionof clusterin (Figure 2A). In general, cell apoptosis in CRCwas inversely correlated with the overexpression of clusterin.

Table 2 Correlation of expression of clusterin and apoptotic index(AI) in colorectal carcinomas

Apoptotic index (AI)

Clusterin Informative High Low P1

case

Overexpression (%) 37 8 (22) 29 (78) <0.01

Normal expression (%) 46 24 (52) 22 (48)

12 test.

Correlation of clusterin expression with cell proliferationTo identify whether or not the overexpression of clusterinwas associated with cell proliferation in colorectal cancer,we further analyzed the potential correlation between theexpression of clusterin and cell proliferation (via monoclonalanti-ki-67). For the 39 cases with overexpression of clusterin,an average of 36.7% of the tumor cells was positively stainedwith Ki-67 antibody, which was similar to that (average of38.1% cells) in the remaining 46 tumors with normal expressionof clusterin (P>0.05, unpaired-t test).

DISCUSSION

Most CRCs arise from adenomas through an archetypalpathogenic pathway, the adenoma-carcinoma-metastasissequence. CRC is a well-studied example of multisteptumorigenesis and, therefore, offers an excellent model toinvestigate the accumulation of genetic alterations duringthis neoplastic process. In the present study, we used apreviously constructed TMA-CRC series[12], which wascomposed of multiple colorectal tissues from differentpathological loci of the same patient samples. These samplesrepresented the full spectrum of CRC pathogenesis, includingadjacent normal mucosa, benign adenoma, primary carcinomasand lymph node and distant metastases. Overall, overexp-ression of clusterin was observed to increase from the earliestdetectable stage of abnormal growth, adenoma, to primarycarcinoma and to local lymph node or distant metastases.These findings provide evidence that the increased expressionof clusterin is involved in CRC tumorigenesis andprogression. In addition, we found that the overexpressionof cytoplasmic clusterin in primary CRCs was stronglyassociated with patients’ Dukes stage, i.e., overexpressionof clusterin in cytoplasm was more frequently detected inlater Dukes stages (C and D) when compared to that inDukes B. These results suggest that overexpression ofcytoplasmic clusterin in CRC may facilitate cancer cell invasionand metastasis. Previous studies have also documented thatincreased expression of clusterin was involved in the develop-ment and progression of several types of carcinomas, including

breast, prostate and kidney carcinomas[8-10]. Taken together,clusterin expression may be an important prognostic factorof aggressive nature of several human cancers, includingCRC.

Although some hypothetical indirect tumorigenicfunctions of clusterin could be speculated due to itsimplication in cell-cell and cell-substratum interactions, andin a cytoprotective role in plasma membrane[13], the biologicalrole in tumorigenesis remains unclear. Trougakos and colleagueshave reported that clusterin knockdown in human cancercell, by using small interfering RNA, may induce higher ratesof spontaneous apoptosis and significantly reduce tumorcell growth [14]. Other groups have reported a significant increasein cell death after transfection of antisense oligonucleotidesinto clusterin[15]. Some authors have suggested that the anti-apoptotic activity of clusterin may account for the genesis andbiologically aggressive behavior of several cancer cells[10,16].In the present study, a significant inverse correlation ofclusterin expression and apoptosis was revealed in our CRCcohorts, i.e., a lower apoptotic index was more likely to beobserved in CRCs with overexpression of cytoplasmicclusterin than in those with normal expression of this protein.Furthermore, tumor cells undergoing apoptosis were oftenfound with a lower expression level of cytoplasmic clusterinwhen compared to their adjacent tumor cells withoutapoptosis. These results demonstrate as well an anti-apoptoticfunction of clusterin in CRCs.

Clusterin has been implicated in apoptosis as a pro-oranti-apoptotic molecule in various models under differentcircumstances, in which clusterin may exert differentbiological functions[13]. Recently, it has become increasinglyclear that the clusterin gene codes for a family of differentprotein isoforms[17], which are derived, by alternative post-translational processes, from the same precursor of 53 kuprotein[18,19]. Different isoforms of clusterin have beenpreviously reported to occur, in apoptotic and surviving cells,in the regressing rat ventral prostate[4]. Nuclear clusterin hasbeen suggested as a cell death protein[20]. Recently, data fromin vivo and in vitro studies of clusterin in colon tumorigenesishave demonstrated that nuclear clusterin was predominantlyexpressed in normal mucosa of colon and may act as a pro-apoptosis protein, while cytoplasmic clusterin may functionas an anti-apoptosis protein[16]. In the colorectal tumors ofthe present study, the antibody (clone 41D) used was amonoclonal anti-human clusterin, which recognizes the subunit of the clusterin heterodimer. The staining ofclusterin in colorectal epithelial cells was only a cytoplasmicpattern and nuclear staining was not observed in colorectalepithelial tissues, non-neoplastic and neoplastic. Althoughfurther studies are needed to determine the exact functionof the different isoforms of clusterin and how the signalingpathways through clusterin gene are regulated, the presentstudy has demonstrated: (1) a cytoplasmic expression patternof clusterin in the full spectrum of CRC pathogenesis, fromnormal mucosa, to adenoma, to carcinoma, to metastasis; and(2) an increased level of cytoplasmic clusterin was directlyassociated with decreased cell apoptosis, increased aggres-siveness and metastasis, suggesting that this protein mayplay an important role in the multistage development and/orprogression of human CRCs.


REFERENCES1 Potter JD. Colorectal cancer: molecules and populations. J

Natl Cancer Inst 1999; 91: 916-932

2 Jin F, Devesa SS, Chow WH, Zheng W, Ji BT, Fraumeni JF,Gao YT. Cancer incidence trends in urban shanghai, 1972-

1994: an update. Int J Cancer 1999; 83: 435-440

3 Murphy BF, Kirszbaum L, Walker ID, d’Apice AJ. SP-40,40,a newly identified normal human serum protein found in the

SC5b-9 complex of complement and in the immune deposits

in glomerulonephritis. J Clin Invest 1988; 81: 1858-18644 Aronow BJ, Lund SD, Brown TL, Harmony JA, Witte DP.

Apolipoprotein J expression at fluid-tissue interfaces: poten-

tial role in barrier cytoprotection. Proc Natl Acad Sci USA 1993;90 : 725-729

5 Fratelli M, Galli G, Minto M, Pasinetti GM. Role of clusterin

in cell adhesion during early phases of programmed cell deathin P19 embryonic carcinoma cells. Biochim Biophys Acta 1996;

1311 : 71-76

6 Humphreys DT, Carver JA, Easterbrook-Smith SB, WilsonMR. Clusterin has chaperone-like activity similar to that of

small heat shock proteins. J Biol Chem 1999; 274: 6875-6881

7 O’Sullivan J, Whyte L, Drake J, Tenniswood M. Alterations

in the post-translational modification and intracellular traf-

ficking of clusterin in MCF-7 cells during apoptosis. Cell Death

Differ 2003; 10: 914-927

8 Parczyk K, Pilarsky C, Rachel U, Koch-Brandt C. Gp80

(clusterin; TRPM-2) mRNA level is enhanced in human renal

clear cell carcinomas. J Cancer Res Clin Oncol 1994; 120: 186-

188

9 Steinberg J, Oyasu R, Lang S, Sintich S, Rademaker A, Lee C,

Kozlowski JM, Sensibar JA. Intracellular levels of SGP-2

(Clusterin) correlate with tumor grade in prostate cancer. Clin

Cancer Res 1997; 3: 1707–1711

1 0 Redondo M, Villar E, Torres-Muñoz J, Tellez T, Morell M,

Petito CK. Overexpression of clusterin in human breastcarcinoma. Am J Pathol 2000; 157: 393–399

1 1 Chen X, Halberg RB, Ehrhardt WM, Torrealba J, Dove WF.

Clusterin as a biomarker in murine and human intestinalneoplasia. Proc Natl Acad Sci USA 2003; 100: 9530-9535

1 2 Xie D, Sham JS, Zeng WF, Lin HL, Che LH, Wu HX, Wen JM,

Fang Y, Hu L, Guan XY. Heterogeneous expression and asso-ciation of beta-catenin, p16 and c-myc in multistage colorectaltumorigenesis and progression detected by tissue microarray.Int J Cancer 2003; 107: 896-902

1 3 Trougakos IP, Gonos ES. Clusterin/apolipoprotein J in hu-man aging and cancer. Int J Biochem Cell Biol 2002; 34 :1430-1448

1 4 Trougakos IP, So A, Jansen B, Gleave ME, Gonos ES. Silencing

expression of the clusterin/apolipoprotein j gene in humancancer cells using small interfering RNA induces spontaneousapoptosis, reduced growth ability, and cell sensitization togenotoxic and oxidative stress. Cancer Res 2004; 64: 1834-1842

1 5 Sensibar JA, Sutkowski DM, Raffo A, Buttyan R, GriswoldMD, Sylvester SR, Kozlowski JM, Lee C. Prevention of cell deathinduced by tumor necrosis factor alpha in LNCaP cells byoverexpression of sulfated glycoprotein-2 (clusterin). Cancer

Res 1995; 55 : 2431-24371 6 Pucci S, Bonanno E, Pichiorri F, Angeloni C, Spagnoli LG.

Modulation of different clusterin isoforms in human colontumorigenesis. Oncogene 2004; 23: 2298-2304

1 7 Wong P, Pfeffer BA, Bernstein SL, Chambers ML, Chader GJ,Zakeri ZF, Wu YQ, Wilson MR, Becerra SP. Clusterin proteindiversity in the primate eye. Mol Vis 2000; 6: 184-191

1 8 Lakins J, Bennett SA, Chen JH, Arnold JM, Morrissey C, Wong

P, O’Sullivan J, Tenniswood M. Clusterin biogenesis is alteredduring apoptosis in the regressing rat ventral prostate. J BiolChem 1998; 273: 27887-27895

1 9 Wong P, Ulyanova T, Organisciak DT, Bennett S, Lakins J,

Arnold JM, Kutty RK, Tenniswood M, vanVeen T, DarrowRM, Chader G. Expression of multiple forms of clusterin dur-ing light-induced retinal degeneration. Curr Eye Res 2001; 23:157-165

2 0 Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA.Synthesis and functional analyses of nuclear clusterin, a celldeath protein. J Biol Chem 2003; 278: 11590-11600

Xie D et al. Clusterin in colorectal carcinoma 3289



Raman spectra of single cell from gastrointestinal cancer patients

Xun-Ling Yan, Rui-Xin Dong, Lei Zhang, Xue-Jun Zhang, Zong-Wang Zhang

EL SEVIER




Xun-Ling Yan, Rui-Xin Dong, School of Physics Science andInformation Engineering, Liaocheng University, Liaocheng 252059,Shandong Province, ChinaLei Zhang, Xue-Jun Zhang, Zong-Wang Zhang, Surgery of LiaochengPeople’s Hospital, Liaocheng 250059, Shandong Province, ChinaSupported by the National Natural Science Foundation of China,No. 60471049 and the Natural Science Foundation of ShandongProvince of China, No. Y2004G09Correspondence to: Xun-Ling Yan, School of Physics Scienceand Information Engineering, Liaocheng University, Liaocheng252059, Shandong Province, China. [email protected]: +86-635-8238321 Fax: +86-635-8238864Received: 2004-07-19 Accepted: 2004-09-24

Abstract

AIM: To explore the difference between cancer cells andnormal cells, we investigated the Raman spectra of singlecells from gastrointestinal cancer patients.

METHODS: Al l samples were obtained from 30diagnosed as gastrointestinal cancer patients. The fleshtumor specimen is located in the center of tumor tissue,while the normal ones were 5 cm away from the outsidetumor section. The imprint was put under the micros-cope and a single cell was chosen for Raman measure-ment. All spectra were collected at confocal Ramanmicro-spectroscopy (British Renishaw) with NIR 780 nmlaser.

RESULTS: We measured the Raman spectra of severalcells from gastrointestinal cancer patients. The resultshows that there exists the strong line at 1 002 /cmwith less half-width assigned to the phenylalanine inseveral cells. The Raman lines of white cell were lowerand less, while those of red cell were not only higherin intensity and more abundant, but also had a parti-cular C-N breathing stretching band of pyrrole ring at1 620-1 540 /cm. The line at 1 084 /cm assigned tophosphate backbone of DNA became obviously weakerin cancer cell. The Raman spectra of stomach cancercells were similar to those of normal cells, but theRaman intensity of cancer cells was much lower thanthat of normal cells, and even some lines disappear.The lines of enteric cancer cells became weaker thanspectra above and many lines disappeared, and thecancer cells in different position had different fluorescenceintensity.

CONCLUSION: The Raman spectra of several cells fromcancer patients show that the structural changes of cancercells happen and many bonds rupture so that the biologicalfunction of cells are lost. The results indicate that Raman

spectra can offer the experiment basis for the cancerdiagnosis and treatment.


Key words: Raman spectra; Gastrointestinal cancer

Yan XL, Dong RX, Zhang L, Zhang XJ, Zhang ZW. Ramanspectra of single cell from gastrointestinal cancer patients.World J Gastroenterol 2005; 11(21): 3290-3292


INTRODUCTION

Cancer is one of the most serious diseases threatening humanhealth and life, and the influence of this disease becomesincreasing. Due to the pathogeny of cancer and some correlativeillness have not been found, and the effective diagnosis andcomplete therapy cannot be carried out at present. It isimpossible to control the progress of the state of the illnessfor cancer patient in terminal stages. Therefore, early diagnosisand timely therapy is the most effective approach in improvingthe surviving chance of patient. It is very difficult to diagnosecancer in modality because the early symptom of cancer isnot evident and it has no distinct difference from that ofsome other illness. Therefore, it is a research emphasis to findnew, effective diagnosis technology and treatment method.

The vibration spectrum has promising potential as ananalytical tool for diagnosing cancer because it can probethe chemical composition and molecular structure of thenormal and pathological tissue, so that researchers havepaid much attention to the field over the past decade[1-5].The Raman method has the relative lower requirement to thepreparation of sample, ordinary biological sample such as cell,living tissue, DNA and RNA can be measured directly. Themeasurement has no damage to sample and a large numberof data can easily be obtained. Therefore, many applicationof Raman spectrum have been gained in biology, medicine,medicament analysis and filtration[6-10]. But to date, there issome lack of knowledge about the Raman spectra of a singlecancer cell in the former reports. In the present paper, wereport a study about the Raman spectra of single cells ofstomach, rectal, and colon cancer tissue and correspondingnormal cells.


All samples were collected from the imprint with desquamationcells from fresh sample after operating on 30 diagnosedpatients of Liaocheng People’s Hospital (20 men and 10women, of ages 30-70 years). The tumor specimens were

taken from the part of cancer tissue, the normal sampleswere 5 cm away from the outside cancer tissue. The residualsamples after the patches were marked were stained andsliced so as to be analyzed and diagnosed in pathology.

All spectra were collected at confocal Raman micro-spectroscopy (British Renishaw), with NIR 780 nm laserwhose power was maintained at 25 mW and the spectralresolution was less than 2 /cm.

RESULTS

The Raman spectra of single red cell and a string of red cellare shown in Figure 1A. The red cell is mainly composed ofmembrane and cytoplasm which has a large number ofhemoglobin. We can see that hemoglobin has a typical bandat 1 620-1 540 /cm in Figure 1A, which is assigned to C-Nbreathing stretching band of pyrrole ring. This band cannot bemeasured in other cells. There exists the peak at 1 654 /cmassigned to -helix, which has low intensity, but the peaksassigned to -folding and random coil are not found. Theband of amide-III at 1 246 /cm is wide and strong, which isassigned to the overlapping of -helix, -folding and randomcoil. The Raman lines at 1 447, 1 369 and 1 340 /cmcorrespond to the deformation vibration of CH2 and CH3.The strong line with 4 /cm half-width at 1 001 /cm assigned tothe phenylalanine is very steady and can be used as a standardline with respect to other Raman lines. The frequencies ofother Raman lines and their assignment are shown in Table 1.

Figure 1 Raman spectra of several cells from cancer patients. A: red cell; B:lymphocyte; C: white cell.

The Raman spectra of single white cell are shown inFigure 1B. Its peaks are very weak except the band ofphenylalanine at 1 003 /cm.

The Raman spectra of lymphocyte are shown inFigure 1C. We can see the wide and strong band at 1 658 /cm,which is assigned to the characteristic vibration ofAmide-I and may be correlated to the overlapping of-helix, -sheet and random coil. The strong Ramanlines at 1 447 /cm corresponds to the deformation ofCH2 and CH3. The assignment of other Raman lines isshown in Table 1.

The Raman spectra of normal cell from rectal cancerpatient are shown in Figure 2A similar to that of thelymphocyte. Figures 2B and 2C show the Raman spectraof cancer cells on rectal smooth muscle and rectal,respectively. The Raman line assigned to phenylalanine isstill distinct and its intensity becomes low in cancer cells.There exist the Raman lines of Amide-I, CH2 and CH3 intwo cases, these lines become weak and other lines disappear.The cancer cells in different position have distinctly differentfluorescence intensity. The Raman spectra of colon cancercells in Figure 3A are similar to that of rectal cancer cells inFigure 2C.

The Raman spectra of stomach cancer cells are shownin Figure 3B. Its Raman spectra are similar to the normalcells, but the Raman intensity is much lower than that ofnormal cells. The peak at 1 084 /cm of phosphate backboneof DNA disappears.

Figure 2 Raman spectra of normal and cancer cell from rectum cancer patients.A: normal cell; B: cancer cell on rectal smooth muscle; C: rectal cancer cell.

Table1 Peak position and assignments of Raman spectra of several cells from cancer patients

Red cell White cell Lymphocyte Normal cell Colon, rectal cancer cell Stomach cancer cell Assignments

1 654 1 658 1 658 1 657 1 662 1 660 Amide-I , -helix

1 619 Tyr, Trp v (C = C)

1 578 Phe v (C = C) symmetric

1 560 Trp

1 548 Trp

1 447 1 445 1 447 1 449 1 449 1 449 (CH2, CH3)

1 369 CH2

1 340 1 338 1 338 1 342 CH2

1 246 1 247 1 247 1 248 Amide-III

1 209 1 208 1 206 Tyr, Phe

1 123 1 126 1 126 1 126 v (C-N)

1 084 1 084 v (C-N)

1 052 1 053 1 054 1 054 v (C-N)

1 030 1 032 1 032 1 032 Phe v (C-H)

1 001 1 003 1 003 1 003 1 002 1 002 Phe v (C-C) symmetric

Symmetric

974 CH2

936 937 936 938 v (CC)skeletal -helix

9 000

8 000

7 000

6 000

5 000

4 000

3 000

2 000

1 700 1 600 1 500 1 400 1 300 1 200 1 100 1 000

Counts/Raman shift (/cm)

1 6

58

1 6

19

1 5

78 1 5

60

1 4

47

1 3

69 1 2

46

1 1

23

1 0

52

1 0

30

1 0

01

974

1 0

03

1 003

A

B

7 000

6 000

5 000

4 000

3 000

1 700 1 600 1 500 1 400 1 300 1 200 1 100 1 000 900


1 6

57

1 4

49

1 3

38

1 2

08 1

154

1 1

26

1 0

84

1 0

32

1 003

936

1 003

A

B

C

Yan XL et al. Raman spectra in GI cancer 3291

C

DISCUSSION

We studied the Raman spectra of several cells from gastroi-ntestinal cancer patients. There exists the strong line at1 002 /cm with less half-width assigned to the phenylalaninein several cells, whose intensity is not easy to change andcan often be a standard of Raman lines of cell. The Ramanintensity of white cell is low and lacking, while that of redcell is high and abundant and it has a particular C-N breathingstretching band of pyrrole ring from 1 620 to 1 540 /cm.The relative intensity of 1 084 /cm of phosphate backboneof DNA becomes obviously weak in cancer cells. The Ramanspectra of stomach cancer cells are similar to the normalcells, but the Raman intensity is much lower than that ofnormal cells. The lines of enteric cancer cells become weakerthan that of stomach cancer and many lines disappear andthe cancer cells in different part have different fluorescenceintensity. These conclusions show that the structure changesof cancer cells happen and many bonds rupture so that the

Figure 3 Raman spectra of cancer cell. A: colon cancer cell; B: stomachcancer cell

biological function of cells are lost. The results indicate thatRaman spectra may offer the experiment basis for cancerdiagnosis and treatment.

REFERENCES1 Huang Z, McWilliams A, Lui H, McLean DI, Lam S, Zeng H.

Near-infrared Raman spectroscopy for optical diagnosis oflung cancer. Int J Cancer 2003; 107: 1047-1052

2 Sun CW, Xu YZ, Sun KH, Wu QG, Li WH, Xu ZH, Wu JG. Astudy of the diagnosis of salivary gland tumors by means ofmid infrared optical fiber technique. Spectroscopy Spectral Analysis1996; 16 : 22-25

3 Ling X, Li W, Song Y, Yang Z, Xu Y, Weng S, Xu Z, Fu X, ZhouX, Wu J. FT-Raman spectroscopic investigation on stomachcancer. GuangPuXue Yu GuangPu FenXi 2000; 20: 692-693

4 Crow P, Uff JS, Farmer JA, Wright MP, Stone N. The use ofRaman spectroscopy to identify and characterize transitionalcell carcinoma in vitro. BJU Int 2004; 93: 1232-1236

5 Notingher I, Verrier S, Haque S, Polak JM, Hench LL. Spec-troscopic study of human lung epithelial cells (A549) inculture: living cells versus dead cells. Biopolymers 2003; 72:230-240

6 Gao XL, Butler IS, Richard KR. A Novel Model of Assessmentof Medical effect and Mechanisms of Anticancer Drugs RamanSpectroscopy. Acta Laser Biol Sinica 1998; 7: 22-26

7 Xu Y, Zhang Z, Zhang W. Raman spectroscopic characteris-tics of microcosmic and photosensitive damage on space struc-ture of liposomes sensitized by hypocrellin and its derivatives.Sci China C Life Sci 1998; 41: 459-464

8 Li G, Yang H, Xu Y, Zhang Z. Raman microspectroscopic studyof biomolecular structure inside living adhesive cells. Sci ChinaC Life Sci 2002; 45: 397-405

9 Dong R, Yan X, Pang X, Liu S. Temperature-dependent Ramanspectra of collagen and DNA. Spectrochim Acta A Mol BiomolSpectrosc 2004; 60: 557-561

1 0 Feofanov AV, Grichine AI, Shitova LA, Karmakova TA,Yakubovskaya RI, Egret-Charlier M, Vigny P. Confocal ramanmicrospectroscopy and imaging study of theraphthal in liv-ing cancer cells. Biophys J 2000; 78: 499-512

Language Editor Elsevier HK

4 500

4 000

3 500

3 000

2 500

2 000

1 700 1 600 1 500 1 400 1 300 1 200 1 100 1 000 900 800


1 1261 206

1 342

1 4491 002

853

827

A

B


1 002


Expression of bcl-2 oncogene in gastric precancerous lesions and

its correlation with syndromes in traditional Chinese medicine

Ling Hu, Shao-Xian Lao, Chun-Zhi Tang

EL SEVIER




Ling Hu, Shao-Xian Lao, Chun-Zhi Tang, Institute of theSpleen and Stomach, Guangzhou University of Traditional ChineseMedicine, Guangzhou 510405, Guangdong Province, ChinaSupported by the Major Programs of Guangzhou University ofTCM and the National Key Technologies Research and DevelopmentProgram of China during the 8th Five-Year Plan Period, No. GH0016and 85-919-01-01Co-correspondents: Shao-Xian LaoCorrespondence to: Ling Hu, Institute of the Spleen and Stomach,Guangzhou University of Traditional Chinese Medicine, 12Jichang Road, Guangzhou 510405, Guangdong Province,China. [email protected]: +86-20-36585444Received: 2004-07-20 Accepted: 2004-09-19

Abstract

AIM: To observe the protein and mRNA expression ofbcl-2 oncogene in gastric precancerous lesions (GPL) andto analyze its correlation with syndromes in traditionalChinese medicine (TCM).

METHODS: Sixty-seven patients with GPL confirmed bygastroscopy and pathology were studied, including 39cases of moderate gastric mucosal dysplasia, 19 casesof severe gastric mucosa dysplasia, 9 cases of incompletecolon metaplasia. In syndrome differentiation of TCM, 17cases belonged to the syndrome of qi and yin deficiencyof the spleen and stomach complicated by qi stagnation,21 cases belonged to the syndrome of qi and yin deficiencyof the spleen and stomach complicated by stomach heat,29 cases belonged to the syndrome of qi and yin deficiencyof the spleen and stomach complicated by blood stasis.Protein and mRNA expression of bcl-2 oncogene weredetected by labeled streptavidin biotin (LSAB) immunohist-ochemistry and in situ hybridization respectively.

RESULTS: Abnormal expression of protein and mRNA onbcl-2 oncogene was found in GPL, which increasedgradually with the course of lesions. In moderate andsevere gastric mucosal dysplasia and incomplete colonmetaplasia, there was no difference in the expression ofbcl-2 oncogene (P>0.05). In different accompanyingsyndromes, the expression of protein and mRNA on bcl-2oncogene increased gradually in the following order:deficiency of both qi and yin of the spleen and stomachaccompanying qi stagnation → stomach heat → bloodstasis. In GPL, compared with accompanying blood stasis,there was an obvious difference in the expression of bcl-2oncogene between the syndrome of qi and yin deficiencyof the spleen and stomach and accompanying stomach

heat, so did accompanying qi stagnation (the level ofprotein: 2 = 8.45, P<0.05; the level of mRNA: 2 = 7.35,P<0.05).

CONCLUSION: Apoptosis-associated bcl-2 oncogene isabnormally expressed in GPL, which correlates with differentaccompanying syndromes in TCM.


Key words: Stomach neoplasm/genetics; Stomach neoplasm/therapy of TCM; Precancerous condition/pathology;Oncogene bcl-2; Syndrome of TCM

Hu L, Lao SX, Tang CZ. Expression of bcl-2 oncogene in gastricprecancerous lesions and its correlation with syndromes intraditional Chinese medicine. World J Gastroenterol 2005;11(21): 3293-3296


INTRODUCTION

Gastric precancerous lesions (GPL) refer to moderate andsevere dysplasia and/or incomplete colon metaplasia. It hasan increasing risk to develop into gastric cancer[1-5]. Gastriccancer has a close correlation with abnormal cell proliferationand apoptosis. Excessive accumulation of cells causedby imbalance of proliferation and apoptosis may be thepathological basis of gastric cancer development[6-10].Traditional Chinese medicine (TCM) holds that GPL is acomplex syndrome of deficient origin and excessivesuperficiality. Deficiency of qi and yin of the spleen andstomach is the origin of GPL. Its superficiality includes qistagnation, blood stasis and heat toxin. Chinese herbs cannot only relieve clinical symptoms of GPL[11-13], but alsoregulate the expression of related oncogenes to some extentin GPL[14-17]. Bcl-2 is one of the oncogenes and has a closecorrelation with apoptosis, its abnormal expression is usuallyobserved during the development of GPL[18-25]. Althoughoverexpression of bcl-2 oncogene is found in GPL, it isdifferent in same tissues of different sufferers and theregulating effect of Chinese herbs is different too. Recently,it has been found that the protein expression of someproliferation-associated genes is correlated with GPLsyndromes[26]. In this article, the correlation betweenexpression of bcl-2 oncogene in GPL with syndromes inTCM was further investigated from the viewpoints ofapoptosis, protein expression and mRNA transcription ofbcl-2 oncogene.



MaterialsAll samples of gastric mucosa were obtained under agastroscopy. Four samples were obtained from each patient.Moderate and severe dysplasia were confirmed by pathologicexamination. Incomplete colon metaplasia was confirmedby HID-ABpH2.5-PAS staining. Based on the syndromedifferentiation in TCM, patients meeting the diagnosticcriteria were included in the study, patients with abnormalfunctions of heart, liver, and kidney or carcinomatous changewere excluded. The criteria of syndrome differentiationin TCM were as follows (referring to Clinical Trial Guidelineof New Chinese Herbs, first edition, 1993:88, 108); dominatingsymptoms of deficiency of both qi and yin of the spleenand stomach: including fullness and distension of theepigastrium being more severe after meal, bulgy and tendertongue, or tongue with tooth prints, weak red tongue withwhitish fur or thin fur, slow and weak pulse; minor symptomsof deficiency of both qi and yin of the spleen and stomach:including lassitude of limbs, no desire to speak, sweating,dryness of mouth and without desire to drink, emaciation.Patients with two dominating symptoms (including state oftongue or pulse) and two minor symptoms could bediagnosed as dysplasia. Accompanying symptoms of qistagnation were as follows: fullness, distension and discomfortof the epigastrium, distending pain in hypochondrium,frequent belching, gastric discomfort with acid regurgitationand taut pulse. Accompanying symptoms of blood stasiswere as follows: persistent and fixed pain, sting, dark tongueor tongue with petechia. Accompanying symptoms ofstomach heat were as follows: dry and bitter mouth, dryfeces, and tongue with yellow fur. Patients having two ofthe above symptoms were diagnosed with accompanyingsyndromes. Sixty-seven cases of GPL were enrolled in thisresearch, including 39 cases of moderate gastric mucosaldysplasia, 19 cases of severe gastric mucosa dysplasia and9 cases of incomplete colon metaplasia. In the syndromedifferentiation in TCM, 17 cases had qi stagnation, 21 caseshad stomach heat, and 29 cases had blood stasis. Theiraverage age was 53±11 years. The course of disease was lessthan 5 years in 36 cases, 5-10 years in 25 cases, and morethan 10 years in 6 cases. Monoclonal antibody to bcl-2and LSAB reagent kit were products of DAKO Company.Bcl-2 ISH kit was a product of Boshide Company.

MethodsGastric mucosa was prepared with 1 g/L diethyl pyrocarbonatebefore it was fixed for preventing degeneration of nuclearacids. Labeled streptavidin biotin method and in situhybridization (ISH) were adopted for determining theexpression of protein and mRNA transcription of bcl-2oncogene. PBS was used instead of the first antibody asnegative control group. Proved positive sections were usedas positive control. Positive signals were fine brown yellowgranules. The hybridization probe was removed in negativegroup. The samples were prepared with RNase forpreventing false positive signals. The positive signals werefine purple and black granules.

Statistical analysisThe data were analyzed by 2 test and 2 partition test withSPSS 10.0 software package. P<0.05 was consideredstatistically significant.

RESULTS

Detection of bcl-2 oncogene in GPLThe expression of protein and mRNA on bcl-2 oncogenewas observed in cytoplasm of GPL (Figures 1 and 2). Asthe lesion developed, the expression gradually increased,but there was no significant difference in moderate andsevere gastric mucosal dysplasia and incomplete colonmetaplasia (P>0.05, Table 1).

Table 1 Protein and mRNA expression of bcl-2 oncogene in GPL (%)

Lesions n Protein mRNA expression expression

Moderate gastric mucosal dysplasia 39 35.89 41.03

Severe gastric mucosal dysplasia 19 47.37 52.63

Incomplete colon metaplasia 9 33.33 44.44

Expression of bcl-2 oncogene in different accompanyingsyndromesThe protein and mRNA expressions of bcl-2 oncogene wereobserved in different accompanying syndromes. The expressionincreased gradually in the following order: deficiency ofboth qi and yin of the spleen and stomach accompanyingqi stagnation → stomach heat → blood stasis (Table 2).

Figure 1 Protein positive expression of bcl-2 oncogene in gastric mucosal dysplasia. (A) and incomplete colon metaplasia; (B) (LSAB, ×200).

A B

Hu L et al. Bcl-2 oncogene GPL 3295

Table 2 Protein and mRNA expression of bcl-2 oncogene in GPLwith different accompanying syndromes (%)

Accompanying syndrome n Protein expression mRNA expression

Qi stagnation 17 17.65 23.53

Stomach heat 21 28.57 33.33

Blood stasis 29 58.62a 62.07c

aP<0.05, 2: 8.45 vs stagnation and stomach heat. cP<0.05, 2: 7.35 vs qi stagnation

and stomach heat.

DISCUSSION

Oncogene can regulate and control proliferation, differentiationmetastasis and apoptosis of carcinoma cells[27,28]. Bcl-2 is anew oncogene, which locates on 18q21 of chromosome, encodesa protein with Mr 26 000 molecule, and is predominantlydistributed in nuclear membrane and cytoplasm of endoplasmicreticulum. It can block programmed cell death but doesnot affect cell proliferation and is an important factor forsuppressing apoptosis[29]. Overexpression of bcl-2 oncogenepromotes development of carcinoma by suppressingapoptosis and prolonging life span of cells[30,31]. Undernormal conditions, cells of human gastric mucosa renewfrequently. The dynamic balance between proliferation andapoptosis maintains the normal structure of gastric mucosa.Generally speaking, apoptotic cells locate on the surface ofmucosa and proliferate on the gland neck of gastric mucosa,indicating the growing, aging and dying rule of gastric mucosacells from basal layer to surface. However, in atrophygastritis, colon metaplasia, dysplasia and gastric cancer,apoptotic and proliferating cells do not have the abovecharacteristics, and abnormal expression of bcl-2 oncogeneis found in these lesions. When the lesions exacerbate, thecell proliferation index increases while apoptosis indexdecreases gradually, the dynamic balance between proliferationand apoptosis is disturbed, suggesting that there is a regulatingdisturbance between cell apoptosis and proliferation incarcinogenesis of gastric mucosa, while bcl-2 oncogene isinvolved in regulating apoptosis of GPL[6-10]. Finally, theincrease of instability and speeding of accumulation of cellsresult in carcinogenesis.

TCM believes that GPL is a syndrome of deficient originand excessive superficiality. Deficiency of both qi and yin ofthe spleen and stomach is the origin of GPL. Its superficialityincludes qi stagnation, blood stasis, and heat toxin. Chinese

herbs can not only relieve the clinical symptoms of GPL[11-13],but also decrease the protein expression of bcl-2 oncogeneto some extent[32,33]. The expression of bcl-2 oncogene isdifferent in similar tissues of different patients, while theregulating effect of Chinese herbs on gene expression isnot the same. GPL is a complex syndrome of deficientorigin and excessive superficiality. Does the differenceindicate that there is an internal relationship between theexpression of apoptosis-associated gene and syndromes inTCM? The results of our study showed that there wereabnormal protein and mRNA expressions of bcl-2 oncogenein GPL. With the development of lesions in gastric mucosa,the positive rate of the gene expression increased gradually.Although there were no significant differences in expressionof bcl-2 oncogene in moderate and severe gastric mucosaldysplasia and incomplete colon metaplasia, it was quitedifferent between different accompanying syndromes inTCM. From the viewpoint of TCM, the state of illness isthe slightest in accompanying qi stagnation, more severe inaccompanying stomach heat, and the worst in accompanyingblood stasis, indicating that there is a parallel relationshipbetween the expression of bcl-2 oncogene and the state ofillness in different accompanying syndromes of GPL. Themore serious the state of illness, the higher is the positiverate of bcl-2 oncogene expression. The pathology oftransformation of accompanying syndromes of GPLcorrelates with the abnormal expression of proliferation-associated genes[26] and apoptosis-associated genes, which isconsistent with the concept that carcinoma results from theimbalance between cell proliferation and apoptosis inWestern medicine. Study on the correlation between thesyndromes of GPL and gene expression might be a newway for uncovering the syndromes of GPL.

REFERENCES1 You WC, Li JY, Blot WJ, Chang YS, Jin ML, Gail MH, Zhang L,

Liu WD, Ma JL, Hu YR, Mark SD, Correa P, Fraumeni JF, XuGW. Evolution of precancerous lesions in a rural Chinesepopulation at high risk of gastric cancer. Int J Cancer 1999; 83:615-619

2 Misdraji J, Lauwers GY. Gastric epithelial dysplasia. SeminDiagn Pathol 2002; 19: 20-30

3 Cesar AC, Silva AE, Tajara EH. Genetics and environmental

factors in gastric carcinogenesis. Arq Gastroenterol 2002; 39:

253-2594 Chen X, Wang MW, You WD. Relationship between Helicobacter

pylori infection and proliferation and apoptosis of gastric

Figure 2 mRNA positive expression of bcl-2 oncogene in gastric mucosal dysplasia. (A) and incomplete colon metaplasia; (B) (ISH, ×200).

A B

epithelial dysplasia cell. Aizheng 2003; 22: 244-247

5 van Grieken NC, Meijer GA, zur Hausen A, Meuwissen SG,Baak JP, Kuipers EJ. Increased apoptosis in gastric mucosa

adjacent to intestinal metaplasia. J Clin Pathol 2003; 56 :

358-3616 Correa P, Miller MJ. Carcinogenesis, apoptosis and cell

proliferation. Br Med Bull 1998; 54: 151-162

7 Xu A, Li S, Liu J. Correlation between apoptosis and prolif-eration in gastric pre-carcinoam. Zhonghua Yixue Zazhi 1999;

79 : 185-186

8 Pan CJ, Zhong P, Huang XR, Liu KY, Wang SX. Study on thecorrelation between proliferation and apoptosis in atrophy

and intestinal metaplasia of gastric mucosa. Shijie Huaren

Xiaohua Zazhi 2000; 8: 143-1469 Pan CJ, Liu KY. Proliferation/apoptosis and expression of

P53 and Bcl-2 in gastric carcinoma. Shijie Huaren Xiaohua

Zazhi 2003; 11 : 526-5301 0 Mong H, Liu LN, Lv S. Expression of relating genes protein of

proliferation and apoptosis in Gastric cancer and its precan-

cerous lesion of gastric mucosa. Shijie Huaren Xiaohua Zazhi2004; 12 : 494-496

1 1 Zhong WR, Huang YX, Cui JP. Clinical study on modified

sijunzi decoction in treating intestinal metaplasia of gastricmucosa. Zhongguo Zhongxiyi Jiehe Zazhi 1997; 17: 462-464

1 2 Lao SHX, Xu XM, Zhou FSH, Yu SHY, Jia JG, Zheng YX,

Huang ZHX, Guo SCH, Bian ZHX. The analysis of therapeu-tic effect in precancerous lesion of gastric cancer by WeiYanXiao.

Zhongyao Xinyao Yu Linchuang Yaoli 1997; 8: 72-75

1 3 Hu L, Lao SX, Zhou FS. The strategy Of therapeutic study onprecancrous lesion of gastric cancer by traditional Chinese

medicine. Shijie Huaren Xiaohua Zazhi 2000; 8(Suppl 8): 3

1 4 Hu L, Lao SX. P21 and P53 protein expression in gastricprecancerous lesions and regulating effect of Weiyanxiao.

Huaren Xiaohua Zazhi 1998; 6: 873-874

1 5 Hu L, Lao SX. Expression of relative genes in precancerouslesion of gastric cancer and the regulating effect of WeiYanXiao

on it. Zhongguo Zhongxiyi Jiehe Piwei Zazhi 1999; 7: 91-92

1 6 Hu L, Lao SX, Zhou FS, Tang CZ. Regulating effects ofWeiYanXiao in target gene expression in gases with precan-

cerous lesion of gastric carcinoma. Zhejiang Zhongxiyi Jiehe

Zazhi 2001; 11 : 334-3361 7 Hu L, Lao SX. Effect of Epidermal Growth Factor Receptor

expression in precancerou lesions of gastric cancer by WeiYanXiao.

Zhongguo Zhongxiyi Jiehe Xiaohua Zazhi 2003; 11: 331-3331 8 Hu L. Preliminary exploration of the relationship between

apoptosis and gastric carcinoma and precancerosis. CJIM 1999;

5: 142-1451 9 Sun SH, Sun BY, Zhi HL, Xu XF, Sun DZH. Poptosis and

expression of its regulating gene in gastric carcinoma and its

precancerous lesions. Zhongguo Bingli Shengli Zazhi 2002; 18:395-397

2 0 Jorge O, Cuello Carrion FD, Jorge A, Ciocca DR. Helicobacter

pylori infection affects the expression of PCNA, p53, c-erbB-2 and Bcl-2 in the human gastric mucosa. Rev Esp Enferm Dig

2003; 95 : 97-104, 89-96

2 1 Lu XG, Feng BA, Zhan LB, Yu ZH. D-limonene inducesapoptosis of gastric cancer cells. Zhonghua Zhongliu Zazhi

2003; 25 : 325-327

2 2 Zhan N, Xiong YY, Lan J, Wang BC, Tian SF, Yu SP. Relation-ship between Helicobacter pylori infection and expression of c-

myc, Bcl-2, and Bax protein in different gastric mucosa lesions.

Aizheng 2003; 22: 1034-10372 3 Yang Y, Deng CS, Peng JZ, Wong BC, Lam SK, Xia HH. Effect

of Helicobacter pylori on apoptosis and apoptosis related genes

in gastric cancer cells. Mol Pathol 2003; 56: 19-242 4 Pan W, Ishii H, Ebihara Y, Gobe G. Prognostic use of growth

characteristics of early gastric cancer and expression patterns

of apoptotic, cell proliferation, and cell adhesion proteins. JSurg Oncol 2003; 82: 104-110

2 5 Lee KM, Lee DS, Yang JM, Ahn BM, Lee EH, Yoo JY, Kim YJ,

Chung IS, Sun HS, Park DH. Effect of Helicobacter pylori ongastric epithelial cell kinetics and expression of apoptosis-

related proteins in gastric carcinogenesis. Korean J Gastroenterol

2003; 42 : 12-192 6 Hu L, Lao SX. Relationship between expression of p21ras, c-

erbB-2 and p53 and TCM syndrome in gastric precancerouslesions. Shijie Huaren Xiaohua Zazhi 2004; 12: 262-265

2 7 Yasui W, Yokozaki H, Fujimoto J, Naka K, Kuniyasu H,Tahara E. Genetic and epigenetic alterations in multistep car-cinogenesis of the stomach. J Gastroenterol 2000; 35 Suppl 12:111-115

2 8 Tamura G. Genetic and epigenetic alterations of tumor sup-pressor and tumor-related genes in gastric cancer. HistolHistopathol 2002; 17 : 323-329

2 9 Chou HK, Chen SL, Hsu CT, Chao YC, Tsao YP. Bcl-2 accel-erates retinoic acid-induced growth arrest and recovery inhuman gastric cancer cells. Biochem J 2000; 348 Pt 2: 473-479

3 0 Wang YK, Ji XL, Ma NX. Expressions of P53, bcl-2 and c-erbB-2 genes in precarcinomatous gastric mucosa. ShijieHuaren Xiaohua Zazhi 1999; 7: 114-116

3 1 Gao HJ, Bai JF, Peng YS, Sun G, Zhao HL, Lu XZ, Zhao ZQ,Xiao SD. Expression and mutual relationship of tumor sup-pression gene and apoptosis regulating gene in gastric carci-noma and paracancerous tissues. Zhonghoa Xiaohua Zazhi2000; 20 : 178-181

3 2 Tang CZ, Lao SX, Hu L, Kuang ZS. Effect of Weiyanxiao onapoptosis and its relative genes expression in treatingprecancerosis of gastric cancer. Zhongguo Zhongxiyi Jiehe PiweiZazhi 2000; 8: 263-264

3 3 Su M, Dai M, Lu X, Li H, Liu J. Effect of traditional Chinesemedicine compounds Aining on the expression of apoptosisinducing genes of human gastric cancer cell. Zhongyaocai 2002;25 : 563-566




Pivotal molecules of MHC I pathway in human primary

hepatocellular carcinoma

Wei Chen, Mei-Ying Cai, Da-Peng Wei, Xia Wang

EL SEVIER




Wei Chen, Department of Medical Cell Biology, School of LifeScience, Sichuan University, Chengdu 610041, Sichuan Province,ChinaMei-Ying Cai, Da-Peng Wei, Xia Wang, Department of Immunology,School of Preclinical and Forensic Medicine, Sichuan University,Chengdu 610041, Sichuan Province, ChinaSupported by the National Natural Science Foundation of China,No. 30070855Correspondence to: Da-Peng Wei, Department of Immunology,School of Preclinical and Forensic Medicine, Sichuan University,Chengdu 610041, Sichuan Province, China. [email protected]: +86-28-85501262Received: 2004-02-23 Accepted: 2004-03-18

Abstract

AIM: To investigate the expression of several importantmolecules involved in major histocompatibility complex(MHC) class I presentation pathway in primary hepatocellularcarcinoma (HCC), and to determine whether cytotoxic Tlymphocyte (CTL) vaccine therapy was suitable for HCC.

METHODS: Labeled streptavidin biotin (LSAB) method ofimmunohisto-chemistry was used to study 33 HCC tissuespecimens.

RESULTS: Most HCC tissues and adjacent histologicalnormal hepatocytes expressed HLA-I antigens,TAP, andB7, expression of B7 was especially strong, and therewas no significant difference between them (P>0.05).

CONCLUSION: The MHC class I presentation pathway inprimary hepatocellular carcinoma may not be abnormalor dysfunctional, and CTL could kill these tumor cells.Thus, it is suitable and practicable to design and constructCTL vaccine against HCC.


Key words: MHC I; Hepatocellular carcinoma

Chen W, Cai MY, Wei DP, Wang X. Pivotal molecules of MHCI pathway in human primary hepatocellular carcinoma. WorldJ Gastroenterol 2005; 11(21): 3297-3299


INTRODUCTION

Cell-mediated immunity plays an important role in anti-tumorimmune response, especially lysis by cytotoxic T lymphocytes

(CTL)[1]. Intact MHC I presentation pathway is crucial forintroduction of cellular immunity and killing by CTL. Thetransporter associated with antigen processing (TAP), humanleukocyte antigen (HLA)-I antigens and B7 are importantmolecules of the MHC I presentation pathway. TAP is atransmembrane transport protein located in endoplasmicreticulum (ER) and its main function is to translocateendogenously processed antigenic peptides from cytosol intoER lumen. There, antigenic peptides and HLA class Imolecules assemble into a HLA I molecule-antigenic peptidecomplex, and then this complex is translocated to the surfaceof cell and recognized by CD8+T lymphocytes to providethe first signal of T cell activation. B7 is the most importantcostimulatory molecule of antigen-presenting cells (APCs),and it binds to its partner (CD28) on the surface of T cellsto deliver the second signal. Upon the double signal stimulationT cells proliferate and differentiate to initiate cell immunity.At the effective stage, lysis of target cells by CTL is alsodependent on recognition of HLA I molecule-antigenicpeptide complex on the target cells. Many tumors down-regulate or lose expression of TAP, HLA-I antigens or B7molecules leading to dysfunction or defect of MHC Ipresentation pathway to escape from immune surveillanceof the host[1-7]. The aim of CTL epitope-based vaccine is toinduce and produce specific CTL response. Therefore, it isnecessary to investigate the expression of TAP, HLA-Iantigens and B7 in human primary hepatocellular carcinoma,and to understand the relationship between the tumor andhost before design and construction of CTL epitope-basedvaccine against HCC.


Main reagentsMouse anti-human B7 mAb and HLA-ABC mAb werepurchased from DAKO Corp. Rabbit anti-human TAP pAbwas from Chemicon International, Inc. Biotin labeled goatanti-mouse IgG, HRP-labeled streptavidin and avidin biotinblocking system were from Beijing Zhongshan Corp.

Tumor specimensThirty-three pathological specimens were obtained fromsurgically resected tissues of patients with HCC in WestChina Hospital of Sichuan University, two of them withoutadjacent histological normal hepatocytes. All specimens werefixed in 40 g/L formaldehyde, embedded in paraffin.Consecutive sections (5 µm) were prepared and attached toloading-slides smeared with APES before. Pathologicaldiagnoses were made based on routinely processed HEsections.


ImmunohistochemistryThe sections were dewaxed and rehydrated. Endogenousperoxidase was blocked with 30 mL/L H2O2 for 15 min.After retrieval of antigens, the sections were incubated withnormal goat serum for blocking non-specific antigens andsubsequently with antibody (anti-TAP, HLA-ABC and B7,respectively) or PBS as control at 37 ℃ for 1 h, washedand incubated with biotinylated goat anti-mouse IgG or goatanti-rabbit IgG at 37 ℃ for 30 min. After being washed asbefore, HRP labeled streptavidin was added. The followingincubation and washing were exactly the same as above.Finally, DAK working solution was added for colordevelopment. The reaction was stopped with tap water rinse.Then, the sections were counterstained with hematoxylinand mounted for examination.

Statistical analysisThe differences between HCC tissues and adjacenthistological normal hepatic tissues were analyzed with 2-square test. P<0.05 was considered statistically significant.

RESULTS

Expression of HLA-I antigensPositive staining of HLA-I antigens appeared in brown. Thestaining was mainly located on the cell membrane, in thecytoplasm and perinuclear area of tumor cells and hepatocytes.The cytoplasmic staining showed a granular pattern. Theadjacent hepatic tissues squeezed by tumor were stainedmore strongly, and there was negative staining in connectivetissues between lobes of liver (Figure 1A).

HLA-I antigens expression was strongly positive in allHCC specimens. Thirty of thirty-one (96.8%) adjacent hepatictissues showed positive staining.

Expression of TAPPositive staining of TAP appeared in brown, and the stainingwas mainly located in the cytoplasm and perinuclear areaof tumor cells and hepatocytes. The staining showed agranular pattern. The hepatic tissues adjacent to tumor werestained more intensely, and connective tissues between lobesof liver were negatively stained (Figure 1B).

TAP expression was detected in 32 of 33 HCC specimens(97.0%). The positive expression of TAP was present in all31 normal hepatic tissues adjacent to tumor.

Expression of B7 moleculesThe very strongly positive expression of B7 molecules wasdetected in 33 HCC tissues and 30 adjacent non-neoplastichepatic tissues. The positive staining located on the cellmembrane and filled cytosol, and showed a granularintracytoplasmic pattern. No B7 molecule was detected inconnective tissues between lobes of liver (Figure 1C).

Comparison between HCC and adjacent normal hepatic tissuesExpressions of HLA-I antigens,TAP and B7 were stronglypositive in 32 of 33 cases of HCC (97.0%).Twenty-nine ofthirty-one cases expressed these molecules (93.5%) inadjacent normal hepatic tissues. The statistical analysisshowed there was no significant difference in expressionsbetween HCC and adjacent normal hepatic tissues (P>0.05).

DISCUSSION

HCC is the most common malignant tumor of liver, andthe second killer cancer in China. Because of unsatisfactorycurative effects of surgical therapy, radiotherapy andchemotherapy, and the high rate of recurrence, much efforthas been devoted to HCC immunotherapy[1]. Currently,antitumor CTL epitope-based vaccines aimed to inducespecific CTL have been widely considered for cancerimmunotherapy[8]. Two basic problems need to be solvedfor the design and construction of CTL vaccines. One ishow to induce tumor-specific CTL, the other is killing tumorcells by CTL. Both of them are associated with the functionof MHC I presentation pathway in tumor cells. Dysfunctionor defect of MHC I presentation pathway could lead to noexpression of HLA I molecule-antigenic peptides on thesurface of tumor cells, and specific CTL could not recognizethe tumor cells and kill them. Therefore, it is necessary toinvestigate the expression of several important moleculesinvolved in MHC class I presentation pathway in HCCbefore design and construction of CTL vaccines targetingtumor-associated antigens (TAA) of HCC.

It has been generally acknowledged that tumors usuallyescape from host immune surveillance by dysfunction ordefect of MHC I presentation pathway, such as decrease ordefect expression of TAP, HLA-I antigens or B7 molecule[1-7].But our results showed the majority of HCC tissues andadjacent normal tissues expressed important componentsof MHC I presentation pathway, which is consistent with

Figure 1 Expression of HLA-I antigens,TAP and B7 in HCC. A: Expression of HLA-I antigens; B: Expression of TAP; C: Expression of B7.

A CB

Chen W et al. MHC I pathway HCC 3299

the results from human HCC cell lines by other groups.Sung et al[9], and Wadee et al[10], found that several humanHCC cell lines strongly express HLA-I antigens by differentways. Kurokohchi et al[11], detected both HLA-I antigen andTAP expression in several liver cancer cell lines by PCR.Furthermore, Butterfield et al[12], obtained three hAFP CTLepitope peptides (hAFP158-166, hAFP325-334, hAFP542-550) fromthe surface of AFP-producing human HCC cell line HepG2by acid elution, and this showed that HepG2 had a functionalMHC I presentation pathway able to process and presentAFP naturally. These results together with our findingindicate that MHC class I presentation pathway may not beabnormal or dysfunctional in most HCCs and adjacent livertissues, and TAA may be processed and presented naturallyin most HCCs. So, specific CTLs are able to recognize andkill HCC cells, the CTL epitope-based vaccine is suitablefor immunotherapy of HCC. It also implies that tumorescape is attributed to post-antigen presentation events.

Wei et al[13], proposed that immunotolerance was one ofthe main mechanisms for tumors to escape from hostimmune surveillance, and tumors were regarded as a kindof special autoantigens, which are normally tolerable tohost immune system. Tumors also escape from immunesurveillance through suppressing host immunity by variedways. Si et al[14], found that B7 molecules were expressed inmany cancerous human tissues. Chaperot et al[15], found thatmalignant B cells from non-Hodgkin’s lymphomas expressedfunctional B7 molecules. This is consistent with our finding,suggesting that tumor growth is not only attributed to defectof costimulatory molecules in APC. Dendritic cells (DC)are the most potent professional APC of our body, andplay an important role in antitumor immunity. The datashowed that tumor environment could inhibit activation andmaturation, and some tumor infiltrating cells could evensecrete IL-10 to suppress host antitumor immunity[16,17]. Itwas reported that DC in human regional lymph nodesdraining cancer exhibited a functional depletion as comparedto those from patients without malignancies[18]. Recently, Chenet al[19], reported that neuroblastoma cells could inhibit theimmune function of DC. Our studies also showed thatDC from peripheral blood of patients with HCC were in astate of low immune function (data unpublished). Takentogether, it indicates that the host of tumor is possibly in astate of immunotolerance or immunosuppression. So it issuitable and practicable to design and construct CTL epitope-based vaccines against HCC.

REFERENCES

1 Melief CJ, Kast WM. Lessons from T cell responses to virusinduced tumours for cancer eradication in general. Cancer Surv

1992; 13 : 81-89

2 Ruiz-Cabello F, Garrido F. HLA and cancer: from research toclinical impact. Immunol Today 1998; 19: 539-542

3 Cromme FV, Airey J, Heemels MT, Ploegh HL, Keating PJ,

Stern PL, Meijer CJ, Walboomers JM. Loss of transporterprotein, encoded by the TAP-1 gene, is highly correlated with

loss of HLA expression in cervical carcinomas. J Exp Med

1994; 179 : 335-3404 Hosch SB, Izbicki JR, Pichlmeier U, Stoecklein N, Niendorf A,

Knoefel WT, Broelsch CE, Pantel K. Expression and prognos-

tic significance of immunoregulatory molecules in esophagealcancer. Int J Cancer 1997; 74: 582-587

5 Fan P, Wang S, Liu X, Zhen L, Wu Z. Major histocompatibil-

ity complex class II antigen and costimulatory molecule ex-pression on the surface of breast cancer cells. Zhonghua

ZhongLiu ZaZhi 2002; 24: 327-330

6 Lang S, Whiteside TL, Lebeau A, Zeidler R, Mack B,Wollenberg B. Impairment of T-cell activation in head and

neck cancer in situ and in vitro: strategies for an immunerestoration. Arch Otolaryngol Head Neck Surg 1999; 125: 82-88

7 Stopeck AT, Gessner A, Miller TP, Hersh EM, Johnson CS,

Cui H, Frutiger Y, Grogan TM. Loss of B7.2 (CD86) andintracellular adhesion molecule 1 (CD54) expression is asso-ciated with decreased tumor-infiltrating T lymphocytes indiffuse B-cell large-cell lymphoma. Clin Cancer Res 2000; 6:

3904-39098 Bona CA, Casares S, Brumeanu TD. Towards development

of T-cell vaccines. Immunol Today 1998; 19: 126-1339 Sung CH, Hu CP, Hsu HC, Ng AK, Chou CK, Ting LP, Su

TS, Han SH, Chang CM. Expression of class I and class IImajor histocompatibility antigens on human hepatocellularcarcinoma. J Clin Invest 1989; 83: 421-429

1 0 Wadee AA, Paterson A, Coplan KA, Reddy SG. HLA ex-

pression in hepatocellular carcinoma cell lines. Clin ExpImmunol 1994; 97: 328-333

1 1 Kurokohchi K, Carrington M, Mann DL, Simonis TB,Alexander-Miller MA, Feinstone SM, Akatsuka T, Berzofsky

JA. Expression of HLA class I molecules and the transporterassociated with antigen processing in hepatocel lularcarcinoma. Hepatology 1996; 23: 1181-1188

1 2 Butterfield LH, Meng WS, Koh A, Vollmer CM, Ribas A,Dissette VB, Faull K, Glaspy JA, McBride WH, EconomouJS. T cell responses to HLA -A*0201-restricted peptides de-rived from human alpha fetoprotein. J Immunol 2001; 166:

5300-53081 3 Wei YQ. Immunotherapy of tumors with vaccines based on

xenogeneic homologous molecules. Anticancer Drugs 2002; 13:229-235

1 4 Si L, Si H, Chen Y, Sun Y, Wing Y. B7-1 antigen expression intumor cells from cancerous human tissues. Anal Quant CytolHistol 1999; 21 : 521-526

1 5 Chaperot L, Plumas J, Jacob MC, Bost F, Molens JP, Sotto JJ,Bensa JC. Functional expression of CD80 and CD86 allowsimmunogenicity of malignant B cells from non-Hodgkin’slymphomas. Exp Hematol 1999; 27: 479-488

1 6 Hart DN, Schultze JL, Stewart AK. Presentation of tumorantigens. Semin Hematol 1999; 36: 21-25

1 7 Biggs MW, Eiselein JE. Suppression of immune surveillancein melanoma. Med Hypotheses 2001; 56: 648-652

1 8 Laguens G, Coronato S, Laguens R, Portiansky E, Di GirolamoV. Human regional lymph nodes draining cancer exhibit aprofound dendritic cell depletion as comparing to those frompatients without malignancies. Immunol Lett 2002; 84: 159-

1621 9 Chen X, Doffek K, Sugg SL, Shilyansky J. Neuroblastoma

cells inhibit the immunostimulatory function of dendritic cells.J Pediatr Surg 2003; 38: 901-905

Science Editor Wang XL and Zhu LH Language Editor Elsevier HK


Construction of single chain Fv antibody against transferrin

receptor and its protein fusion with alkaline phosphatase

Dao-Feng Yang, Hui-Fen Zhu, Zhi-Hua Wang, Guan-Xin Shen, De-Ying Tian

EL SEVIER




Dao-Feng Yang, De-Ying Tian, Tongji Hospital, Tongji MedicalCollege, Huazhong University of Science and Technology, Wuhan,430030, Hubei Province, ChinaHui-Fen Zhu, Zhi-Hua Wang, Guan-Xin Shen, Division ofImmunology, Tongji Medical College, Huazhong University ofScience and Technology, Wuhan, 430030, Hubei Province, ChinaSupported by Natural Key and Basic Research DevelopmentProgram, No. 2002CB513109Correspondence to: Guan-Xin Shen, Division of Immunology, TongjiMedical College, Huazhong University of Science and Technology,Wuhan 430030, Hubei Province, China. [email protected]: +86-27-83692640Received: 2004-03-03 Accepted: 2004-04-05

Abstract

AIM: To construct fusion protein of a single-chain antibody(scFv) against transferrin receptor (TfR) with alkalinephosphatase (AP).

METHODS: The VH-linker-VL, namely scFv gene, wasprepared by amplifying the VH and VL genes from plasmidpGEM-T-VH and pGEM-T-VL with splicing overlap extensionpolymerase chain reaction (SOE PCR). After the ScFv genewas modified by Sfi I and Not I, it was subcloned into thesecretory expression vector pUC19/119, and then wastransformed into E.coli TG1. The positive colonies werescreened by colony PCR and their expressions wereinduced by IPTG. ScFv gene was gained by digesting ScFvexpression vector pUC19/119 with Sfi I and Not I restrictionenzymes, then subcloned into expression vector pDAP2,followed by transformation in E.coli TG1. The positivecolonies were selected by bacterial colony PCR. Theexpression of fusion protein (scFv-AP) was induced byIPTG. Its activity was detected by enzyme immunoassay.The molecular weights of scFv and scFv-AP were measuredby sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE).

RESULTS: The product of SOE PCR formed a band of 700bp in agarose gel electrophoresis. SDS-PAGE demonstratedthe molecular weight of scFv was 27 ku. Immunofluorescentassay (IFA) demonstrated its reactivity with TfR. Themolecular weight of scFv-AP was 75 ku. Enzyme immunoassayshowed that scFv-AP could specifically bind to human TfRand play AP activity.

CONCLUSION: We have successfully prepared the anti-human TfR scFv and constructed the fusion protein of scFvand AP. It is promising for immunological experiments.


Key words: Transferrin receptor; Fusion protein; Single chainFv antibody; Alkaline phosphatase; Primary hepatocarcinoma

Yang DF, Zhu HF, Wang ZH, Shen GX, Tian DY. Constructionof single chain Fv antibody against transferrin receptor andits protein fusion with alkaline phosphatase. World JGastroenterol 2005; 11(21): 3300-3303


INTRODUCTION

Transferrin receptor (TfR) is a transmembrane glycoprotein,which expresses on the surface of rapidly proliferative cellsand highly expresses in various tumor cells, especially inhepatoma carcinoma cells[1]. It is associated with substancetransfer in cell cycles[2-5]. Therefore, anti-TfR antibody (Ab)is regarded as a potential molecule for the located diagnosisand target treatment of tumors[6-8]. In our previous studies,the plasmid expressing VH and VL had been successfullyprepared[9]. In this paper, we prepared single chain Fv (scFv)antibody against TfR and then constructed the fusion proteinof scFv and alkaline phosphatase (AP) by using geneengineering technique.


Bacterium strains and vectorsE.coli TG1 was purchased from Stratagen Corporation. Clonevector pGEM-T was produced by Promega Co. Ltd. Theprokaryotic secretory expression vectors pUC19/119 andpDAP2 were generously presented by Dr. RJ Kerschboumer.The former carries a T7 RNA polymerase promoter, aleading peptide pelB, His and c-myc markers which makefor the expression and purification of scFv, and a terminationcodon. The pelB, His and c-myc markers, and terminationcodon can be cut during scFv preparation. The lattercontains AP gene and Lac promotor which switches on theexpression of fusion protein scFv-AP under the inductionof isopropyl -D-thiogalactopyanoside (IPTG). Its N-terminal pelB leader can lead the fusion protein into theperiplasma and its hexa-histidine-tag makes it easy to bepurified via affinity chromatography[10].

EnzymesT4 DNA ligase was purchased from USB Corporation(Cleveland, USA), calf AP and RNase from Boerhinger-Mannheim Biochemicals (Indianapolis, USA), endonucleasesSfiI and NotI from Jingmei Biotech Co., Ltd.

Construction of anti-TfR scFvA primer was designed according to the complementarysequences of FR1 region of VH, which contained cleavagesites of SfiI: 15560, VH2 SfiI 5’-TATGCGGCCC AGCC-GGCCATGGC(A/C)(G/C)AG(G/A)T(T/C)CAGC-TGCAGCA-3’; Another primer was designed accordingto the sequences of FR4 of VH, which contained 2/3sequences of 5’-terminal glycine linker [(Gly4Ser)3]: 15 561,VH3 Linker, 5’-GGAGCCGCCGCCGCCAGAACC-ACCACCACC(C/T)G(A/C)(T/G)GAGAC (T/A)GTGA(G/C)-3’.

A pair of primers for VL were designed according tothe same segments, the forward primer contained 2/3sequences of 3’-terminal glycine linker and reverse primercontained Not I cleavage site: 15 562, VL5 Linker, 5’-GGCGGCGGCGGCTCCGGTGGTGGTGGTTCT(G/C)A(C/A)ATTGT(G/C)(A/C)T(G/C)ACCC-3’; and1261K, VL Not I, 5’-CGGGCGGCCGCTTTGATT-TCCAGC TTGGTCCC-3’.

VH gene of monoclonal antibody (McAb) was amplifiedfrom pGEM-T-VH by PCR with primers 15 560 and15 561. VL gene was amplified from plasmid pGEM-T-VLwith primers 15 562 and 1 261 K. VH-Linker-VL (scFvgene) was obtained by splicing overlap extension PCR (SOEPCR). Cleaved by Sfi I and Not I, ScFv gene was subclonedinto vector pUC19/119, which was then transformed intocompetent E.coli TG1, and positive colonies were selectedby colony PCR. The expression of scFv was induced byIPTG and its molecular weight was identified by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Human TfR expressing cell line SMMC7721 atlogarithmic phase was plated into 96-well plates (2×105/well),then IPTG induced supernatant was added to the wells(100 L/well). After incubated for 30 min at 4 ℃, rabbitanti-His McAb was added and indirect immunofluorescentassay (IFA) was performed to identify the antibody activity.

Preparation and identification of anti-TfR scFv-AP fusion

proteinThe plasmid pUC19/119 expressing scFv was digested bySfi I and Not I to produce scFv gene, then the gene wassubcloned into vector pDAP2 to construct the gene encodingfusion protein (scFv-AP) directly. The expression vectorwas transformed into E.coli TG1. Positive colonies werescreened by colony PCR, and the expression of scFv-APwas induced by IPTG. The molecular weight was measuredby SDS-PAGE. SMMC7721 cells at 1×107/mL at logarithmicphase were plated into 96-well plates (20 L/well),glutaraldehyde 20 L/well was added to fix cells for 2 min.After washed twice by PBS, IPTG induced culturalsupernatant was added to the wells (100 L/well) andincubated at 37 ℃ for 60 min. The plate was washed thriceby PBS, the substrate was added and then the A value wasmeasured at 405 nm.

RESULTS

Amplification of target geneOn agarose gel electrophoresis, SOE PCR product formed

a single band of expected size of 700 bp (Figure 1).

Figure 1 scFv gene from SOE PCR amplification. Lanes A and F: DNAmarkers; lanes B-E: SOE PCR products.

Subcloning and sequencing of PCR productAfter collection, purification and quantification, the SOEPCR product was digested by SfiI and NotI, and linked withpUC19/119. The conjugate was transformed into E.coliTG1 on Amp+ LB plates. Ten colonies were identified from20-30 colonies by colony PCR for selection of positivecolonies. After two positive colonies were proliferated byculture, small quantities of plasmids were extracted andwere put through plasmid PCR. On electrophoresis, PCRproduct formed a band of 700 bp (Figure 2). The plasmidextracted from positive colonies was sequenced andconfirmed that the prepared sequence was scFv gene (VH-Linker-VL, data not shown).

Figure 2 plasmid PCR products. A: DNA marker; B and C: PCR products.

Identification of expression product of anti-TfR scFvThe positively transformed bacteria of scFv gene wereinduced by IPTG; the bacteria were cleaved and examinedby SDS-PAGE. On the gel, a specific protein band wasdisplayed at 27 ku. The control bacteria did not display thisband (Figure 3). IFA showed that SMMC7721 cells reactedwith IPTG-induced cultural supernatant. Negative controldid not show membrane fluorescence as it reacted withSMMC7721 cells. It suggested that IPTG-induced culturalsupernatant contained anti-human TfR scFv.

Preparation and identification of anti-TfR scFv-AP fusionproteinAfter the plasmid pUC19/119 which carries anti-TfR scFv

A B C D E F

bp

1 000

500

bp

700500

A B C

bp

1 000

500

700 bp

Yang DF et al. Protein fusion of scFv against transferrin receptor and alkaline phosphatase 3301

gene and vector pDAP2 was digested by SfiI and NotI,ScFv gene was converted into vector pDAP2 with AP gene.The conjugate was transformed into E.coli TG1 on Amp+

LB plates. Twenty to thirty colonies were obtained, 10 positivecolonies were determined by colony PCR and agarose gelelectrophoresis. The positive colonies were cultured andproliferated, and the plasmid was extracted and underwentplasmid PCR. Its product formed a band of 700 bp onelectrophoresis (Figure 4). It suggested that the scFv genehad been subcloned into the vector pDAP2.

ScFv-AP gene transformed bacteria were culturedovernight, and induced by IPTG. SDS-PAGE was performedto determine the molecular weight of the expressionproduct. On the gel, the product formed a specific proteinband of 75 ku. It is consistent with the molecular weight offusion protein. However, the empty bacteria did not displaythe protein band at 75 ku (Figure 5). It suggested that thefusion protein of anti-TfR scFv-AP had been successfullyconstructed and expressed.

The supernatant from scFv-AP positive bacteria wasadded into SMMC7721 cell coated plates, and then thesubstrate of AP was added into the wells to stain. Theaverage A value of positive wells was 1.32, obviously higherthan that of control wells (0.32). It suggested that IPTGinduced cultural supernatant contained the specific fusionproteins, which had a specific binding reactivity with humanTfR and possessed the activity of AP.

DISCUSSION

In general, TfR predominantly expresses on the surfaces

of proliferative cells, especially malignant cells. Therefore,detection of TfR is useful to diagnosis of tumors. A reporton 20 surgically resected samples of HCC showed that TfRexpressed highly in cancer tissue, whereas expressed verylow in pericancer tissues and normal tissues[11]. Its importancefor cancer diagnosis and prognostic evaluation has beenalso documented in leukemia[4], lymphoma[5], pulmonarycancer[12,13], breast cancer[14], and gastroenteric cancer[15].There is an additional kind of transferrin receptor in serum,termed as soluble transferrin receptor (sTfR). It is lack oftransmembrane and intracellular segment of TfR andassociated with iron metabolism. The detection of sTfR isuseful for adjuvant diagnosis of iron deficiency anemia[16].sTfR represents a valuable quantitative assay of marrowerythropoietic activity as well as a marker of tissue irondeficiency[17].

Immunoassay is the major measurement method of TfR.McAb and polyclonal serum are employed for this test.ScFv is a small single-strand peptide that is formed by linkingVH and VL of immunoglobulin. Fv segment comprisingVH and VL is a tiny unit of an antibody molecule. ScFvhas many advantages[18,19]: (1) Its small molecule, only 1/6of the full antibody, makes it potentially applicable in theclinical diagnosis and treatment of both infectious diseasesand cancers due to its good penetration and rapid clearance;(2) It can be mass-produced by fermentation in E.coli; (3)Its single chain makes it easy to fuse with other proteins ortoxins[20]. In this paper, anti-TfR scFv was successfullyconstructed and exhibited a good specificity and sensitivity.It has potential to substitute McAb for immunoassay ofTfR, especially for the immunohistochemistry assay.

In ordinary EIA and IFA, it is necessary to label theanti-Ab1 antibody (Ab2) with a kind of enzyme or fluorescein.In the protocol, every batch of labeled antibody needs tobe standardized. The fusion protein for special purposeproduced by gene engineering technique can replace theroutine chemistry linking enzyme-labeled antibody and canbe mass-produced. ScFv-enzyme fusion protein canspecifically bind to the antigen and catalyze the substratereaction. Compared to McAb, the small size of Fv fragmentand the absence of the constant regions of the antibodypolypeptide chain suggest fewer background reactions. Itshows a unique advantage as a reagent for immunoassayand antigen location. The application of scFv-enzyme fusion

Figure 3 SDS-PAGE of ScFv induced products. A: Negative bacteria inducedby IPTG; B: low molecular mass protein markers; C: positive bacteria inducedby IPTG.

Figure 5 SDS-PAGE of scFv-AP expressing product. A: Negative bacteriainduced by IPTG; B: low molecular mass protein markers; C: positive bacteriainduced by IPTG.

Figure 4 ScFv- pDAP2 plasmid PCR. M: DNA molecular markers; A-G: PCRproducts.

A B Cku

97

6643

31

20

14

27 ku

M A B C D E F Gbp

2 500

1 500

700500

300

200100

A B Cku97

6643

31

20

14

75 ku


protein in immunological test will omit the procedure ofenzyme labeling or fluorescence labeling. For example, thefusion protein of AP and scFv against tumor associatedantigens (e.g., CEA or AFP) can display the AP activity aswell as the binding ability to CEA or AFP. With thisdetection system, the detection of CEA or AFP can befinished in a single step. In this report, anti-TfR scFv-APwas successfully constructed, and expressing product couldspecifically bind to TfR and displayed AP activity. The useof this detection system in immunoassay can omit the stepadding the enzyme-labeled antibody. It is promising forimmunological experiments and clinical application.

REFERENCES1 Miller YE, Jones C, Scoggin C, Morse H, Seligman P. Chro-

mosome 3q(22-ter) encodes the human transferrin receptor.

Am J Hum Genet 1983; 35: 573-5832 Shionoya K. A study of relationship between proliferative

activity and expressed transferrin receptor content in cancer

cells. Kokubyo Gakkai Zasshi 1994; 61: 580-5893 Hogemann-Savellano D, Bos E, Blondet C, Sato F, Abe T,

Josephson L, Weissleder R, Gaudet J, Sgroi D, Peters PJ,

Basilion JP. The transferrin receptor: a potential molecularimaging marker for human cancer. Neoplasia 2003; 5: 495-

506

4 Kollia P, Samara M, Stamatopoulos K, Belessi C, StavroyianniN, Tsompanakou A, Athanasiadou A, Vamvakopoulos N,

Laoutaris N, Anagnostopoulos A, Fassas A. Molecular evi-

dence for transferrin receptor 2 expression in all FAB sub-types of acute myeloid leukemia. Leuk Res 2003; 27: 1101-

1103

5 Feremans W, Bujan W, Neve P, Delville JP, Schandene L.

CD71 phenotype and the value of gall ium imaging inlymphomas. Am J Hematol 1991; 36: 215-216

6 Xu L, Huang CC, Huang W, Tang WH, Rait A, Yin YZ, Cruz

I, Xiang LM, Pirollo KF, Chang EH. Systemic tumor-targetedgene delivery by anti-transferrin receptor scFv-immunoliposomes.

Mol Cancer Ther 2002; 1: 337-346

7 Moura IC, Lepelletier Y, Arnulf B, England P, Baude C, Beau-mont C, Bazarbachi A, Benhamou M, Monteiro RC, Hermine

O. A neutralizing monoclonal antibody (mAb A24) directed

against the transferrin receptor induces apoptosis of tumor Tlymphocytes from ATL patients. Blood 2004; 103: 1838-1845

8 Yang DF, Wang S, Zhu HF, Shen GX. The anti-tumor effects

of an anti-CD71 chimeric antibody in vitro and its distribu-tion in a tumor xenograph model. Chinese German J Clin Oncol

2002; 1: 109-112

9 Wang S, Shen GX, Jiang L, Wang XL, Xiong W, Lu CX. Se-quence analysis of functional and nonfunctional Vk genes from

a hybridoma. Zhongguo Mianyixue Zazhi 1999; 15: 82-84

1 0 Kerschbaumer RJ, Hirschl S, Schwager C, Ibl M, Himmler G.pDAP2: a vector for construction of alkaline phosphatase

fusion proteins. Immunotechnology 1996; 2: 145-150

1 1 Zhou GW, Cai WY, Yang WP, Chen H, Di ZM, Li HW. Thestudy of transferrin receptor gene expression and diagnosis

of hepatocellular carcinoma by monoclonal antibody. Shang-

hai Dier Yike Daxue Xuebao 2000; 20(Suppl): 436-4381 2 Dowlati A, Loo M, Bury T, Fillet G, Beguin Y. Soluble and

cell-associated transferrin receptor in lung cancer. Br J Cancer

1997; 75 : 1802-18061 3 Rac A, Brass N, Heckel D, Pahl S, Remberger K, Meese E.

Expression analysis of genes at 3q26-q27 involved in frequentamplification in squamous cell lung carcinoma. Eur J Cancer1999; 35 : 641-646

1 4 Yang DC, Wang F, Elliott RL, Head JF. Expression of trans-ferrin receptor and ferritin H-chain mRNA are associated withclinical and histopathological prognostic indicators in breastcancer. Anticancer Res 2001; 21: 541-549

1 5 Shinohara H, Fan D, Ozawa S, Yano S, Van Arsdell M, VinerJL, Beers R, Pastan I, Fidler IJ. Site-specific expression oftransferrin receptor by human colon cancer cells directly cor-relates with eradication by antitransferrin recombinant

immunotoxin. Int J Oncol 2000; 17: 643-6511 6 Wang JR, Zou DD. Use of serum transferrin receptor detec-

tion in diagnosis of iron deficiency anemia in children.Zhonghua Erke Zazhi 2004; 42: 388-389

1 7 Beguin Y. Soluble transferrin receptor for the evaluation oferythropoiesis and iron status. Clin Chim Acta 2003; 329: 9-22

1 8 Xu L, Tang WH, Huang CC, Alexander W, Xiang LM, Pirollo

KF, Rait A, Chang EH. Systemic p53 gene therapy of cancerwith immunolipoplexes targeted by anti-transferrin receptorscFv. Mol Med 2001; 7: 723-734

1 9 Boado RJ, Ji A, Pardridge WM. Cloning and expression in

Pichia pastoris of a genetically engineered single chain anti-body against the rat transferrin receptor. J Drug Target 2000;8: 403-412

2 0 Rathore D, Batra JK. Construction, expression and charac-

terization of chimaeric toxins containing the ribonucleolytictoxin restrictocin: intracellular mechanism of action. BiochemJ 1997; 324(Pt 3): 815-822

Yang DF et al. Protein fusion of scFv against transferrin receptor and alkaline phosphatase 3303



Mutation in D-loop region of mitochondrial DNA in gastric cancer

and its significance

Yi-Bing Zhao, Hong-Yu Yang, Xi-Wei Zhang, Guo-Yu Chen

EL SEVIER




Yi-Bing Zhao, Hong-Yu Yang, Xi-Wei Zhang, Guo-Yu Chen,Department of Gastrointestinal Surgery, Jiangsu Provincial Hospital,Nanjing 210029, Jiangsu Province, ChinaCorrespondence to: Yi-Bing Zhao, Department of GastrointestinalSurgery, Jiangsu Provincial Hospital, Nanjing 210029, JiangsuProvince, China. [email protected]: +86-25-83226889Received: 2004-05-25 Accepted: 2004-06-24

Abstract

AIM: To investigate the mutation in D-loop region of mitoc-hondrial DNA in gastric cancer and its influence on thechanges of reactive oxygen species (ROS) and cell cycle.

METHODS: The D-loop region was amplified by PCR andsequenced. Reactive oxygen species and cell cycle weredetected by flow cytometry in 20 specimens from gastriccancer and adjacent normal tissues. According to the sequenceresults, gastric cancer tissue was divided into mutationgroup and control group. Reactive oxygen species, apoptosisand proliferation in the two groups were compared.

RESULTS: Among the 20 gastric cancer specimens, 18mutations were identified in 7 patients, the mutation ratebeing 35%. There were four microsatellite instabilities inthe mutations. No mutation was found in the adjacent tissues.Reactive oxygen species, apoptosis, and proliferation inthe mutation group were all significantly higher than thosein control group.

CONCLUSION: Mutation in D-loop region plays a role inthe genesis and development of gastric cancer.


Key words: Mitochondria; DNA; D-loop; Mutation; Reactiveoxygen species

Zhao YB, Yang HY, Zhang XW, Chen GY. Mutation in D-loopregion of mitochondrial DNA in gastric cancer and itssignificance. World J Gastroenterol 2005; 11(21): 3304-3306


INTRODUCTION

The occurrence and progression of gastric cancer are a multi-step process due to multiple factors and gene mutations.Although great success has been achieved in oncogenes and

cancer suppressor genes, a lot of questions cannot be explainedby alteration of nuclear genes. In recent years, mutation ofmitochondrial DNA (mtDNA) has been associated with theoccurrence and progression of tumor and is regarded as apossible causitive factor for cancer[1].

Human mtDNA is a closed double strand circular moleculeof 16 569 bp, coding 13 proteins, 22 tRNAs and 2 rRNAs.Its D-loop is a non-coding region, containing some importantsequences such as the promoter for heavy chain replication.Because of the properties of its structure as well as itsmechanism of DNA replication and injury repair, themutation frequency of mitochondria is 10-100×higher thanthat of nuclear DNA. In recent years, the instability, genemutation or abnormal expression of mitochondrial genomehas been detected in many kinds of malignant cancertissues[2,3]. The mitochondrial D-loop is a hotspot for genemutation in cell lines of colonic and rectal cancer. But thereis a difference in mutation frequency of the D-loop amongdifferent tumors[4-7].

In this report the region of mtDNA D-loop wasamplified by PCR and then sequenced with samples fromcancer tissues and corresponding normal mucous membraneof 20 gastric cancer patients. Reactive oxygen species (ROS)and cell cycle were detected with flow cytometry. The sampleswere divided into mutation group and control groupaccording to the mutations. We compared the level of ROSand cell cycle within two groups to clarify the influence ofmutations of D-loop on ROS and cell cycle. Our purposewas to investigate the influence of mutation of D-loop oncell carcinogenesis and progression of gastric cancer.


PatientsTwenty surgical samples of gastric cancer were selected fromhospitalized patients in the Department of GastroenterologySurgery of Jiangsu Provincial Hospital from May to November,2003. All patients, 13 males and 7 females, were diagnosedby gastroscopy and biopsy before operation. Their ages variedfrom 39 to 78 years and averaged 57.2 years.

Procedure of sample preparationA region without bleeding was carefully selected. A blockof 1.0 cm3 fresh cancer tissue was cut and stored in a -70 ℃refrigerator. Other tissues were cleaned with PBS. Cellsuspension was prepared by mechanical grinding and filteredthrough a net and cancer cells were separated by centrifugation(proved by Rye’s dyeing). A block of 1.0 cm3 normal gastrictissue was cut and cell suspension was prepared accordingto the same procedure.

Determination of cell cycleHalf of 1 mL cell suspension was put into a test tube,centrifuged for 5 min at 1 500 r/min, washed thrice withnormal saline water and cell debris were by centrifugationfor 3 min at 500-800 r/min. Cells were fixed with 2-4 mL1% poly-formaldehyde and centrifuged for 10 min at1 500 r/min. The supernate was discarded and the palletwas resuspended in 2-4 mL 0.1% Triton-X-100 for 3 minand centrifuged. The supernate was discarded andresuspended in 1-2 mL 0.01% RNase, vortexed for 30 minin 37 ℃ water bath. One milliliter 0.05% PI solution wasadded to dye the DNA for 30 min. The cell cycle of cancercells and normal gastric cells was measured by FACS (VantageSE, BD, USA). The fluorescence signal was processed bymulticycle analytical software for cell cycle.

Measurement of ROS level[8]

DCFH-DA (from Sigma Company) was dissolved in 95%ethanol to a concentration of 5 mmol/L and stored at 4 ℃in the dark, diluted to 5 mol/L with PBS before use.

Two hundred microliter cell suspension (1×106/mL) wasput into a test tube, washed twice with PBS and centrifugedfor 5 min at 1 500 r/min. The supernate was discarded andthe pallet was resuspended in 2 mL and 5 mol/L DCFH-DA(2 mL PBS for the contrast groups), vortexed for 20 min in37 ℃ water bath and centrifuged for 5 min at 1 500 r/min.The supernate was discarded and the cells were resuspendedin 600 L PBS. The intensity of DCF green fluorescencewas measured after DCFH-DA reaction with FACS. Thewavelength of stimulation sub-laser within the FACS was488 nm and the power was 10 mW. The results were expressedas mean fluorescence intensity (MFI).

DNA extractionDNA extraction was carried out according to the protocolof the reagent kit. (Promega, USA).

PCR replication of mtDNA D-loop regionThe sequences of primers are listed in Table 1. The totalvolume of PCR reaction was 50 L, including 1 L ofeach primer (20 pmol/L), 5 L of 10× PCR buffer, 5 Lof dNTPs (2 nmol/L), 0.4 L of ExTaq DNA polymerase(5 U/L) and 100 ng of extracted DNA sample. PCRreaction was carried on using PCR instrument (Perkin Elmer2400, USA). The initial denaturation was at 94 ℃ for 5 min,followed by 35 cycles of denaturation at 94 ℃ for 45 s, adenaturation at 56 ℃ for 45 s, an extension at 72 ℃ for 90 s.The final extension was at 72 ℃ for 7 min.

Table 1 Primers for amplification and their nucleotide sequences

Primers Nucleotide sequence

Upper nt15791-15810 5’-ATCATTGGACAAGTAGCATC-3’

Down nt725-706 5’-GGTGAACTCACTGGAACGGG-3’

Confirmation of PCR productTwo microliters of PCR product was loaded on 1.5% agrosegel for electrophoresis. If the mtDNA D-loop region wassuccessfully amplified, a picture was taken (Figure 1) and

the PCR product was purified with an instant PCR productpurification kit (Promega, USA) and quantified with aspectrophotometer.

Figure 1 PCR amplification of D-loop region in mtDNA; lane 1: PCR product of

D-loop region in mtDNA; lane 2: marker.

DNA sequencingSequencing reaction was completed with the sequencing kitof end termination by fluorescence labeled ddNTPs (ABI,USA). The total volume of sequencing PCR reaction was10 L, including 1 L of sequencing primer, 6 L of kitmixture, 3 L of purified PCR product. Three sequencingprimers (Table 2) were used to divide the replicated D-loopregion into three overlapped segments. The reactioncondition was as follows: the initial denaturation step was at96 ℃ for 1 min, followed by 40 cycles of at 96 ℃ for 10 sand at 55 ℃ for 2 min. The sequencing reaction productwas precipitated by 70% ethanol and loaded on a ABI Prism310 sequencer (Perkin Elmer, USA).

Table 2 Primers for sequencing and their nucleotide sequences

Primers Nucleotide sequence

Upper nt111-nt130 5’-ACCCTATGTCGCAGTATCTG-3’

Upper nt16 328-16 347 5’-CGTACATAGCACATTACAGT-3’

Down nt16 540-16 514 5’-GTGGGCTATTTAGGCTTTATGACCCTG-3’

Experimental data and statistical analysisTaken the sequence of mtDNA D-loop from Cambridgesequence[9] as criterion, a comparison was made betweenthe sequences of cancerous tissue and those of normal tissue.If the mtDNA D-loop sequence from cancerous tissue wasdifferent from normal tissue, the alteration was regardedas gene mutation.

Other data were expressed as mean±SD. Comparisonbetween groups was carried out by t test. P<0.05 was consideredstatistically significant.

RESULTS

Eighteen gene mutations were found in the cancerous tissuefrom seven patients, among which four were microsatelliteinstabilities. Thus the mutation rate of mtDNA D-loop inthe specimens of gastric cancer was 35% (Table 3).

Cell cycle and apoptosis could be detected by flowcytometry synchronously. In cell cycle, DNA was synthesizedin synthesis (S) phase. As a result, the percentage of cells insynthesis phase could reflect cell proliferation. As shown inTable 4, level of ROS, rate of cell apoptosis and proliferationin mutation group were higher than those in control (P<0.05).

1 2

bp

2 9601 8821 489

952

421

Zhao YB et al. Significance of mutation in D-loop region in gastric cancer 3305

DISCUSSION

There was only 1 120 nt in the D-loop of mtDNA, but 18mutations were detected in the 20 gastric cancer patients,indicating that the D-loop of mtDNA is a fragment with ahigh mutation rate.

Among the 18 gene mutations found in this work, fourwere microsatellite instabilities. Habano[10] researched themitochondrial genome instability (mtGI) and nuclear micro-satellite instability (MSI ) in 62 gastric cancer tissues andfound 10 mitochondrial PolyC instabilities (16%) and 7 MSI,among which 4 existed mtGI. Thus mtGI is correlated withnuclear MSI. Since nuclear MSI induces gene mutation incoding region, mtDNA mutation plays its role in the processof cancer genesis and progression by cooperating with thealteration of some nuclear genes.

Although a non-coding region, the mtDNA D-loopcontains the initial site of heavy chain replication and thepromoters for heavy and light chain transcription. Thus D-loop is responsible for the regulation of mtDNA replicationand transcription, its mutation leads to mutations in codingregion and change of protein synthesis, and finally affectsthe function of respiration chain which hampers the energysupply of cells and produces volume of ROS. ROS resultsin injury to the genome and then induces cancer.

High level of ROS is toxic through activating cellapoptosis and causing injuries to the genome. ROS mightregulate cell apoptosis in the following ways. ROS is themessage molecule of some transcription factors (such as

Apaf-1) and can activate some useful components of cellapoptosis[11]. The increase of ROS is often accompaniedwith the decrease of intracellular anti-oxidant, resulting inimbalance between oxidant and reductive, which is just thecommon central step of cell apoptosis[2]. Most people believethat ROS is necessary for cell apoptosis. High level of ROSinspires cell necrosis or drives cells to the way from apoptosisto necrosis.

ROS not only participates in the process of cell apoptosisbut also is a kinetin for cell division that promotes nuclearDNA mutation, cell mitosis and selective growth of tumorcells. ROS is relatively stable and easy to diffuse within cellsand exist universally in various cell types. The formationand elimination of them are under strong cellular regulation.All the above properties make ROS extraordinary properfor second messengers. The level of intracellular ROS increasesunder extracellular stimulation signals such as cytokine andgrowth factor. Then they take part in cellular signal transduction.There exist two research hotspots at present as for the relationbetween ROS and cell proliferation. One is activation ofMAP kinase family to promote cell mitosis, the other isactivation of transcription factors such as NF-B to facilitategene expression.

In conclusion, the mutation of D-loop takes part in thecarcinogenesis and progression of gastric cancer throughthe effect of increased ROS.

REFERENCES1 Copeland WC, Wachsman JT, Johnson FM, Penta JS. Mitochon-

drial DNA alterations in cancer. Cancer Invest 2002; 20: 557-569

2 Bianchi NO, Bianchi MS, Richard SM. Mitochondrial genomeinstability in human cancers. Mutat Res 2001; 488: 9-23

3 Penta JS, Johnson FM, Wachsman JT, Copeland WC. Mitochon-

drial DNA in human malignancy. Mutat Res 2001; 488: 119-1334 Polyak K, Li Y, Zhu H, Lengauer C, Willson JK, Markowitz

SD, Trush MA, Kinzler KW, Vogelstein B. Somatic mutations

of the mitochondrial genome in human colorectal tumours.Nat Genet 1998; 20 : 291-293

5 Habano W, Sugai T, Yoshida T, Nakamura S. Mitochondrial

gene mutation, but not large-scale deletion,is a feature ofcolorectal carcinomas with mitochondrial microsatellite

instability. Int J Cancer 1999; 83: 625-629

6 Fliss MS, Usadel H, Caballero OL, Wu L, Buta MR, Eleff SM,Jen J, Sidransky D. Facile detection of mitochondrial DNA mu-

tations in tumors and bodily fluids. Science 2000; 287: 2017-2019

7 Lewis PD, Fradley SR, Griffiths AP, Baxter PW, Parry JM.Mitochondrial DNA mutations in the parotid gland of ciga-

rette smokers and non-smokers. Mutat Res 2002; 518: 47-54

8 Cai L, Gao S, Yang Y, Zheng D, Wang W, Zhang G, Fuyong Q.Study on the relationship between apoptosis and reactive

oxygen species of cancer cell lines induced by anticarcinogens.

Zhonghua Xueyexue Zazhi 2001; 22: 249-2519 Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson

AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F,

Schreier PH, Smith AJ, Staden R, Young IG. Sequence andorganization of the human mitochondrial genome. Nature

1981; 290 : 457-465

1 0 Habano W, Sugai T, Nakamura SI, Uesugi N, Yoshida T, Sasou S.Microsatellite instability and mutation of mitochondrial and nuclear

DNA in gastric carcinoma. Gastroenterology 2000; 118: 835-841

1 1 Lovat PE, Ranalli M, Corazzari M, Raffaghello L, Pearson AD,Ponzoni M, Piacentini M, Melino G, Redfern CP. Mechanisms

of free-radical induction in relation to fenretinide-induced

apoptosis of neuroblastoma. J Cell Biochem 2003; 89: 698-708


Table 3 Mutations in D-loop region of mitochondrial DNA in gastriccancer

Location Cambridge Cancer Normal sequence nucleotide tissue nucleotide

16 122 T C T

16 221 C T C

16 234 C Deletion C

16 366 T C T

16 401 C A C

16 438 G A G

16 465 A G A

16 492 A Deletion A

16 494 C T C

41 C T C

72 T C T

167 C G C

255 G A G

303 (C)7 (C) 8 (C) 7

303 (C) 7 (C) 9 (C) 8

392 T C T

514 (CA) 5 (CA) 6 (CA) 5

567 (C) 6 (C) 7 (C) 6

Table 4 ROS level and cell cycle in mutation group and control group(mean±SD)

ROS Apoptosis G0/G1 S G2/M (MFI) (%) (%) (%) (%)

Mutation 156.3±9.7a 12.5±1.5a 57.3±5.3 22.3±2.4a 20.6±2.1

group n = 7

Control 117.3±10.4 8.6±0.1 65.4±5.6 16.4±1.5 18.1±1.3

group n = 13

aP<0.05 vs control group.



Superior mesenteric artery syndrome following scoliosis surgery: Its

risk indicators and treatment strategy

Ze-Zhang Zhu, Yong Qiu

EL SEVIER




Ze-Zhang Zhu, Yong Qiu, Department of Spine Surgery, Drum TowerHospital, Nanjing University Medical School, Nanjing 210008,Jiangsu Province, ChinaCorrespondence to: Dr. Ze-Zhang Zhu, Department of SpineSurgery, Drum Tower Hospital, Nanjing University Medical School,Nanjing 210008, Jiangsu Province, China. [email protected]: +86-25-83304616 Fax: +86-25-83317016Received: 2004-03-03 Accepted: 2004-06-24

Abstract

AIM: To investigate the risk indicators, pattern of clinicalpresentation and treatment strategy of superior mesentericartery syndrome (SMAS) after scoliosis surgery.

METHODS: From July 1997 to October 2003, 640 patientswith adolescent scoliosis who had undergone surgicaltreatment were evaluated prospectively, and among themseven patients suffered from SMAS after operation. Eachpatient was assigned a percentile for weight and a percentilefor height. Values of the 5th, 10th, 25th, 50th, 75th, and 95th

percentiles were selected to divide the observations. Thesagittal Cobb angle was used to quantify thoracic or thora-columbar kyphosis. All the seven patients presented withnausea and intermittent vomiting about 5 d after operation.An upper gastrointestinal barium contrast study showed astraight-line cutoff at the third portion of the duodenumrepresenting extrinsic compression by the superior mese-nteric artery (SMA).

RESULTS: The value of height in the seven patients withSMAS was above the mean of sex- and age-matchednormal population, and the height percentile ranged from5% to 50%. On the contrary, the value of weight was belowthe mean of normal population with the weight percentileranging from 5% to 25%. Among the seven patients, fourhad a thoracic hyperkyphosis ranging from 55° to 88°(average 72°), two had a thoracolumbar kyphosis of 25°and 32° respectively. The seven patients were treatedwith fasting, antiemetic medication, and intravenous fluidsinfusion. Reduction or suspense of traction was adoptedin three patients with SMAS during halo-femoral tractionafter anterior release of scoliosis. All the patients recoveredcompletely with no sequelae. No one required operativeintervention with a laparotomy.

CONCLUSION: Height percentile<50%, weight percentile<25%, sagittal kyphosis, heavy and quick halo-femoraltraction after spinal anterior release are the potential riskindicators for SMAS in patients undergoing correction surgeryfor adolescent scoliosis.


Key words: Scoliosis; Superior mesenteric artery syndrome;Indicators

Zhu ZZ, Qiu Y. Superior mesenteric artery syndrome followingscoliosis surgery: Its risk indicators and treatment strategy.World J Gastroenterol 2005; 11(21): 3307-3310


INTRODUCTION

Superior mesenteric artery syndrome (SMAS) results fromcompression of the third portion of duodenum as it crossesunderneath the superior mesenteric artery (SMA), the secondbranch of the abdominal aorta (Figure 1). Several authorshave reported series or individual cases of the conditionafter the trunk is immobilized with a cast, also known as castsyndrome[1,2] or Wilkie’s syndrome[3-5]. It is rarely reportedthat SMAS occurs after scoliosis correction with newly-developed three-dimensional derotation technique. Theextrinsic compression of duodenum by the SMA producesa charac-teristic contrast with the upper gastrointestinal tract.Clinically, the syndrome may progress to serious sequelae witha mortality rate of 33% or follow a benign course[6].Therefore, its early diagnosis and treatment should beemphasized. We report seven cases of SMAS followingsurgery for scoliosis and the risk indicators, pattern of clinicalpresentation and treatment strategy.

Figure 1 Anatomic relationship between SMA and duodenum.


From July 1997 to October 2003, 640 patients (228 boys and

T12

Superior mesenteric

Artery

Duodenum

Aorta

L1

L2

L3


412 girls) with adolescent scoliosis who had undergone surgicaltreatment with three-dimensional correction technique wereevaluated prospectively. Seven of them suffered from SMASafter operation, including three males and four females, agedfrom 13 to 16 years. Three of them were diagnosed ascongenital scoliosis and four as idiopathic scoliosis with theircoronary Cobb angle ranging between 45° and 116° (average,82°). SMAS occurred in three patients during halo-femoraltraction following anterior spinal release, in three afterposterior correction with three-dimensional TSRH (TexasScottish Rite Hospital, Sofamor-Danek, USA) derotationtechnique, and in one after anterior correction with CDH(CD-Horizon, Sofamor-Danek, USA) instrumentation.

Charts were reviewed for weight and height at admission.Each patient was assigned a percentile for weight and apercentile for height. The percentile was obtained by referringto the normal data reported by the National Center forStudent Status and Health Statistics in 2001, and the tabulateddata were sex- and age-specific. Values of the 5th, 10th, 25th,50th, 75th, and 95th percentiles were selected to divide theobservations. The sagittal Cobb angle across the involvedsegments was used to quantify thoracic or thoracolumbarkyphosis. Values were interpreted with respect to normativedata for sagittal alignment in adolescents.

All the seven patients presented with nausea and inter-mittent vomiting about 5 d after operation. The vomit wasbrown green and turbid liquid. Between bouts of vomiting,the patients felt appetitive. On examination, the epigastriumwas distended and soft with mild tenderness and resonantpercussion, and bowel sounds were often active. An uppergastrointestinal barium contrast study showed a barium-filleddilatation of the proximal part of duodenum and a straight-line cutoff at the third part of the duodenum representingextrinsic compression by the SMA.

RESULTS

In the seven patients, the correction rate of coronary Cobbangle ranged from 57% to 74%, with an average of 66%.The height increased 4-15 cm after surgery.

All the seven patients with SMAS had a disproportionatelythin habitus in relation to their height. The value of heightwas above the mean of sex- and age-matched normalpopulation, and the height percentile ranged from 5% to50%. On the contrary, the value of weight was below themean of sex- and age-matched normal population with theirweight percentile ranging from 5% to 25% (Table 1). Thenormal thoracic kyphosis was defined as 20°-50°, and the

normal thoracolumbar alignment was 0°[6]. Among the sevenpatients, four had a thoracic hyperkyphosis ranging from55° to 88° (average 72°), one had a thoracic alignment of48° within the normal range of thoracic kyphosis but closeto the upper normal value. Thoracolumbar kyphosis wasidentified in the other two patients with the sagittal Cobbangle of 25° and 32° respectively.

The seven patients were treated with fasting, antiemeticmedication, and intravenous fluids infusion. A left lyingposition was mandatory, and reduction or suspense oftraction was adopted in three patients who developed SMASduring halo-femur traction after anterior release of scoliosis.Symptoms were alleviated after 5-7 d in five patients. Theother two patients had an obstinate and repetitive vomiting,conservative management was continued, and feeding wasnot started until days 12 and 18. At that time, their weightreduced 7 and 11 kg respectively. All the patients recoveredcompletely with no sequelae. No one required operativeintervention with a laparotomy.

DISCUSSION

The etiology of SMAS is related to the anatomy of thethird part of duodenum, which passes between the aortaand its SMA branch. The SMA arises from the anterioraspect of the aorta at level of L1 and L2 vertebral body. It isencased in fat and lymphatic tissue at its origin and descendsdownwards at an acute angle into the mesentery. In normalindividuals, the SMA to aortic angle is 20°-50°. Theduodenum usually passes across the aorta at level of L3vertebral body and is suspended in acute angle between theaorta and the SMA by Treitz ligament[7]. This special anatomicalrelationship has been referred to as “a nutcracker”[8]. Anyfactors disturbing the close relationship of this anatomymay lead to extrinsic compression of duodenum. SMASmay occur due to weight loss in patients suffering frommalabsorption, anorexia nervosa, extensive burns, or multipletrauma, when fat is depleted at origin of the SMA surroundingduodenum[9-12]. Other causes include extrinsic vascularobstruction secondarily due to bowel dilatation resultingfrom atrophy of bowel musculature and its replacement bycollagen in connective tissue disorders.

Since 1990s, three-dimensional derotation technique hasimproved the corrective rate of scoliosis greatly[8,13]. AlthoughSMAS has decreased sharply due to the adoption of thistechnique, SMA compression of duodenum is still apotentially life-threatening complication of scoliosis surgery[14].The incidence of adverse sequelae from the syndrome

Table 1 Height, weight, and sagittal kyphosis data of patients with SMAS

Case no. Sex Age (yr) Height percentile Weight percentile Pre-operative sagittal kyphosis

1 M 16 25 5 85° (T)

2 F 15 50 5 48° (T)

3 M 16 25 10 88° (T)

4 F 14 25 25 55° (T)

5 M 15 10 5 60° (T)

6 F 13 5 25 32° (TL)

7 F 14 25 25 25° (TL)

M, male; F, female; T, thoracic; TL, thoracolumbar.

Zhu ZZ et al. SMAS after scoliosis surgery 3309

remains alarmingly high. Aspiration pneumonia, acute gastricrupture, and cardiovascular collapse have been documentedas morbid or fatal complications of SMAS[15-17]. Scoliosissurgery also relatively lengthens the spine, displacing theSMA origin cephalad at the expense of lateral mobility.Crowther et al[15], showed that there can be an acute increasein vertebral column length with spinal instrumentation,resulting in traction on the SMA and narrowing of thearteriomesenteric angle, and postoperative weight loss resultsin loss of retroperitoneal fat that protects duodenum fromcompression[18,19].

We emphasize the importance of identifying thosepatients at risk and maintaining a high index of suspicion.Paying attention to the various risk factors that may bepresent before surgery may be beneficial to the understandingand treatment of SMAS. Munns et al[20], identified high-riskpatients as “those with a thin, asthenic habitus”. Hutchinsonand Bassett[21] reported that five patients undergoing operativetreatment of scoliosis have a “disproportionately thin habitus inrelation to their height”. However, there are no clinically usefulparameters to identify individuals susceptible to SMAS[22].In order to quantify the degree of asthenia, we calculatedthe absolute difference in these patients’ height percentileand weight percentile and compared it with the sex- andage-matched normal population. In our series, all the sevenpatients who developed SMAS had also a disproportionatelythin habitus in relation to their height, the value of heightwas above the mean of normal population with the heightpercentile ranging from 5% to 50%, and the value of weightwas below the mean of normal population with the weightpercentile ranging from 5% to 25%. We propose that theheight percentile <50% and the weight percentile <25%might be potential risk indicators for SMAS in patientsundergoing correction surgery for adolescent scoliosis. Attentionshould also be given to sagittal kyphosis. Scoliosis associatedwith sagittal kyphosis is usually accompanied with severetrunk collapse. Following scoliosis correction or heavy skull-femur traction, the trunk elongation becomes moreremarkable. This may lead to further narrowing of thearteriomesenteric angle. In this series, six patients had thesagittal abnormity including four with thoracic hyperkyphosisand two with thoracolumbar kyphosis. In addition, the high-risk patients include those who undergo heavy and quickhalo-femoral traction after spinal anterior release (threepatients in our group).

Symptoms of obstruction often become apparent 5-7 dafter surgery. Clinicians should be on the alert for the persistentnature of vomiting. This is accompanied with upper abdominaldistension, epigastric tenderness, and tympanic percussion.Bowel sounds are present on auscultation in contrast to thefindings in postoperative ileus. Postoperative paralytic ileuscaused by general anesthesia, analgesic, electrolytic imbalance,or greater splanchnic nerve injury during anterior spinalrelease usually occurs at an earlier period after operationand disappeared spontaneously in 3-5 d. Plain abdominalradiograph has no remarkable value in early diagnosis. Anupper gastrointestinal barium contrast radiograph shouldbe mandatory, the classic findings of which are specific forSMAS. Computed tomography scan and endoscopy do notcontribute to the diagnosis of SMAS[15].

Treatment of SMAS varies from nonoperative to operativeprocedures[23-26]. Anderson et al[27], reported that five of ninecases require exploratory laparotomy. Crowther et al[15], proposedthat most patients recover after conservative measures, butoccasionally surgical intervention may be required. VanBrussel et al[4], states that the first choice of treatment forSMAS is conservative therapy. In our series, through fasting,gastrointestinal decompression, changing posture, maint-aining electrolytic balance or relieving halo-femoral traction,the seven patients recovered without operative interventionand internal fixation removal. We consider that conservativetherapy is effective if early diagnosis, appropriate measures,and gastrointestinal physicians’ participation are obtained.

In conclusion, patients undergoing correction surgeryfor adolescent scoliosis have multiple potential risk indicatorsfor SMAS. The main risk indicators include height percentile<50%, weight percentile<25%, sagittal kyphosis, heavy andquick halo-femoral traction after spinal anterior release.

ACKNOWLEDGMENTS

The authors thank Dr. Li-Hua Zhu, Bing Wang, and YangYu for their invaluable support to this study.

REFERENCES1 Griffiths GJ, Whitehouse GH. Radiological features of vas-

cular compression of the duodenum occurring as a complica-

tion of the treatment of scoliosis (the cast syndrome). ClinRadiol 1978; 29 : 77-83

2 Sprague J. Cast syndrome: the superior mesenteric artery

syndrome. Orthop Nurs 1998; 17: 12-15; quiz 16-17

3 Raissi B, Taylor BM, Taves DH. Recurrent superior mesen-teric artery (Wilkie’s) syndrome: a case report. Can J Surg

1996; 39 : 410-416

4 Van Brussel JP, Dijkema WP, Adhin SK, Jonkers GJ. Wilkie’ssyndrome, a rare cause of vomiting and weight loss: diagno-

sis and therapy. Neth J Med 1997; 51: 179-181

5 Lundell L, Thulin A. Wilkie’s syndrome--a rarity? Br J Surg1980; 67 : 604–606

6 Boseker EH, Moe JH, Winter RB, Koop SE. Determination of

“normal” thoracic kyphosis: a roentgenographic study of 121“normal” children. J Pediatr Orthop 2000; 20: 796–798

7 Meyers MA. Treitz redux: the ligament of Treitz revisited.

Abdom Imaging 1995; 20 : 421-4248 Vitale MG, Higgs GB, Liebling MS, Roth N, Roye DP. Superior

mesenteric artery syndrome after segmental instrumentation: a

biomechanical analysis. Am J Orthop (Belle Mead NJ) 1999; 28:461-467

9 Wilkinson R, Huang CT. Superior mesenteric artery syn-

drome in traumatic paraplegia: a case report and literaturereview. Arch Phys Med Rehabil 2000; 81: 991-994

1 0 Milner EA, Cioffi WG, McManus WF, Pruitt BA. Superior

mesenteric artery syndrome in a burn patient. Nutr Clin Pract1993; 8: 264-266

1 1 Laffont I, Bensmail D, Rech C, Prigent G, Loubert G, Dizien

O. Late superior mesenteric artery syndrome in paraplegia:case report and review. Spinal Cord 2002; 40: 88-91

1 2 Ahmed AR, Taylor I. Superior mesenteric artery syndrome.

Postgrad Med J 1997; 73: 776-7781 3 Labelle H, Dansereau J, Bellefleur C, Poitras B, Rivard CH,

Stokes IA, de Guise J. Comparison between preoperative and

postoperative three-dimensional reconstructions of idiopathicscoliosis with the Cotrel-Dubousset procedure. Spine (Phila

Pa 1976) 1995; 20: 2487-2492

1 4 Shapiro G, Green DW, Fatica NS, Boachie-Adjei O. Medicalcomplications in scoliosis surgery. Curr Opin Pediatr 2001; 13:

36-41

1 5 Crowther MA, Webb PJ, Eyre-Brook IA. Superior mesenteric

artery syndrome following surgery for scoliosis. Spine (PhilaPa 1976) 2002; 27 : E528–E533

1 6 Sapkas G, O’Brien JP. Vascular compression of the duode-

num (cast syndrome) associated with the treatment of spinaldeformities. A report of six cases. Arch Orthop Trauma Surg

1981; 98 : 7-11

1 7 Todd SR, Marshall GT, Tyroch AH. Acute gastric dilatationrevisited. Am Surg 2000; 66: 709-710

1 8 Baltazar U, Dunn J, Floresguerra C, Schmidt L, Browder W.

Superior mesenteric artery syndrome: an uncommon cause ofintestinal obstruction. South Med J 2000; 93: 606-608

1 9 Bapat VN, Rastogi S, Moorthy K, Kulgod S, Supe An. Acute

superior mesenteric artery syndrome due to rapid weight lossfollowing massive small bowel resection. Indian J Gastroenterol

1996; 15: 154

2 0 Munns SW, Morrissy RT, Golladay ES, McKenzie CN.Hyperalimentation for superior mesenteric-artery(cast) syn-

drome following correction of spinal deformity. J Bone Joint

Surg Am 1984; 66: 1175-11772 1 Hutchinson DT, Bassett GS. Superior mesenteric artery syn-

drome in pediatric orthopedic patients. Clin Orthop Relat Res1990; 250 : 250-257

2 2 Rosa-Jimenez F, Rodriguez Gonzalez FJ, Puente GutierrezJJ, Munoz Sanchez R, Adarraga Cansino MD, ZambranaGarcia JL. Duodenal compression caused by superior mesen-teric artery: study of 10 patients. Rev Esp Enferm Dig 2003;95 : 485-489 480-484

2 3 Lippl F, Hannig C, Weiss W, Allescher HD, Classen M, KurjakM. Superior mesenteric artery syndrome: diagnosis and treat-ment from the gastroenterologist’s view. J Gastroenterol 2002;37 : 640-643

2 4 Murthi GV, Raine PA. Superior mesenteric artery syndromein children. Scott Med J 2001; 46: 153-154

2 5 Kim IY , Cho NC, Ki m DS, Rhoe BS. Lap aroscopi cduodenojejunostomy for management of superior mesentericartery syndrome: two cases report and a review of theliterature. Yonsei Med J 2003; 44: 526-529

2 6 Bermas H, Fenoglio ME. Laparoscopic management of supe-rior mesenteric artery syndrome. JSLS 2003; 7: 151-153

2 7 Anderson JR, Earnshaw PM, Fraser GM. Extrinsic compres-sion of the third part of the duodenum. Clin Radiol 1982; 33:75–81




Hand-assisted laparoscopic surgery for complex gallstone

disease: A report of five cases

Qi Wei, Lai-Gen Shen, He-Ming Zheng

EL SEVIER




Qi Wei, Lai-Gen Shen, He-Ming Zheng, Department of GeneralSurgery, Sir Run Run Shaw Hospital, Zhejiang University, Hangzhou310016, Zhejiang Province, ChinaCorrespondence to: Qi Wei, Department of General Surgery, SirRun Run Shaw Hospital, Zhejiang University, Hangzhou 310016,Zhejiang Province, China. [email protected]: +86-571-86437761Received: 2004-05-27 Accepted: 2004-06-17

AbstractAIM: To describe the use of hand-assisted laparoscopicsurg-ery (HALS) as an alternative to open conversion forcomplex gall-stone diseases, including Mirizzi syndrome(MS) and mimic MS.

METHODS: Five patients with MS and mimic MS of 232consecutive patients undergoing laparoscopic cholecyst-ectomies were analyzed. HALS without a hand-port devicewas performed as an alternative to open conversion if theanatomy was still unclear after the neck of the gallbladderwas reached.

RESULTS: HALS was performed on three patients with MStype I and 2 with mimic MS owing to an unclear or abnormalanatomy, or an unusual circumstance in which an impactedstone was squeezed out from the infundibulum or theaberrant cystic duct impossible with laparoscopic approach.The median operative time was 165 min (range, 115-190 min). The median hand-assisted time was 75 min (range,65-100 min). The median postoperative stay was 4 d (range,3-5 d). The postoperative course was uneventful, exceptfor 1 patient complicated with a minor incision infection.

CONCLUSION: HALS for MS type I and mimic MS is safeand feasible. It simplifies laparoscopic procedure, and canbe used as an alternative to open conversion for complexgallstone diseases.


Key words: Laparoscopic surgery; Gallstone disease

Wei Q, Shen LG, Zheng HM. Hand-assisted laparoscopic surgeryfor complex gallstone disease: A report of five cases. WorldJ Gastroenterol 2005; 11(21): 3311-3314


INTRODUCTION

Mirizzi syndrome (MS) is an uncommon complication of

chronic cholecystitis and cholelithiasis. The diagnosis of MSis established after the demonstration of a compression orobstruction of the bile duct by stone located in the gallbladderneck or cystic duct. Laparoscopic surgery in the treatmentof MS has been reported at a few centers[1-4]; however,laparoscopic intervention for the MS has its limitations andmay result in more complications and a significant conversionrate[5,6]. The aim of this paper is to describe the use ofhand-assisted laparoscopic surgery (HALS) as an alternativeto open conversion for the MS and mimic MS. Mimic MSis defined as an impacted stone(s) in the neck of gallbladderwith short cystic duct, causing obscured Calot’ trianglewithout obstructive jaundice.


PatientsFrom June 2003 to December 2003, 232 consecutive patientsunderwent laparoscopic cholecystectomy (LC) by a singlesurgeon and his team. Five of the patients with MS andmimic MS were analyzed here. Three patients were of MStype I, according to McSherry Classification, and two patientshad mimic MS. Data and video-recordings were collectedwith regard to the patients’ age, sex, presentation, investigations,operative findings, method and time, and causes of HALS.

Operative techniquesThe procedure was carried out using the conventionallaparoscopic method of insertion of Trocars. The cameraport was placed via an umbilical incision. Once the decisionwas made to perform HALS, a right subcostal oblique incisionwas done. The incision approximated the surgeon’s handsize (6.0-6.5 cm). Following the introduction of the surgeon’sleft hand, the incision was tightened by a towel clip. The sizeof the split-muscles should be smaller. The pneumoperitoneumwas re-established. A gauze roll was placed around the surgeon’swrist if gas was escaped. These can provide a seal to avoidgas escape. The introduction site of the hand should not betoo close to the operating field, otherwise the hand itselfmay interfere with the laparoscopic view and instrumentation.The working port was inserted into the left subcostal regionto allow enough room for manipulation (Figure 1). Thesurgeon and the assistant/camera operator stood on theleft side of the patient.

We tried an initial fundus-first dissection (FFD) whenthe presence of MS was suspected or when Calot’s trianglewas completely obscured. HALS was performed as analternative to open conversion if the anatomy is still unclearafter the neck of the gallbladder is reached. The operativeprinciples are similar to those recommended for open


procedures. A partial or subtotal cholecystectomy was performedwith suturing closure or with endoloops closure; the intraoperativecholangiography (IOC) was performed by a direct injectioninto the bile duct or via the cystic duct. The IOC clarifiedthe anatomy and excluded bile duct stones. A suction drainwas placed in the subhepatic space at the end of the procedurein all patients.

RESULTS

Table 1 presents the demographic data of the five patients.There were four men and one woman. The average agewas 52 years (range, 33-68 years). All patients presentedwith histories of recurrent right upper quadrant pain, three MSpatients were jaundiced with abnormal liver function atpresentation, and one patient had pancreatitis with jaundicehistory. Of two mimic MS patients presented with subacutecholecystitis. Preoperative investigations of the five patientswere as follows: In three MS patients, ultrasonographyshowed an atrophic gallbladder with stones, and intrahepaticbile duct or common hepatic duct (CHD) dilatation. Magneticresonance cholang-iopancreaticography (MRCP) (Figure 2)and computed tomography (CT) scan were used, and MSwas established provisionally. Ultrasonography showedgallbladder distension with specific mention of the neckstones in two mimic MS patients.

Figure 2 Preoperative MRCP demonstrated compression of the CHD by a large stonewith dilation of intrahepatic bile duct characteristic of Mirizzi’s syndrome (Case 4).

Table 2 presents the causes of HALS and operative methodfor the five patients. Case 1 underwent subtotal cholec-ystectomy for an atrophic gallbladder with multiple stones,

but one 1.0-cm stone impacted in the infundibulum, whichwas fused with the CHD, impossible to remove with laparoscopicinstruments (Figure 3A and B). The operative findings of case4 proved a contracted atrophic gallbladder, one 2.5-cm largestone with extrinsic compression of the CHD, and obliterationof Calot’s triangle (Figure 3C and D). Case 5 had dense adhesionsof Calot’s triangle, and one 0.8-cm stone impacted in thecystic duct incapable of milked back. IOC was performedin case 4 and case 5 with the aid of the hand. Case 2 hadone 2.5-cm neck stone, and case 3 had two neck stones of0.5- and 0.8-cm; both had severely inflamed large gallbladders.Causes of HALS were unclear anatomy in the Calot’s triangleshown in Figure 3E, and the bleeding of FFD and gallbladderempyema, respectively (Table 2). Both short cystic ductswere ligated with a 12-mm Lapro-Clip. The histopathologicalresults showed both acute suppurative cholecystitis. Theintra-abdominal hand-aid operation was easier and quickerfor retraction of the liver and gallbladder, finger dissection,identification of bile duct, and manual hemostasis.

Table 2 Causes of HALS and operative method for the five patients

Patient No. Causes of HALS Operative method

1 Impacted stone in Subtotal Cholecystectomy

infundibulum

2 Obscured Calot triangle, Total cholecystectomy

bleeding of FFD

3 Obscured Calot triangle, Partial cholecystectomy

GB emphysema

4 Contracted atrophic GB, Partial cholecystectomy

obliterated Calot triangle

5 Dense adhesions of Calot Subtotal Cholecystectomy

triangle, impacted stone

in cystic duct

HALS: hand assisted laparoscopic surgery. FFD: first-fundus dissection, GB:

gallbladder.

The median operative time was 165 min (range, 115-190 min). The median hand-assisted time was 75 min (range,65-100 min). The median postoperative stay was 4 d (range,3-5 d) (Table 3). The estimated median operative bloodloss was 80 mL (range, 50-100 mL). Only two patients neededan additional single dose of 75 mg pathidine. The patientswere encouraged to have oral intake at the 1st day aftersurgery, and early ambulation as well. The postoperativecourse was uneventful, except for one patient who had aminor incision infection. Seven to twenty-one days aftersurgery, liver function was back to normal range in three MSpatients. All patients remain asymptomatic within a follow-upperiod of 15-36 wk (median, 25 wk).

Figure 1 Position of the Trocars and the hand. A: Camera port; B: working port;C: hand insertion; D: additional port.

Table 1 Demographic data of the five patients

Patient Age Sex Bilirubin ALP ASTNo. (yr) (mg/dL) (IU/L) (IU/L)

1 33 M 8.5 337 68

2 63 M 1.0 71 59

3 43 M 0.9 83 30

4 51 M 6.2 211 70

5 68 F 5.0 277 350

M: male, F: female.

A

B

C

D

Wei Q et al. Complex gallstone disease 3313

DISCUSSION

MS has a reported incidence of 0.7-1.4% of all patientsundergoing biliary surgery[2] and is 1.3% (3/232) in our cases.However, our three patients were of MS type I. Thisdifference is possibly a consequence of early operation inthe era of LC. Csendes suggested that the MS type I andcholecystobiliary fistulas have different stages of the samedisease process[7]. The presence of a short or absent cysticduct may increase the likelihood of MS occurrence. Thisindicates that patients with mimic MS or MS type I aremore often encountered at LC[8].

Ultrasound is a screening investigation in patients ofbiliary symptoms. A single large stone in the neck of thegallbladder commonly raises suspicion of MS. In our cases,an atrophic gallbladder with stones was more frequently afeature. If such findings are recognized at ultrasonography,further evaluation of the biliary tree is required. In ourstudies, MRCP and CT were used in three suspected MS patientsand preliminary diagnosis of MS was made. Endoscopicretrograde cholangiopancreatography (ERCP) is the

investigation currently recommended, however, surgery isneeded in most patients[1,2]. The roles of MRCP and ERCPremain to be further evaluated[9].

Successful laparoscopic surgery for MS has been reportedin Refs.[1-4], however, it can be extremely challenging and time-consuming, and may be associated with increased intraoperativeand postoperative complications, and the cumulativeconversion rate being 68% among these cases[5,6].

In MS and mimic MS patients, abnormal anatomy suchas the presence of contracted atrophic or distended gallbladderwith an impacted stone(s) in the neck, often led to problemsin grasping or retracting the gallbladder and liver, andcontributed to the difficulty of laparoscopic procedure[10].In laparoscopic FFD fashion, however, retraction of theliver and control of unexpected bleeding may still be thelimiting factors, especially in an acutely intensive inflamedgallbladder[11].

In our cases, the main causes for HALS were unclearor abnormal anatomy, and a severe adhesion if the neckof the gallbladder has been reached, even after partial orsubtotal cholecystectomy was performed (Table 2). Sincecontinued dissection laparoscopically at the obscure Calot’striangle carries the potential risk of ductal injury and difficultyof unexpected bleeding control, in those situations, HALScan be considered a technical aid in cases in which conversionis required due to unclear anatomy[12-14]. With improvedtactile sense and manipulative ability of traction and counter-traction with the hand rather than the instruments, bluntand sharp dissections are achieved expeditiously withoutfear of injury to the organs. Similarly, finger dissection andfinger depression of bleeding are easy and quick. Criticalstructures such as bile duct and blood vessels are easily

Figure 3 Causes of hand-assisted laparoscopic surgery. A: One 1.0-cmstone impacted in the infundibulum fused with the CHD, impossible to removewith laparoscopic instruments; B: Using the intra-abdominal hand to facilitatesuch maneuvers as squeezing out of the stone (case 1); C: Compression of

the CHD by one 2.5-cm stone; D: Identification and dissection of the obscuredCalot triangle by the hand (case 4); E: A severely inflamed gallbladder with aneck stone caused obscured Calot’ triangle without jaundice (mimic Mirizzisyndrome, case 2).

Table 3 Operative time and postoperative stays of the five patients

Patient Operative Hand-assisted Postoperative ClinicalNo. time (min) time (min) stays (d) diagnosis

1 165 75 4 MS type I

2 165 70 3 Mimic MS

3 115 65 4 Mimic MS

4 180 100 5 MS type I

5 190 90 4 MS type I

MS: Mirizzi syndrome.

A C

D E

B

identified by tactile feedback, thus having a lower chanceof being inadvertently injured[6,13-15].

Another important reason for HALS was unusual maneuverssuch as removing an impacted stone in the infundibulumor the aberrant cystic duct, which might be impossible withlaparoscopic approach, but readily performed by the intra-abdominal hand in our case 1 and case 5 (Table 2). As faras the identification of gallbladder or bile duct carcinoma isconcerned, the ability to palpate and define tissue characteristicsmanually is helpful[12].

The benefit of HALS is demonstrated by the reductionin operative time owing to improved identification of anatomy,dissection, retraction, and better control of hemorrhagicaccidents[6,13-15]. In our initial experience, the median operativetime was 165 min and the median hand-assisted time was75 min. Decision made promptly in HALS could reducethe operative time.

Concerning gas leakage by the procedures without hand-port device, the movement of the hand was limited to someextent, however, it was not difficult to keep the seal of thesmall incision tight and to avoid loss of gas. The seal withthe help of “a towel clip” to maintain pneumoperitoneumwas feasible. Gas leakage was encountered in two of fivepatients, however, the pneumoperitoneum generally wasmaintained at 10-12 mmHg during surgery. A hand-portdevice requires much space around a relatively small incision;and in the subcostal oblique incision where the device isplaced close to the rib margin and lateral abdominal wall,there can be gas leakage[14]. Moreover, the hand-port deviceis relatively expensive, leading to an increased cost.

Hand fatigue is one drawback of HALS in long orcomplicated procedures. Hand fatigue occurred in 2 of 5procedures due to longer hand-assisted operative time (Table 3).In such cases, the surgeon can remove or have his or hershand rest for a few minutes. Following the principles ofinstrument triangulation, with the hand considered as aninstrument, this could reduce intraoperative hand fatigue[13,14].

Between June 2001 and June 2003, eight cases of MSwere identified in 5310 LC (0.15 %) at our surgicaldepartment; six patients had MS type I and two had MStype II. There were three men and five women. The averageage was 50 years (range, 38-72 years). All patients wereconverted to an open procedure with a 15-20 cm subcostalincision. Two cases with injuries of the bile duct (a completetransection and an excision of a duct segment) underwentan end-to-end anastomosis of the injured bile duct over aT-tube and a Roux-en-Y hepatico-jejunostomy with atransanastomotic stent, respectively. The median operativetime was 165 min (range, 140-250 min). The medianpostoperative stay was 5.5 d (range, 4-13 d). The medianestimated operative blood loss was 100 mL (range, 80-400mL). At the end of surgery, a mixture of tramadol plusfentanyl was used maintaining 48-96 h in the analgesia pumpfor all patients. The patients began to have oral intake fromthe 2nd to 5th d (median, 3 d) after surgery.

As described above, HALS can improve the success rateand decrease the complication rate of laparoscopic procedures,

especially bile duct injuries. It is a mini-access surgerycharacterized with less pain, earlier oral intake, and decreasedhospital stay in comparison with the open operations[12-15].

Experienced surgeons can be successful in performinglaparoscopic surgery for MS. However, it is challenging andtime-consuming. Our results suggest that HALS without ahand-port device for MS type I and mimic MS is safe andfeasible. HALS appears to facilitate difficult laparoscopicprocedures, by decreasing operative time and had minimalincrease of complications. It can be used as an alternativeto open conversion for complex gallstone diseases.

ACKNOWLEDGMENTS

We thank Dr. Robert Jr. Finley for his editorial assistance.

REFERENCES1 Targarona EM, Andrade E, Balague C, Ardid J, Trias M.

Mirizzi’s syndrome. Diagnostic and therapeutic controver-

sies in the laparoscopic era. Surg Endosc 1997; 11: 842-8452 Kok KY, Goh PY, Ngoi SS. Management of Mirizzi’s syn-

drome in the laparoscopic era. Surg Endosc 1998; 12: 1242-1244

3 Bagia JS, North L, Hunt DR. Mirizzi syndrome: an extrahazard for laparoscopic surgery. ANZ J Surg 2001; 71: 394-397

4 Yeh CN, Jan YY, Chen MF. Laparoscopic treatment for Mirizzi

syndrome. Surg Endosc 2003; 17: 1573-15785 Contini S, Dalla Valle R, Zinicola R, Botta GC. Undiagnosed

Mirizzi’s syndrome: a word of caution for laparoscopic sur-

geons-a report of three cases and review of the literature. JLaparoendosc Adv Surg Tech A 1999; 9: 197-203

6 Memon MA, Fitzgibbons RJ. Hand-assisted laparoscopic sur-

gery (HALS): a useful technique for complex laparoscopicabdominal procedures. J Laparoendosc Adv Surg Tech A 1998;

8: 143-150

7 Csendes A, Diaz JC, Burdiles P, Maluenda F, Nava O. Mirizzisyndrome and cholecystobiliary fistula: a unifying classification.

Br J Surg 1989; 76: 1139-1143

8 Dorrance HR, Lingam MK, Hair A, Oien K, O’Dwyer PJ.Acquired abnormalities of the biliary tract from chronic gall-

stone disease. J Am Coll Surg 1999; 189: 269-273

9 Choi BW, Kim MJ, Chung JJ, Chung JB, Yoo HS, Lee JT.Radiologic findings of Mirizzi syndrome with emphasis on

MRI. Yonsei Med J 2000; 41: 144-146

1 0 Strasberg SM, Eagon CJ, Drebin JA. The "hidden cystic duct"syndrome and the infundibular technique of laparoscopic

cholecystectomy--the danger of the false infundibulum. J Am

Coll Surg 2000; 191: 661-6671 1 Mahmud S, Masaud M, Canna K, Nassar AH. Fundus-first

laparoscopic cholecystectomy. Surg Endosc 2002; 16: 581-584

1 2 Wolf JS, Moon TD, Nakada SY. Hand assisted laparoscopicnephrectomy: comparison to standard laparoscopic nephrectomy.

J Urol 1998; 160: 22-27

1 3 Targarona EM, Gracia E, Rodriguez M, Cerdan G, BalagueC, Garriga J, Trias M. Hand-assisted laparoscopic surgery.

Arch Surg 2003; 138: 133-141; discussion 141

1 4 Litwin DE, Darzi A, Jakimowicz J, Kelly JJ, Arvidsson D,Hansen P, Callery MP, Denis R, Fowler DL, Medich DS, O’Reilly

MJ, Atlas H, Himpens JM, Swanstrom LL, Arous EJ, Pattyn

P, Yood SM, Ricciardi R, Sandor A, Meyers WC. Hand-as-sisted laparoscopic surgery (HALS) with the HandPort

system: initial experience with 68 patients. Ann Surg 2000;

231: 715-7231 5 Seifman BD, Wolf JS. Technical advances in laparoscopy:

hand assistance, retractors, and the pneumodissector. J

Endourol 2000; 14: 921-928

Science Editor Ma JY and Zhu LH Language Editor Elsevier HK



Portal venous stent placement for treatment of portal hypertension

caused by benign main portal vein stenosis

Hong Shan, Xiang-Sheng Xiao, Ming-Sheng Huang, Qiang Ouyang, Zai-Bo Jiang

EL SEVIER




Hong Shan, Xiang-Sheng Xiao, Qiang Ouyang, Department ofRadiology, Changzheng Hospital of the Second Military MedicalUniversity, Shanghai 200433, ChinaMing-Sheng Huang, Zai-Bo Jiang, Department of Radiology,The 3rd Affiliated Hospital of Sun Yat-Sen University, Guangzhou510630, Guangdong Province, ChinaCorrespondence to: Professor Hong Shan, Department of Radiology,Changzheng Hospital of the Second Military Medical University,Shanghai 200433, China. [email protected]: +86-20-85516867-2316 Fax: +86-20-87580725Received: 2004-07-19 Accepted: 2004-09-09

Abstract

AIM: To evaluate the value of endovascular stent in thetreatment of portal hypertension caused by benign mainportal vein stenosis.

METHODS: Portal vein stents were implanted in six patientswith benign main portal vein stenosis (inflammatory stenosisin three cases, postprocedure of liver transplantation inanother three cases). Changes in portal vein pressure, portalvein patency, relative clinical symptoms, complications, andsurvival were evaluated.

RESULTS: Six metallic stents were successfully placedacross the portal vein stenotic or obstructive lesions insix patients. Mean portal venous pressure decreasedsignificantly after stent implantation from (37.3±4.7) cmH2O to (18.0±1.9) cm H2O. The portal blood flow restoredand the symptoms caused by portal hypertension wereeliminated. There were no severe procedure-relatedcomplications. The patients were followed up for 1-48 mo.The portal vein remained patent during follow-up. Allpatients survived except for one patient who died of othercomplications of liver transplantation.

CONCLUSION: Percutaneous portal vein stent placementfor the treatment of portal hypertension caused by benignmain portal vein stenosis is safe and effective.


Key words: Angioplasty; Stent; Portal vein stenosis;Hypertension; Portal

Shan H, Xiao XS, Huang MS, Ouyang Q, Jiang ZB. Portalvenous stent placement for treatment of portal hypertensioncaused by benign main portal vein stenosis. World JGastroenterol 2005; 11(21): 3315-3318


INTRODUCTIONPortal venous hypertension is caused by extrahepaticobstruction or stenosis when the portal vein is blocked beforeblood reaches the liver. Patients with this condition accountfor 5-10% of all cases of portal hypertension[1-3]. Benignportal venous stenosis or obstruction induced by pancreatitis,appendicitis and postsurgical adhesive portal venous stenosisare the most common extrahepatic portal venous occlusion[4].Portal hypertension resulted from the occlusion of mainportal vein often results in the development of varices inesophagus, stomach, duodenum, small and large bowel, andgastrointestinal bleeding leading to death[4,5]. The developmentof ascites due to portal hypertension affects the patient’squality of life. Therefore, it is crucial to restore the bloodflow of portal vein and to prevent symptoms of portalhypertension.

To date, little is known about the role of stent placementin the treatment of benign portal venous stenosis orocclusion. The aim of the present study was to retrospectivelyassess the value of stent placement in the treatment ofportal hypertension caused by benign main portal veinstenosis or occlusion.


PatientsFrom July 2000 to July 2004, six male patients (mean age,39.8±14.7 years, range 21-65 years) underwent percutaneoustranshepatic stent placement for benign portal vein stenosisor occlusion. The clinical characteristics of these patientsare summarized in Table 1. Three cases were associatedwith procedure of liver transplants for posthepatitic cirrhosis,two cases with necrotizing pancreatitis, and one case withsuppurative appendicitis. The diagnosis of portal veinstenosis (five cases) and occlusion (one case) was establishedby Doppler ultrasound, and confirmed by transhepaticdirect portography. Clinical signs or symptoms includedgastrointestinal tract bleeding from varices in two patients,gastrointestinal tract bleeding and ascites in two patients,and ascites in two patients.

Stent placementInformed consent was obtained from all patients prior toall procedures. After local anesthesia was performed with2% lidocaine, the liver was punctured with fluoroscopicguidance using a 21-G needle (Chiba, COOK) or 18-Gpercutaneous cholangiographic needle (NPAS-100, COOK).A 7-F sheath was inserted into the portal vein through aguidewire. A 5-F catheter was advanced beyond the stenotic


or occluded lesions. Then portography was performed andportal venous pressure was measured. After 3 000-IUheparin was directly injected into the portal vein, the stenoticor occluded segment was dilated with a 10-mm-diameterballoon catheter. The stents were placed across the lesionsbecause of the persistence of stenotic lesions after repeateddilations. The implanted stents included 5 wallstents with adiameter of 10 mm and a length of 5-8 cm (Wallstent, BostonScientific) in five patients (patients 1-4 and 6), and aSymphony stent with a diameter of 10 mm and a length of8 cm (Symphony stent, Boston Scientific) in one patient(patient 5) (Table 1). Then portography and portal venouspressure measurement beyond the lesions were repeated.Finally, gelatin sponge or coins were placed in the liverparenchymal tract via the sheath or catheter to preventintraperitoneal hemorrhage.

All the patients underwent anticogulant therapy usingfraxiparin 3-5 d after the procedure, followed by warfarinadministration for 3 mo unless bleeding occurred.

Follow-up protocolAll the patients were followed up by Doppler ultrasoundevery month to evaluate the patency and blood flow in theportal vein, stent location and stenosis recurrence.Improvement of clinical symptoms, complications andsurvival was observed.

Statistical analysesThe data were expressed as mean±SD. The significance ofdifferences in portal venous pressure before and after stent

placement was assessed with Student’s t test. P<0.05 wasconsidered statistically significant.

RESULTS

Six stents were successfully implanted in the portal venouslesions of all six patients (Table 1, Figure 1). The mean portalvenous pressure decreased significantly from (37.3±4.7) cmH2O (1 cm H2O = 0.098 kPa) to (18.0±1.9) cm H2O(Table 1). There was a significant difference in portalvenous pressure before and after stent placement (t = 10.52,P<0.001).

The clinical signs or symptoms of gastrointestinal tractbleeding, gastroesophageal varices and ascites were eliminatedafter stent placement in all patients. The follow-up periodranged from 1 to 48 mo (mean 30 mo). During the follow-up period, all patients survived except for patient 4 whodied of other complications of liver transplantation 1 moafter stent implantment. The follow-up Doppler ultrasounddemonstrated that the portal vein remained patent and bloodflow in the portal vein with a stent was good. All stentsremained patent, and none required repeat dilation andmigration of stents was not observed in all patients duringfollow-up.

After stent placement, all patients complained of mildabdominal pain at the puncture site. Transient fever (lowerthan 38 ℃) occurred in three patients (patients 1, 3 and 4).These symptoms could be alleviated after symptomatictreatment. There were no other procedure-related andpostprocedure complications in all patients.

Figure 1 Development of ascites and hematemesis 1 mo after liver transplantationin a 33-year-old man (A and B) and refractory ascites 4 mo after acute necrotizing

pancreatitis in a 40-year-old man (C, D).

Table 1 The clinical characteristics of six patients

Portal venous pressure (cm H2O)Patient Sex Age (yr) Symptoms Etiology Stent styleno. Before stent After

placement stent placement

1 Male 33 Ascites, gastroesophageal Postsurgical of liver transplantation 45 20 Wallstent

varices, hematemesis

2 Male 35 Ascites Postsurgical of liver transplantation 33 18 Wallstent

3 Male 21 Ascites, Melena Necrotizing pancreatitis 38 20 Wallstent

4 Male 65 Gastroesophageal varices, Melena Postsurgical of liver transplantation 35 18 Wallstent

5 Male 40 Ascites Necrotizing pancreatitis 40 15 Symphony

6 Male 45 Gastroesophageal varices, Melena Suppurative appendicitis 33 17 Wallstent

1 cm H2O = 0.098 kPa.

A C DB

Shan H et al. Stenting in benign main portal vein stenosis 3317

DISCUSSIONEtiology of portal vein stenosis or occlusionPortal vein stenosis or occlusion is associated with neoplasticand non-neoplastic conditions. Malignant portal veinstenosis usually results from portal vein tumor thrombusor compression of neoplasms, accounting for 15-24% ofpatient with portal venous stenosis or occlusion[4,6-9]. Non-neoplastic conditions are the most common causes of portalvenous stenosis and occlusion. The following factors areassociated with benign portal vein stenosis or occlusion:inflammatory diseases such as pancreatitis and appendicitis,which can result in thrombosis or elastic portal veinstenosis[10-12]; portal hypertension resulted from liver cirrhosisduring which stasis of blood flow in main portal vein andits branches caused by portal hypertension may result inportal vein stenosis or occlusion due to thrombosis[13,14], andanticardiolipin antibodies may play a role in the developmentof portal vein thrombosis in cirrhosis[15]; abdominal surgeriesor trauma such as liver transplantation surgery, spleenectomy,cholecystectomy[4,16,17]; other conditions such as primaryportal vein thrombosis and congenital absence of portalvein[18]. Local portal vein stenosis secondary to fibrosisadhesion is usually associated with the inflammatory factorsor abdominal surgery at the region of liver hilum. However,not all portal vein stenoses would cause symptoms relatedto portal hypertension. Some studies indicated that there isno clinical symptom if the stenosis is less than 50% of thediameter of portal vein. If the stenosis of portal vein wasgreater than 80% of its diameter, symptoms of portalhypertension (e.g, gastrointestinal bleeding, refractoryascites, and thrombocytopenia) develop and liver failureand transplant recipient liver dysfunction occur[19,20].

In our series, three patients were associated with livertransplant surgery, and the other three patients wereassociated with inflammation (necrotizing pancreatitis in twocases and suppurative appendicitis in one case). The stenosisin our series was greater than 50% of the diameter ofportal vein and occluded completely in one case. Becausethe clinical symptoms of portal hypertension in these patientswere significant, portal venoplasty or stent placement wasnecessary to decrease the portal venous pressure.

Clinical value of portal venous stent placementPortal venous stent placement is useful for most patientswith portal vein stenosis or occlusion caused by malignantneoplasms. Yamakado et al [6,21], reported the clinicaleffectiveness of portal venous stent placement in patientswith hepatocellular carcinoma (HCC), pancreatic andbiliary neoplasms invading portal vein, and found that portalvenous stent placement decreases portal venous bloodpressure. The clinical outcomes, however, are quite differentdepending on the invasion site. When portal venous bloodflow is blocked and the splanchnic vein is intact, the stentsremain patent and portal hypertension symptoms subside.If splanchnic vein is involved, stents patency would becomeworse.

To our knowledge, there are only few case reports aboutthe stent placement for portal hypertension caused by benignportal vein stenosis or occlusion. Funaki et al[16], consideredthat the first choice of treatment for most patients with

benign portal vein stenosis is venoplasty with balloondilation, and stent placement is important for the elasticand recurrent stenosis to maintain the portal vein bloodflow. In their study, intravascular stents were placed in 12patients with segment hepatic transplants for ‘elastic’ or‘recurrent’ portal vein stenosis, which remained patent for5-61 mo (mean time, 46 mo). Cherukuri et al[22], placed stentsafter thrombolysis in two patients with hepatic transplantsand portal vein stenosis and thrombosis, and reported thatthe portal venous patency is good during follow-up. Someauthors considered that the management of thrombolysisafter stent placement is crucial and effective for patientswith portal vein thrombosis[23,24]. In our series, portal stenosis(n = 5) and occlusion (n = 1) were elastic. Balloon dilationwas not enough for these patients, stent implantation wasperformed for all patients to decrease the portal veinpressure. Our results showed portal venous stent placementwas useful in decreasing the portal vein pressure, and allstents remained patent in the follow-up. All patients survivedand were asymptomatic except for one case who died ofcomplications of hepatic artery thrombosis and bile leakagerelated to liver transplant.

Complications of pecutaneous transhepatic portal venousstent placementAbdominal pain at the puncture site is the most commoncomplication of pecutaneous transhepatic portal venousstent placement[6,16], which occurred in all cases of our series.Transient fever (lower than 38 ℃) occurred in three of sixpatients. The symptoms of abdominal pain and fever areusually mild and disappear 2-3 d after symptomatictreatments. Complication of liver abscess has been reported[16].Percutaneous drainage is necessary in these patients. Thepotential complications of intraperitoneal bleeding, bileinjury or biliary bleeding, have been reported inpercutaneous portal vein embolization or percutaneoustranshepatic measurement of portal pressure[25-29]. Therewere no severe complications in our series.

In conclusion, percutaneous portal vein stent placementfor the treatment of portal hypertension caused by benignmain portal vein stenosis is safe and effective.

REFERENCES1 Cohen J, Edelman RR, Chopra S. Portal vein thrombosis: a

review. Am J Med 1992; 92: 173-1822 Witte CL, Brewer ML, Witte MH, Pond GB. Protean manifes-

tations of pylethrombosis: A review of thirty-four patients.Ann Surg 1985; 202: 191-202

3 Sugiura N, Matsutani S, Ohto M, Ebara M, Yoshikawa M,Yamaguchi T, Okuda K, Miki M. Extrahepatic portal veinobstruction in adults detected by ultrasound with frequentlack of portal hypertension signs. J Gastroenterol Hepatol 1993;

8: 161-1674 Sarin SK, Agarwal SR. Extrahepatic portal vein obstruction.

Semin Liver Dis 2002; 22: 43-58

5 D’Amico G, De Franchis R. Upper digestive bleeding incirrhosis. Post-therapeutic outcome and prognostic indicators.

Hepatology 2003; 38 : 599-612

6 Yamakado K, Nakatsuka A, Tanaka N, Fujii A, Isaji S,Kawarada Y, Takeda K. Portal venous stent placement in

patients with pancreatic and biliary neoplasms invading por-

tal veins and causing portal hypertension: initial experience.Radiology 2001; 220: 150-156

7 Tsukamoto T, Hirohashi K, Kubo S, Tanaka H, Hamba H,

Shuto T, Higaki I, Takemura S, Kinoshita H. Percutaneoustranshepatic metallic stent placement for malignant portal

vein stenosis. Hepatogastroenterology 2003; 50: 453-455

8 Tanaka Ji, Andoh H, Yoshioka M, Furuya T, Asanuma Y,Koyama K. Palliative treatment with metallic stents for

unresectable gallbladder carcinoma involving the portal vein

and bile duct. J Hepatobiliary Pancreat Surg 2000; 7: 331-3359 Higaki I, Hirohashi K, Kubo S, Tanaka H, Tsukamoto T,

Omura T, Kinoshita H. Portal vein stenting to treat portal

vein tumor thrombus in hepatocellular carcinoma. Osaka CityMed J 2000; 46 : 99-104

1 0 Vujic I. Vascular complications of pancreatitis. Radiol Clin

North Am 1989; 27: 81-911 1 Schaible R, Textor J, Decker P, Strunk H, Schild H. Transjugular

portal venous stenting in inflammatory extrahepatic portal

vein stenosis. Cardiovasc Intervent Radiol 2002; 25: 530-5321 2 Maleux G, Vaninbroukx J, Verslype C, Vanbeckevoort D,

Van Hootegem P, Nevens F. Pancreatitis-induced extrahe-

patic portal vein stenosis treated by percutaneous transhepaticstent placement. Cardiovasc Intervent Radiol 2003; 26: 395-397

1 3 Malkowski P, Pawlak J, Michalowicz B, Szczerban J,

Wroblewski T, Leowska E, Krawczyk M. Thrombolytic treat-ment of portal thrombosis. Hepatogastroenterology 2003; 50 :

2098-2100

1 4 Denninger MH, Chait Y, Casadevall N, Hillaire S, GuillinMC, Bezeaud A, Erlinger S, Briere J, Valla D. Cause of portal

or hepatic venous thrombosis in adults: the role of multiple

concurrent factors. Hepatology 2000; 31: 587–5911 5 Oksuzoglu G, Bayraktar Y, Arslan S, Celik I, Arslan M, Sivri

B, Kirazli S, Kayhan B. Portal vein thrombosis in cirrhotics:

related with anticardiolipin antibodies? Hepatogastroenterology2003; 50 : 1527-1530

1 6 Funaki B, Rosenblum JD, Leef JA, Zaleski GX, Farrell T, Lorenz

J, Brady L. Percutaneous treatment of portal venous stenosisin children and adolescents with segmental hepatic transplants:

long-term results. Radiology 2000; 215: 147-151

1 7 Hiraoka K, Kondo S, Ambo Y, Hirano S, Omi M, Okushiba S,Katoh H. Portal venous dilatation and stenting for bleeding

jejunal varices: report of two cases. Surg Today 2001; 31 :

1008-10111 8 Yada S, Hizawa K, Aoyagi K, Hashizume M, Matsumoto T,

Koga H, Fujishima M. Portal hypertensive gastropathy due

to chronic portal vein occlusion in Crohn’s disease. Am JGastroenterol 1998; 93: 1376-1377

1 9 Huang YH, Yang JY, Chen W, Zhuang WQ, Yu SP, Chen GH.

Intervenioal method in diagnosis and treatment of vascularcomplication after liver transplantation. Zhonghua Fangshexue

Zazhi 2001; 35 : 453-456

2 0 Jiang L, Yang JY, Chen W, Zhuang WQ, Huang YH, Li HP,Chen GH. Interventional treatment on vascular and biliary

complications after liver transplantation. Zhonghua Fangshexue

Zazhi 2002; 36 : 40-432 1 Yamakado K, Nakatsuka A, Tanaka N, Fujii A, Terada N,

Takeda K. Malignant portal venous obstructions treated by

stent placement: significant factors affecting patency. J VascInterv Radiol 2001; 12: 1407-1415

2 2 Cherukuri R, Haskal ZJ, Naji A, Shaked A. Percutaneous

thrombolysis and stent placement for the treatment of portalvein thrombosis after liver transplantation: long-term follow-

up. Transplantation 1998; 65: 1124-1126

2 3 Bhattacharjya T, Olli ff SP, Bhattacharjya S, Mirza DF,McMaster P. Percutaneous portal vein thrombolysis and

endovascular stent for management of posttransplant portal

venous conduit thrombosis. Transplantation 2000; 69: 2195-2198

2 4 Lee SY, Ko GY, Gwon DI, Song HY, Lee SG, Yoon HK, Sung

KB. Living donor liver transplantation: complications indonors and interventional management. Radiology 2004; 230:

443-449

2 5 Amitrano L, Guardascione MA, Brancaccio V, MargaglioneM, Manguso F, Iannaccone L, Grandone E, Balzano A. Risk

factors and clinical presentation of portal vein thrombosis in

patients with liver cirrhosis. J Hepatol 2004; 40: 736-7412 6 Mamada Y, Tajiri T, Akimaru K, Yoshida H, Taniai N. Long-

term prognosis after arterio-portal embolization for hepato-

cellular carcinoma. Hepatogastroenterology 2004; 51: 234-2362 7 Madoff DC, Hicks ME, Abdalla EK, Morris JS, Vauthey JN.

Portal vein embolization with polyvinyl alcohol particles and

coils in preparation for major liver resection for hepatobiliarymalignancy: safety and effectiveness-study in 26 patients.

Radiology 2003; 227: 251-260

2 8 Azoulay D, Castaing D, Smail A, Adam R, Cailliez V, LaurentA, Lemoine A, Bismuth H. Resection of nonresectable liver

metastases from colorectal cancer after percutaneous portal

vein embolization. Ann Surg 2000; 231: 480-4862 9 Fujii Y, Shimada H, Endo I, Morioka D, Nagano Y, Miura Y,

Tanaka K, Togo S. Risk factors of posthepatectomy liver fail-

ure after portal vein embolization. J Hepatobiliary PancreatSurg 2003; 10 : 226-232




Expression of gamma-aminobutyric acid A receptor subunits 1,

1, 2 mRNA in rats with hepatic encephalopathy

Xiao-Qing Li, Lei Dong, Zhong-Hua Liu, Jin-Yan Luo

EL SEVIER




Xiao-Qing Li, Lei Dong, Jin-Yan Luo, Department of Gastroenterology,Second Hospital of Xi’an Jiaotong University, Xi’an 710004, ShaanxiProvince, ChinaZhong-Hua Liu, Department of Anatomy, Medical School of Xi’anJiaotong University, Xi’an 710061, Shaanxi Province, ChinaCorrespondence to: Dr. Xiao-Qing Li, Department of Gastroenterology,Second Hospital of Xi’an Jiaotong University, Xi’an 710004, ShaanxiProvince, China. [email protected]: +86-29-87679272Received: 2004-04-04 Accepted: 2004-05-29

Abstract

AIM: To investigate the mRNA expression of gamma-aminobutyric acid A (GABAA) receptor subunits 1, 1, 2

in different parts of the brain of rats with hepaticencephalopathy.

METHODS: Twelve adult male Sprague-Dawley rats wererandomly divided into two groups: (1) hepatic encephalopathymodel group (n = 6), which was induced by intraperitonealinjection of thioacetamide (TAA, 350 mg/kg) for threeconsecutive days; (2) control group (n = 6), in which therats were treated with same dose of normal salinesolution. After the freeze slice of cerebrum was made, insitu hybridization was used to detect the mRNA of GABAA

receptor subunits 1, 1, and 2 in rat cerebral cortex,basal nuclei, substantia nigra and hippocampi. Image datawere collected and analyzed quantitatively by QWin550CWmodel image signal gather and analysis system.

RESULTS: In rats with hepatic encephalopathy, mRNAexpression levels of GABAA receptor subunits 1, 1 increasedsignificantly in basal nuclei, substantia nigra parscompacta, substantia nigra pars reticularis and hippocampi(144.7±15.67/184.14±4.41, 60.61±33.66/113.07±32.44,87.71± 21.25/128.40±18.85, 122.34±5.56/161.60±4.56,123.29±5.21/140.65±4.15, 123.40±4.42/140.09±4.52,124.76±4.18/140.09±4.12, 141.62±15.09/182.80 ±5.20,69.13±30.74/134.21±43.76, 87.87±25.16/151.01±19.49,122.14±6.30 /162.33±3.92, 122.81±5.09/137.19±7.12,123.00±4.63/138.11±5.92, 125.75 ±2.43/138.81±6.10,P<0.01), but did not change in the cerebral cortex comparedto the control group. Similar changes were found in themRNA expression levels of GABAA receptor subunit 2,which increased significantly in basal nuclei, substantianigra pars compacta, substantia nigra pars reticularis(136.81±26.41/167.97±16.23, 51.00±36.14/113.18±36.52,86.35±20.30/ 126.90±19.74, P<0.01), CA1 of hippocampal(162.15±9.05/178.62±6.45, P<0.05), and no changeswere found in the cerebral cortex and CA2, CA3, CA4 ofhippocampi.

CONCLUSION: In rats with hepatic encephalopathy,mRNA expression levels of GABAA receptor subunits 1,1, 2 increase significantly in basal nuclei, substantia nigraand hippocampi, suggesting that the changes of mRNAexpression levels in GABAA receptor subunits maycontribute to the pathogenesis of hepatic encephalopathy.


Key words: Gama-aminobutyric acid A receptor; mRNA

Li XQ, Dong L, Liu ZH, Luo JY. Expression of gamma-aminobutyric acid A receptor subunits 1, 1, 2 mRNA inrats with hepatic encephalopathy. World J Gastroenterol2005; 11(21): 3319-3322


INTRODUCTION

Hepatic encephalopathy (HE) is a neuropsychiatric syndromeassociated with fulminant hepatic failure and chronic liverdisease. Its pathogenesis is unclear till now. One of the importantfactors is the increase of gamma-aminobutyric acid (GABA)level and GABA-ergic activity. GABA is the most importantinhibitory neurotransmitter in the central nervous system(CNS). Up to now, three different GABA receptors havebeen discovered: GABAA, GABAB and GABAC receptors.Among these three receptors, GABAA receptor is consideredto have the closest relationship with HE. In order to findout the pathogenesis of HE, we used in situ hybridization todetect the changes of mRNA expression of GABAA

receptor subunits 1, 1, and 2 in several major parts ofthe brain of rats after making hepatic encephalopathy modelsby intraperitoneal injection of thioacetamide.


Animal modelTwelve adult male Sprague-Dawley rats (230±17 g), suppliedby Xi’an Jiaotong University Experiment Animal Centre wereused in this study. The rats were randomly divided intohepatic encephalopathy model group (n = 6) which wasinduced by intraperitoneal injection of thioacetamide (TAA,350 mg/kg) for three consecutive days, and control group(n = 6) in which the rats were treated with same dose ofnormal saline solution.

Slide preparationRats were poured with 40 g/L polymerisatum/0.1 mol/L


PBS with 1 mL/L DEPC for fixation after being anesthetized.Cerebrum was taken out, fixed with 40 g/L polymerisatum/0.1 mol/L PBS containing 1 mL/L DEPC for 20 min, andsoaked in 300 g/L cane sugar solution. Before bein cut into14-m thick slices, the slides were dealt with poly-L-lysine.

In situ hybridizationDigoxin-labeled oligonucleotide probes aimed directly atGABAA receptor subunits 1, 1, 2 were used for in situhybridization (ISH). Experiments were carried out accordingto ISH detection kit manufacturer’s instructions (BosterCompany, Wuhan). Slices were dealt with 1:50 mixed30 mL/L H2O2 and pure methanol for 30 min at roomtemperature. After washing thrice with distilled water, theslices were digested with fresh pepsin that was diluted in3% citromalic acid for 5-120 s at room temperature inorder to expose mRNA nucleic acid fragment, then washedthrice (5 min each time) with PBS for ISH, followed by awash with distilled water. After washing, the slices were fixedwith 40 g/L polymerisatum/0.1 mol/L PBS containing1 mL/L DEPC for 10 min at room temperature, andsubsequently washed thrice with distilled water. After allthe preparatory procedures were completed, we added20 L of prehybridization liquid to each slice and prehybridizedit for 2-4 h at 38-42 ℃. Then the unnecessary liquid wasremoved without washing. Thereafter, we added 20 L ofhybridization liquid to each slice and covered it with a coverslip. After hybridizing overnight at 38-42 ℃, the slices werewashed twice (5 min each time) with 2×SSC at 37 ℃, oncefor 15 min with 0.5×SSC at 37 ℃, 1-3 times (15 min eachtime) with 0.2×SSC at 37 ℃, and finally treated with closeliquid for 30 min at 37 ℃. Unnecessary liquid was removedwithout washing before biotin-conjugated rat anti-digoxinantibody was added to the slices. After reaction for 60 minat 37 ℃, the slices were washed four times (5 min eachtime) with PBS for ISH. Then, we added streptavidin-biotincomplex (SABC). After reaction for 20 min at 37 ℃, theslices were washed thrice (5 min each time) with PBS forISH. Then biotin-conjugated peroxidase was added to reactfor 20 min at 37 ℃, washed four times (5 min each time)with PBS for ISH. After the color was developed by DAB,the slices were washed sufficiently with water. At last, allslices were dehydrated with alcohol, and sealed.

Image analysisTen ISH slices were randomly selected from each brain

region in both groups. Image data were collected andanalyzed quantitatively using QWin550CW model imagesignal gather and analysis system.

Statistical analysisData analysis was done with SPSS10.0 statistics software.The average gray values were compared between controland hepatic encephalopathy model group with t test. P<0.05was considered statistically significant.

RESULTS

mRNA expression levels of GABAA receptor subunitsThe positively stained GABAA receptor subunits 1, 1, 2

mRNA were located in cytoplasm of the cells. Table 1 showsthe results of quantitative analysis of mRNA expressionlevels of GABAA receptor subunits 1, 1, 2 in rats withhepatic encephalopathy using QWin550CW model imagesignal gather and analysis system.

In rats with hepatic encephalopathy, mRNA expressionlevels of GABAA receptor subunits 1, 1 increased significantlyin basal nuclei, substantia nigra pars compacta, substantianigra pars reticularis and hippocampi (P<0.01), but did notchange in the cerebral cortex compared to the control group.Similar changes were found in the mRNA expression levelsof GABAA receptor subunit 2, which increased significantlyin basal nuclei, substantia nigra pars compacta, substantianigra pars reticularis (P<0.01), CA1 of hippocampi (P<0.05),and no changes were found in the cerebral cortex and CA2,CA3, CA4 of hippocampi. (Figure 1, Table 1)

DISCUSSION

Although many research works were reported in recentyears that tried to explain the pathogenesis of hepaticencephalopathy, it is still not elucidated properly[1,2].According to the increased levels of GABA in plasma,increased permeability of the blood-brain barrier and thechanges of GABA receptors on the surface of neuronmembrane, Schafer and other scientists proposed the GABAhypothesis about hepatic encephalopathy in 1982[3,4]. GABAis a principal inhibitory neurotransmitter in the mammalianbrain, and the concentration of GABA in plasma is increasedin the animal model of liver function failure during hepaticencephalopathy. The increased concentration of GABAneurotransmitter and enhanced GABA-ergic activity are

Table 1 Gray values of mRNA expression levels of GABAA receptor subunits 1, 1, 2 in rats with hepatic encephalopathy (mean ± SD)

1 mRNA 1 mRNA 2 mRNAPosition

Control group HE model Control group HE model Control group HE model

Basal nuclei 184.14±4.41 144.7±15.67b 182.80±5.20 141.62±15.09b 167.97±16.23 136.81±26.41b

Cerebral cortex 149.54±13.74 154.9±11.02 141.96±17.55 155.26±10.24 142.47±15.69 143.29±24.87

Substantia nigra pars reticularis 113.07±32.44 60.61±33.66b 134.21±43.76 69.13±30.74b 113.18±36.52 51.00±36.14b

Substantia nigra pars compacta 128.40±18.85 87.71±21.25b 151.01±19.49 87.87±25.16b 126.90±19.74 86.35±20.30b

Hippocampal CA1 161.60±4.56 122.34±5.56b 162.33±3.92 122.14±6.30b 178.62±6.45 162.15±9.05a

Hippocampal CA2 140.65±4.15 123.29±5.21b 137.19±7.12 122.81±5.09b 162.70±5.90 161.57±6.40



aP<0.05, b P<0.01 vs control group HE: hepatic encephalopathy.

Li XQ et al. GABAA receptor in rats with hepatic encephalopathy 3321

considered to be associated with the development of hepaticencephalopathy in the central nervous system[5-7].

Up to now, 3 GABA receptors GABAA, GABAB andGABAC have been reported, and GABAA receptor has beenextensively studied in recent years. GABAA receptor, achloride-permeable channel, can increase permeability forchlorions when activated and thereafter mediate inhibitorypostsynaptic potentials (IPSPs), thus inducing inhibitoryeffects. Benzodiazepine (BDZ) can enhance these intermediaryeffects directly or indirectly. Moreover, the function ofGABA receptors can also be mediated by alcohol, evanescentnarcotic and steroid after binding to the sites on thesereceptors[8,9]. GABA receptor is an oligomer, which consistsof seven subunits, 1-6, 1-4, 1-4, , 1-3, , and , and eachsubunit has a different function. Now it is deemed that subunit is the binding site for GABA and GABAA receptors,and and subunits of GABAA can react with BDZ[10,11].Among these subunits, 1, 2, and 2 account for 43% ofall the subunits, and 2 subunit presents in 60% of GABAA

receptors. The pharmacological analysis proved that BDZhas a much more enhancing effect on the receptors thatconsisted of 1, 3, and 2 subunits than those consisted of2, 5, 6, and 2 subunits[12]. The presence of 2 subunitcan up-regulate BDZ[13].

In this study, the rat model of hepatic encephalopathyinduced by thioacetamide was chosen to study the mRNAexpression level of 1, 1, and 2 subunits of GABAA receptorson the different regions of brain by ISH. The results showedthat the mRNA expression level of 1, 1, and 2 subunitssignificantly increased in the areas of basal nuclei, substantianigra pars compacta and pars reticularis, suggesting thathepatic encephalopathy is related with the diversity of

mRNA level expression of GABAA receptor subunits. Whenthe mRNA expression level of 1 significantly increased,the number of binding sites for GABA and GABAA

receptors increased, the GABA-ergic tension was enhanced,the number of open chlorion tunnels was increased, andinhibitory neurotransmitter effects were enhanced. ThemRNA expression level of 1 and 2 subunits significantlyincreased, the sensitivity of GABAA receptors for BDZwas enhanced, and BDZ could induce conformational changeof receptors, the affinity of GABA for its receptors wasincreased, leading to enhancement of the GABA-ergic tension.According to these findings, we could explain the reasonwhy hepatic encephalopathy can be effectively treated withthe specific antagonist of Benzodiazepine (Flumazenil)[14,15].

GABA is the most important inhibitory transmitter ofsubstantia nigra-corpus striatum pathway and by-pass[16].Most neurons in corpus striatum are multi-dendritic spineGABA-ergic neurons (75%), and these neurons may be theunique source of efferent nerve fibers of corpus striatum(send fibers to pallidum and substantia nigra). GABA canbe found in all globus pallidus, and has a concern with theefferent nerve fibers of pallidum-substantia nigra parsreticularis. Substantia nigra is divided into the dorsal parscompacta and ventral pars reticularis, and most neurons inpars reticularis are GABA-ergic neurons. The ventral partof substanti nigra can extend to thalamus. Furthermore, itis presumed to connect with pallidum and has a similarstructure with it[17]. The GABA-ergic fibers from lateralglobus pallidus reach both pars compacta and pars reticularis,and most fibers terminate at pars reticularis. The projectionpathways of GABA-ergic neurons of pars reticularis are asfollows: (1) The fibers reach nucleus ventralis anterior

Figure 1 mRNA expression of GABAA receptor subunits as detected by in situhybridization. A: 1 mRNA of GABAA receptor in basal nuclei of rats with HE(×400); B: 1 mRNA of GABAA receptor in basal nuclei of control rats (×400); C:2 mRNA of GABAA receptor in substantia nigra of rats with HE (×400); D: 2

mRNA of GABAA receptor in substantia nigra of control rats (×400); E: 1 mRNAof GABAA receptor in hippocampi of rats with HE (×100); F: 1 mRNA of GABAA

receptor in hippocampi of control rats (×100).

A C

D E

B

F

thalami and mediodorsal nucleus through nigrothalamictract, then project to the prefrontal and cingulum cortexafter relay; (2) The fibers reach pontine nucleus and reticularformation through pathway, then the impulse transmits toanterior column neurons of spinal cord after relay; (3) Thefibers from substantia nigra-tectum tract project athomolateral superior colliculus, and reach reticular formationof medulla oblongata and spinal cord. Nucleus ventralisanterior thalami regulates the motion, and participates inascending activation. Mediodorsal nucleus participates insuperordinary action of cortex, and has a concern withemotion. In our study, we found that the expression of 1,1 and 2 subunits significantly increased in basal nuclei ofMeynert, substantia nigra pars compacta and pars reticularis,that is to say, GABA-ergic tension of substantia nigra-corpusstriatum pathway and by-pass was enhanced, which may bethe molecular mechanism for the multi-psychiatric andneuropathic symptoms during hepatic encephalopathy.

Hippocampal formation has a concern with emotion,learning and memory, sleep and wakefulness, etc. In ourstudy, we also found that the expression of 1 and 1 subunitssignificantly increased in all areas of hippocampus duringhepatic encephalopathy, and the expression level of 2

subunit increased in the CA1 region, suggesting that GABA-ergic tension is enhanced in those regions, and this iscorrelated with the symptoms of motion change, and sleepreverse during hepatic encephalopathy.

In summary, our results show that in rats with hepaticencephalopathy, mRNA expression levels of GABAA receptorsubunits 1, 1, 2 increase significantly in basal nuclei,substantia nigra and hippocampi, suggesting that the changesof GABAA receptor subunits mRNA expression levels maycontribute to the pathogenesis of hepatic encephalopathy.At present, the pathogenesis of hepatic encephalopathy isstudied at the transcriptional level of GABAA receptorsubunits. The expression abnormality of other subunits ofreceptors is also involved during hepatic encephalopathy,meanwhile, the expression of receptors is regulated by post-translational subunits, and also influenced by receptorassembly, transportation, insertion on the membrane. Allthese require further research.

REFERENCES1 Chu CJ, Lee FY, Wang SS, Chang FY, Lin HC, Wu SL, Chan

CC, Tsai YT, Lee SD. Establishment of an animal model of

hepatic encephalopathy. Zhonghua Yixue Zazhi (Taipei) 2000;

63 : 263-2692 Jones EA. Ammonia, the GABA neurotransmitter system, and

hepatic encephalopathy. Metab Brain Dis 2002; 17: 275-281

3 Schafer DF, Jones EA. Hepatic encephalopathy and the

gamma-aminobutyric-acid neurotransmitter system. Lancet

1982; 1: 18-20

4 Schafer DF, Jones EA. Potential neural mechanisms in the

pathogenesis of hepatic encephalopathy. Prog Liver Dis 1982;

7: 615-627

5 Jones EA. Pathogenesis of hepatic encephalopathy. Clin Liver

Dis 2000; 4: 467-485

6 Wysmyk U, Oja SS, Saransaari P, Albrecht J. Enhanced GABA

release in cerebral cortical slices derived from rats with

thioacetamide-induced hepatic encephalopathy. Neurochem

Res 1992; 17 : 1187-1190

7 Zhang Z, Wu C, Zhou P. Changes in gamma-amino-butyric

acid and N-methyl-D-aspartic acid receptor-gated currents

from freshly isolated hippocampal CA1 pyramidal neurons

of hepatic encephalopathy rats. Zhonghua Yixue Zazhi 1997;

77 : 439-442

8 Akk G, Steinbach JH. Low doses of ethanol and a neuroac-

tive steroid positively interact to modulate rat GABA(A) re-

ceptor function. J Physiol 2003; 546: 641-6469 Ahboucha S, Desjardins P, Chatauret N, Pomier-Layrargues

G, Butterworth RF. Normal coupling of brain benzodiazepineand neurosteroid modulatory sites on the GABA-A receptorcomplex in human hepatic encephalopathy. Neurochem Int2003; 43 : 551-556

1 0 1998 Receptor and ion channel nomenclature . TrendsPharmacol Sci 1998; (Suppl): 1-98

1 1 Crestani F, Assandri R, Tauber M, Martin JR, Rudolph U.Contribution of the alpha1-GABA(A) receptor subtype to thepharmacological actions of benzodiazepine site inverseagonists. Neuropharmacology 2002; 43: 679-684

1 2 Costa E, Guidotti A. Benzodiazepines on trial: a researchstrategy for their rehabilitation. Trends Pharmacol Sci 1996; 17:192-200

1 3 Als-Nielsen B, Kjaergard LL, Gluud C. Benzodiazepine re-ceptor antagonists for acute and chronic hepatic encephalopathy.Cochrane Database Syst Rev 2001; 4: CD002798

1 4 Dursun M, Caliskan M, Canoruc F, Aluclu U, Canoruc N,Tuzcu A, Yilmaz S, Isikdogan A, Ertem M. The efficacy offlumazenil in subclinical to mild hepatic encephalopathicambulatory patients. A prospective, randomised, double-blind, placebo-controlled study. Swiss Med Wkly 2003; 133:118-123

1 5 Ferenci P, Grimm G. Benzodiazepine antagonist in the treat-ment of human hepatic encephalopathy. Adv Exp Med Biol1990; 272 : 255-265

1 6 Farrant M, Webster RA. Compartmental distribution of en-dogenous amino acids in the substantia nigra of the rat. BrainRes 1989; 480: 344-348

1 7 Webster KE. Structure and function of the basal ganglia-a

non-clinical view. Proc R Soc Med 1975; 68: 203-210

Science Editor Wang XL and Kumar M Language Editor Elsevier HK


• CASE REPORT •

Occult celiac disease prevents penetrance of hemochromatosis

Andreas Geier, Carsten Gartung, Igor Theurl, Guenter Weiss, Frank Lammert, Christoph G. Dietrich, Ralf Weiskirchen,

Heinz Zoller, Benita Hermanns, Siegfried Matern

EL SEVIER




Andreas Geier, Carsten Gartung, Frank Lammert, ChristophG. Dietrich, Siegfried Matern, Department of Internal MedicineIII, Aachen University (RWTH), Aachen, GermanyIgor Theurl, Guenter Weiss, Heinz Zoller, Department of InternalMedicine, University of Innsbruck, Innsbruck, AustriaRalf Weiskirchen, Department of Clinical Chemistry andPathobiochemistry, Aachen University (RWTH), Aachen, GermanyBenita Hermanns, Department of Pathology, Aachen University(RWTH), Aachen, GermanyCorrespondence to: Andreas Geier, MD, Department of InternalMedicine III, Aachen University (RWTH), Pauwelsstrasse 30, D-52074 Aachen, Germany. [email protected]: +49-241-8088634 Fax: +49-241-8082455Received: 2004-07-05 Accepted: 2004-09-19

Abstract

AIM: To report a patient with C282Y homozygocity, depletedbody iron and intestinal atrophy caused by celiac disease(CD) who experienced resolution of the enteropathy withsubsequent normalization of iron metabolism upon gluten-free diet.

METHODS: To obtain information on the tissue distributionand quantitative expression of proteins involved induodenal iron trafficking, we determined the expressionof divalent-metal transporter 1 (DMT1), ferroportin 1 (FP1)and transferrin receptor (TfR1) by means of immunohist-ochemistry and real-time PCR in duodenal biopsies of thispatient.

RESULTS: Whereas in hereditary hemochromatosispatients without CD, DMT1 expression was up-regulatedleading to excessive uptake of iron, we identified a significantreduction in protein and mRNA expression of DMT1 as acompensatory mechanism in this patient with HH and CD.

CONCLUSION: Occult CD may compensate for increasedDMT1 expression in a specific subset of individuals withhomozygous C282Y mutations in the hemochromatosis(HFE) gene, thus contributing to the low penetrance of HH.


Key words: Hemochromatosis; Celiac disease; Divalent-metal transporter 1; Transferrin receptor; Iron metabolism

Geier A, Gartung C, Theurl I, Weiss G, Lammert F, Dietrich CG,Weiskirchen R, Zoller H, Hermanns B, Matern S. Occult celiacdisease prevents penetrance of hemochromatosis. World JGastroenterol 2005; 11(21): 3323-3326


INTRODUCTIONHereditary hemochromatosis (HH) is an inherited disorder ofiron metabolism that is characterized by excessive gastrointestinaliron absorption with subsequent iron deposition in majororgans of the body[1,2]. Autosomal recessive transmission ofthe HH gene and genetic linkage to the HLA complex hasbeen known since the mid-1970s[3,4]. In 1996 a candidategene for HH, now known as HFE, was detected by positionalcloning[5]. Two missense mutations were initially identifiedin the HFE gene, leading to an exchange of cysteine totyrosine at position 282 (C282Y) or a change from histidineto aspartate at position 63 (H63D)[5]. Although the homozygousC282Y genotype affects between 1 in 200 and 1 in 400persons of northern European descent, only a considerablylow percentage of these homozygotes develop clinicallysevere hemochromatosis[6]. Thus, genetic or environmentalfactors affecting the penetrance of hemochromatosis inpatients with HFE mutations still remain to be elucidated.

Iron deficiency anemia in patients with HH is very rarelydiscovered due to proposed algorithms, which suggestgenotyping only in patients with fasting transferrin saturationhigher than 45%[1,2]. However, rare cases are documentedand may be associated with disorders leading to duodenalatrophy with subsequent iron malabsorption. To date onlythree patients with HH and iron deficiency anemiaassociated with celiac disease (CD) have been reported inthe world literature[7-9]. In this contribution, we report anotherpatient with C282Y homozygosity, depleted body iron andintestinal atrophy caused by CD. Whereas in HH patientswithout CD divalent-metal transporter 1 (DMT1)expression is up-regulated leading to excessive uptake ofiron, we identified a significant reduction in protein andmRNA expression of DMT1 in duodenal biopsies as amechanism which modulates iron stores in a patient withHH and CD.

CASE REPORT

A 65-year-old Caucasian female patient presented withchronic diarrhea and weight loss of 10 kg over 4 years.Diarrheal episodes occurred in association with cereals andmilk products. An initial lactose-free diet failed to improvesymptoms but a recent trial of gluten-free diet brought partialrelief at the time of referral. Her history was unremarkableexcept for the fact that she suffered from hemochromatosis14 years ago and was treated with phlebotomy over nearlya decade. Two years ago HFE genotyping detected ahomozygous C282Y mutation. Nevertheless an oral ironsubstitution therapy had to be started because she developedan iron deficiency anemia. The initial evaluation revealed


the persistence of iron deficiency anemia (Table 1). Endomysium(1:160, reference <1:10), gliadin (IgG 37 kU/L, IgA 740kU/L, reference <12 kU/L each) and tissue transglutaminaseantibodies (253 U, reference <20 U) were strongly positive.Histological examination of small bowel biopsies detectedintestinal atrophy with lymphocytic infiltrates suggestive forCD. Within 3 mo of gluten-free diet, diarrhea completelyresolved and milk products were tolerated well. Iron substi-tution was stopped when serum iron, ferritin and hemoglobinreached normal values after 4 mo of gluten-free diet (Table 1).She gained 15 kg of weight within 1 year. Control smallbowel biopsies showed resolution of the enteropathy, and abreath test with H2 lactose proved resolution of the secondarylactose intolerance.

Table 1 Clinical chemistry data

First visit End of follow up Reference time of biopsy control biopsy values

Hemoglobin (g/L) 112 153 120-160

Hematocrit 35 45 0.37-0.47

Serum iron (µmol/L) 7.0 26.0 11.1-31.1

Transferrin (g/L) 2.5 1.9 2.0-3.6

Transferrin saturation (%) <15 54 16-45

Ferritin (µg/L) 11 78 30-150

Under iron substitution 100 mg q.d.

AssaysSerum clinical chemistry was performed by standard techniqueswith an autoanalyzer.

HFE genotypingGenomic DNA was extracted from whole blood and lightcycler (Roche, Mannheim, Germany) amplification of theH63D and C282Y variant fragments with subsequent meltingcurve analysis was performed using standard cycle conditions.The C187G transversion at codon 63 was monitored withthe 3’-fluorescein-labeled anchor 5’-CTTGAAATTCTA-CTGGAAACCCATGGAGTTCGGGGCTCC-3’ and the5’-LC-Red640-labeled sensor 5’-CACGGCGACTCTCA-TCATCATAGAACACGAACA-3’ probe. The G845Atransition at codon 282 was simultaneously analyzed withthe 3’-fluorescein-labeled sensor 5’-AGATATACGTAC-CAGGTGGAG-3’ and the 5’-LC-Red640-labeled anchorprobe 5’-CCCAGGCCTGGATCAGCCCCTCATTGT-GATCTGGG-3’.

TaqMan real-time PCRTaqMan real-time PCR primers and TaqMan probe forquantification of DMT1 cDNA and FP1 cDNA weredesigned as previously described[10]. For the quantificationof TfR1 cDNA the following intron spanning primers wereused: sense 5’-TCCCAGCAGTTTCTTTCTGTTTT-3’;antisense 5’-CTCAATCAGTTCCTTATAGGTGTCCA-3’. The TaqMan probe 5’-CGAGGACACAGATTATC-CTTATTTGGGTACCACC-3’ was labeled with the reporterfluorescent dye 6-carboxyfluorescein at the 5’ end and withthe quencher 6-carboxytetramethyl-rhodamine at the 3’end.For quantification of DMT1, FP1, and TfR1 mRNA levelsin duodenal biopsy specimens TaqMan real-time PCR was

carried out in the ABIPrism 7700 sequence detector (AppliedBiosystems, Vienna, Austria) as previously described[10].

ImmunohistochemistryRoutinely formalin-fixed, paraffin-embedded duodenalbiopsies were used for immunohistochemical stainingperformed as previously described[10]. Sections were incubatedwith 0.1 mL of 300 µg/mL affinity-purified anti-DMT1(260-275) or anti-FP1 (240-254) antiserum and a biotin-coupled goat anti-rabbit immunoglobulin (Ig) G (Dako, Vienna,Austria) in a 1:500 dilution. Similar immunohistochemicalmethods, as described for DMT1 and FP1, were used forTfR1, using a monoclonal mouse anti-human TfR1 antibody(Zymed Laboratories, South San Francisco, CA, USA;code 13-6 800) diluted 1:200. Sections were incubated withthe TfR1 antibody and a biotin-coupled goat anti-mouseimmunoglobulin (Ig)G (Dako) in a 1:800 dilution. Subseq-uently, the reaction product was developed as previouslydescribed.

Informed consent was obtained for all analyses describedin this section.

OutcomesIn order to get an estimate of duodenal iron absorption inthis patient who was homozygous for the C282Y mutation(data not shown), we determined DMT-1, FP1 and TfR1expression by means of immunohistochemistry and TaqManreal-time PCR. To obtain information on the tissue distributionand expression of the proteins, we performed immunohis-tochemical staining of duodenal biopsy specimens. DMT1,the transmembrane protein, which is centrally involved inabsorption of ferrous iron from the intestinal lumen, wasexpressed at decreased levels at the apical site of enterocytesand recovered significantly during therapy with gluten-freediet (Figures 1A and C). In contrast, TfR1 expression washighly increased at the basolateral site before initiation oftreatment, when the patient was iron deficient. During followup, TfR1 expression drastically decreased in line with regenerationof the epithelium as shown in Figures 1B and D. FP1expression was largely unaltered either in atrophic epitheliumor during regeneration after therapy (immunohistochemistrynot shown).

To quantify these changes in expression during treatmentmRNA levels of DMT1, FP1, and TfR1 were determinedby real-time PCR. DMT1 mRNA expression was minimalwith subtotal atrophy of the duodenal epithelium but waselevated fourfold after therapy. In contrast, TfR1 expressionwas inversly related to body iron stores and fell to one-thirdwith regeneration of the epithelium and restoration of ironuptake (Figure 2). Consistent with our immunohistochemistry,FP1 mRNA was only slightly increased during follow-up.These findings indicate that the inverse regulation of basolateralTfR1 expression which is believed to be a sensor for the body’sneed for iron, was functional in our patient with HH, whereasDMT1 appeared to be differentially regulated in comparisonto other patients with hemochromatosis but no CD.

DISCUSSION

Over 90% of patients with HH are homozygous for the C282Ymutation of the HFE gene, but the majority of patients,

Geier A et al. Celiac disease and hemochromatosis 3325

who have been identified as being homozygous for theC282Y mutation, have no evidence of iron overload. Thebest current estimate of penetrance for C282Y homozygosityis that less than 1% of homozygotes develop frank clinicalhemochromatosis[6]. In contrast, another population basedstudy found a higher prevalence of 50%[11], but these dataare difficult to interpret since clinical findings are not matchedto a control group. Overall population prevalence for clinicalHH and HH-related death appears to be far less thanexpected from C282Y allele frequency and heterozygosityfrequency[12].

Normal HFE protein is expressed in cryptal enterocytesof the small intestine and acts to facilitate the iron-sensingfunction of these cells by a physical association with thetransferrin receptor (TfR1) at a strategic site to influenceTfR1-mediated iron transport[13]. This facilitory effect is lostby C282Y mutant HFE resulting in a ‘relative’ iron deficiencyof enterocytes and an uncoupling of iron uptake regulation[2,14].This uncoupling leads to increased expression of the divalent-metal transporter 1 (DMT1) and ferroprotein 1 (FP1)[2,14,17].

Whereas DMT1 represents a transmembrane transporterin the apical membrane of duodenal enterocytes whichfacilitates iron uptake from the intestinal lumen into theenterocytes. FP1 is involved in basolateral iron export intothe portal circulation[2,14].

Iron transport across the basolateral plasma membraneof villus enterocytes involves intact epithelia with a sufficientamount of basolateral and apical transport proteins[2,14].Atrophy of the duodenal mucosa in chronic inflammatorydisorders of the small bowel such as CD leads to irondeficiency[15]. Our immunohistochemistry data implicate thata marked reduction of basolateral DMT1 in the atrophicintestinal epithelium causes secondary malabsorption of ironand prevents clinical iron overload. A control biopsy takenon gluten-free diet showed resolved duodenal enteropathyparalleled by ferritin levels within the normal range. Restorediron uptake was accompanied with increased expression ofDMT1, which was higher than levels usually present inhealthy controls in both immunohistochemical staining andreal-time PCR. This pattern of transporter expression aftertherapy meets with previous data from patients with HH,which show an increased expression of DMT1[10,16,17]. Incontrast, FP1 expression was not restored during theobservation period but showed a tendency to increase similarto HH patients without CD[10,16,17]. The data clearly demonstratethat the impaired expression of iron transporters in enteropathicmucosa is different from patients with HH and iron overloadand compensates for the uncoupling of iron uptake inhomozygous C282Y HFE mutants. DMT1 down-regulationin patients with both HH and CD may cause even irondeficiency and anemia although the transferrin receptor isstill physiologically regulated by the body’s iron store. Increasedduodenal tissue levels of transferrin receptor expressionduring epithelial atrophy rather favor a selective regulatory

Figure 2 TfR1, FP1 and DMT1 cDNA levels in duodenal biopsy specimens.

Figure 1 Immunohistochemical staining for DMT1 and TfR1 of duodenal biopsyspecimens of the patient taken before (upper panels A and B) and after gluten

free diet (lower panels C and D).

A

C D

B

18

16

14

12

10

8

6

4

2

0

mRN

A leve

l (r

atio

to b

eta

-act

in)

TfR

FP1

DMT1

Subtotal atrophy Regeneration

process leading to DMT1 down-regulation than an unselectiveloss of specialized epithelium. Based on these quantitativedata and the clinical recovery of our patient from irondeficiency on a gluten-free diet, we hypothesize that CDmasks overt HH due to a reversible reduction in the irontransporter DMT1 and therefore could prevent the penetranceof HH.

CD accounts for up to 8.5% of iron deficiency anemiaof unknown etiology, especially when refractory to oralsupplementation[18], and iron deficiency appears to be themost frequent and sometimes only extraintestinal symptomin CD[19]. Recovery from iron deficiency anemia in CD usuallyoccurs between 6 and 12 mo on gluten-free diet alone as aconsequence of normalization of histological alterationson the intestinal mucosa[15]. The prevalence of this diseaseis difficult to ascertain, because many patients have atypicalsymptoms or none at all[20], but it seems more commonthan previously considered and ranges between 0.5% in thegeneral population[21] and 1.6% among patients undergoingendoscopy[22]. CD and hemochromatosis are common HLAdefined conditions with surprisingly high frequencies inpopulations of Northern Europe commonly attributed tosurvival advantages. A genetic association between CD andthe HLA-D locus has emerged and it has been shown thatover 95% of patients express the DQ1*0501 DQ1*0201heterodimer (HLA DQ2)[20,23]. This locus on chromosome6p is in close proximity to the HFE locus[24]. Recently, HFEgene mutations have been found to be common and inlinkage disequilibrium with different HLA alleles in CDpatients compared with controls[25]. A disease specific haplotypethat carries both the C282Y HFE gene mutation and HLADQ2 has been suggested but the origins of the geneticlinkage still remain to be investigated in detail[25]. The HFEgene may have spread due to the protection of heterozygotesagainst iron deficiency[26] and the same might be true forCD which diminishes iron overload. We hypothesize thatthe genetic predisposition for either disease ameliorates themanifestation of the other thereby leading to a markedextent of unidentified disease. Occult CD may preventincreased DMT1 expression in a specific subset of individualswith homozygous C282Y mutations in the HFE gene thuscontributing to the low penetrance of HH.

REFERENCES1 Bacon BR. Hemochromatosis: diagnosis and management.

Gastroenterology 2001; 120: 718-725

2 Philpott CC. Molecular aspects of iron absorption: Insights into

the role of HFE in hemochromatosis. Hepatology 2002; 35: 993-1001

3 Simon M, Bourel M, Fauchet R, Genetet B. Association of HLA-

A3 and HLA-B14 antigens with idiopathic haemochromatosis.

Gut 1976; 17: 332-334

4 Simon M, Bourel M, Genetet B, Fauchet R. Idiopathic

hemochromatosis. Demonstration of recessive transmission

and early detection by family HLA typing. N Engl J Med

1977; 297 : 1017-1021

5 Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA,

Basava A, Dormishian F, Domingo R, Ellis MC, Fullan A,

Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, Lee

VK, Loeb DB, Mapa FA, McClelland E, Meyer NC, Mintier

GA, Moeller N, Moore T, Morikang E, Prass CE, Quintana L,

Starnes SM, Schatzman RC, Brunke KJ, Drayna DT, Risch NJ,

Bacon BR, Wolff RK. A novel MHC class I-like gene is mu-

tated in patients with hereditary haemochromatosis. Nat Genet1996; 13 : 399-408

6 Beutler E, Felitti VJ, Koziol JA, Ho NJ, Gelbart T. Penetranceof 845G--> A (C282Y) HFE hereditary haemochromatosismutation in the USA. Lancet 2002; 359: 211-218

7 Morris WE. Hemochromatosis and celiac sprue. Case report.

J Fla Med Assoc 1993; 80: 243-2458 Heneghan MA, Feeley KM, Stevens FM, Little MP, McCarthy

CF. Precipitation of iron overload and hereditary hemochro-matosis after successful treatment of celiac disease. Am J

Gastroenterol 2000; 95: 298-3009 Turcu A, Leveque L, Bielefeld P, Besancenot JF, Hillon P. Adult

celiac disease and hemochromatosis. Am J Gastroenterol 2000;95 : 3661-3662

1 0 Zoller H, Koch RO, Theurl I, Obrist P, Pietrangelo A, Montosi G,Haile DJ, Vogel W, Weiss G. Expression of the duodenal iron trans-porters divalent-metal transporter 1 and ferroportin 1 in iron defi-ciency and iron overload. Gastroenterology 2001; 120: 1412-1419

1 1 Olynyk JK, Cullen DJ, Aquilia S, Rossi E, Summerville L, PowellLW. A population-based study of the clinical expression of thehemochromatosis gene. N Engl J Med 1999; 341: 718-724

1 2 Jackson HA, Carter K, Darke C, Guttridge MG, Ravine D, Hutton

RD, Napier JA, Worwood M. HFE mutations, iron deficiency andoverload in 10,500 blood donors. Br J Haematol 2001; 114: 474-484

1 3 Parkkila S, Niemela O, Britton RS, Fleming RE, Waheed A,Bacon BR, Sly WS. Molecular aspects of iron absorption and

HFE expression. Gastroenterology 2001; 121: 1489-14961 4 Pietrangelo A. Physiology of iron transport and the hemo-

chromatosis gene. Am J Physiol Gastrointest Liver Physiol 2002;282: G403-G414

1 5 Annibale B, Severi C, Chistolini A, Antonelli G, Lahner E,Marcheggiano A, Iannoni C, Monarca B, Delle Fave G. Efficacyof gluten-free diet alone on recovery from iron deficiency anemiain adult celiac patients. Am J Gastroenterol 2001; 96: 132-137

1 6 Zoller H, Pietrangelo A, Vogel W, Weiss G. Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients withhereditary haemochromatosis. Lancet 1999; 353: 2120-2123

1 7 Rolfs A, Bonkovsky HL, Kohlroser JG, McNeal K, Sharma A,

Berger UV, Hediger MA. Intestinal expression of genes in-volved in iron absorption in humans. Am J Physiol GastrointestLiver Physiol 2002; 282: G598-G607

1 8 Corazza GR, Valentini RA, Andreani ML, D’Anchino M, Leva

MT, Ginaldi L, De Feudis L, Quaglino D, Gasbarrini G. Sub-clinical coeliac disease is a frequent cause of iron-deficiencyanaemia. Scand J Gastroenterol 1995; 30: 153-156

1 9 Fasano A, Catassi C. Current approaches to diagnosis and

treatment of celiac disease: an evolving spectrum. Gastroen-

terology 2001; 120: 636-651

2 0 Farrell RJ, Kelly CP. Celiac sprue. N Engl J Med 2002; 346:

180-188

2 1 Volta U, Bellentani S, Bianchi FB, Brandi G, De Franceschi L, Miglioli

L, Granito A, Balli F, Tiribelli C. High prevalence of celiac disease in

Italian general population. Dig Dis Sci 2001; 46: 1500-1505

2 2 Dickey W. Diagnosis of coeliac disease at open-access endoscopy.

Scand J Gastroenterol 1998; 33: 612-6152 3 Sollid LM, Markussen G, Ek J, Gjerde H, Vartdal F, Thorsby

E. Evidence for a primary association of celiac disease to a

particular HLA-DQ alpha/beta heterodimer. J Exp Med 1989;169: 345-350

2 4 Zhong F, McCombs CC, Olson JM, Elston RC, Stevens FM,

McCarthy CF, Michalski JP. An autosomal screen for genesthat predispose to celiac disease in the western counties of

Ireland. Nat Genet 1996; 14: 329-333

2 5 Butterworth JR, Cooper BT, Rosenberg WM, Purkiss M, JobsonS, Hathaway M, Briggs D, Howell WM, Wood GM, Adams

DH, Iqbal TH. The role of hemochromatosis susceptibility

gene mutations in protecting against iron deficiency in celiacdisease. Gastroenterology 2002; 123: 444-449

2 6 Motulsky AG. Genetics of hemochromatosis. N Engl J Med

1979; 301: 1291



• LETTERS TO THE EDITOR •

Manipulation of enteric flora in ulcerative colitis

Mario Guslandi

EL SEVIER

PO Box 2345, Beijing 100023, China World J Gastroenterol 2005;11(21):3327



Mario Guslandi, Gastroenterology Unit, S.Raffaele UniversityHospital, Milan, ItalyCorrespondence to: Dr. Mario Guslandi, Gastroenterology Unit,S.Raffaele University Hospital, Via Olgettina 60, 20132 Milan, ItalyTelephone: +39-2-26432744 Fax: +239-2-26433491Received: 2004-12-13 Accepted: 2005-01-31


Key words: Manipulation; Enteric flora; Ulcerative colitis

Guslandi M. Manipulation of enteric flora in ulcerative colitis.

World J Gastroenterol 2005; 11(21): 3327


TO THE EDITOR

Reviewing the available therapeutic options in the medicaltreatment of ulcerative colitis, Xu et al[1], have omitted tomention an important aspect in the pharmacologicalmanagement of the disease, namely the possibility topromote clinical and endoscopic improvement by manipulatingthe enteric flora.

Although no specific bacterium has been singled out asinvolved in the pathogenesis of inflammatory bowel disease(IBD), an imbalance between protective and harmfulbacteria (“dysbiosis”), has been postulated as a pro-inflammatory mechanism both in ulcerative colitis and inCrohn’s disease[2]. Indeed the pathogenetic role of bacteriain IBD is now widely recognized[3-5], hence the possibletherapeutic use of either antibiotics or probiotics.

Antibiotics such as metronidazole or ciprofloxacin, and,more recently, the nonabsorbable antibacterial agent rifaximin,have been successfully employed in IBD patients[5]. Althoughmost studies are still uncontrolled, preliminary data are

extremely encouraging. The best results are achieved in themaintenance treatment of Crohn’s disease, in the managementof pouchitis and, in general, of perianal IBD complications,but a role of antibiotics as a supportive treatment also inactive ulcerative colitis can be postulated[5].

Similarly, probiotic agents such as Saccharomyces boulardii[6]

and a nonpathogenetic strain of E.coli[7] have been foundclinically effective respectively in the short- and long-termtreatment of ulcerative colitis, whereas several clinical trialsemploying a probiotic cocktail (VSL # 3) have shown asubstantial benefit in both acute and chronic pouchitis (forreview see Ref. 4).

Studies are in progress to further establish the preciserole of probiotics in IBD therapy and to identify the mosteffective products among the available brands.

At any rate manipulation of enteric flora by means ofeither antibacterial agents or probiotics represents a recognizedtherapeutic measure in ulcerative colitis and should bementioned whenever reviewing this important topic.

REFERENCES1 Xu CT, Meng SY, Pan BR. Drug therapy for ulcerative colitis.

World J Gastroenterol 2004; 10: 2311-23172 Tamboli CP, Neut C, Desreumaux P, Colombel JF. Dysbiosis

in inflammatory bowel disease. Gut 2004; 53: 1-43 Swidsinski A, Ladhoff A, Pernthaler A, Swidsinski S, Loening-

Baucke V, Ortner M, Weber J, Hoffmann U, Schreiber S, DietelM, Lochs H. Mucosal flora in inflammatory bowel disease.Gastroenterology 2002; 122: 44-54

4 Guslandi M. Probiotics for chronic intestinal disorders. Am JGastroenterol 2003; 98: 520-521

5 Guslandi M. Antibiotics for inflammatory bowel disease: dothey work? Eur J Gastroenterol Hepatol 2005; 17: 145-147

6 Guslandi M, Giollo P, Testoni PA. A pilot trial of Saccharo-myces boulardii in ulcerative colitis. Eur J Gastroenterol Hepatol2003; 15 : 697-698

7 Kruis W, Fric P, Pokrotnieks J, Lukás M, Fixa B, Kascák M,Kamm MA, Weismueller J, Beglinger C, Stolte M, Wolff C,Schulze J. Maintaining remission of ulcerative colitis with theprobiotic Escherichia coli Nissle 1917 is as effective as with

standard mesalazine. Gut 2004; 53 : 1617-1623

Science Editor Guo SY


A diagnostic approach to abdominal tuberculosis

Eser Vardareli, Baybora Kircali

EL SEVIER




Eser Vardareli, Baybora Kircali, Osmangazi University MedicalFaculty Department of Gastroenterology Meselik EskisehirCorrespondence to: Baybora Kircali, Osmangazi UniversityMedical Faculty Department of GastroenterologyMeselik Eskisehir. [email protected]

Received: 2004-12-21 Accepted: 2005-01-25


Key words: Abdominal tuberculosis

Vardareli E, Kircali B. A diagnostic approach to abdominaltuberculosis. World J Gastroenterol 2005; 11(21): 3328


TO THE EDITOR

We read with interest the article by Uzunkoy et al[1]. aboutdiagnosis of abdominal tuberculosis. In this article authorsconcluded that PCR for mycobacterium tuberculosiscomplex is a noninvasive method which can provide thediagnosis in most cases. If this tests negative or not feasible,laparotomy should be performed.

Previously, we analyzed and reported the diagnosticapproach to peritoneal tuberculosis of our clinic[2]. In thispaper, diagnosis of the peritoneal tuberculosis was made

by image-guided percutanous biopsy (IGPB) in 18/19 ofpatients. Laparoscopic biopsy was needed only 1/19 patient.Laparoscopic biopsy allows better inspection as well asdirected biopsies from peritoneum. However, it requireshospitalization, and has some complications. Therefore,IGPB seems to be an effective, safe and inexpensive methodto provide diagnosis of peritoneal tuberculosis. In editorialof this article, Dhiman stated that IGPB is less invasive ascompared to laparoscopy, does not requires generalanesthesia and can be performed even at bedside. Analgorithmic approach was suggested by doing IGPB orimage-guided biopsy from associated lessions first, and ifthe results are inconclusive then laparoscopic biopsy maybe the next step[3].

In conclusion, mycobacterial culture requires 8 wk tomake diagnosis this delay can give way to an increasedmortality rate. If PCR for mycobacterium tuberculosis isnot diagnostic or not feasible, IGPB should be performed.

REFERENCES1 Uzunkoy A, Harma M, Harma M. Diagnosis of abdominal

tuberculosis: experience from 11 cases and review of the

literature. World J Gastroenterol 2004; 10: 3647-36492 Vardareli E, Kebapci M, Saricam T, Pasaoglu O, Acikalin M.

Tuberculous peritonitis of the wet ascitic type: clinical fea-

tures and diagnostic value of image-guided peritoneal biopsy.

Dig Liver Dis 2004; 36: 199-204

3 Dhiman RK. Tuberculous peritonitis: towards a positive

diagnosis. Dig Liver Dis 2004; 36: 175-177



Endoscopic biopsy: Duodenal ulcer penetrating into liver

Baybora Kircali, Tülay Saricam, Aysegul Ozakyol, Eser Vardareli

EL SEVIER




Baybora Kircali, Tülay Saricam, Aysegul Ozakyol, Eser Vardareli,Medical Faculty, Osamangazi University, Fakultesi 26100, TurkeyCorrespondence to: Baybora Kircali, Medical Faculty, OsamangaziUniversity, Fakultesi 26100, Turkey. [email protected]: +90-2222291394Received: 2004-08-27 Accepted: 2004-12-01


Key words: Endoscopic biopsy; Duodenal ulcer

Kircali B, Saricam T, Ozakyol A, Vardareli E. Endoscopic biopsy:Duodenal ulcer penetrating into liver. World J Gastroenterol2005; 11(21): 3329


TO THE EDITOR

We have read with interest the recent report by E Kayacetinand S Kayacetin of ‘’Gastric ulcer penetrating to liverdiagnosed by endoscopic biopsy[1] since we diagnosed theduodenal ulcer which penetrated into liver similarly. This isa rather unusual case because of the fifth case in theliterature and responding to medical therapy.

Eighty-five-year-old female was admitted with 1-mohistory of periumblical pain, weight loss, 1-wk vomittingprovoked with food and no history of GI bleeding. Onphysical examination, there was periumblical tenderness.

Laboratory evaluation showed Hb: 11.5 gr/dL, WBC:11 000/mm3 MCV: 92 fl, Plt: 415 000/mm3, normal liverchemistries, and tumor markers. Grade IV esophagitis anddiscolerated atypical giant ulcer that stemmed from anteriorwall of bulbus duodeni were detected in gastroduodenoscopy.However, it could not be passed through the second partof duodenum due to the presence of edema. Endoscopicbiopsy of the ulcer revealed muscular layer without mucosaand exudate on the surface of the liver fragments and macro-microvesicular degeneration, pseudoaciner transformationand perisinusoidal fibrosis in the liver tissue. Furthermore,CT showed fibrofatty on the level of hepatic flexura adjacentto bulbus in the liver (Figure 1).

After 10-d decompression of stomach and intravenous

PPI treatment, diminished edema was seen and was easilypassed through the second part of the duodenum in thesecond EGD.

To summarize, in significant part of the patients withabdominal pain without bleeding, penetration peptic ulcerinto the liver is diagnosed falsely negative. For this reason,suspicion criteria of penetration of peptic ulcer into theliver should be reviewed and also be developed reliable,cheep diagnostic methods.

Figure 1 A: CT demonstrates fibrofatty in the liver next to liver; B: Endoscopicbiopsy material shows deep ulceration of mucosa of duodenum and attachingliver tissue (hematoxylin-eosin ×200).

REFERENCES1 Kayacetin E, Kayacetin S. Gastric ulcer penetrating to liver

diagnosed by endoscopic biopsy. World J Gastroenterol 2004;

10 : 1838-1840


A

B

• ACKNOWLEDGEMENTS •

Acknowledgements to Reviewers of World Journal of

Gastroenterology

ELSEVIER




Many reviewers have contributed their expertise and timeto the peer review, a critical process to ensure the qualityof World Journal of Gastroenterology. The editors andauthors of the articles submitted to the journal are gratefulto the following reviewers for evaluating the articles(including those were published and those were rejectedin this issue) during the last editing period of time.

Pelayo Correa, Boyd ProfessorDepartment of Pathology, Louisiana State University Health ScienceCenter, 1901 Perdido St., New Orleans La 70112, United States

Chi-Hin Cho, Chair and ProfessorDepartmentof Pharmacology, The University of Hong Kong,21 Sassoon Road, Hong Kong, China

Zong-Jie Cui, ProfessorInstitute of Cell Biology, Beijing Normal University, Beijing100875, China

Da-Jun Deng, ProfessorDepartment of Cancer Etiology, Peking University School ofOncology, 1 Da-Hong-Luo-Chang Street, Western District,Beijing 100034, China

Sunao Kawano, ProfessorDepartment of Clinical Laboratory Science, School of AlliedHealth Sciences, Faculty of MedicineOsaka University, Yamada-oka 1-7, Osaka 565-0871, Japan

Joseph B Kirsner, M.D.Department of Medicine/GI, Univ. of Chicago Hospitals &Clinics, University of Chicago Hosp. & Clinics, 5841 S. MarylandAve., Mail Code 2100. Chicago IL 60637-1470, United States

Burton I Korelitz, M.D.Department of Gastroenterology, Lenox Hill Hospital, 100 East77th Street, 3 Achelis, New York, N.Y 10032, United States

Rene Lambert, ProfessorInternational Agency for Research on Cancer, 150 Cours AlbertThomas, Lyon 69372 cedex 8, France

Gary R Lichtenstein, ProfessorDepartment of Gastroenterology and Internal Medicine, Hospitalof the University of Pennsylvania, University of PennsylvaniaSchool of Medicine, 3rd Floor -Ravdin Building, GI Division,3400 Spruce Street, Philadelphia, Pennsylvania 19104-4283,United States

You-Yong Lu, ProfessorBeijing Molecular Oncology Laboratory, Peking University School

of Oncology and Beijing Institute for Cancer Reaearch, #1, Da-Hong-Luo-Chang Street, Western District, Beijing 100034, China

Tilman Sauerbruch, M.D.Department of Internal Medicine I, University of Bonn,Sigmund-Freud-Strasse 25, 53105 Bonn, Germany

Qin Su, ProfessorDepartment of Pathology, Cancer Hospital and Cancer Institute,Chinese Academy of Medical Sciences and Peking Medical College,PO Box 2258, Beijing 100021, China

Hidekazu Suzuki, Assistant ProfessorDepartment of Internal Medicine, Keio University School ofMedicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan

Shinji Tanaka, DirectorDepartment of Endoscopy, Hiroshima University Hospital, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan

George Triadafilopoulos, ProfessorDivision of Gastroenterology and Hepatology,Alway Building,Room M 211, 300 Pasteur Drive, MC: 5187, Stanford, CA 94305-5187, United States

Ian David Wallace, M.D.,Gastroenterologist , President, New Zealand Society ofGastroenterology, School of Medicine Auckland University;Department Gastroenterology North Shore Hospital; ShakespeareSpecialist Group, 181 Shakespeare Rd Milford, Auckland,New Zealand

George Y Wu, ProfessorDepartment of Medicine, Division of Gastroenterology-Hepatology University of Connecticut Health Center, 263Farmington Ave, Farmington, CT 06030, United States

Ming-Shiang Wu, Associate ProfessorDepartment of Internal Medicine, National Taiwan UniversityHospital, No 7,Chung-Shan S. Rd., Taipei 100, Taiwan, China

Harry H-X Xia, M.D.Department of Medicine, The University of Hong Kong,Pokfulam Road, Hong Kong, China

Yuan Yuan, ProfessorCancer Institute of China Medical University, 155 North NanjingStreet, Heping District, Shenyang 110001, Liaoning Province, China

Jian-Zhong Zhang, ProfessorDepartment of Pathology and Laboratory Medicine, Beijing 306Hospital, 9 North Anxiang Road, PO Box 9720, Beijing 100101,China

ELSEVIER

PO Box 2345, Beijing 100023, China World J Gastroenterol 2005;11(21):Appendix 1



www.bsg.org.uk

Birmingham

Digestive Disease Week DDW 106th

Annual Meeting

May 15–18, 2005

www.ddw.org

Chicago, Illinois

70th ACG Annual Scientific Meeting

and Postgraduate Course

October 28-November 2, 2005

Honolulu Convention Center, Honolulu,

Hawaii

Events and Meetings in 2006

EASL 2006 - THE 41ST ANNUAL

MEETING

April 26–30, 2006

Vienna, Austria

Canadia n Digestive Disea se Week

Conference

March 4–12, 2006

www.cag-acg.org

Quebec City

XXX pan-american congress of digestive

diseases XXX congreso panamericano de

anfermedades digestivas

November 25-December 1, 2006

www.gastro.org.mx

Cancun

World Congress on Gastrointestinal

Cancer

June 14–17, 2006

Barcelona, Spain

7th World Congress of the International

Hepato-Pancreato-Biliary Association

September 3–7, 2006

www.edinburgh.org/conference

Edinburgh

71st ACG Annual Scientific Meeting

and Postgraduate Course

October 20–25, 2006

Venetian Hotel, Las Vegas, Neveda

Meetings

Major meetings coming up

Digestive Disease Week

106th Annual Meeting of AGA, The

American Gastroenterology Association

May 14-19, 2005

www.ddw.org/

Chicago, Illinois

13th World Congress of Gastroenterology

September 10-14, 2005

www.wcog2005.org/

Montreal, Canada

13th United European Gastroenterology

Week, UEGW

October 15-20, 2005

www.uegf.org/

Copenhagen, Denmark

American College of Gastroenterology

Annual Scientific Meeting

October 28-November 2, 2005

www.acg.gi.org/

Honolulu Convention Center, Honolulu,

Hawaii

Events and Meetings in the upcoming6 monthsWorld Congress on Gastrointestinal

Cancer

June 15–18, 2005

Barcelona

Events and meetings in 2005

Ca nadian Diges tive Diseas e We ek

Conference

February 26-March 6, 2005

www.cag-acg.org

Banff, AB

2005 World Congress of Gastroenterology


Montreal, Canada

I n te r n a t io na l C olo r e c t a l D is e a s e

Symposium 2005

February 3–5, 2005

Hong Kong

13th UEGW meeting United European

Gastroenterology Week

October 15–20, 2005

www.webasistent.cz/guarant/uegw2005/

Copenhagen-Malmoe

7th International Workshop on Thera-

peutic Endoscopy


www.alfamedical.com

Theodor Bilharz Research Institute

EASL 2005 the 40th annual meeting

April 13–17, 2005

www.easl.ch/easl2005/

Paris, France

Pediatric Gastroenterology, Hepatology

and Nutrition

March 13, 2005

Jakarta, Indonesia

21st annual international congress of

Pakistan society of Gastroenterology &

GI Endoscopy

March 25–27, 2005

www.psgc2005.com

Peshawar

8th Congress of the Asian Society of

HepatoBiliary Pancreatic Surgery

February 10–13, 2005

Mandaluyong, Philippines

APDW 2005 - Asia Pacific Digestive

Week 2005


www.apdw2005.org

Seoul, Korea

World Congress on Gastrointestinal Cancer

June 15–18, 2005

Barcelona

British Society of Gastroenterology

Conference (BSG)

March 14–17, 2005

www.wjgnet.com

Instructions to authors

GENERAL INFORMATIONWorld Journal of Gastroenterology (WJG, ISSN 1007-9327 CN 14-1219/R)is a weekly journal of more than 48 000 circulation, published on the7th, 14th, 21st and 28th of every month.

Original Research, Clinical Trials, Reviews, Comments, and CaseReports in esophageal cancer, gastric cancer, colon cancer, liver cancer,viral liver diseases, etc., from all over the world are welcome on thecondition that they have not been published previously and have notbeen submitted simultaneously elsewhere.

Published jointly byThe WJG Press and Elsevier Inc.

SUBMISSION OF MANUSCRIPTSManuscripts should be typed double-spaced on A4 (297×210 mm)white paper with outer margins of 2.5 cm. Number all pagesconsecutively, and start each of the following sections on a new page:Title Page , Abstract, Introduction, Materials and Methods, Results,Discussion, Acknowledgements, References, Tables, Figures and FigureLegends. Neither the Editors nor the Publisher is responsible for theopinions expressed by contributors. Manuscripts formally acceptedfor publication become the permanent property of The WJG Pressand Elsevier Inc., and may not be reproduced by any means, in wholeor in part without the written permission of both the Authors and thePublisher. We reserve the right to put onto our website and copy-editaccepted manuscripts. Authors should also follow the guidelines forthe care and use of laboratory animals of their institution or nationalanimal welfare committee.

Authors should retain one copy of the text, tables, photographsand illustrations, as rejected manuscripts will not be returned to theauthor(s) and the editors will not be responsible for the loss or damageto photographs and illustrations.

Online submissionOnline submission is strongly advised. Manuscripts should be submittedthrough the Online Submission System at: http://www.wjgnet.com/index.jsp. Authors are highly recommended to consult the ONLINEINSTRUCTIONS TO AUTHORS (http://www.wjgnet.com/wjg/help/instructions.jsp) before attempting to submit online. Authorsencountering problems with the Online Submission System may send anemail describing the problem to [email protected] for assistance. If yousubmit manuscript online, do not make a postal contribution. A repeatedonline submission for the same manuscript is strictly prohibited.

Postal submissionSend 3 duplicate hard copies of the full-text manuscript typed double-spaced on A4(297×210 mm) white paper together with any originalphotographs or illustrations and a 3.5 inch computer diskette or CD-ROMcontaining an electronic copy of the manuscript including all the figures,graphs and tables in native Microsoft Word format or *.rtf format to:

World Journal of GastroenterologyApartment 1066 Yishou Garden,58 North Langxinzhuang Road,PO Box 2345, Beijing 100023, ChinaE-mail: [email protected]: //www.wjgnet.com

MANUSCRIPT PREPARATIONAll contributions should be written in English. All articles must besubmitted using a word-processing software. All submissions must betyped in 1.5 line spacing and in word size 12 with ample margins. Theletter font is Tahoma. For authors originating from China, one copy ofthe Chinese translation of the manuscript is also required (excludingreferences). Style should conform to our house format. Requiredinformation for each of the manuscript sections is as follows:

Title pageFull manuscript title, running title, all author(s) name(s), affiliations,institution(s) and/or department(s) where the work was accomplished,disclosure of any financial support for the research, and the name, fulladdress, telephone and fax numbers and email address of thecorresponding author should be involved. Titles should be concise andinformative (removing all unnecessary words), emphasize what is NEW,and avoid abbreviations. A short running title of less than 40 lettersshould be provided. List the author(s)’ name(s) as follows: initialsand/or first name, middle name or initial(s) and full family name.

AbstractAn informative, structured abstract of no more than 250 words shouldaccompany each manuscript. Abstracts for original contributions should bestructured into the following sections: AIM: Only the purpose should beincluded. METHODS: The materials, techniques, instruments andequipments, and the experimental procedures should be included. RESULTS:The observatory and experimental results, including data, effects,outcome, etc. should be included. Authors should present P value wherenecessary, and the significant data should accompany. CONCLUSION:Accurate view and the value of the results should be included.

The format of structured abstracts is at: http://www.wjgnet.com/wjg/help/11.doc

Key wordsPlease list 3-10 key words that could reflect content of the study.

TextFor most article types, the main text should be structured into thefollowing section s: INTRODUCTION, MATERIALS ANDMETHODS, RESULTS and DISCUSSION, and should includeappropriate Figures and Tables. Data should be presented in the bodytext or Figures and Tables, not both.

IllustrationsFigures should be numbered as 1, 2, 3 and so on, and mentioned clearlyin the main text. Provide a brief title for each figure on a separate page.No detailed legend should be involved under the figures. This partshould add into the text where the figures are applicable. Digital images:black and white photographs should be scanned and saved in TIFFformat at a resolution of 300 dpi; color images should be saved asCMYK (print files) and not RGB (screen-viewing files). Place eachphotograph in a separate file. Print images: supply images of size nosmaller than 126×76 mm printed on smooth surface paper; label theimage by writing the Figure number and orientation using an arrow.Photomicrographs: indicate the original magnification and stain in thelegend. Digital Drawings: supply files in EPS if created by Freehandand Illustrator, or TIFF from Photoshop. EPS files must beaccompanied by a version in native file format for editing purposes.Scans of existing line drawings should be scanned at a resolution of1200 dpi and as close as possible to the size at which they will appearwhen printed, not smaller. Please use uniform legends for the samesubjects. For example: Figure 1 Pathological changes of atrophicgastritis after treatment. A: ...; B: ...;C: ...; D: ...; E: ...; F: ...; G: ...

TablesThree-line tables should be numbered as 1, 2, 3 and so on, and mentionedclearly in the main text. Provide a brief title for each table. No detailedlegend should be involved under the tables. This part should add into thetext where the tables are applicable. The information should complementbut not duplicate that contained in the text. Use one horizontal lineunder the title, a second under the column heads, and a third below theTable, above any footnotes. Vertical and italic lines should be omitted.

Notes in tables and illustrationsData which is not statistically significant should not be noted. aP<0.05,bP<0.01 (P>0.05 should not be noted). If there are other series ofP values, cP<0.05 and dP<0.01 are used; Third series of P values can beexpressed as eP<0.05 and fP<0.01. Other notes in tables or under

EL SEVIER

PO Box 2345, Beijing 100023, China World J Gastroenterol 2005;11(21):Appendix 2-3



illustrations should be expressed as 1F, 2F, 3F; or some other symbolswith a superscript (Arabic numerals) in the upper left corner. In amulti-curve illustration, each curve should be labeled with ●, ○, ■,□, ▲, △, etc. in a certain sequence.

AcknowledgmentsBrief acknowledgments of persons who have made genuine contributionsto the manuscripts and who endorse the data and conclusions areincluded. Authors are responsible for obtaining written permission touse any copyrighted text and/or illustrations.

ReferencesCited references should mainly be drawn from journals covered in theScience Citation Index (http://www.isinet.com) and/or Index Medicus(http://www.ncbi.nlm.nih.gov/PubMed) databases. Mention allreferences in the text, tables and figure legends, and set off by consecutive,superscripted Arabic numerals. References should be numberedconsecutively in the order in which they appear in the text. Abbreviatejournal title names according to the Index Medicus style (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=journals). Unpublishedobservations and personal communications are not listed as references.The style and punctuation of the references conform to ISO standardand the Vancouver style (5th edition); see examples below. Referencelists not conforming to this style could lead to delayed or even rejectedpublication status. Examples:

Standard jounal article (list all authors and include the PubMed ID[PMID] where applicable)1 Das KM, Farag SA. Current medical therapy of inflammatory bowel

disease. World J Gastroenterol 2000; 6: 483-489 [PMID: 11819634]2 Pan BR, Hodgson HJF, Kalsi J. Hyperglobulinemia in chronic liver

disease: Relationships between in vitro immunoglobulin synthesis,short lived suppressor cell activity and serum immunoglobulinlevels. Clin Exp Immunol 1984; 55: 546-551 [PMID: 6231144]

3 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic effect ofJianpi Yishen decoction in treatment of Pixu-diarrhoea. Shijie HuarenXiaohua Zazhi 1999; 7: 285-287 [CMFAID:1082371101835979]

Books and other monographs (list all authors)4 Sherlock S, Dooley J. Diseases of the liver and billiary system. 9th

ed. Oxford: Blackwell Sci Pub, 1993: 258-296

Chapter in a book (list all authors)5 Lam SK. Academic investigator’s perspectives of medical treatment

for peptic ulcer. In: Swabb EA, Azabo S. Ulcer disease: investigationand basis for therapy. New York: Marcel Dekker, 1991: 431-450

Electronic journal (list all authors)6 Morse SS. Factors in the emergence of infectious diseases. Emerg

Infect Dis serial online, 1995-01-03, cited 1996-06-05; 1(1):24 screens.Available from: URL: http//www.cdc.gov/ncidod/EID/eid.htm

PMID requirementFrom the full reference list, please submit a separate list of thosereferences embodied in PubMed, keeping the same order as in the fullreference list, with the following information only: (1) abbreviatedjournal name and citation (e.g. World J Gastroenterol 2003;9(11):2400-2403; (2) article title (e.g. Epidemiology of gastroenterologiccancer in Henan Province, China; (3) full author list (e.g. Lu JB, SunXB, Dai DX, Zhu SK, Chang QL, Liu SZ, Duan WJ; (4) PMID (e.g.14606064). Provide the full abstracts of these references, as quotedfrom PubMed on a 3.5 inch disk or CD-ROM in Microsoft Wordformat and send by post to The WJG Press. For those references takenfrom journals not indexed by Index Medicus, a printed copy of the firstpage of the full reference should be submitted. Attach these referencesto the end of the manuscript in their order of appearance in the text.

Inappropriate referencesAuthors should always cite references that are relevant to their article,and avoid any inappropriate references. Inappropriate references includethose that are linked with a hyphen and the difference between the twonumbers at two sides of the hyphen is more than 5. For example, [1-6],[2-14] and [1,3,4-10,22] are all considered as inappropriate references.Authors should not cite their own unrelated published articles.

Statistical dataPresent as mean±SD and mean±SE.

Statistical expressionExpress t test as t(in italics), F test as F(in italics), chi square test as 2

(in Greek), related coefficient as r(in italics), degree of freedom as (inGreek), sample number as n(in italics), and probability as P(in italics).

UnitsUse SI units. For example: body mass, m(B) = 78 kg; blood pressure, p(B)=16.2/12.3 kPa; incubation time, t(incubation)=96 h, blood glucoseconcentration, c(glucose) 6.4±2.1 mmol/L; blood CEA massconcentration, p(CEA) = 8.6 24.5 µg/L; CO2 volume fraction, 50 mL/LCO2 not 5% CO2; likewise for 40 g/L formaldehyde, not 10% formalin;and mass fraction, 8 ng/g, etc. Arabic numerals such as 23,243,641should be read 23 243 641.

The format about how to accurately write common units andquantum is at: http://www.wjgnet.com/wjg/help/15.doc

AbbreviationsStandard abbreviations should be defined in the abstract and on firstmention in the text. In general, terms should not be abbreviated unlessthey are used repeatedly and the abbreviation is helpful to the reader.Permissible abbreviations are listed in Units, Symbols and Abbreviations:A Guide for Biological and Medical Editors and Authors (Ed. Baron DN,1988) published by The Royal Society of Medicine, London. Certaincommonly used abbreviations, such as DNA, RNA, HIV, LD50, PCR,HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS, ATP, EDTA,mAb, can be used directly without further mention.

ItalicizationQuantities: t time or temperature, c concentration, A area, l length,m mass, V volume.Genotypes: gyrA, arg 1, c myc, c fos, etc.Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc.Biology: Helicobacter pylori, H pylori, E coli, etc.

SUBMISSION OF THE REVISED MANUSCRIPTS AFTERACCEPTEDPlease revise your article according to the revision policies of WJG.The revised version including manuscript and high-resolution imagefigures (if any) should be copied on a floppy or compact disk. Authorshould send the revised manuscript, along with printed high-resolutioncolor or black and white photos, copyright transfer letter, the finalcheck list for authors, and responses to reviewers by a courier (such asEMS) (submission of revised manuscript by e-mail or on the WJGEditorial Office Online System is NOT available at present).

Language evaluationThe language of a manuscript will be graded before sending for revision.(1) Grade A: priority publishing; (2) Grade B: minor language polishing;(3) Grade C: a great deal of language polishing; (4) Grade D: rejected.The revised articles should be in grade B or grade A.

Copyright assignment formIt is the policy of WJG to acquire copyright in all contributions. Papersaccepted for publication become the copyright of WJG and authors willbe asked to sign a transfer of copyright form. All authors must read andagree to the conditions outlined in the Copyright Assignment Form(which can be downloaded from http://www.wjgnet.com/wjg/help/9.doc).

Final check list for authorsThe format is at: http://www.wjgnet.com/wjg/help/13.doc

Responses to reviewersPlease revise your article according to the comments/suggestions ofreviewers. The format for responses to the reviewers’ comments is at:http://www.wjgnet.com/wjg/help/10.doc

Proof of financial supportFor paper supported by a foundation, authors should provide a copy ofthe document and serial number of the foundation.

Publication feeAuthors of accepted articles must pay publication fee.


World Journal of Gastroenterology standard of quantities and units

Number Nonstandard Standard Notice

1 4 days 4 d In figures, tables and numerical narration 2 4 days four days In text narration 3 day d After Arabic numerals 4 Four d Four days At the beginning of a sentence 5 2 hours 2 h After Arabic numerals 6 2 hs 2 h After Arabic numerals 7 hr, hrs, h After Arabic numerals 8 10 seconds 10 s After Arabic numerals 9 10 year 10 years In text narration10 Ten yr Ten years At the beginning of a sentence11 0,1,2 years 0,1,2 yr In figures and tables12 0,1,2 year 0,1,2 yr In figures and tables13 4 weeks 4 wk14 Four wk Four weeks At the beginning of a sentence15 2 months 2 mo In figures and tables16 Two mo Two months At the beginning of a sentence17 10 minutes 10 min18 Ten min Ten minutes At the beginning of a sentence19 50% (V/V) 500 mL/L20 50% (m/V) 500 g/L21 1 M 1 mol/L22 10 M 10 mol/L23 1N HCl 1 mol/L HCl24 1N H2SO4 0.5 mol/L H2SO4

25 4rd edition 4th edition26 15 year experience 15- year experience27 18.5 kDa 18.5 ku,18 500u or Mr18 50028 25 g.kg-1/d-1 25 g/(kg·d) or 25 g/kg per day29 6900 6 90030 1000 rpm 1 000 r/min31 sec s After Arabic numerals32 1 pg·L-1 1 pg/L33 10 kilograms 10 kg34 13 000 rpm 13 000 g High speed; g should be in italic and suitable conversion.35 1000 g 1 000 r/min Low speed. g cannot be used.36 Gene bank GenBank International classified genetic materials collection bank37 Ten L Ten liters At the beginning of a sentence38 Ten mL Ten milliliters At the beginning of a sentence39 umol mol40 30 sec 30 s41 1 g/dl 10 g/L 10-fold conversion42 OD260 A260 “OD” has been abandoned.43 One g/L One microgram per liter At the beginning of a sentence44 A260 nm A260 nm A should be in italic.

bP<0.05 aP<0.05 In Table, no note is needed if there is no significance in statistics: aP<0.05, bP<0.01(no note if P>0.05). If there is a second set of P value in the same table, cP<0.05 anddP<0.01 are used for a third set: eP<0.05, fP<0.01.

45 *F=9.87, §F=25.9, 1F=9.87,2F=25.9, Notices in or under a table#F=67.4 3F=67.4

46 KM km kilometer47 CM cm centimeter48 MM mm millimeter49 Kg, KG kg kilogram50 Gm, gr g gram51 nt N newton52 l L liter53 db dB decibel54 rpm r/min rotation per minute55 bq Bq becquerel, a unit symbol56 amp A ampere57 coul C coulomb58 HZ Hz59 w W watt60 KPa kPa kilo-pascal61 p Pa pascal62 ev EV volt (electronic unit)63 Jonle J joule64 J/mmol kJ/mol kilojoule per mole65 10×10×10cm3 10 cm×10 cm×10 cm66 N·km KN·m moment67 x±s mean±SD In figures, tables or text narration68 Mean±SEM mean±SE In figures, tables or text narration69 im im intramuscular injection70 iv iv intravenous injection71 Wang et al Wang et al.72 EcoRI EcoRI Eco in italic and RI in positive. Restriction endonuclease has its prescript form of writing.73 Ecoli E.coli Bacteria and other biologic terms have their specific expression.74 Hp H pylori75 Iga Iga writing form of genes76 igA IgA writing form of proteins77 -70 kDa ~70 ku

ELSEVIER

PO Box 2345, Beijing 100023, China World J Gastroenterol 2005;11(21):Appendix 4



Gastroenterology® - BPG Management System

Documents

Transcript of Gastroenterology® - BPG Management System