Expression of the Nonmuscle Myosin Heavy Chain IIA in theHuman Kidney and Screening for MYH9 Mutations in Epsteinand Fechtner Syndromes

CHRISTELLE ARRONDEL,* NICOLAS VODOVAR,* BERTRAND KNEBELMANN,†

JEAN-PIERRE GRUNFELD,† MARIE-CLAIRE GUBLER,* CORINNE ANTIGNAC,* andLAURENCE HEIDET**Inserm U 423, Universite Rene Descartes, Hopital Necker-Enfants Malades, Paris, France; †Service deNephrologie, Hopital Necker, Paris, France.

Abstract. Mutations in the MYH9 gene, which encodes thenonmuscle myosin heavy chain IIA, have been recently re-ported in three syndromes that share the association of macro-thrombocytopenia (MTCP) and leukocyte inclusions: the May-Hegglin anomaly and Sebastian and Fechtner syndromes.Epstein syndrome, which associates inherited sensorineuraldeafness, glomerular nephritis, and MTCP without leukocyteinclusions, was shown to be genetically linked to the samelocus at 22q12.3 to 13. The expression of MYH9 in the fetaland mature human kidney was studied, and the 40 codingexons of the gene were screened by single-strand conformationpolymorphism in 12 families presenting with the association ofMTCP and nephropathy. MYH9 is expressed in both fetal andmature kidney. During renal development, it is expressed in the

late S-shaped body, mostly in its lower part, in the endothelialand the epithelial cell layers. Later, as well as in mature renaltissue, MYH9 is widely expressed in the kidney, mainly in theglomerulus and peritubular vessels. Within the glomerulus,MYH9 mRNA and protein are mostly expressed in the epithe-lial visceral cells. Four missense heterozygous mutations thatare thought to be pathogenic were found in five families,including two families with Epstein syndrome. Three muta-tions were located in the coiled-coil rod domain of the protein,and one was in the motor domain. Two mutations (E1841K andD1424N) have been reported elsewhere in families with May-Hegglin anomaly. The two others (R1165L and S96L) are newmutations, although one of them affects a codon (R1165),found elsewhere to be mutated in Sebastian syndrome.

The association of hereditary nephritis with platelet abnormal-ities was first reported by Epstein et al. (1) in 1972. Thoseauthors studied two families with macrothrombocytopenia(MTCP), deafness, and nephritis, a syndrome that appeared tobe autosomal dominant. The platelet disorder was character-ized by thrombocytopenia, giant platelets, and ultrastructuraland functional platelet abnormalities. In Fechtner syndrome,patients are affected with nephritis and MTCP as well. How-ever, they also have cataracts and small, pale blue cytoplasmicinclusions within the neutrophils and eosinophils that were notdescribed in families with Epstein syndrome (2). Leukocyteinclusions are also observed in two other autosomal dominantMTCP without renal, ocular, or hearing defects: Sebastiansyndrome and the May-Hegglin anomaly (3,4). The renal dis-ease in Epstein and Fechtner syndromes is progressive glomer-ular nephropathy. Patients present with hematuria and protein-

uria and develop renal failure. End-stage renal disease does notgenerally occur before the fourth or fifth decade of life; how-ever, progression to end-stage renal disease during childhoodhas been reported (5). Renal histology shows variable andnonspecific abnormalities, including varying degrees of mes-angial cell proliferation and mesangial matrix expansion andsome tubular atrophy. Electron microscopy shows mesangialalterations, focal or diffuse effacement of podocyte foot pro-cesses, and alterations of the glomerular basement membrane(GBM). Thickening, basket-wave splitting, and rarefaction ofthe GBM have been reported. These alterations are reminiscentof the ultrastructural GBM lesions observed in Alport syn-drome, a progressive inherited hematuric nephropathy fre-quently associated with sensorineural hearing loss and result-ing from an alteration in one of the three chains of type IVcollagen that are mainly expressed in the GBM: �3, �4, and�5(IV). For this reason, the kidney disease associated withMTCP is usually described as an Alport-like nephropathy.However, GBM alterations in Fechtner and Epstein syndromeshave mostly a focal distribution and, except in rare cases (5),are not specific to Alport syndrome.

Recently, the May-Hegglin anomaly and Sebastian andFechtner syndromes have been shown to be genetically linkedto the same locus at 22q12.3-13.1 (6–8), which suggests thatthese three dominant MTCP were allelic. Indeed, mutations inthe MYH9 gene, which encodes the nonmuscle myosin heavy

Received June 4, 2001. Accepted August 3, 2001.Correspondence to Dr. Corinne Antignac, INSERM U423- Tour Lavoisier6eme etage, Hopital Necker-Enfants Malades, 149 rue de Sevres, 75743 ParisCedex 15, France. Phone: 33-1-44-49-50-98; Fax: 33-1-44-49-02-90; E-mail:antignac@necker.frDr. Clifford Kashtan served as Guest Editor and supervised the review andfinal disposition of this manuscript.

1046-6673/1301-0065Journal of the American Society of NephrologyCopyright © 2001 by the American Society of Nephrology

J Am Soc Nephrol 13: 65–74, 2001

chain IIA, were subsequently identified in patients affectedwith these diseases (9–11). Epstein syndrome was shown to begenetically linked to 22q11-13 as well (12), but no mutationshave been reported in this syndrome so far.

MYH9 encodes a nonmuscle myosin II heavy chain, chainIIA. Myosins II (or conventional myosins) are hexameric two-headed motor proteins composed of two heavy chains and twopairs of light chains. Each heavy chain contains a motordomain (or head) that interacts with actin and binds ATP anda two-helix coiled–coil-forming sequence that homodimerizesto form a long rod (or tail). Multiple myosin II moleculesassociate through their tail domain to form bipolar filaments(13). In nonmigrating cells in vertebrates, nonmuscle myosinsII are mainly expressed in the cell cortex and in stress fibers(13). Vertebrates have two nonmuscle myosin heavy chains,IIA and IIB, that are encoded by two distinct genes, MYH9 andMYH10, respectively (14). Most cells express both isoforms,with a few exceptions, such as platelets, which only expressnonmuscle myosin IIA (12). Kidney contains relatively largeamounts of both mRNAs (14). However, little is known aboutthe cellular expression of nonmuscle myosins within the kid-ney and their potential function.

As a first step in the understanding of the nephropathyassociated with MTCP, we studied MYH9 expression in thehuman kidney and screened 12 families affected with MTCPand progressive nephropathy for MYH9 mutations.

Materials and MethodsPatients

Twelve unrelated families with at least one individual presentingwith the association of MTCP and nephropathy were investigated.Pedigrees are summarized in Figure 1. All individuals affected withnephropathy had proteinuria. Information regarding hematuria wasnot always available, but hematuria was present in most patients. Tenpatients reached end-stage renal failure. The age at end-stage renalfailure is indicated in Figure 1. None of the patients had congenitalcataracts. Deafness was reported in nine families (families 1, 4 to 7,and 9 to 12). Leukocyte inclusions were detected in three cases(families 5, 7, and 10). No information regarding leukocyte morphol-ogy was available in six families (1, 4, 6, 8, 11, and 12). Threefamilies (2, 3, and 9) were affected with Epstein syndrome (that is,association of nephropathy and MTCP without polynuclear inclu-sions). However, inclusion bodies were screened only by optic mi-croscopy after May-Grunwald-Giemsa staining. In family 10, theaffected male patient was found to have hypercholesterolemia and

Figure 1. Pedigrees of the 12 families affected with macrothrombocytopenia (MTCP) and nephropathy. MTCP: Ä ; Nephropathy: Á ; Hearingloss: Â ; Leukocyte inclusions: Ã . For individuals having reached end-stage renal failure (ESRF), the age at ESRF is indicated below thepedigree symbols.

66 Journal of the American Society of Nephrology J Am Soc Nephrol 13: 65–74, 2002

abnormal liver enzymes (levels of transaminase and alkaline phos-phatase were slightly elevated) that were not investigated further.Blood samples for DNA analysis were collected from one index caseand, when possible, from other individuals in the family. Informedconsent was obtained from all individuals or their parents, accordingto French legislation.

TissuesNormal fetal kidneys were obtained at autopsy from three fetuses

(at 12, 15, and 26 gestational weeks) after spontaneous abortion. Twonormal mature kidneys not used for transplantation were also used forthe study. Specimens were immediately snap-frozen in liquid nitrogenand stored at �80°C until use or fixed in 4% paraformaldehyde inphosphate-buffered saline (PBS) solution before paraffin embedding.

MethodsRiboprobes Transcription and In Situ Hybridization. Two

MYH9 cDNA fragments were amplified by reverse transcriptase–PCRthat used human mature kidney total RNA and subcloned into PGMT-easy II (Promega, Charbonnieres, France). Reverse transcriptase wasperformed as in reference 15. The primers used for PCR were5'CCATGTGGAGCTGGTGGAGA3' and 5'AGCGGTATTTGTTG-TACGGCTC 3' for probe 1, which covered nucleotides 181 to 1013(14) and included exons 1 to 7 and part of exon 8; and 5' CAAAG-GAGCCCTGGCGTTAGAG 3' and 5' CCCCATCCGCTTTGC-CATCTAC 3' for probe 2, which covered nucleotides 3007 to 3722(16) and included exons 35 to 40. Restriction enzymes for lineariza-tion and RNA polymerases used for in vitro transcription were asfollows: probe 1 antisense, NcoI/Sp6 RNA polymerase; probe 1 sense,SalI/T7 RNA polymerase; probe 2 antisense, NsiI/T7 RNA polymer-ase; and probe 2 sense, SacII/Sp6 RNA polymerase. Labeled RNAprobes were synthesized with 35S-UTP (Amersham, Brauschweig,UK) or with digoxigenin-11-UTP (Roche, Meylan, France), accordingto the manufacturer’s instructions. In situ hybridization was carriedout as described elsewhere (17,18). Antisense and sense strands weresynthesized for all riboprobes.

ImmunohistologyAntibodies. Immunofluorescence labeling was performed with

the use of rabbit polyclonal antibodies against human platelet myosin,diluted to 1/10. These antibodies, from Biomedical Technologies(Stoughton, MA), recognize the nonmuscle myosin heavy chain IIAand are not reactive with any other protein (19). For double labeling,the following antibodies were used: monoclonal antibodies M3F7,which recognizes the type IV collagen [�1(IV)2,�2(IV)], extractedfrom human placenta (Developmental Hybridoma Bank, the Univer-sity of Iowa, Iowa City, IA); MAB5 against the NC1 domain of the �5chain of type IV collagen (Wieslab, Lund, Sweden); or G1D4 againstsynaptopodin (Progen Biotechnik GMBH, Heidelberg, Germany).Cyanin2 or fluorescein isothiocyanate–conjugated AffiniPure goat ordonkey anti-rabbit IgG (H�L) and cyanin3-conjugated affiniPuredonkey anti-mouse IgG (H�L) antibodies were from Jackson Immu-noResearch Laboratories (West Grove, PA).

Immunofluorescence. Immunofluorescence labeling was per-formed on 3-�m-thick cryostat sections fixed in acetone for 10 minand incubated for 20 min with 10% normal goat serum, 1% bovineserum albumin in PBS-Tween (0.01 M PBS containing 0.1% Tween-20) for blocking nonspecific binding. After incubation for 1 h at roomtemperature in a moist chamber with primary antibodies diluted in thesame buffer, sections were rinsed three times in PBS and incubated for30 min with fluorescein isothiocyanate–conjugated anti-rabbit anti-

bodies diluted 1/200 in PBS. A mounting medium that containedpolyvinyl alcohol, glycerol, and tris buffer (Fluoprep, BioMerieux,Lyon, France) was used to delay fluorescence quenching. Labelingwas examined with an orthoplan microscope equipped for light,fluorescence, and phase-contrast microscopy (Leica Microscopic Sys-tems, Heezbrugg, Switzerland). Phase-contrast microscopy allows thevisualization of cell structure.

For dual labeling, the slides were simultaneously incubated withrabbit anti-myosin and mouse anti-[�1(IV)2,�2(IV)] collagen, anti-�5(IV) collagen, or anti-synaptopodin antibodies as described else-where (20). Sections to be stained with anti-�5(IV) antibodies werepretreated with 0.1 mM glycine and 6 mM urea (pH 3.5) for 10 min,then rinsed in distilled water for 5 min. Then, after they were washedwith PBS, tissue sections were simultaneously incubated with Cy2-conjugated goat anti-rabbit IgG and Cy3-conjugated donkey anti-mouse IgG. They were examined with an orthoplan microscope (LeicaMicroscopic Systems) equipped with appropriate filters and with aZeiss confocal microscope (Carl Zeiss Microscopy, Jena, Germany).

Tissue sections directly incubated with the secondary antibodies orserially incubated with normal rabbit or mouse serum instead of theprimary antibodies, followed by incubation with the correspondingsecondary antibodies, served as controls.

Mutation Detection by Single-Strand ConformationPolymorphism Analysis and Direct Sequencing andMutation Analysis

DNA was extracted by use of standard procedures, and PCR wasperformed with 50 ng of genomic DNA. The 40 MYH9 coding exonswere amplified by use of flanking intronic primers selected with theOLIGO 5.1 program (National Bioscience, Inc., Plymouth, MN).Oligonucleotide sequences and location, as well as PCR conditionsand PCR product sizes, are summarized in Table 1. Large exons wereamplified into two fragments. PCR products were screened by single-strand conformation polymorphism (SSCP) analysis as in reference 21by use of Genephor electrophoresis unit and silver staining (Amer-sham Pharmacia Biotech, Orsay, France). Sequence variation, whichgave rise to mobility shift, was determined by direct automatedsequencing (Applied Biosystems).

Mutation mapping onto the chicken smooth-muscle heavy-chaincrystal structure backbone (22) was performed by use of the Swiss-Pdb (23) and Rasmol (24) programs.

ResultsIn Situ Expression of MYH9 Transcript in Fetal andMature Human Kidneys

In the 12-wk embryonic kidney, strong hybridization wasobserved with both antisense probes in the late S-shaped bod-ies. Labeling was particularly strong in the lower part of theS-shaped body, within both endothelial and epithelial celllayers (Figure 2, A and B). More mature nephrons, locateddeeper in the cortex, also show strong labeling in the glomer-ulus that was mainly located in peripheral epithelial podocytes,as shown in Figure 2C. Focal labeling of tubular and peritu-bular capillary endothelial cells was also observed. The samedistribution persisted at 15 and 26 wk. In adult kidney, a verystrong expression of MYH9 mRNA was observed in glomeruli,particularly in the peripheral epithelial cells (Figure 2, D andE). Sense probes showed only background (not shown).

J Am Soc Nephrol 13: 65–74, 2002 MYH9 Expression in Kidney and Novel MYH9 Mutations 67

Expression of the MYH9 Chain in Mature KidneyBy standard immunofluorescence, the protein was expressed

in the glomeruli, in arteriolar and peritubular capillary endo-thelial cells, and faintly in the brush border in proximal tubules.Figure 3 shows double labeling that used both MYH9 antibod-

ies and antibodies directed against the [�1(IV)2,�2(IV)] col-lagen molecule (Figure 3A), the �5 chain of type IV collagen(Figure 3B), or synaptopodin (Figure 3, D and E). Within theglomerulus, MHY9 was widely expressed (Figure 3C). Stronglabeling was observed within cells regarded as podocytes be-

Table 1. Oligonucleotide primers and PCR conditions used for single-strand conformation polymorphism analysis

ExonNumber

Sense (Number of Intron Bases betweenPrimer and Exon) (5�33�)

Antisense (Number of Intron Bases betweenPrimer and Exon) (5�33�)

PCR AnnealingTemperature (°C)

PCR ProductSize (bp)

1 TCCTTCTCCTCCCCGCTTAG (19)b TCCTTGTTCACCTTCACCTTCTa 55 248CATCGTGGAGCTGGTGGAGA (33) CCCACCTCGGAGCCCTCAGA 57 225

2 GAATCAAACTTCCTAACCTGTT (24) (50) CTGCAAAGGTGTCAATGA 55 2713 GGGAGGCTTTTGCATCTG (18) (60) AGTTGTGGTTTCAGTAGGAGAC 52 1614 GGGACAGAGGTCAAGGACTT (41) (50) AAGTGCTCTTCCTCCATCAT 56 2255 CTGCCATCGTCCCCCTTCCA (65) (59) CCCAGGAAAAGGCAGCATGA 61 2576 CTCTCTAGCTCCCCATGTCA (38) (8) CTCTTATCCCAACGAACCAC 50 1507 GCCTTCTCCCCAGCTTGT (23) (56) ATGATGTCTACGGTCCAATTCT 55 2188 GCCTCCACTTTCAGCACCTC (32) (17) TGCCCCACACTCGACCATAG 54 2339 GACCCATGTCTGCTTCTGAG (22) (51) CCTTCCCTCCTGAGCAAATC 56 209

10 GAACTTTCTCTCTTGGGTCT (44) (61) CCCACAACAGCCTCAACT 55 26211 GGGTTTTCAGATCCTTTGTA (33) (42) AAGGATAAGGCAACCAACAG 54 26812 TAGTGCAGGGTTGGCGTCTC (26) (18) AGAGGCAGGTGTGAGGTCAA 56 25813 CTCCCAGGGTGCACTCAC (26) (35) GACTCCACCTCTCCTGTGAA 58 27314 CTTGTGACTCCTGCCTCTCT (11) (46) TGTGGAGGTGGGAAGATGAC 54 21215 TGTGGGCACTCACGTGTTCT (15) (35) CTGAGCACCCCACACCACAG 60 28416 CTGTTCTAGGCACGGAAGTGAG (27) (38) GGGACTCACTGCACGCACAG 55 22917 GAATCGAGGCAATGGGTAAA (28) (25) GGCTGCCCATCCAGAGAG 56 15918 CACCCTTTCATGGAGCTGTG (42) (38) CAACAGAAGGGCGTGGCAAG 59 28119 GTCGGGTCTGCTGTCCACTG (31) (25) TGCACCCGTAGTCCCAGCTA 60 20520 TCTTCCAGCCGAGCATGTCT (22) (54) CCTACCGATGGCCAGCAG 60 24621 TGTTGCGAGGAGCTTGTGTT (19) (54) TCCTGGTTCCTGCTCCTC 55 237

GAAACCGAGCTGTGTGCC GGGCAGGAACCTGGATGT 54 25622 TCTGGGCCTGCTGTCCTTAC (21) (43) TGACCACACTCTCCCATCCA 60 24223 AACCAACACTAAATGCCAGCCT (16) (44) CCTGACCGCCAGCCCTTG 55 22424 GACAGAACCCATGGCACTGA (29) (55) AGAACTAGGGCCAGCAGCAA 61 29625 TGCTCCTTGGAGGTGAAACT (34) (50) GTCCATGTCTCCAAGCCAAG 58 33726 ATCCCCGGCCTCCACTCTGA (18) (22) AACCCTGCCCTCCCCCTG 61 22327 CACTCACGTCTTTGCTTTCT (10) (31) ACTGCTGCTAGGGCCCAC 58 28728 GGGTCCATGGTCCTTTGTGT (17) (41) GCGTGGACACAGAGGCCTTT 60 20329 CTAAGCACCCGCACCCCTCT (14) (41) GTGCCCGGCCAGCAGCTC 61 24630 CATCTCGGGCATCTGCTTAC (17) AGCCGCGTCTTGGTCTTCTC 58 195

CAGCGGCACGAGGAGAAG (19) GGAGAGGAAATGCAAAGGAT 58 18931 TCATGGTGCCCACCTCTT (6) (45) CACCGACCCTCTGTGATGAC 59 30432 TTGCTCCTGACTTGGGCTCT (11) (48) AGAACAGAAGCCTGCGTGAA 60 31233 TTCCCAAGTTGTTGATGT (12) (43) CTTCATATGTAGTTGGCTCA 54 25534 AGCACCAGCCATGAGCCGTGTT (76) (44) GCCCCACGCTGCCACCTGCT 59 29135 GCTGTGGCTGCCTTTAGGTC (22) (32) ACCCTGGGGACACACCTGGT 60 18336 CCCTCACTTCTCCCGCCCAC (7) (60) TTCTGCCGGCTGGGTCCAAG 58 23137 ATCCTGCTGCCACCTTCCTC (67) TCCATCTCCTGCAGCTTGAC 59 206

ACGCCCAGAAGAACGAGAAT (32) GCCAGAGTTTTTTCCAGGAC 56 22138 GTGTTCCCTCTGAGCCACCT (14) (47) CCTGCCTGTCACCCCATCTG 61 20939 CTGCACGCCCAGAGCCCCTA (34) (13) GAGGCAAAGGGGCGGGTGGG 64 26040 CCCGCTGACCCTCTGCTTCT (14) (42) TCTGGGAAGGGGAGGCTGTG 61 214

a Exonic sequences are underlined.b Number of exon bases between primer and begining of translation.

68 Journal of the American Society of Nephrology J Am Soc Nephrol 13: 65–74, 2002

cause of their location at the periphery of the glomerular tuft onthe outer face of the GBM labeled with anti-type IV collagenantibodies (Figure 3A). It was colocalized with that of synap-topodin in the podocyte foot processes, as evidenced by theorange color seen on double immunolabeling (Figure 3E). Inaddition, it was also detected in the podocyte body, at distancefrom the GBM and synaptopodin labelings. Glomerular endo-capillary cells also stained for MYH9 antibodies (Figure 3A).

Characterization of the Mutations and Segregation ofthe Mutation in Families

We tested the 40 coding exons of MHY9 in 12 families andfound a total of 15 sequence variants. Four were polymor-

phisms, and six were silent mutations. Four mutations thoughtto be pathogenic were found in five families. In one of thesefamilies, we found an additional mutation of unknown signif-icance. All were missense heterozygous mutations. These re-sults are summarized in Table 2.

The D1424N mutation observed in family 1 was alreadyreported in a family with the May-Hegglin anomaly (11).D1424N involves a highly conserved aspartic acid residue(Figure 4) in the coiled-coil domain that was also found to bemutated (D1424H) in a family presenting with Fechtner syn-drome (9). This mutation replaces a negatively charged residueby a positively charged amino acid within the coiled-coildomain. It might affect the dimerization of the proteins through

Figure 2. In situ hybridization with MYH9 antisense probe 1 labeled with 35S (A, D, and E) or digoxigenin (B and C) in fetal (A through C)and mature kidney (D and E). Dark-field (A and E) and phase-contrast microscopy (D). Strong hybridization is observed in the lower part ofthe S-shaped body (A and B, arrows) as well as in the capillary loop-stage glomerulus, where it predominates in epithelial cells (C). A highlevel of expression observed in mature glomeruli, particularly in podocytes (D and E, arrows). The pattern observed with probe 2 was the same.Sense probes showed only background. Magnifications: �80 in A; �250 in B and C; and �350 in D and E.

J Am Soc Nephrol 13: 65–74, 2002 MYH9 Expression in Kidney and Novel MYH9 Mutations 69

their � helices. DNA was available for patients II-1 and III-1,who both carried the heterozygous mutation. This G3A mu-tation at position 4270 was not found in 48 controlchromosomes.

The G3A mutation observed at position 5521 of the codingregion of the cDNA in family 2, which predicts a change fromglutamic acid to lysine at amino acid 1841, has already beenreported in seven unrelated families with MTCP (9,10). Itaffects a conserved acidic residue in the rod repeat 37 of the�-helical coiled-coil domain. This residue is conserved in themajority of myosins. In four smooth-muscle myosins as well asin drosophila nonmuscle myosin II, another negatively chargedhydrophilic amino acid (an aspartic acid) fits that position(Figure 4). In family 2, patients II-3 and III-2 carried themutation, whereas DNA from the mother of III-2 was not

mutated. DNA from patients II-1, II-2, and III-1 were notavailable. This mutation was not found in 48 controlchromosomes.

Family 5 carried an R1165L mutation due to a G3T tran-sition at position 3494 in the cDNA. A missense mutationaffecting the same arginine (R1165C) was reported elsewherein a family with Sebastian syndrome (9). This arginine ishighly conserved in the coiled-coil domain of nonmuscle andmuscle myosins (Figure 4). Its substitution by a leucine wouldchange a positively charged residue with a neutral amino acidwithin the coiled-coil domain, probably resulting in modifica-tion of polar interactions. We were not able to study thesegregation of the mutation in that family, because DNA wasavailable only for patient III-3. This mutation was not found in48 control chromosomes.

Figure 3. Double immunolabeling with MYH9 antibodies (in green), type IV collagen (A), �5 chain of type IV collagen (B), and synaptopodin(D and E) antibodies (in red). Nonmuscle heavy chain IIA is expressed in the glomeruli, peritubular vessels, and the proximal tubule brushborder (A). Within the glomerulus, it is expressed in endocapillary cells (B, arrowheads) and in podocytes (A and B, arrows), as shown by theoverlapping labeling with synaptopodin (E). Magnifications: �350 in A; �650 in B; �500 in C through E.

70 Journal of the American Society of Nephrology J Am Soc Nephrol 13: 65–74, 2002

We found the C3T mutation in exon 1 at position 287 ofthe cDNA (Figure 5), predicting a change from serine toleucine at amino acid 96 (S96L), in two families (families 3and 4) that originated from South America and France, respec-tively. In family 4, patient III-1 and her mother, II-5, carriedthe mutation, whereas neither of the mother’s brothers nor herparents carried this mutation. In family 3, the unaffected par-ents of individual II-2 did not carry the mutation. This mutationoccurred in a CpG pair, which suggests that its recurrence infamilies that originate from different parts of the world is dueto methylation-mediated deamination. In addition, this muta-tion is a de novo mutation in both individual II-2 in family 3and in individual II-5 in family 4, which rules out the possi-bility of a founder effect responsible for the occurrence of thesame mutation in these two families. This mutation occurs inthe globular head of the myosin heavy chain, downstream from

the SH3 domain. The serine at position 96 is located at theextremity of the 96 to 107 helix (which correspondes to 99 to110 in Gallus gallus smooth-muscle myosin [22]). As shown inFigure 4, this amino acid is conserved in nonmuscle andsmooth muscle myosins in all species. In human skeletal andcardiac myosins, either a glycine or an alanine fits that posi-tion. These two amino acids are also quite small. Figure 6shows a space-filling representation of the region with any ofthe three amino acids from the wild-type myosins (Figure 6, Athrough C) or with the leucine substitution (Figure 6D). Thebulkier side chain of leucine may be predicted to collide withcysteine 91 and, in doing so, to disturb the organization of theregion. Furthermore, the leucine substitution results in the lossof the hydrogen bound normally linking S96 to N93 (notshown). This mutation was not found in 48 control chromo-somes. Surprisingly, another mutation located in exon 30,which substitutes an arginine to a tryptophan in the coiled-coildomain (R1400W), was found in individuals II-2 and I-1 infamily 3. This mutation was not found in 140 controlchromosomes.

DiscussionMutations in the MYH9 gene have been recently reported

elsewhere in nonsyndromic inherited deafness (DFNA17) (25)as well as in the May-Hegglin anomaly and Fechtner andSebastian syndromes (9–11). These three syndromes share theassociation of MTCP and leukocyte inclusions. The May-Hegglin anomaly and Sebastian syndrome can be differentiatedby the ultrastructural aspect of the leukocyte inclusions that areboth different from Dohle bodies seen in acute infections (26).

Figure 4. Clustal W alignment of the amino acid sequences from class II muscle and nonmuscle myosins. Numbering is according to the humanMYH9 sequence. SM, smooth muscle; NM, nonmuscle; MHC, myosin heavy chain; Sk, skeletal; Rn, Rattus norvegicus; Gg, Gallus gallus; Xl,Xenopus laevis; Bt, Bos taurus; Dm, Drosophila melanogaster; Mm, Mus musculus; Oc, Oryctolagus cuniculus; and Ce, Caenorhabditiselegans. GeneBank accession numbers are human MYH9, P35579; Rn. MYH9, NP_037326; Gg. MYH9, P14105; Xl. NMMHCA, AAC83556;human MYH10, AAA99177; Rn. NMMYHB, AAF61445; Gg. NMMHCB, AAA48988; Xl. NMMMHCB, AAA49915; Bt. NMMHCB,BAA36494; Dm. NMII, AAB09049; Ce. NMYII, AAA83339; Rn. neuronal MHC, S21801; Gg. SMMHC, P10587; Mm. SM2, JC5421; Oc.SM2, P35748; human skeletal B, AAD29949; human skeletal A, AAD29950; human fetal skeletal muscle, AAD29951; human perinatalskeletal muscle, P13535; human embryonal, P11055; human extra-ocular, AAD29948; human cardiac muscle beta, P12883; human cardiacmuscle alpha, P13533; and human smooth muscle, P35749.

Table 2. Mutations in the MYH9 gene in five familiesa

Family Phenotype NucleotideChange

Amino AcidChange Exon

1 Fe/Ep G4270A D1424N 302 Ep G5521A E1841K 383 Ep C287T S96L 1

C4198T R1400W 304 Fe/Ep C287T S96L 15 Fe G3494T R1165L 26

a Fe, Fechtner syndrome; Ep, Epstein syndrome; Fe/Ep, familiesfor which there is no information regarding leukocyte morphology.

J Am Soc Nephrol 13: 65–74, 2002 MYH9 Expression in Kidney and Novel MYH9 Mutations 71

Fechtner syndrome, in which leukocyte inclusions look likethose observed in Sebastian syndrome, is distinguished by theadditional occurrence of progressive nephritis and deafnessthat is considered to be a variant of Alport syndrome and by thepresence of congenital cataracts (2).

In this study, we studied MYH9 expression in human kidneyby in situ hybridization and immunohistology. We found thatMYH9 is expressed in both fetal and mature renal tissues.During development, it is mainly expressed in the lower part ofthe late S-shaped body, in both the endothelial cells and thefuture podocytes. Later, MYH9 is widely expressed in the

kidney, mainly in glomeruli and arteriolar and peritubularcapillary endothelial cells. Within the glomerulus, MHY9mRNA and protein are mostly expressed by the podocyte cells,although endocapillary cells show some level of expression. Ithas been shown elsewhere (27) by immunoelectron micros-copy that, within the podocyte, “platelet myosin” was colocal-ized with actin and �-actinin. They are mainly located in thefoot processes but are also present in a continuous narrow layerlocated underneath the entire plasma membrane. Taken to-gether, these data suggest that, in the kidney, nonmuscle heavychain IIA is a major component of the actin-myosin contractileapparatus in the podocyte foot process. It could play a role inmaintaining capillary wall integrity against hydraulic pressurein physiological conditions and/or contribute to the foot pro-cess retraction in pathological conditions. This expression inglomerular epithelial cells is in agreement with the clinical andpathological features observed in Fechtner nephropathy.

Ultrastructural alterations of the GBM close to those ob-served in Alport syndrome have been reported in some patients(5). It will be interesting to study whether basement membraneproteins that are normally synthesized by the glomerular epi-thelial cells are downregulated in these patients. However, theexpression of the �3, �4, and �5 chains of type IV collagen inthe GBM was shown to be normal in some patients affectedwith nephropathy and MTCP (28).

Because mutations in MYH9 were found in different syn-dromes with MTCP and leukocyte inclusions, with or withoutassociated kidney disease, we looked for mutations in this genein families with progressive nephropathy associated withMTCP, regardless of the presence of polynuclear inclusions.Indeed, many patients were not examined for leukocyte mor-phology. In addition, the characterization of leukocyte inclu-sions, which is the central point for a correct differentiationbetween Fechtner and Epstein syndromes, may be missed ifonly a few cells are screened. Therefore, the distinction be-tween Fechtner and Epstein syndromes may be not definitive.None of the patients had congenital cataracts. Using SSCP, wescreened the 40 coding exons of the MYH9 gene in 12 unre-lated families, including 3 with Epstein syndrome, as deter-mined by leukocyte morphology that used Giemsa-stainedsmears. Epstein syndrome was previously shown to be genet-ically linked to 22q11-13 (12), but no mutations have beenreported in this syndrome so far. We found four mutations thatare thought to be pathogenic in five families, including twowith Epstein syndrome. Three are located in the coiled-coilrod, and one affects the motor domain of the protein.

In families with several affected individuals, the varioussymptoms (nephritis, deafness, and MTCP) are frequentlypresent in various combinations in different individuals (Figure1). Such variability in penetrance and expressivity, alreadyreported for many families in the literature, suggests that othergenes and/or environmental events might influence the pheno-typic expression of the mutation. The D1424N mutation is notalways associated with kidney disease in family 1 and has beenreported elsewhere in a family with MTCP without renalinvolvement (11). The E1841K mutation that we found infamily 2, in which all affected individuals have kidney disease,

Figure 5. Mobility shift observed in single-strand conformation poly-morphism of DNA in members of family 4. The heterozygous muta-tion C287T in patient III-1 and II-5 is not present in patients I-1, I-2,II-1, II-2, II-3, and II-4.

Figure 6. Schematic representation of amino acid 99 (correspondingto human S96) and cysteine 94 (corresponding to C91 in human)mapped onto the G. gallus smooth-muscle heavy-chain crystal struc-ture backbone (22). A, S96; B, G96; C, A96; and D, L96 as predictedby the C3T mutation at position 287 of the cDNA. The bulkier sidechain of the leucine is predicted to collide with the cysteine 91. Theprograms used were Swiss-Pdb viewer (23) and Rasmol (24).

72 Journal of the American Society of Nephrology J Am Soc Nephrol 13: 65–74, 2002

has been reported elsewhere in seven families without renalinvolvement, six with May-Hegglin anomaly, and one witheither May-Hegglin or Sebastian syndrome (9,10). In family 5,which carries the R1165L mutation, several patients sufferfrom isolated MTCP, whereas others show the association ofMTCP, deafness, and nephropathy. R1165L affects a codonfound elsewhere to be mutated in Sebastian syndrome(R1165C) (9). Finally, the S96L mutation identified in twounrelated families has not been reported before. In one family(family 4), the mother is affected with MTCP, deafness, andnephropathy, whereas her daughter suffers from MTCP andhearing loss but has not developed proteinuria or hematuria atage 6 yr. In family 3, the female affected with the samemutation does not suffer from deafness.

The affected patient in family 3 carries, in addition to theS96L de novo mutation, a R1400W mutation that was inheritedfrom her father, who is not affected with MTCP or nephropa-thy. We were not able to determine whether these two muta-tions are located on one or on two different alleles in thepatient. We believe that the S96L mutation is pathogenic,because it affects a conserved amino acid, it is predicted toperturb the helical region, and it segregates with the disease infamily 4. Conversely, the arginine at position 1400 is lessconserved, and its substitution is not responsible for any phe-notype in the father in family 3. However, the R1400W was notfound in 140 control chromosomes. Thus, we cannot rule out apathogenic role for that variant that would not be expressed inthe father. In addition it might influence the phenotypic ex-pression of the S96L mutation. More generally, polymor-phisms or rare variants in MYH9 itself or within other genesinteracting with MYH9 might play a role in the renal expres-sivity of MYH9 mutations. Whether MYH9 variants might playa role in the course of other glomerular nephropathies remainsanother open question.

We did not find any mutation in MYH9 in seven otherfamilies. From a clinical point of view, these families are notdistinguishable from the five families that were found to carrya mutation, apart from family 10, in which one affected indi-vidual was found to have abnormal liver enzymes and hyper-cholesterolemia. Elevation of transaminases and alkaline phos-phatase with hypercholesterolemia have been reportedelsewhere in several members of a family with Fechtner syn-drome (29). In that family, the liver defect seemed to beinherited with an incomplete penetrance. The case we reporthere suggests that liver involvement is part of the Fechtnersyndrome and that liver enzymes and cholesterol levels shouldbe investigated in those families.

The mutation rate we report here is lower than that detectedfor other genes when we used SSCP in our laboratory. It ispossible that some mutations have been missed because of thepresence of polymorphism (which makes additional band shiftsdifficult to detect) or because of a large rearrangement, such asa deletion, that would not be detected by SSCP. Anotherpossibility is that the association of MTCP and glomerularnephropathy is a genetically heterogeneous syndrome, al-though data from linkage analysis (6–8,12) do not favor thishypothesis.

In conclusion, we describe here the wide expression ofMYH9 in fetal and mature kidneys and show that nonmusclemyosin heavy chain IIA is mainly expressed in podocytes. Wereport four MYH9 mutations associated with MTCP and pro-gressive nephropathy. Two are new mutations, and two hadbeen reported elsewhere in families with the May-Hegglinanomaly. Furthermore, we show for the first time that MYH9mutations are associated with Epstein syndrome. These results,along with recent articles that have shown the involvement ofMYH9 in isolated inherited deafness (25), as well as in MTCPwith leukocyte abnormalities (9–11), illustrate the broad rangeof phenotypes associated with MYH9 mutations. It does alsodemonstrate the variable penetrance and expressivity of thedifferent symptoms within a given family and between familiesthat carry the same mutation. This study will contribute tounraveling a complex classification of diseases includingMTCP that until now was based on leukocyte morphology andon the presence or absence of symptoms that are actually dueto incomplete penetrance and variable expressivity. The nextstep is now to characterize the genetic and epigenetic factorsimplicated in the phenotypic expression of the glomerulardisease associated with MYH9 mutations.

AcknowledgmentsWe thank the patients, families, and physicians who contributed to

this work. This study was supported by the Association Francaisecontre les Myopathies, the Fondation pour la Recherche medicale, theAssociation Claude Bernard, and the Association pour l’Utitisation duRein Artificiel. We are grateful to Thomas Edmons for technicalassistance. We are indebted to Doreen Broneer for her comments onthis manuscript.

References1. Epstein CJ, Sahud MA, Piel CF, Goodman JR, Bernfield MR,

Kushner J, Ablin AR: Hereditary macrothrombocytopathia, ne-phritis and deafness. Am J Med 52: 299–310, 1972

2. Peterson L, Rao V, Crosson J, White J: Fechtner syndrome. Avariant of Alport syndrome with leukocyte inclusions and mac-rothrombocytopenia. Blood 65: 397–406, 1985

3. Hegglin R: Gleichzeitige konstitutionelle Veranderungen anNeutrophilen und Thombozyten. Helv Med Acta 12: 439–440,1945

4. Greinacher A, Nieuwenhuis HK, White JC: Sebastian plateletsyndrome: A new variant of hereditary macrothrombocytopeniawith leukocyte inclusions. Blut 61: 282–288, 1990

5. Moxey-Mims MM, Young G, Silverman A, Selby DM, WhiteJG, Kher KK: End stage renal disease in two pediatric patientswith Fechtner syndrome. Pediatr Nephrol 13: 782–786, 1999

6. Kunishima S, Kojima T, Tanaka T, Kamiya T, Ozawa K, Naka-mura Y, Saito H: Mapping of a gene for May-Hegglin anomalyto chromosome 22q. Hum Genet 105: 379–383, 1999

7. Toren A, Amariglio N, Rozenfeld-Granot G, Simon A, Brok-Simoni F, Pras E, Rechavi G: Genetic linkage of autosomaldominant Alport syndrome with leucocyte inclusion and macro-thrombocytopenia (Fechtner syndrome) to chromosome 22q11–13. Am J Hum Genet 65: 1711–1717, 1999

8. Martignetti J, Heath K, Harris J, Bizzaro N, Savoia A, BalduiniC, Desnick R: The gene for May-Hegglin anomaly localizes to a

J Am Soc Nephrol 13: 65–74, 2002 MYH9 Expression in Kidney and Novel MYH9 Mutations 73

�1-Mb region on chromosome 22q12.3–13.3. Am J Hum Genet66: 1449–1454, 2000

9. The May-Hegglin/Fechtner Syndrome Consortium. Mutations inMYH9 result in the May-Hegglin anomaly, and Fechtner andSebastian syndromes. Nat Genet 26: 103–105, 2000

10. Kelley MJ, Jawien W, Ortel TL, Korczak JF: Mutation of theMYH9 gene, encoding non-muscle heavy chain A, in May-Hegglin anomaly. Nat Genet 26: 106–108, 2000

11. Kunishima S, Kojima T, Matsushita T, Tanaka T, Tsurusawa M,Furukawa Y, Nakamura Y, Okamura T, Amemiya N, NakayamaT, Kamiya T, Saito H: Mutations in the NMMHC-A gene causeautosomal dominant macrothrombocytopenia with leukocyte in-clusions (May-Hegglin anomaly/Sebastian syndrome). Blood 97:1147–1149, 2001

12. Toren A, Rozenfeld-Granot G, Rocca B, Epstein C, Amariglio N,Laghi F, Landolfi R, Brok-Simoni F, Carlsson L, Rechavi G,Greinacher A: Autosomal dominant giant platelet syndromes: Ahint of the same genetic defect as in Fechtner syndrome owing toa similar linkage to chromosome 22q11–13. Blood 96: 3447–3451, 2000

13. Sellers JR: Myosins:A diverse superfamily. Biochim BiophysActa 1496: 3–22, 2000

14. Simons M, Wang M, MCBride W, Kawamoto S, Yamakawa K,Gdula D, Adelstein R, Weir L: Human non-muscle myosin heavychains are encoded by two genes located on different chromo-somes. Circ Res 69: 530–539, 1991

15. Knebelmann B, Deschenes G, Gros F, Hors MC, Grunfeld JP,Zhou J, Tryggvason K, Gubler MC, Antignac C: Substitution ofarginine for glycine 325 in the collagen alpha 5 (IV) chainassociated with X-linked Alport syndrome: Characterization ofthe mutation by direct sequencing of PCR-amplified lymphoblastcDNA fragments. Am J Hum Genet 51: 135–142, 1992

16. Saez CG, Myers JC, Shows TB, Leinwand LA: Human non-muscle myosin heavy chain mRNA: Generation of diversitythrough alternative polyadenylation. Proc Natl Acad Sci USA 87:1164–1168, 1990

17. Heidet L, Cai Y, Sado Y, Ninomyia Y, Thorner P, GuicharnaudL, Boye E, Chauvet V, Cohen Solal L, Beziau A, Garcia TorresR, Antignac C, Gubler MC: Diffuse leiomyomatosis associatedwith X-linked Alport Syndrome: Extracellular matrix study usingimmunohistochemistry and in situ hybridization. Lab Invest 76:233–243, 1997

18. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, FuchshuberA, Dahan K, Gubler MC, Niaudet P, Antignac C: The NPHS2

gene encoding a novel glomerular protein, podocin, is mutated inautosomal recessive steroid-resistant nephrotic syndrome. NatGenet 24: 349–354, 2000

19. Miller M, Bower E, Levitt P, Li D, Chantler PD: Myosin IIdistribution in neurons is consistent with a role in growth conemotility but not synaptic vesicle mobilization. Neuron 8: 25–44,1992

20. Cai YI, Sich M, Beziau A, Kleppel MM, Gubler MC: Collagendistribution in focal and segmental glomerulosclerosis: An im-munofluorescence and ultrastructural immunogold study.J Pathol 179: 188–196, 1996

21. Saunier S, Calado J, Heilig R, Silbermann F, Benessy F,Morin G, Konrad M, Broyer M, Gubler MC, Weissenbach J,Antignac C: A novel gene that encodes a protein with aputative src homology 3 domain is a candidate gene forfamilial juvenile nephronophthisis. Hum Mol Genet 6: 2317–2323, 1997

22. Dominguez R, Freyzon Y, Trybus KM, Cohen C: Crystal struc-ture of a vertebrate smooth muscle myosin motor domain and itscomplex with essential light chain: Visualization of the pre-power stroke state. Cell 94: 559–571, 1998

23. Guex N, Peitsch MC: SWISS-MODEL and the Swiss-Pdb-Viewer: An environment for comparative protein modeling.Electrophoresis 18: 2714–2723, 1997

24. Sayle RA, Milner-White EJ: RASMOL: Biomolecular graphicsfor all. Trends Biochem Sci 20: 374, 1995

25. Lalwani J, Goldstein MJ, Kelley MJ, Luxford W, Castelein CM,Mhatre AN: Human non syndromic hereditary deafnessDFNA17 is due to a mutation in non-muscle myosin MYH9.Am J Hum Genet 67: 1121–1128, 2000

26. Cawley JC, Hayhoe FG: The inclusions of the May-Hegglinanomaly and Dohle bodies of infection: Ultrastructural compar-ison. Br J Haematol 22: 491–496, 1972

27. Drenckhahn D, Kranke RP: Ultrastructural organization of con-tractile and cytoskeletal proteins in glomerular podocytes ofchicken, rat and man. Lab Invest 59: 673–681, 1988

28. Naito I, Nomura S, Inoue S, Kagawa M, Kawai S, Gunshin Y,Joh K, Tsukidate C, Sado Y, Osawa G: Normal distribution ofcollagen IV in renal basement membranes in Epstein’s syn-drome. J Clin Pathol 50: 919–922, 1997

29. Gershoni-Baruch R, Baruch Y, Viener A, Lichtig C: Fechtnersyndrome: Clinical and genetic aspects. Am J Med Genet 31:357–367, 1988

74 Journal of the American Society of Nephrology J Am Soc Nephrol 13: 65–74, 2002