10.1101/gad.1615208Access the most recent version at doi: 2008 22: 26-36Genes Dev.

 David M. Tyler, Katsutomo Okamura, Wei-Jen Chung, et al. transcription and processing of microRNA lociFunctionally distinct regulatory RNAs generated by bidirectional  

MaterialSupplemental http://genesdev.cshlp.org/content/suppl/2008/01/08/22.1.26.DC1.html

References

http://genesdev.cshlp.org/content/22/1/26.full.html#related-urlsArticle cited in:  

http://genesdev.cshlp.org/content/22/1/26.full.html#ref-list-1This article cites 32 articles, 13 of which can be accessed free at:

serviceEmail alerting

click heretop right corner of the article orReceive free email alerts when new articles cite this article - sign up in the box at the

http://genesdev.cshlp.org/subscriptions go to: Genes & DevelopmentTo subscribe to

Copyright © 2008, Cold Spring Harbor Laboratory Press

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

Functionally distinct regulatory RNAsgenerated by bidirectional transcriptionand processing of microRNA lociDavid M. Tyler,1 Katsutomo Okamura,1 Wei-Jen Chung,1 Joshua W. Hagen,1 Eugene Berezikov,2

Gregory J. Hannon,3 and Eric C. Lai1,4

1Department of Developmental Biology, Sloan-Kettering Institute, New York, New York 10021, USA; 2Hubrecht Institute,Utrecht 3584 CT, The Netherlands; 3Watson School of Biological Sciences and Howard Hughes Medical Institute, ColdSpring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA

Many microRNA (miRNA) loci exhibit compelling hairpin structures on both sense and antisense strands;however, the possibility that a miRNA gene might produce functional species from its antisense strand hasnot been examined. We report here that antisense transcription of the Hox miRNA locus mir-iab-4 generatesthe novel pre-miRNA hairpin mir-iab-8, which is then processed into endogenous mature miRNAs. Sense andantisense iab-4/iab-8 miRNAs are functionally distinguished by their distinct domains of expression andtargeting capabilities. We find that miR-iab-8-5p, like miR-iab-4-5p, is also relevant to Hox gene regulation.Ectopic mir-iab-8 can strongly repress the Hox genes Ultrabithorax and abdominal-A via extensive arrays ofconserved target sites, and can induce a dramatic homeotic transformation of halteres into wings. Wegeneralize the antisense miRNA principle by showing that several other loci in both invertebrates andvertebrates are endogenously processed on their antisense strands into mature miRNAs with distinct seeds.These findings demonstrate that antisense transcription and processing contributes to the functionaldiversification of miRNA genes.

[Keywords: BX-C; antisense; homeotic gene; microRNA]

Supplemental material is available at http://www.genesdev.org.

Received September 13, 2007; revised version accepted November 6, 2007.

Nearly 100 years of genetic, molecular, and biochemicalstudies of the Drosophila bithorax complex (BX-C) haverevealed myriad insights into fundamental mechanismsof gene regulation, molecular evolution, and develop-mental patterning (Maeda and Karch 2006). Its mostwell-studied residents are the homeobox genes Ultrabi-thorax (Ubx), abdominal-A (abd-A), and Abdominal-B(Abd-B) (Fig. 1A), which are responsible for the specifi-cation of thoracic and abdominal segments. These genesencode some of the founding members of the Hox fam-ily, which are highly conserved regulators of anterior–posterior axis development in all animals.

Despite its long history of study, fundamental aspectsof the BX-C remain poorly understood. Prime amongthese regards the role of noncoding RNAs (ncRNAs),some of which were discovered >20 years ago (Lipshitz etal. 1987). As with the homeobox genes, BX-C ncRNAsare expressed in spatially discrete domains along the an-terior–posterior axis that suggest their participation indevelopmental regulation. One of these is encoded by

iab-4, which is located between abd-A and Abd-B (Fig.1A). Originally recognized by Cumberledge (Cum-berledge et al. 1990), who cloned its spliced and polyade-nylated messages, iab-4 was later recognized by theTuschl group as a likely primary-miRNA (pri-miRNA)transcript that generates the mir-iab-4 hairpin and ma-ture ∼22-nucleotide (nt) RNAs, termed miR-iab-4-5p andmiR-iab-4-3p (Aravin et al. 2003). miRNAs comprise anextensive class of regulatory RNAs that are inferred tohave profound influence on the activity of thousands oftranscripts (Lai 2003). However, the in vivo activitiesand phenotypically relevant targets of few miRNAs arecurrently known.

We recently demonstrated that ectopic mir-iab-4 di-rectly represses Ubx and induces a partial Ubx loss-of-function phenotype, namely the transformation of hal-tere toward wing identity (Ronshaugen et al. 2005). Wealso extended the previous finding that both sense andantisense strands of the iab-4 region are transcriptionallyactive in temporally and spatially distinct domains (Baeet al. 2002; Drewell et al. 2002; Ronshaugen et al. 2005).Specifically, transcription of the antisense strand ini-tiates later and more posteriorly relative to iab-4 (Fig.1C–F). Since the sequence antisense to mir-iab-4 is also

4Corresponding author.E-MAIL laie@mskcc.org; FAX (212) 717-5604.Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.1615208.

26 GENES & DEVELOPMENT 22:26–36 © 2008 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/08; www.genesdev.org

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

predicted to adopt an extended hairpin (Fig. 1B), we hy-pothesized that the antisense iab-4 transcript might in-dependently produce miRNAs whose activity might berelevant to Hox gene regulation.

In this study, we demonstrate that the antisensestrand of iab-4 produces the novel miRNA precursormir-iab-8, which in turn, generates functional miRNAswhose regulatory activity is distinct from that of theirsense counterparts. In particular, while ectopic miR-iab-4-5p weakly represses Ultrabithorax and has no effect onabdominal-A, ectopic miR-iab-8-5p could potently si-lence Ultrabithorax and abdominal-A. This is true ofboth sensor transgenes and the endogenous gene prod-ucts. Thus, sense and antisense miRNAs generated fromthe iab-4 locus have overlapping and distinct activitieswith respect to BX-C gene regulation. Accompanyingstudies corroborate our findings regarding the regulatoryactivity of antisense iab-4 miRNAs, and demonstratetheir endogenous requirement for Ubx regulation andnormal development (Bender 2008; Stark et al. 2008). We

then generalize this principle by showing that Dro-sophila mir-307 and mammalian mir-338 are endog-enously processed on their antisense strands into maturemiRNAs, whose seeds differ from their sense counter-parts. Therefore, antisense transcription and processingcontributes to the functional diversification of animalmiRNA genes.

Results

Both strands of the mir-iab-4 hairpin are processedin vivo into mature miRNAs

Although both sense and antisense strands of the mir-iab-4 locus are transcriptionally active in Drosophilaembryos, this fact alone does not imply the existence ofantisense iab-4 miRNAs. We anticipated that the detec-tion of such putative antisense miRNAs might be chal-lenging, since far fewer cells express primary transcriptsof the antisense mir-iab-8 strand than express mir-iab-4

Figure 1. Sense and antisense transcription of the iab-4 locus in the BX-C produces mature miRNAs. (A) Map of the BX-C depictingthe homeobox genes Ubx, abd-A, and Abd-B, and sense and antisense iab-4 hairpins; the Antp gene of the antennapedia complex(ANTP-C) is also shown. Targets with highly conserved “2–8” seed + t1A pairing to miR-iab-4-5p or miR-iab-8-5p are indicated; seeFigure 3 and Supplemental Figures S1–S3 for details of target site pairing and conservation. Darker lines represent stronger regulatoryrelationships, as evidenced by multiple sites and experimental validation. Below this is the DNA sequence of the iab-4 hairpin region,with the sense-strand miRNAs shaded in green and antisense-strand miRNAs shaded in red. Alignment of mature miR-iab-4-5p andmiR-iab-8-5p shows that the latter has a 2-nt “UU” extension at its 5� end. (B) Proposed secondary structures of the mir-iab-4 andmir-iab-8 hairpins. (C–F) In situ hybridization demonstrates temporally and spatially distinct expression patterns of pri-mir-iab-4 andpri-mir-iab-8. (G) Northern analysis of RNA from 6- to 10-h embryos reveals processed pre-miRNA hairpins for mir-iab-4 andmir-iab-8, and mature miRNAs for iab-4-5p, iab4-3p, and iab-8-5p; iab-4-5p and iab-8-5p are predominant. Ethidium stains of 5S rRNAand Northern analysis of 2S rRNA species are shown as loading and transferring controls. (H) Tests of probe specificity. Titration seriesof synthetic mir-iab-4 and mir-iab-8 hairpin RNAs were analyzed using probes for all four of the iab-4 locus miRNAs. Both iab-4-5pand iab-4-3p probes recognize only the mir-iab-4 hairpin, while the iab-8-5p and iab-8-3p probes recognize only the mir-iab-8 hairpin.

Antisense microRNAs

GENES & DEVELOPMENT 27

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

(Fig. 1C–F). In fact, previously published Northern analy-ses failed to detect the mir-iab-4 hairpin, or even its ma-ture products miR-iab-4-5p and miR-iab-4-3p (Leaman etal. 2005).

Locked nucleic acid probes proved efficacious forNorthern analysis. On the sense strand, both miR-iab-4-5p and miR-iab-4-3p probes detected endogenous hairpinprecursor and mature miRNAs in embryos (Fig. 1G). Thelevel of mature miR-iab-4-5p was much higher thanmiR-iab-4-3p, as judged by the relative ratio betweenhairpin and mature RNA signals with these probes. Onthe antisense strand, a miR-iab-8-5p probe similarly de-tected both pre-miRNA and mature species, whereas amiR-iab-8-3p probe detected only the pre-miRNA (Fig.1G). Thus, the major products of the sense and antisenseiab-4 hairpins are their respective “5p” species. Wewished to rule out that these positive Northern signalsmight be confounded by probe cross-hybridization. To doso, we transcribed mir-iab-4 and mir-iab-8 hairpin RNAsin vitro, and analyzed titration series of these RNAsagainst all four iab-4/iab-8 miRNA probes. As shown inFigure 1H, synthetic mir-iab-4 hairpin RNA was ro-bustly detected with both miR-iab-4-5p and miR-iab-4-3p probes, but not by miR-iab-8-5p or miR-iab-8-3pprobes. Conversely, synthetic mir-iab-8 hairpin RNAwas detected by miR-iab-8-5p and miR-iab-8-3p probes,but not by miR-iab-4-5p or miR-iab-4-3p probes. Thesecontrol experiments demonstrated the specificity ofthese probes in Northern analysis.

We determined the 5� ends of iab-8 miRNAs usingadaptor-mediated PCR and found that while the 5� end ofmiR-iab-8-5p is related to that of miR-iab-4-5p, theformer contains a strict 2-nt “UU” extension (Fig. 1A).Because of their seed offset, the target site preferences ofthese miRNAs are expected to be mostly nonoverlap-ping. However, certain appropriate sequences could, inprinciple, accommodate the seeds of both miRNAs. Sub-

sequently, iab-4/iab-8 miRNA clones were obtained via454 pyrosequencing (GEO series GSE7448), which veri-fied the ends of the iab-8 small RNAs (Ruby et al. 2007).The characteristic 3� overhangs to the antisense miRNAduplex served as further evidence that mir-iab-8 transitsthe canonical miRNA biogenesis pathway (Ruby et al.2007).

The pyrosequencing data suggested that the maturemiRNAs derived from mir-iab-8 are less abundant thanthose from mir-iab-4, which is consistent with the muchmore restricted spatial and temporal expression of theantisense transcript (Fig. 1C–F; Bae et al. 2002). On theother hand, the read numbers suggested comparable lev-els of miR-iab-8-5p and miR-iab-8-3p RNAs (Ruby et al.2007), a conclusion that was at odds with our Northerndata. It is worth noting that the original cloning data ofAravin et al. (2003) identified one clone each of miR-iab-4-5p and miR-iab-4-3p, an equivalency of expression thatwas neither borne out by larger clone sets (Ruby et al.2007), nor by our Northern analysis (Fig. 1G). Therefore,low numbers of small RNA clones likely do not permitaccurate quantitation of small RNA levels.

Sense and antisense iab-4 miRNAs exhibit separabletarget specificities

We next asked whether sense and antisense iab-4miRNAs are active regulatory species in the animal. Weused an in vivo assay in wing imaginal discs (Stark et al.2003) to test whether mir-iab-4 or mir-iab-8 expressionconstructs could repress GFP “sensor” transgenes. Basedon our observation that the left arm, “5p,” species fromboth hairpins predominate over their right arm, “3p”counterparts, we constructed tub-GFP sensors bearingantisense matches to miR-iab-4-5p or miR-iab-8-5p. Weobserved robust repression of the miR-iab-4-5p sensor bymir-iab-4 (Fig. 2A), and of the miR-iab-8-5p sensor by

Figure 2. Sense and antisense iab-4 miRNAs are functional inhibitory RNAs that exhibit target selectivity. Shown are pouch regionsof wing imaginal discs that carry the indicated tub-GFP sensors and express either UAS-DsRed-mir-iab-4 under ptc-Gal4 control (A,C)or UAS-DsRed-mir-iab-8 under dpp-Gal4 control (B,D). (A�,D�) Evidence for strong target inhibition is seen in the GFP-negativeregions designated with asterisks; arrow in C� indicates weak target inhibition.

Tyler et al.

28 GENES & DEVELOPMENT

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

mir-iab-8 (Fig. 2D). Conversely, we observed little re-pression of the miR-iab-8-5p sensor by ectopic mir-iab-4,and no activity of mir-iab-8 on the miR-iab-4-5p sensor(Fig. 2B,C). Therefore, miRNAs derived from mir-iab-4and mir-iab-8 are functional regulatory species that ex-hibit distinct target capabilities in vivo, which is consis-tent with their distinct seed regions (Fig. 1A).

iab-4-5p and iab-8-5p exhibit distinct BX-C genetarget relationships

Our previous work established Ubx as a direct target ofmiR-iab-4-5p (Ronshaugen et al. 2005). However, onlyone (#3) of the many candidate sites in the Ubx 3� un-translated region (UTR) is a canonical “2–8” seed-matchsite (Fig. 3A,C,E; Supplemental Fig. S1); that is, a sitewith Watson-Crick complementarity to positions 2–8 ofa miRNA (Lai 2002; Lewis et al. 2005). Since most of theother sites are well conserved, we earlier hypothesizedthat Ubx might be configured to respond to a multiplic-

ity of suboptimal miRNA-binding sites. Surprisinglythen, six of these sites proved to be “2–8” seed matchtargets for miR-iab-8-5p (Fig. 3A,C,E). Four of these sitesalso have adenosines against position 1 of the miRNA(t1A features), which correlate with increased targetingefficacy (Lewis et al. 2005; Grimson et al. 2007; Nielsenet al. 2007); none of the candidate miR-iab-4-5p sites hast1A features. Therefore, Ubx appears to be a relativelymodest target of miR-iab-4-5p, but a very strong target ofmiR-iab-8-5p.

Equally striking is the degree to which miR-iab-8-5ptargets abd-A (Fig. 3B,D,F; Supplemental Fig. S2). Theabd-A 3� UTR contains four “2–8” seed match sites formiR-iab-8-5p, with two additional sites distal to the an-notated transcript; three of these sites have t1A features.We suspected that these downstream sites are genuinefeatures of the abd-A transcription unit. Indeed, ESTsearches revealed both the canonical transcript and anovel abd-A transcript that utilizes a conserved, down-stream poly(A) signal (Supplemental Fig. S2), and thus

Figure 3. Ubx and abd-A are strong, direct targets of miR-iab-8-5p. (A,B) Alignments of the Ubx and abd-A 3� UTRs across 12Drosophilid genomes (obtained from the University of California at Santa Cruz Genome Browser, http://genome.ucsc.edu). The distalsites in abd-A are contained within a novel, extended isoform whose structure is supported by the indicated ESTs. (C,D) Canonicalbinding sites for sense and antisense iab-4 miRNAs in Ubx and abd-A. All sequences are from Drosophila melanogaster except for Ubxsite #6; which is canonical only in nonmelanogaster group species (D. virilis [Dv] sequence is shown as a representative). ContiguousWatson-Crick seed-matches to miR-iab-4-5p are highlighted in green, while nucleotides that match the 5� extension of miR-iab-8-5pare in red. The number of seed-matched nucleotides, t1A features (“A”), and depth of species conservation are tabulated to the rightof each alignment. Seed-match data are highlighted green or red if predicted as a functional target of miR-iab-4-5p or miR-iab-8-5p,respectively; note that Ubx site #3 is a canonical binding site for both miRNAs. Additional conservation data are reported inSupplemental Figures S1–S3. (E,F) Examples of highly conserved miR-iab-8-5p/miR-iab-4-5p-binding sites in the 3� UTRs of Ubx andabd-A. (G–J) Wing disc assays of the ability of sense and antisense iab-4 miRNAs to regulate Ubx or abd-A 3� UTR sensors. Asterisksindicate strong regulation, while the arrow indicates weak regulation.

Antisense microRNAs

GENES & DEVELOPMENT 29

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

includes all six sites (Fig. 3B). None of these sites is a“2–8” seed match to miR-iab-4-5p, since all are unpairedat positions 7 and/or 8 of miR-iab-4-5p, and all of themalso lack t1A pairing (Fig. 3D). The selection of Ubx andabd-A to have multiple “2–8” seed + t1A sites specifi-cally for miR-iab-8-5p strongly suggests that they arepreferred targets of the antisense miRNA mir-iab-8.

The conservation patterns of these extensive targetsite arrays are notable. Ubx sites #1, #3, and #5 havebeen perfectly conserved among all 12 sequenced Dro-sophilids, whereas the other three sites are found only inmore limited species subsets (Supplemental Fig. S1); infact, site #6 is a “2–8” seed-match site only in nonme-lanogaster group species. In contrast, with the sole ex-ception of site #4 in Drosophila virilis (which has asingle C → T substitution introducing a G:U seed pair),all six miR-iab-8-5p sites in abd-A orthologs have beenperfectly conserved among the 12 sequenced Drosophi-lids (Supplemental Fig. S2). The invariant nature of thelarge array of miR-iab-8-5p sites in Drosophilid abd-Agenes contrasts with the fact that several sites in Ubxorthologs are actively evolving. We note that previousgenome-wide searches revealed only one other Dro-sophila gene 3� UTR with six highly conserved seed-match sites for an individual miRNA (nerfin, with sixsites for miR-279/miR-286) (Grun et al. 2005; Stark et al.2005). Thus, these Hox targets of miR-iab-8-5p are re-markable with respect to the complete landscape of Dro-sophila miRNA targets.

In vivo validation of Ubx and abd-A as mir-iab-8targets

We next tested the capacity of sense and antisense iab-4miRNAs to regulate tub-GFP-Ubx 3�UTR or tub-GFP-abd-A 3�UTR sensors in wing imaginal discs. These testsrevealed a clear distinction between their regulatory ac-tivities. While ectopic mir-iab-4 induced only mild sup-pression of Ubx (Fig. 3G), mir-iab-8 strongly suppressedboth Ubx and abd-A sensors (Fig. 3H,J). The degree oftarget inhibition correlated well with the qualities of thepredicted target sites, yielding strong support for our no-tions regarding miRNA site functionality. For example,Ubx contains one well-conserved “1–8” site for miR-iab-4-5p (Fig. 3E; Ubx site #3, which is also a site formiR-iab-8-5p), and could be mildly repressed by mir-iab-4. On the other hand, even though abd-A contains sixconserved sites that could pair with nucleotides 1–6 or1–7 with iab-4-5p, we did not detect any inhibition ofabd-A by ectopic mir-iab-4 (Fig. 3I).

The mild-to-nonexistent repression of these Hox tar-gets by mir-iab-4 was not a consequence of an ineffectualtransgene, since the same transgene could strongly re-press its cognate perfect sensor (Fig. 2A). Conversely,these differences were not due to the chance isolation ofan abnormally powerful mir-iab-8 transgene, since fiveindependent genomic insertions of this constructshowed similar activities. Instead, these data indicatethat canonical “2–8” seed pairing is normally prerequi-site for conventional miRNA target recognition, and

cannot be compensated for simply by a large number ofsuboptimal target sites. Indeed, these data questionwhether “1–7” seed matches lacking t1A features evenqualify as potential miRNA target sites.

We next asked if mir-iab-4 or mir-iab-8 could affectthe accumulation of endogenous target proteins. Weused the FLP-out technique to generate clones of cellsthat express DsRed and either iab-4 or iab-8 miRNAs.We then examined the behavior of endogenous Ubx andabd-A proteins in miRNA-expressing clones in halterediscs and genital discs, respectively, using the adjacentnonclonal tissue as an internal staining control. We ob-served that mir-iab-4 weakly represses Ubx (Fig. 4A) asshown previously (Ronshaugen et al. 2005), while itsmisexpression had no effect on endogenous abd-A (Fig.4C). In contrast, ectopic mir-iab-8 nearly eliminated theaccumulation of endogenous Ubx and abd-A proteins ina cell-autonomous fashion (Fig. 4B,D). These data pro-vide evidence for strong regulatory capability of Ubx andabd-A by miR-iab-8-5p, as supported by stringent con-servation of their extensive target site arrays among theDrosophilids. In addition, the fact that the endogenoustranscripts responded identically to the GFP sensors fur-ther suggests that targets lacking “2–8” seed pairing and/or t1A features are unlikely to be of functional signifi-cance.

Misexpression of mir-iab-8 induces a strong Ubxphenocopy

With these target data in hand, we investigated the phe-notypic effects of ectopic mir-iab-8. We previouslyshowed that misexpression of mir-iab-4 in developinghalteres using sd-Gal4 subverts halteres into adoptingpartial wing identity (Ronshaugen et al. 2005). This issimilar to the phenotype exhibited by a mild Ubx alleliccombination, and is most clearly indicated by the speci-fication of an anterior wing margin-like structure on thehaltere decorated with sensory bristles (Fig. 4E,F). Mis-expression of mir-iab-8 using sd-Gal4 induced larval andpupal lethality. However, by reducing the activity ofGal4 we obtained some pharate lethal females that ex-hibited nearly complete haltere-wing transformations(Fig. 4G). These substantial phenocopies of Lewis’ (Lewis1978) classic four-winged flies obtained with strong Ubxmutant alleles are a palpable exhibition of the powerfulregulatory relationship between miR-iab-8-5p and Ubx.

We also searched for potential transformations in ab-dominal segments characteristic of abd-A loss of func-tion. DsRed/mir-iab-4+ clones were recovered in theadult abdomen, and these exhibited no overt phenotype(data not shown). In contrast, we were unable to recoverclones of DsRed/mir-iab-8+ cells in the adult abdomen.Histoblast nest cells (which give rise to abdominal struc-tures) lacking both Ubx and abd-A assume thoracicidentity, and are unable to differentiate within the ab-dominal environment (Casanova et al. 1987). Therefore,the dual targeting of these BX-C genes by mir-iab-8 con-strains the types of visible homeotic transformationsthat it can induce.

Tyler et al.

30 GENES & DEVELOPMENT

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

Endogenous sense and antisense processingof Drosophila mir-307 and mammalian mir-338

We wished to generalize the principle of endogenous an-tisense miRNAs. Hairpins composed solely of Watson-Crick pairs have identical secondary structures on eitherstrand. On the other hand, since miRNA hairpins typi-cally exhibit G:U basepairs and/or unpaired nucleotides,their corresponding sense and antisense structures areusually different (e.g., mir-133) (Fig. 5C), with the anti-sense version usually presenting a less compelling struc-ture (Fig. 5A). Nevertheless, analysis of the 76 Dro-sophila miRBase genes on both strands suggested thatmore than one-quarter are plausible as miRNA genes asantisense transcripts (Fig. 5A), with mir-iab-4 in the up-per quartile.

Another distinguishing feature of mir-iab-4 is thatboth sides of its hairpin are under tremendous evolution-ary constraint. In fact, both arms have been perfectly

preserved among flies, mosquitoes, bees, and beetles,species that have been separated for >400 million years(Ronshaugen et al. 2005). We believe this to be a likelyconsequence of the critical functions of sense and anti-sense miRNAs produced from both arms of this locus.

We noticed through this analysis that the mir-307hairpin was the sixth highest scoring antisense candidate(Fig. 5; Supplemental Fig. S4) and has been strictly con-served on both arms during insect evolution (Lai et al.2003). In fact, while mature miR-307 (which derivesfrom the “3p” hairpin arm) contains a 2-nt divergence inApis (although it is completely conserved in the moredistant Tribolium species), miR-307* is 100% conservedamong these widely divergent insects (Fig. 6A). Mightthe particular constraint on miR-307* actually reflect anantisense miRNA? Indeed, analysis of small RNAscloned from female Drosophila heads revealed both ma-ture miRNA and miRNA* species for antisense (AS) mir-307, with miR-307AS-3p as the predominant species.

Figure 4. Ectopic mir-iab-8 inhibits endogenous Ubx and abd-A proteins and induces homeotic phenotypes. (A–D) FLP-out clonesexpressing sense or antisense iab-4 miRNAs were assayed for their effect on Ubx or abd-A. A–D show DsRed/miRNA-expressingclones (in red), A�–D� depict endogenous Hox proteins (in green), and A�–D� display merged images; selected clone boundaries thatoverlap domains of Hox protein expression are marked with dotted lines. Ectopic mir-iab-4 reduces Ubx (A) but has no effect on abd-A(C), while ectopic mir-iab-8 nearly eliminates both Hox proteins (B,D). (E–G) Haltere-to-wing respecification induced by sense andantisense iab-4 miRNAs, characteristic of Ubx loss of function. (E) Wild-type thorax. The wing is marked with an asterisk and thehaltere is marked with an arrow; inset shows a higher-magnification view of the haltere. (F) sd-Gal4/X; UAS-DsRed-mir-iab-4/+animal exhibits mild haltere-to-wing transformation including extensive specification of anterior wing margin bristles (see inset); theendogenous wing has not yet inflated. (G) sd-Gal4/X; UAS-DsRed-mir-iab-8/+ pharate lethal animal exhibits a nearly completetransformation of haltere toward wing identity; the morphology of both wings is abnormal.

Antisense microRNAs

GENES & DEVELOPMENT 31

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

miR-307 and miR-307AS-3p have different seeds, andconsequently have distinct regulatory capacity. Al-though miR-307AS-3p is rarer than miR-307, its higherevolutionary constraint indicates that its trans-regula-tory function is under stringent selection. It is conceiv-able that, as is the case with mir-iab-4 and mir-iab-8,mir-307AS is transcriptionally active in a much morespatially and/or temporally restricted domain than ismir-307.

The head small RNAs also revealed candidate anti-sense miRNAs for several other loci. The most compel-ling loci were mir-13b-2AS, which was the seventh high-est-scoring antisense candidate, and mir-305AS, forwhich two clones were obtained. Finally, we note thatRuby et al. (2007) also reported antisense clones for mir-307, mir-305, mir-124. Thus, there is candidate evidencefor at least five processed antisense miRNA loci in Dro-sophila.

Does the phenomenon of antisense miRNAs apply toother species? We analyzed a recently published mam-malian small RNA data set (Landgraf et al. 2007) andidentified several candidate antisense miRNAs. Ofthese, the most compelling example was mir-338, sincethe antisense strand of human mir-338 generated bothcloned miRNA and miRNA* species (Fig. 6B). The mod-est number of antisense clones did not permit confidentassignment of the miRNA* strand, and comparison ofthe relative free energies at the ends of its small RNAduplex did not suggest a particular strand asymmetry(Supplemental Fig. S5). However, we found thatmiR-338AS-5p was also cloned from rat. This indicatesthat the production of antisense miRNAs is a conserved

feature of the mammalian mir-338 locus, and plausiblysuggests miR-338AS-5p as the antisense miRNA of pre-ferred endogenous usage. Consistent with this notion,the DNA sequence that jointly encodes miR-338 andmiR-338AS-5p is more highly conserved than the se-quence that encodes their partner small RNAs (Fig. 6B).

In summary, these additional examples generalize theprinciple of antisense miRNAs in both invertebrates andvertebrates. In the three most confident cases—forwhich both antisense miRNA and miRNA* werecloned—the register of hairpin processing on the senseand antisense strands was distinct (Figs. 1, 6). This re-sults in antisense miRNA seeds that are radically differ-ent from their sense counterparts. Therefore, antisensemiRNA transcription and processing can serve to diver-sify the activities of miRNA genes in both Drosophilaand mammals.

Discussion

Our studies of BX-C miRNAs reveal two principal in-sights into miRNA regulatory biology. First, we identi-fied a new Hox cluster miRNA, mir-iab-8, and showedusing gain-of-function assays that it can strongly inhibitUbx and abd-A and generate homeotic phenotypic trans-formations. Indeed, the Hox-regulatory properties of mir-iab-8 are far more potent than those of mir-iab-4(Ronshaugen et al. 2005), and correlate directly with theproperties of its target sites in their 3� UTRs (Figs. 3, 4;Supplemental Fig. S1, S2). Curiously, both BX-CmiRNAs obey organizational and functional rules previ-

Figure 5. Comparison of miRNA precursors as sense and antisense transcripts. (A) Sense and antisense miRNA hairpins of knownDrosophila miRNAs were assessed according to their free energy and structural parameters (Lai et al. 2003). The X-axis denotes eachmiRNA hairpin folded and scored on its sense strand (blue) and antisense strand (purple); the Y-axis denotes the score of the miRNAcandidate. Most antisense strands are poorer candidates than their sense counterparts (e.g., mir-133); however, nearly one-third of them(gray box) achieve a score that is plausible as a miRNA candidate (e.g., mir-307). In a few cases, such as mir-4, the antisense strand ismore compelling than the sense strand. The full analysis is available in Supplemental Figure S4. (B) Example of a miRNA locus thatadopts comparable structures on both strands. (C) Example of a miRNA locus whose antisense structure is dissimilar to its sensecounterpart.

Tyler et al.

32 GENES & DEVELOPMENT

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

ously defined for the protein-encoding members of theBX-C (Lewis 1978). These regulatory RNAs exhibit co-linearity, in that transcription of pri-mir-iab-8 initiatesmore distally on the chromosome and is expressed moreposteriorly in the embryo relative to pri-mir-iab-4 (Fig.1A,C–F). They also exhibit posterior prevalence, in thatboth sense and antisense iab-4 miRNAs directly repressmultiple homeotic genes located more anteriorly in theHox cluster (Figs. 1, 3, 4). In fact, we identified the nextmost-anterior Hox gene Antp as a third likely endo-genous iab-miRNA target that contains highly con-served target sites with t1A features for miR-iab-8-5p

(Fig. 1A; Supplemental Fig. S3). On the other hand,Abd-B contains no conserved sites for either iab-4 oriab-8 miRNAs in its long (>2 kb) 3� UTR. Therefore,BX-C miRNAs and homeobox genes are governed by thesame regulatory logic.

It is worth recalling that saturation mutagenesisscreens of the BX-C revealed only three loci that are re-quired for viability and exhibit homeotic defects, corre-sponding to the homeobox genes Ubx, abd-A, and Abd-B(Sanchez-Herrero et al. 1985; Tiong et al. 1985). On theother hand, pioneering studies by Lewis (1978) that alsoconsidered rearrangements and dominant alleles sug-

Figure 6. Drosophila mir-307 and mammalian mir-338 produce antisense miRNAs. (A) Multiple alignment of the insect mir-307locus (obtained from the University of California at Santa Cruz Genome Center, http://genome.ucsc.edu). Previously cloned miR-307derives from the bottom strand (miR-307, “3p” arm). Both arms of the hairpin have been highly conserved during insect evolution(blue-shaded boxes), but miR-307 has diverged slightly in Apis (yellow, arrow). Below this is the DNA sequence of the mir-307 hairpin,color-coded for cloned sense (in red) and antisense (in green) miRNAs. (B) Multiple alignment of the vertebrate mir-338 locus.Previously identified miR-338 derives from the bottom strand. Both arms of the hairpin are strongly conserved in placental mammals.Below this is the DNA sequence of the mir-338 hairpin, color-coded for cloned sense (in red) and antisense (in green) miRNAs.

Antisense microRNAs

GENES & DEVELOPMENT 33

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

gested the existence of at least eight homeotic “factors”in this region of the genome. Although many of these arenow recognized as cis-regulatory elements that regulateHox gene transcription (Maeda and Karch 2006), ourwork with BX-C miRNAs reveals two bona fide Hoxregulators that are capable of inducing severe dominanthomeotic transformations. The endogenous requirementfor iab-4/iab-8 miRNAs appears to be subtle, possiblydue to compensatory transcriptionally based regulatorymechanisms. Nevertheless, loss of function analysis inan accompanying manuscript corroborates that thesemiRNAs are required for normal expression of Hox tar-gets in the nervous system and for normal development(Bender 2008). These data emphasize that loss-of-func-tion and gain-of-function genetics are complementaryapproaches to uncover important regulatory molecules.

Second, we uncovered antisense transcription and pro-cessing as a mechanism to generate new functionalmiRNAs. Bioinformatic analysis suggests that a largefraction of miRNA loci are theoretically competent toproduce antisense miRNAs (Fig. 5; Supplemental Fig.S4). Extant cloning efforts suggest that few miRNA lociactively produce large quantities of antisense miRNAs.Nevertheless, the sequencing effort reported here and ina contemporary analysis (Ruby et al. 2007) revealed ad-ditional instances of putative antisense miRNAs. Al-though none of these was cloned more than twice, ge-netics demonstrates that rare miRNAs (e.g., lsy-6, ex-pressed by a handful of neurons in a whole animal) canbe critical components of regulatory networks and canhave potent biological activities (Johnston and Hobert2003). Therefore, assessment of the biological relevanceof the other antisense miRNA candidates awaits furtherstudy.

In the case of the iab-4 locus, the regulatory diversityafforded by sense and antisense transcription of a singlemiRNA hairpin is manifested by altering the seed re-gions of their respective miRNA products and by deploy-ing the sense and antisense pri-miRNA transcripts indistinct spatial domains. It might in fact be deleteriousfor a given locus to be simultaneously transcribed onboth strands—either because of transcriptional interfer-ence from colliding polymerase complexes, or because ofthe possibility to inadvertently generate dsRNA. Furtheranalysis is needed to test the notion that it is favorablefor sense/antisense miRNA pairs not to be expressed inthe same cells. Overall, though, as animal genomes arequite extensively transcribed (Manak et al. 2006;Kapranov et al. 2007), and many miRNA genes adoptextensive hairpins on both strands (Fig. 5), the potentialfor endogenous antisense processing of miRNA hairpinsis theoretically quite broad. We propose that antisensetranscription of other miRNA loci might generate novelsmall RNAs whose potentially beneficial regulatory ac-tivities are available for selection and stabilization bynatural selection (Chen and Rajewsky 2007). Our iden-tification of several confident examples of antisensemiRNAs, whose processing and/or targets have beenconserved among diverse species, provides compellingsupport for this hypothesis.

Materials and methods

Northern analysis

Endogenous total RNAs were isolated from staged Canton Sembryos using Trizol (Life Technologies). Synthetic pre-mir-iab-4 and pre-mir-iab-8 templates were generated by first an-nealing a long pre-miRNA oligo with a T7 promoter oligo andextending with Taq polymerase. Oligos are as follows, with T7sequences in lowercase: T7-promoter, taatacgactcactatag; T7-pre-mir-iab-4, GTTACGTATACTGAAGGTATACCGGATAGGATACACTCAGGATACATTCAGTATACGTCCctatagtgagtcgtatta; T7-pre-mir-iab-8, TAAACGTATACTGAATGTATCCTGAGTGTATCCTATCCGGTATACCTTCAGTATACGTAACCctatagtgagtcgtatta.

These templates were then transcribed using T7 RNA poly-merase (Ambion). RNA samples (20 µg of total embryonic RNAor specified amounts of synthetic RNA per lane) were run on12% acrylamide denaturing gels and then electrophoreticallytransferred to Genescreen Plus (Perkin Elmer) membranes. Af-ter transfer, they were cross-linked with 120 mJ of UV. LNA orDNA probes were labeled using T4 polynucleotide kinase (NewEngland Biolabs) and �-32P ATP and hybridized to the mem-branes at 45°C in hybridization buffer (50% Formamide, 5×SSPE, 5× Denhardt’s, 0.5% SDS, 20 µg/mL sheared fish DNA)overnight. Membranes were washed at 45°C, twice with 2×SSC, 0.1% SDS, and three times with 0.2× SSC, 0.1% SDS,followed by PhosphorImager analysis (Fuji, BAS2500).

The following probes were used: miR-iab-4-5p, TCAGGATACATTCAGTATACGT (LNA, Exiqon); miR-iab-4-3p, TTACGTATACTGAAGGTATACCG (LNA, Exiqon); miR-iab-8-5p,CGGTATACCTTCAGTATACGTAA (LNA, Exiqon); miR-iab-8-3p, TAAACGTATACTGAATGTATCCT (LNA, Exiqon); 2SrRNA, (TACAACCCTCAACCATATGTAGTCCAAGCA) (DNA,IDT).

Drosophila strains

dpp-Gal4, ptc-Gal4, and sd-Gal4 driver strains were obtainedfrom the Bloomington Stock Center. tub-GFP-Ubx 3� UTR,UAS-DsRed-mir-iab-4 were described previously. The mir-iab-8 expression construct was created by inserting the reversecomplement of a previously described mir-iab-4 genomic frag-ment (Ronshaugen et al. 2005) into the 3� UTR of UAS-DsRed.Perfect sensors for iab-4-5p and iab-8-5p were generated by clon-ing the following oligos into the XhoI and XbaI sites of tub-GFP(Stark et al. 2003): miR-iab4-5 sensor, 5�-CTAGAcTCAGGATACATTCAGTATACGTtcaacaatcaccTCAGGATACATTCAGTATACGTtC-3� and 3�-TgAGTCCTATGTAAGTCATATGCAagttgttagtggAGTCCTATGTAAGTCATATGCAaGAGCT-5�; miR-iab8-5 sensor, 5�-CTAGATCCGGTATACCTTCAGTATACGTAACACGAGcaacaatcacTCCGGTATACCTTCAGTATACGTAACACGAGcC-3� and 3�-TAGGCCATATGGAAGTCATATGCATTGTGCTCgttgttagtgAGGCCATATGGAAGTCATATGCATTGTGCTCgGAGCT-5�.

We generated the GFP-abd-A 3� UTR sensor by amplifying a2.3-kb fragment containing the entire 3� UTR from w1118 geno-mic DNA and cloned it into the NotI and XbaI sites of tub-GFP:abdA_RA 5�Not, ggggcggccgcTAAgctgacaaccacccatc; and ab-dA_RA 3�Xba, ggggtctagaGTATATGCGGGTTCTTGAAC.

Transgenic strains were generated by BestGene, Inc., and atleast three independent insertions were isolated for each con-struct.

In situ hybridization

For in situ hybridizations, we used PCR to generate two differ-ent amplicons of the iab-4 region, incorporating flanking T7 and

Tyler et al.

34 GENES & DEVELOPMENT

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

T3 promoters. These templates were used to make sense andantisense pairs of digoxigenin-labeled probes, which were hy-bridized to embryos using a standard method (Kosman andSmall 1997). Both probe sets gave identical staining patterns;the data shown in the paper used the “4–5” probe set below.

This primer set generated an ∼1-kb fragment centered on theiab-4 hairpin: iab4T3, AATTAACCCTCACTAAAGGGAGAaccaccgaacacaagacaca; iab4T7, TAATACGACTCACTATAGGGAGAgcggtttcatgacacagaga. The second primer set was “4–5,”described by Bae et al. (2002): 4–5 s, ACCACAAGAAGGAGCAGTCG; and 4–5 as, GCACTCTCACCTACACGAATGC.

Small RNA libraries

We prepared total RNA from adult female Canton S Drosophilaheads using Trizol, and cloned the ∼18- to 26-nt fraction usinga previously published method (Lau et al. 2001). The libraryDNA was then adapted with primers that permitted them to beloaded onto Solexa flow cells. One sequencing lane was ana-lyzed, and the mapped miRNA data were deposited in GEO(record GPL6072).

Sensor assays

We crossed X-Gal4; tub-GFP-Y trans-heterozygous females toUAS-DsRed-mir-Z males, where “X” is either dpp-Gal4 or ptc-Gal4, “Y” is either a perfect sensor (bearing tandem antisensematches to miR-iab-4-5p or miR-iab-8-5p) or a 3� UTR sensor(containing the 3� UTR of abd-A or Ubx), and “Z” is either apri-miRNA fragment of mir-iab-4 or mir-iab-8. We then se-lected GFP+, DsRed+ larvae for dissection. It was necessary toexpress mir-iab-4 using ptc-Gal4 and mir-iab-8 using dpp-Gal4because reciprocal combinations were lethal before the thirdlarval instar.

Clonal expression of miRNAs

To analyze the effect of ectopic miRNAs on Hox protein accu-mulation, we heat-shocked y w hsFlp/+; tub-�1 > FRT Gal80, y+FRT > Gal4/+; UAS-DsRed-miRNA/+ first instar larvae for 30min at 38°C. Flp-mediated excision of the FRT-Gal80 cassetteinduced Gal4 and miRNA expression in DsRed-marked cellclones. Fluorescent antibody staining of third instar imaginaldiscs was then performed as described previously (Lai and Rubin2001). We used the following antibodies: rabbit �-GFP (1:1250;Molecular Probes), mouse �-Ubx (1:10; from Nipam Patel),mouse �-Abd-A (1:10; from Ian Duncan), and Alexa-coupled sec-ondary antibodies (1:400; Molecular Probes).

Acknowledgments

Bergin Tam and Nancy Arango helped to clone miRNA con-structs, and Emily Hodges performed Solexa sequencing. JuliusBrennecke, Stephen Cohen, Nipam Patel, and Ian Duncan gen-erously provided antibodies and plasmids. K.O. was supportedby grants from the Japan Society for the Promotion of Scienceand Charles H. Revson Foundation. J.W.H. was supported by theMildred and Emil Holland Scholarship, the Margaret and Her-man Sokol Fellowship and NIH MSTP grant GM07739. E.B. wassupported by a VIDI grant (NWO). G.J.H. is an investigator ofthe Howard Hughes Medical Institute. E.C.L. was supported bygrants from the Leukemia and Lymphoma Foundation, the Bur-roughs Wellcome Foundation, the V Foundation for Cancer Re-

search, the Sidney Kimmel Foundation for Cancer Research andthe National Institutes of Health (GM083300).

References

Aravin, A., Lagos-Quintana, M., Yalcin, A., Zavolan, M., Marks,D., Snyder, B., Gaasterland, T., Meyer, J., and Tuschl, T.2003. The small RNA profile during Drosophila melanogas-ter development. Dev. Cell 5: 337–350.

Bae, E., Calhoun, V.C., Levine, M., Lewis, E.B., and Drewell,R.A. 2002. Characterization of the intergenic RNA profile atabdominal-A and Abdominal-B in the Drosophila bithoraxcomplex. Proc. Natl. Acad. Sci. 99: 16847–16852.

Bender, W. 2008. MicroRNAs in the Drosophila bithorax com-plex. Genes & Dev. (this issue), doi: 10.1101/gad.1614208.

Casanova, J., Sanchez-Herrero, E., Busturia, A., and Morata, G.1987. Double and triple mutant combinations of bithoraxcomplex of Drosophila. EMBO J. 6: 3103–3109.

Chen, K. and Rajewsky, N. 2007. The evolution of gene regula-tion by transcription factors and microRNAs. Nat. Rev.Genet. 8: 93–103.

Cumberledge, S., Zaratzian, A., and Sakonju, S. 1990. Charac-terization of two RNAs transcribed from the cis-regulatoryregion of the abd-A domain within the Drosophila bithoraxcomplex. Proc. Natl. Acad. Sci. 87: 3259–3263.

Drewell, R.A., Bae, E., Burr, J., and Lewis, E.B. 2002. Transcrip-tion defines the embryonic domains of cis-regulatory activ-ity at the Drosophila bithorax complex. Proc. Natl. Acad.Sci. 99: 16853–16858.

Grimson, A., Farh, K.K., Johnston, W.K., Garrett-Engele, P.,Lim, L.P., and Bartel, D.P. 2007. MicroRNA targeting speci-ficity in mammals: Determinants beyond seed pairing. Mol.Cell 27: 91–105.

Grun, D., Wang, Y.-L., Langenberger, D., Gunsalus, K.C., andRajewsky, N. 2005. microRNA target predictions acrossseven Drosophila species and comparison to mammaliantargets. PLOS Compt. Biol. 1: e13. doi: 10.1371/journal.pcbi.0010013.

Johnston, R.J. and Hobert, O. 2003. A microRNA controllingleft/right neuronal asymmetry in Caenorhabditis elegans.Nature 426: 845–849.

Kapranov, P., Cheng, J., Dike, S., Nix, D.A., Duttagupta, R.,Willingham, A.T., Stadler, P.F., Hertel, J., Hackermuller, J.,Hofacker, I.L., et al. 2007. RNA maps reveal new RNAclasses and a possible function for pervasive transcription.Science 316: 1484–1488.

Kosman, D. and Small, S. 1997. Concentration-dependent pat-terning by an ectopic expression domain of the Drosophilagap gene knirps. Development 124: 1343–1354.

Lai, E.C. 2002. microRNAs are complementary to 3� UTR se-quence motifs that mediate negative post-transcriptionalregulation. Nat. Genet. 30: 363–364.

Lai, E.C. 2003. microRNAs: Runts of the genome assert them-selves. Curr. Biol. 13: R925–R936. doi: 10.1016/j.cub.2003.11.017.

Lai, E.C. and Rubin, G.M. 2001. neuralized functions cell-au-tonomously to regulate a subset of Notch-dependent pro-cesses during adult Drosophila development. Dev. Biol. 231:217–233.

Lai, E.C., Tomancak, P., Williams, R.W., and Rubin, G.M. 2003.Computational identification of Drosophila microRNAgenes. Genome Biol. 4: R42. doi: 10.1186/gb-2003-4-7-r42.

Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Ara-vin, A., Pfeffer, S., Rice, A., Kamphorst, A.O., Landthaler,M., et al. 2007. A mammalian microRNA expression atlas

Antisense microRNAs

GENES & DEVELOPMENT 35

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from

based on small RNA library sequencing. Cell 129: 1401–1414.

Lau, N., Lim, L., Weinstein, E., and Bartel, D.P. 2001. An abun-dant class of tiny RNAs with probable regulatory roles inCaenorhabditis elegans. Science 294: 858–862.

Leaman, D., Chen, P.Y., Fak, J., Yalcin, A., Pearce, M., Unner-stall, U., Marks, D.S., Sander, C., Tuschl, T., and Gaul, U.2005. Antisense-mediated depletion reveals essential andspecific functions of MicroRNAs in Drosophila develop-ment. Cell 121: 1097–1108.

Lewis, E.B. 1978. A gene complex controlling segmentation inDrosophila. Nature 276: 565–570.

Lewis, B.P., Burge, C.B., and Bartel, D.P. 2005. Conserved seedpairing, often flanked by adenosines, indicates that thou-sands of human genes are microRNA targets. Cell 120: 15–20.

Lipshitz, H.D., Peattie, D.A., and Hogness, D.S. 1987. Noveltranscripts from the Ultrabithorax domain of the bithoraxcomplex. Genes & Dev. 1: 307–322.

Maeda, R.K. and Karch, F. 2006. The ABC of the BX-C: Thebithorax complex explained. Development 133: 1413–1422.

Manak, J.R., Dike, S., Sementchenko, V., Kapranov, P., Biemar,F., Long, J., Cheng, J., Bell, I., Ghosh, S., Piccolboni, A., et al.2006. Biological function of unannotated transcription dur-ing the early development of Drosophila melanogaster. Nat.Genet. 38: 1151–1158.

Nielsen, C.B., Shomron, N., Sandberg, R., Hornstein, E., Kitz-man, J., and Burge, C.B. 2007. Determinants of targeting byendogenous and exogenous microRNAs and siRNAs. RNA13: 1894–1910.

Ronshaugen, M., Biemar, F., Piel, J., Levine, M., and Lai, E.C.2005. The Drosophila microRNA iab-4 causes a dominanthomeotic transformation of halteres to wings. Genes & Dev.19: 2947–2952.

Ruby, J.G., Stark, A., Johnston, W.K., Kellis, M., Bartel, D.P.,and Lai, E.C. 2007. Evolution, biogenesis, expression, andtarget predictions of a substantially expanded set of Dro-sophila microRNAs. Genome Res. 17: 1850–1864..

Sanchez-Herrero, E., Vernos, I., Marco, R., and Morata, G. 1985.Genetic organization of Drosophila bithorax complex. Na-ture 313: 108–113.

Stark, A., Brennecke, J., Russell, R.B., and Cohen, S.M. 2003.Identification of Drosophila microRNA targets. PLoS Biol. 1:E60. doi: 10.1371/journal.pbio.0000060.

Stark, A., Brennecke, J., Bushati, N., Russell, R.B., and Cohen,S.M. 2005. Animal MicroRNAs confer robustness to geneexpression and have a significant impact on 3�UTR evolu-tion. Cell 123: 1133–1146.

Stark, A., Bushati, N., Jan, C., Kheradpour, P., Hodges, E., Bren-necke, J., Bartel, D.P., Cohen, S.M., and Kellis, M. 2008.A single Hox locus in Drosophila produces functionalmicroRNAs from opposite DNA strands. Genes & Dev. (thisissue), doi: 10.1101/gad.1613108.

Tiong, S., Bone, L.M., and Whittle, J.R. 1985. Recessive lethalmutations within the bithorax-complex in Drosophila. Mol.Gen. Genet. 200: 335–342.

Tyler et al.

36 GENES & DEVELOPMENT

Cold Spring Harbor Laboratory Press on July 2, 2009 - Published by genesdev.cshlp.orgDownloaded from