1 23

Journal of Molecular Neuroscience ISSN 0895-8696 J Mol NeurosciDOI 10.1007/s12031-014-0445-x

Expression of a Second Ecto-5′-Nucleotidase Variant Besides theUsual Protein in SymptomaticPhase of Experimental AutoimmuneEncephalomyelitisIrena Lavrnja, Danijela Laketa, DanijelaSavic, Iva Bozic, Ivana Bjelobaba, SanjaPekovic & Nadezda Nedeljkovic

1 23

Your article is protected by copyright and all

rights are held exclusively by Springer Science

+Business Media New York. This e-offprint is

for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

Expression of a Second Ecto-5′-Nucleotidase VariantBesides the Usual Protein in Symptomatic Phase of ExperimentalAutoimmune Encephalomyelitis

Irena Lavrnja & Danijela Laketa & Danijela Savic & Iva Bozic &

Ivana Bjelobaba & Sanja Pekovic & Nadezda Nedeljkovic

Received: 4 September 2014 /Accepted: 13 October 2014# Springer Science+Business Media New York 2014

Abstract Ecto-5′-nucleotidase/cluster of differentiation73 (CD73) (eN) is a 70-kDa glycoprotein expressed inseveral different mammalian tissues and cell types. It isthe rate-limiting enzyme of the purine catabolic path-way, which catalyzes the hydrolysis of AMP to produceadenosine with known anti-inflammatory and immuno-suppressive actions. There is strong evidence for lym-phocyte and endothelial cell eN having a role in exper-imental autoimmune encephalomyelitis (EAE), but therole of eN in cell types within the central nervoussystem is less clear. We have previously shown thateN activity significantly increased in the lumbar spinalcord during EAE. The present study is aimed to exploremolecular pattern of the eN upregulation over thecourse of the disease and cell type(s) accountable for

the induction. EAE was induced in Dark Agouti (DA)rats by immunization with the spinal cord tissue homog-enate and adjuvant. Animals were sacrificed 8, 15, and28 days following immunization (D8, D15, and D28),i.e., at time points which corresponded to the presymp-tomatic, symptomatic, and postsymptomatic phases ofthe disease, respectively. Significant increase in eN ac-tivity and its upregulation at the gene and the proteinlevels were demonstrated at D15 and less prominentlyat D28 in comparison to control. Additionally, reactiveastrocytes abundantly present in the lumbar spinal cordparenchyma were identified as principal cell type withsignificantly elevated eN expression. In all experimentalgroups, eN was expressed as a 71-kDa protein band ofuniform abundance, whereas the overexpression of eNat D15 and D28 was associated with the expression of asecond 75-kDa eN variant. The possible outcome of eNupregulation during EAE as a part of protective astro-cyte repertoire contributing to the resolution of thedisease is discussed.

Keywords Ecto-5′-nucleotidase/CD73 . Astrocytes . EAE .

Neuroinflammation . Adenosine . Glycosylation

AbbreviationsATP Adenosine triphosphateCNS Central nervous systemD Days after immunizationEAE Experimental autoimmune encephalomyelitiseN Ecto-5′-nucleotidaseENT Equilibrative nucleoside transporterMS Multiple sclerosisNTPDase Nucleoside triphosphate diphosphohydrolasePanx1 pannexin 1

Irena Lavrnja and Danijela Laketa contributed equally to this work.

I. Lavrnja :D. Savic : I. Bozic : I. Bjelobaba : S. PekovicInstitute for Biological Research “Sinisa Stankovic”, University ofBelgrade, Boulevard Despot Stefan 142, Belgrade 11060, Serbia

I. Lavrnjae-mail: irenam@ibiss.bg.ac.rs

D. Savice-mail: danisto@ibiss.bg.ac.rs

I. Bozice-mail: iva.bozic@ibiss.bg.ac.rs

I. Bjelobabae-mail: ivana.bjelobaba@ibiss.bg.ac.rs

S. Pekovice-mail: spekovic@ibiss.bg.ac.rs

D. Laketa :N. Nedeljkovic (*)Institute for Physiology and Biochemistry, Faculty of Biology,University of Belgrade, Studentski trg 3, Belgrade 11001, Serbiae-mail: nnedel@bio.bg.ac.rs

D. Laketae-mail: danijela@bio.bg.ac.rs

J Mol NeurosciDOI 10.1007/s12031-014-0445-x

Author's personal copy

Introduction

Multiple sclerosis (MS) is a chronic neurodegenerative dis-ease, characterized by a progressive loss of neurological func-tions due to immune-mediated demyelination and axonal lossin multiple areas of the brain and spinal cord (Keegan andNoseworthy 2002; Lassmann et al. 2007). Although there isevidence for both genetic and environmental components ofsusceptibility to MS (Niino et al. 2007; Ascherio and Munger2007), the common effector phase in development and pro-gression of MS is widespread and continuous or recurringinflammation driven by autoreactive T cells that infiltrate thecentral nervous system (CNS). However, the lack of lympho-cyte recruitment after the initial relapsing phase of the diseasepoints to other factors which may drive the pathology in laterphases, and there is increasing evidence implicating residentglial cells in the mechanism of the disease.

Among resident cells within the CNS, astrocytes are re-ceiving increasing attention for their complex roles in neuro-inflammation associated with MS (Brück 2005; Voskuhl et al.2009; Lavrnja et al. 2012; Ingram et al. 2014). Although,widespread reactive astrogliosis in different areas of the brainand spinal cord is the prominent feature of MS (Eng et al.1970; Liedtke et al. 1998; Hostenbach et al. 2014), roles ofreactive astrocytes during peripherally initiated, adaptive, oracquired immune CNS inflammation in vivo are not fullyunderstood. Astrocytes establish close contact with bloodvessels, regulate leukocyte entry to the CNS (John et al.2005; Mills et al. 2008, 2012), and produce number of pro-inflammatory chemokines, cytokines, and various reactiveoxygen species (ROS), thus acting as mediators of neuroin-flammation (Dong and Benveniste 2001; Chen and Swanson2003; Farina et al. 2007; Nair et al. 2008). However, scar-forming reactive astrocytes may protect CNS tissue by limit-ing the spread of immune and inflammatory leukocytes intoCNS parenchyma and by producing anti-inflammatory cyto-kines and ROS scavengers (Aloisi et al. 1997; Nair et al. 2008;Voskuhl et al. 2009).

The role of purinergic signaling inMS is another promisingarea of the research. Extracellular adenosine triphosphate(ATP) has been recognized as damage-associated molecularpattern (Virgilio et al. 2009; Fiebich et al. 2014), with impor-tant role in inflammation and immune responses associatedwith MS (Matute 2011). Excessive ATP signaling throughmultiple P2X and P2Y receptors can be deleterious to neuronsand oligodendrocytes (Franke et al. 2012). ATP acts as pro-inflammatory agent, recruiting neutrophils and monocytes,facilitating leukocyte adhesion to the endothelium(Henttinen et al. 2003), and potentiating the release of pro-inflammatory cytokines (Hide et al. 2000; Bours 2006). ATPalso acts as a chemoattractant to microglia and astrocytes(Franke et al. 2012). The role of ATP in neuroinflammationis closely related to its final breakdown product, nucleoside

adenosine, which performs several important roles in theimmunity. Adenosine exhibits strong anti-inflammatory andimmunosuppressive actions by inhibiting T cell proliferation(Kobie et al. 2006), secretion of cytokines, and migration ofleukocyte across endothelial barriers (Thompson et al. 2008).The interrelation between ATP and adenosine is additionallybased on the co-expression and co-localization of their respec-tive purinoreceptors, P2 and P1, and their metabolizing en-zymes at all neuronal and glial cell types. Specifically, theact ions of ext racel lu lar ATP are terminated byectonucleotidase enzyme cascade, which sequentiallyremoves phosphate groups from ATP to produce adenosine(Zimmermann et al. 2012). Nucleotides ATP and ADP areh y d r o l y z e d by e c t o - n u c l e o s i d e t r i p h o s p h a t ediphosphohydrolase 1–3 (NTPDase1–3), whereas the finalstep of the conversion is catalyzed by ecto-5′-nucleotidase,which produces adenosine (Zimmermann and Braun 1999).

Ecto-5′-nucleotidase (eN/Cluster of differentiation 73(CD73)) is a divalent cation-dependent AMP-hydrolyzingenzyme. The protein is glycosyl phosphatidylinositol (GPI)-linked membrane-bound glycoprotein, with its active sitefacing the extracellular compartment. In rodents, the enzymecomprises 576 amino acids with a predictedmolecular mass of57–59 kDa (Wada et al. 1986). The rat protein possesses fivepotential sites forN-glycosylation (Misumi et al. 1990), whosetotal or partial occupation along with the changing composi-tion of the N-linked oligoglycans explains the wide diversityof eN variants (Vogel et al. 1991; Zimmermann 1992). Thevarying oligosaccharides may be responsible for the reporteddifferences in size and kinetic behavior of eN variants indistinct tissues and cell types, between healthy and patholog-ical tissues, and, even, between eN components arising fromthe same cell type (Wada et al. 1986; Vogel et al. 1991;Misumi et al. 1990; Zimmermann 1992; Cunha et al. 2000;Grkovic et al. 2014). The enzyme belongs to the clusterof differentiation family (CD73) and has role as celladhesion molecule implicated in a variety of biologicalprocesses, including cell adhesion, spreading, growth,and migration (Vogel et al. 1991; Zimmermann et al.2012).

Several lines of evidence suggest involvement of eN/CD73in the neuroinflammatory process associated with MS.Specifically, CD73−/− mice are highly resistant to inductionof experimental autoimmune encephalomyelitis (EAE), awell-defined immune-driven model for MS (Mills et al.2008). The resistance is due to lack of eN/CD73 and adeno-sine receptor signaling, which are both required for efficiententry of lymphocytes into the CNS during EAE development(Mills et al. 2008, 2012). On the other hand, a disease phase-specific enhancement of eN activity was demonstrated in thelumbar spinal cord tissue over the course of EAE (Lavrnjaet al. 2009). Several inflammatory factors associated withdevelopment and progression of MS/EAE regulate the

J Mol Neurosci

Author's personal copy

expression of eN by astrocytes in vitro (Brisevac et al. 2012),whereas IFN-β, one of the most effective therapeutics for MS,upregulates eN expression on endothelial cells in vivo andin vitro (Airas et al. 2007; Niemela et al. 2008). Therefore, theaim of present study was to describe the pattern of eN expres-sion at molecular and cellular level over the course of EAE.Significant induction of eN at transcriptional level was shownin the lumbar spinal cord during acute symptomatic andpostsymptomatic phases of clinical EAE. The upregulationof eN at the protein level and increase in the enzyme activitywere demonstrated as well, wherein the upregulation at theprotein level was associated with the appearance of a secondeN variant with slightly different apparent molecular weight.Based on immunofluorescence data, it was demonstrated thatreactive astrocytes were preeminent source of eN during EAE.Since abundant localization of eN at highly hypertrophiedastrocytes was manifested in the symptomatic andpostsymptomatic phases of this monophasic disease, collecteddata indicate that overexpression of eN by reactive astrocytesmay be part of protective astrocyte repertoire during acuteinnate inflammation.

Materials and Methods

Induction of EAE

All experiments were conducted using 2-month-old male ratsof Dark Agouti inbred strain from the local colony. Animalprocedures were approved by the Ethical Committee for theUse of Laboratory Animals of Institute for BiologicalResearch “Sinisa Stankovic” (Belgrade, Serbia), as being incompliance with the EEC Directive (86/609/EEC) on theprotection of animals used for experimental and other scien-tific purposes. Animals were housed (3–5/cage) under con-ventional conditions (constant temperature and humidity, 12-hlight/dark cycle) and had free access to food and water. Duringperiod of paralysis, animals were watered manually.

Animals were randomly divided into two groups. EAEgroup was injected with 100 μL of an encephalitogenic emul-sion of rat spinal cord homogenate (50 % w/v in saline) mixedwith an equal volume of complete Freund’s adjuvant contain-ing 0.5 mg/mLMycobacterium tuberculosis (CFA; Sigma, St.Louis, MO, USA). The dosage was divided in halves andsubcutaneously injected in both hind footpads .Immunization was performed under ether anesthesia. Thegroup of age-matched intact animals was used as a control.

Disease Severity Assessment

Each morning, animals were examined, weighed, and scoredfor neurological signs of EAE for 28 days after immunization(D). Disease severity was assessed according to standard 0–5

EAE grading scale, with 0.5 points for intermediate neurolog-ical findings: 0, unaffected; 0.5, partial loss/reduced tail tone,characterized by inability to curl the distal end of the tail; 1,tail atony; 1.5, slightly/moderately clumsy gait, impairedrighting ability or combination; 2, hind limb weakness; 2.5,partial hind limb paralysis; 3, complete hind limb paralysis;3.5, complete hind limb paralysis and fore limb weakness; 4,tetraplegic; and 5, moribund state or death. To ensure impar-tiality and avoid errors arising from bias, blind scoring wasperformed by two independent experimenters who were un-aware of the protocol. Scores for each animal were averagedand plotted as daily mean clinical score (Fig. 1).

After immunization, animals developed acute monophasicdisease with 100 % incidence. First signs of the diseaseappeared, on average, at D9. The values peaked at D14 anddecreased afterwards during the period of recovery, with allrats completely recovered at D24. Neurological scores aregiven in Table 1. According to neurological scoring, the timepoints selected for the analysis, D8, D15, and D28, representlate presymptomatic (score 0), acute symptomatic (2–3), andpostsymptomatic (score 0) phase of the disease, respectively.

Tissue Preparation

Rats were deeply anesthetized with Zoletil® 50 (Virbac,France; 30 mg/kg i.p.). Animals from EAE group weresacrificed at D8, D15, and D28 (three/group). Age-matchednaive animals were used as control. Spinal cords were rapidlydissected on ice. Lumbar region of the spinal cords was usedfor all further tissue processing.

eN Assay

Animals were sacrificed under deep anesthesia, and lumbarspinal cords were dissected and pooled (three/group) for crudeplasma membrane preparation (Gray and Whittaker 1962).Ecto-5′-nucleotidase (eN) was assayed in a reaction mediumcontaining (in mmol/L): 100 Tris–HCl, pH 7.4, and 10MgCl2and 50 μg of crude membrane preparation proteins in the finalvolume of 200 μL. The reaction mixtures were preincubatedfor 10 min at 37° and then incubated for 30 min in thepresence of 1 mM AMP. The reactions were stopped byaddition of 20 μL of 3 mol/L perchloric acid. The sampleswere chilled on ice, and amount of inorganic phosphate (Pi)released as a result of the enzyme reaction was determined byMalachite Green Phosphate assay kit (Bioassay system,Hayward, CA, USA). Incubation time and protein concentra-tion were chosen in order to ensure the linearity of the reac-tion. All samples were run in triplicate in n-independentdeterminations. Enzyme activities were expressed as nmolPi/mg of protein/min.

J Mol Neurosci

Author's personal copy

Real-Time PCR

Animals were sacrificed at D8, D15, and D28 (three/group).Lumbar spinal cord was dissected, and the tissue was imme-diately frozen in liquid nitrogen and kept at −80 °C until RNAextraction. Gene expression analyses were performed byquantitative reverse transcription (qRT)-PCR using SYBRGreen PCR Master Mix and standardized protocol. Briefly,total RNAwas isolated using TRIzol reagent (Invitrogen LifeTechnologies, Carlsbad, CA, USA). The RNA concentrationwas assessed by determining optical density (OD) 260, where-as the purity was evaluated based on OD260/OD280 ratio(1.8–2.1, for all samples) and gel inspection. RNAwas reversetranscribed using High-capacity complementary DNA(cDNA) RT kit (Applied Biosystems, Carlsbad, CA, USA).Reactions were performed in a 25-μL reaction mixture con-taining SYBR Green PCR Master Mix and the cDNA tem-plate (10 ng of RNA converted to cDNA). Reactions werecarried out in the ABI Prism 7000 Sequence Detection System(Applied Biosystems, USA) under the optimized conditions.Primer sequences are given in Table 2 (Invitrogen, Germany).As the validity of the method critically depends on the con-stant expression of a reference gene, the condition was testedin preliminary experiments with the use of four reference

genes: cyclophilin A (CycA), hypoxanthine-guaninephosphoribosyltransferase (HPRT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and actin. The mostconsistent expression was obtained with GAPDH, whichwas used for quantification by the ΔCt method. Relativeexpression of target genes was calculated by comparing theCt values in each sample with the Ct values of the internalstandard, and data were expressed as the ratio of the amount ofeach transcript vs. concentration of GAPDH. Melting curves

Fig. 1 Disease severity scores. EAE was induced in DA rats followingimmunization with rat spinal cord homogenate (50 %w/v emulsion insaline) in complete Freund’s adjuvant. Naive rats served as a control.Animals were scored for neurological signs of EAE according to thestandard 0–5 EAE grading scale. Animals (9/group) were sacrificed atD8, D15, and D28, which corresponded to the presymptomatic, acutesymptomatic, and postsymptomatic phases, respectively. Data areexpressed as the mean clinical score±SEM

Table 1 EAE neurological scores

Neurological parameter Score

Incidence 29/29 (100 %)

Disease onset (D±SEM) 9.3±0.4

Duration of the disease (mean days±SEM) 10.3±0.8

Duration of paralysis (mean days±SEM) 1.9±0.3

Mean maximum severity score 2.3±0.2

Table 2 Primer sequences used for qRT-PCR

Target gene Primer sequence (5′→3′)

eN/CD73 (f): CAAATCTGCCTCTGGAAAGC

(r): ACCTTCCAGAAGGACCCTGT

NTPDase1 (f): TCAAGGACCCGTGCTTTTAC

(r): TCTGGTGGCACTGTTCGTAG

NTPDase2 (f): TGCTTCGACACAGATCACCT

(r): GATGAACAGCCCTGTGATGA

AdoR1 (f): GTGATTTGGGCTGTGAAGGT

(r): GAGCTCTGGGTGAGGATGAG

P2X1 (f): GTGTTTGGGATTCACTTTGATA

(r): TCTGCTTGTAGTAGTGCCTCTT

P2X2 (f): AGAAGAGTGACTACCTCAAGCA

(r): ACAGTTCCAGTTGATGATGACT

P2X3 (f): CCTCACCGACAAGGACATA

(r): ACACCCAGCCGATCTTAAT

P2X4 (f): TCCTGATAAGACCAGCATTT

(r): CAAGAGGGTGAAGTTTTCTG

P2X5 (f): CAAATCTCTACTGTCCCATCTT

(r): TAGTAGTGTGGGTTGCATTTAG

P2X7 (f): TCGGAGAGAACTTTACAGAGG

(r): ACAGGGACTCATTGGTGTACT

Panx1 (f): CCACCGAGCCCAAGTTCAA

(r): GGAGAAGCAGCTTATCTGGGT

ENT1 (f): CACTTCCTTCGCTGTTAGGG

(r): TGTCCCCCTACCACTCTGAC

ENT2 (f): CCCTCATGACCTTCTTCCTG

(r): CCAAGAGACCCGGTATAGCA

TGF-β (f): ACGGTGATGCGGAAGCAC

(r): CCCTGCCCCTACATTTGG

IL-10 (f): GCTCAGCACTGCTATGT

(r): GTCTGGCTGACTGGGAAGTG

TNF-α (f): CTCCCAGAAAAGCAAGCAAC

(r): CGAGCAGGAATGAGAAGAGG

Vimentin (f): CGTACGTCAGCAATATGAAAGTGTG

(r): TCAGAGAGGTCAGCAAACTTGGA

GFAP (f): CTCCTATGCCTCCTCCGAGACGAT

(r): GCTCGCTGGCCCGAGTCTCTT

GAPDH (f): TGGACCTCATGGCCTACAT

(r): GGATGGAATTGTGAGGGAGA

J Mol Neurosci

Author's personal copy

and gel electrophoresis of the PCR products were routinelyperformed to determine this specificity of the PCR reaction(not shown).

Western Blot

Animals were sacrificed under deep anesthesia, and lumbarspinal cords were dissected and pooled (three/group) for crudeplasma membrane preparation (Gray and Whittaker 1962).The tissue was homogenized in the isolation buffer(0.32 mol/L sucrose, 5 mmol/L Tris, pH 7.4) and centrifugedat 1,000×g for 10 min at 4 °C. Resulting supernatant wascentrifuged at 12,000×g for additional 30 min, and the pelletwas resuspended and homogenized in 5 mmol/LTris, pH 7.4,and kept on −70 °C until use. The protein contents weredetermined using Micro BCA Protein Assay Kit (ThermoFisher Scientific, Rockford, USA), according to the manufac-turer’s instruction.

Crude plasma membrane samples were diluted 1:1 in 2×sample buffer (Bio-Rad, USA), and equivalent amounts(24 μg of proteins) were resolved on 7.5 % sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) gelsand transferred to a PVDF support membrane. After blockingwith 5 % bovine serum albumin (BSA, Sigma-Aldrich, USA)in Tris-buffered saline/Tween 20 (TBST), the blots wereprobed overnight at 4 °C with the rabbit monoclonal anti-eNantibodies (1:1 500 dilution in 2 % BSA/TBST; CellSignaling, USA). Bands were visualized on X-ray films(Kodak) with the use of chemiluminescence, after incubatingsupport membrane for 2 h at room temperature in donkey anti-goat IgG-horseradish peroxidase-conjugated secondary anti-bodies (1:5,000 dilution; Santa Cruz Biotechnology, SantaCruz, CA, USA). The intensity of the bands was evaluatedby densitometric analysis using ImageQuant 5.2 software.The optical density of each protein band was normalizedagainst optical density of the β-actin band on the same laneand expressed relative to control (100 %). Data are expressedas mean effect±SEM from eight separate determinations.

Immunofluorescence

Isolated tissues were fixed in Bouin solution for 48 h,dehydrated in a series of alcohol, immersed in xylene, andembedded in paraffin. Five-micrometer-thick horizontal sec-tions of the lumbar spinal cord (L1–L5) were cut, and fiveconsecutive slices were placed on the same glass slide.Antigen retrieval was performed in heated citrate buffer (pH6) and tissue permeabilization with 0.3 % Triton X-100 inphosphate-buffered saline (PBS) in order to enhance staining.Normal donkey serum (10 % solution in PBS; Santa CruzBiotechnology, Santa Cruz, CA, USA) was used to blockunspecific labeling. For double immunofluorescence labeling,sections were incubated with anti-CD73 antibodies (1:200,

Santa Cruz Biotechnology, Santa Cruz, CA, USA), followedby incubation with the antibodies against specific cellmarkers: rabbit anti-GFAP (1:500, DAKO, Glostrup,Denmark), mouse anti-ED1 (1:200, Abcam, MA, USA), orgoat-anti-Iba1 (1:200, Abcam, MA, USA) antibodies.Immune complexes were visualized with donkey anti-goatAlexa Fluor 555 (1:200), donkey anti-rabbit Alexa Fluor488 (1:200), donkey anti-mouse IgG Alexa Fluor 488(1:200), donkey anti-rabbit Alexa Fluor 555 (1:200), anddonkey anti-goat Alexa Fluor 488 (1:200), all purchased fromInvitrogen (Carlsbad, CA, USA). Sections incubated withappropriate secondary antibodies without the primary anti-body were used as negative control. The sections weremounted in Mowiol (Calbiochem, Millipore, Germany) andcaptured on Zeiss Axiovert fluorescent microscope equippedwith camera and EC Plan-Apochromat 100× objective, usingthe Apotome system for obtaining optical sections.

Data Analysis

Statistical analysis was performed by using R version 2.8.1software (The R Foundation for Statistical Computing,Vienna, Austria) and Origin version 7.4 software. A one-way analysis of variance (ANOVA) followed by Tukey’s posthoc test (considering p<0.05 as significant) was used todetermine the significant alterations in relative protein andmessenger RNA (mRNA) abundances.

Fig. 2 eN activity over the course of EAE. Ecto-5′-nucleotidase activitywas assayed in crude plasma membrane preparation obtained from thelumbar spinal cord of control animals and animals at D8, D15, and D28.The activity was assayed in the presence of 1 mM AMP. The results areexpressed as mean specific activities (nmol Pi/mg protein/min)±SEMfrom n=9 determinations performed in duplicate, from two independentplasma membrane preparations. Dot line represents mean eN activity±SEM (gray area) measured in control animals. *p<0.01 (ANOVAfollowed by Tukey’s post hoc test)

J Mol Neurosci

Author's personal copy

Results

eNActivity is Significantly Upregulated in the Lumbar SpinalCord in a Disease Phase-Specific Manner

eN activity was assayed in lumbar spinal cord plasma mem-brane preparations obtained from control animals and animalsat D8, D15, and D28, which corresponded to the presymptom-atic phase, acute symptomatic phase, and postsymptomaticphase of EAE, respectively. At the earliest time point afterthe induction, eN-hydrolyzing activity was comparable withthe activity of control (Fig. 2). The AMP hydrolysis wassignificantly upregulated at D15 and D28, being 2-fold(p<0.01) and 1.5-fold higher (p<0.01) than in control,respectively.

eN mRNA is Significantly Upregulated in the Lumbar SpinalCord over the Course of EAE

eN gene expression was determined in the lumbar spinalcord tissue by qRT-PCR. While relative abundance of

eN mRNA at D8 was comparable with the abundance incontrol (Fig. 3a), the level significantly increased inEAE animals at D15 (2.5-fold induction, p<0.01) andD28 (2-fold induction, p<0.01).

To identify related genes that may be regulated over thecourse of EAE, gene expression of several relevantectonucleotidases, purinoreceptors, nucleoside transporters,and cytokines was analyzed over the time course of EAE(Fig. 3b). Of the 17 genes analyzed, 16 were differentiallyexpressed at some point during EAE. Of these, only P2X1,P2X3, and pannexin 1 (Panx1) were altered at D8, a time pointassociated with disease onset. At D15, transcripts encodingNTPDase1, tumor necrosis factor (TNF)-α, transforminggrowth factor (TGF)-β, and IL-10 increased more than 5-fold,whereas ENT1 decreased to less than 30 % of the control. AtD28, among purinergic genes, transcripts for NTPDase1,NTPDase2, ENT1, ENT2, Panx1, and P2X7 were significant-ly altered. Based on the collected data, sample correlationcoefficients (R) were calculated using R version 2.8.1 soft-ware. Statistically significant correlation with eN gene expres-sion was obtained for NTPDase1 (R=0.992, p=0.045), ENT1

Fig. 3 Gene expression profiling. a Ecto-5′-nucleotidase gene expres-sion. Bars represent mean±SEM of eN mRNA (relative to GAPDH),measured from total RNA isolated from lumbar spinal cord of EAE rats atD8, D15, and D28. Dot line represents mean eN mRNA level±SEM(gray area) measured in control animals. Samples are from three animalsper each group. *p<0.01 (ANOVA followed by Tukey’s post hoc test). bGene expression in the lumbar spinal cord tissue from control animals andEAE animals at D8, D15, and D28, as determined by qRT-PCR. The

mRNA levels were normalized to GAPDH and displayed in a heat map asa ratio of EAE to control animals, to determine fold differences inexpression at each disease phase. c Based on quantitative RT-PCR data,sample correlation coefficients (R) were calculated using R version 2.8.1software. Graph shows statistically significant correlations between eNand NTPDase1 (close square), TGF-β (open circle), ENT1 (closetriangle) and IL-10 (diamonds)

J Mol Neurosci

Author's personal copy

(R=−0.993, p=0.045), TGF-β (R=0.980, p=0.012), and IL-10 (R=0.953, p=0.047) (Fig. 3c).

eN is Upregulated at the Protein Level Due to Expressionof a Second 75-kDa Variant

eN protein expression was determined by Western blotting.Crude membrane preparations of lumbar spinal cord wereresolved on SDS-PAGE and probed with anti-CD73 antibody(Fig. 4). In control rats and animals at D8, the enzyme wasexpressed as a single 71-kDa band, abundantly expressed overthe course of the disease (Fig. 4a). At D15 and D28, theantibody revealed another band at about 75-kDa molecularweight. The abundance of 71-kDa band did not vary over acourse of the disease. However, the 75-kDa variant, whichappeared at D15 with the abundance similar to the 71-kDaband at the same time point, decreased at D28 to about onethird of the corresponding 71-kDa band abundance (Fig. 4b).When abundances of both protein bands were combined

(Fig. 4c), 4-fold increase in total eN abundance was revealedat D15 compared with control (p<0.01), demonstrating closecoupling of eN expression at transcriptional and translationallevels.

eN is Primarily Associated with Reactive AstrocytesDuring EAE

To evaluate glial cell contribution to observed upregulation ofeN during EAE, double immunofluorescence stainings wereperformed against eN and glial cell markers. Contribution ofreactive astrocytes was evaluated by eN/GFAP double label-ing (Fig. 5). At control sections, eN reactivity demarcatedsurface of large ellipsoid (Fig. 5a) and smaller ovoid(Fig. 5b) cells, which, according to anatomical and morpho-logical criteria, belonged to neurons. The signal was alsoprominent at the surface of blood vessels (Fig. 5c) or scatteredthroughout gray matter parenchyma. The reactivity wasscarcely observed in association with astrocytic processes

Fig. 4 eN expression at the protein level. a Representative supportmembranes of lumbar spinal cord preparation probed with anti-eN anti-bodies and visualized on X-ray films with the use of chemiluminescence.The antibody revealed single 71-kDA band at control and D8 andadditional 75-kDa band at D15 and D28. b Intensities of the bands wereassessed by densitometry using ImageQuant5.2 software. Band intensitywas expressed relative to the optical density of the β-actin band on thesame lane. The eN/β-actin ratio in control preparation was arbitrarilydefined as 1.0. The eN/β-actin ratios in EAE animals were expressed as

relative mean effects±SEM from n=8 separate determinations. Barsrepresent mean relative abundance (±SEM) of 71-kDa (light gray) and75-kDa (dark gray) band in lumbar spinal cord. c Total abundance of bothprotein bands in EAE animals in lumbar spinal cord. Mean total abun-dance in control animals is represented as dot line±SEM (light grayarea). Significance inside the graph: asterisk denotes significance (atp<0.01) in respect to control; number sign denotes significance (atp<0.05) in 75-kDA abundance in respect to control

J Mol Neurosci

Author's personal copy

(Fig. 5c) and never at astrocyte cell bodies strongly labeled forGFAP (Fig. 5c, d). In the white matter, eN immunoreactivitywas not localized at GFAP-positive astrocyte processes con-tributing to the glial limiting membrane (Fig. 5e), but promi-nently labeled the outer meningeal layer (Fig. 5f). In sectionsobtained at D8 (Fig. 6), altered eN pattern was observed. TheeN immunoreactivity almost completely disappeared fromneuronal somata, while bulk eN immunofluorescence exhibit-ed diffuse, punctuated pattern with apparent acellular localiza-tion (Fig. 6a–c). The reactivity was sporadically found atGFAP-positive astrocyte processes in the gray and white mat-ter (Fig. 6d–f). At D15 sections, similar pattern of eN reactivitywas observed, scarcely in association with hypertrophied pro-toplasmic (Fig. 6g–i) and fibrous (Fig. 6j–l) astrocyte process-es. At D28 sections, however, not just that general intensity ofeN reactivity noticeably increased in comparison to D15, butGFAP immunoreaction exhibited a pattern typical for reactiveastrocytes (Fig. 7). Strong eN immunosignal was almostcompletely localized at cell bodies and enlarged processes ofhypertrophied astrocytes in the gray matter (Fig. 7a–f).Similarly, numerous double-labeled fibrous astrocytes wereobserved in the white matter (Fig. 7g–l), providing almostcompletely overlapping signal.

Contribution of microglia to eN expression over the courseof EAE was evaluated by double immunofluorescence label-ing for eN and ED1, marker of activated rat microglia andmacrophages (Fig. 8). While ED1 immunoreactivity was ab-sent at control sections (Fig. 8a), at D8, reactive microgliawere found scattered between eN-positive structures (Fig. 8b).At D15, ED1 reactivity revealed typical pattern of reactivemicrogliosis. Numerousmicroglia were accumulated through-out the parenchyma, particularly in the vicinity of bloodvessels, displaying distinctive amoeboid morphology(Fig. 8c). In addition to microglia, abundant ovoid ED1-positive cells, probably macrophages, populated perivascularspace around thinly eN-labeled blood vessels (Fig. 8d). AtD28, reactive microglia were still dispersed amonghypertrophied eN-positive astrocytic processes, yet apparentlyless dense compared to D15 (Fig. 8e, f). Similar pattern ofmicroglial activation was observed at sections immunolabeledfor eN and microglial marker Iba1 at D15 (Fig. 9a, b) and D28(Fig. 9c, d). However, with the exception of few eN/Iba1-positive microglial cells captured at D15 (Fig. 9a), eN reac-tivity was generally sparsely localized at Iba1- or ED1-positive elements. Although one cannot exclude a contribu-tion of other cell types, like infiltrated lymphocytes, to

Fig. 5 Doubleimmunofluorescence labeling foreN and GFAP at control lumbarspinal cord sections. In controlsections, eN (red fluorescence)labels large ellipsoid (a, arrow)and smaller ovoid cells (b, arrow)that probably belong to neurons.The signal is abundantly presentat large blood vessels (c, arrow).The fluorescence is rarelyobserved at GFAP-positiveastrocyte processes (a, asterisk),and has never been observed atprotoplasmic astrocyte cell bodiesabundantly labeled for GFAP (c).In the white matter, eN reactivitystrongly labels the pial surface(arrow, e) and is completelyabsent from GFAP-positivefibrous astrocyte processes whichextend to the pial surface (f,arrowhead). Scale bar: 50 μm

J Mol Neurosci

Author's personal copy

observed upregulation of eN over the course of EAE, theresults strongly support the conclusion that reactive astrocytesare the preeminent glial source of upregulated eN during EAE.

Discussion

The present study was aimed to explore a pattern of eNexpression in EAE and to shed more light on the complexrole(s) of the enzyme in acute neuroinflammatory processesassociated with EAE. The disease was induced in Dark Agouti(DA) rats by injection of complete spinal cord tissue homog-enate in Freund’s adjuvant. After immunization, animals de-veloped acute monophasic disease, with 100 % incidence.First neurological signs of EAE appeared 9 days after immu-nization (D9), and the severity of illness peaked at D14,whereas the neurological signs disappeared at D24.Accordingly, in order to explore alterations in eN expressionthat may contribute to initiation, development, and/or resolu-tion of EAE, the study was performed at D8, D15, and D28,

which corresponded to presymptomatic, acute symptomatic,and postsymptomatic phases of the disease, respectively.

The main findings of present study are the following:(i) eN is significantly upregulated in the lumbar spinalcord at mRNA, protein, and functional levels at D15 andD28, whereas the alterations are not observed in D8 incomparison to control; (ii) in all experimental groups, eNis expressed as a 71-kDa band of invariable abundance,while the overexpression of the enzyme at D15 and D28is due to the appearance of a second protein variant ofabout 75-kDa molecular weight; and (iii) reactive astro-cytes are the principal cells overexpressing eN in thelumbar spinal cord over the course of EAE.

It has been known, for some time, that innate CNS inflam-matory processes initiated after ischemia or brain injury areassociated with prominent increase in the activity and expres-sion of eN at reactive astrocytes (Braun et al. 1998;Nedeljkovic et al. 2006; Bjelobaba et al. 2011). This is thefirst study to show that peripherally initiated adaptive CNSinflammation is also associated with significant astrocyticupregulation of eN, in a disease phase-specific manner.

Fig. 6 Immunolocalization of eNat lumbar spinal cord sections atD8 and D15. At D8 sections, eNreactivity is almost completelyabsent from neuronal cell bodiesand exhibits a diffuse, punctuatedpattern of reactivity (a–c).Prominent blood vessel labelingis observed (arrow, a). Astrocyticcolocalization of eN and GFAPwas scarcely observed in thewhite matter (asterisk, d–f). AtD15, the general intensity of eNimmunofluorescence slightlyincreased (g–l). In the gray matter,punctuated pattern of reactivitywas observed, without associationwith hypertrophied GFAP-positive astrocytes (arrowhead,g–i). In the white matter, eNreactivity was colocalized withhypertrophied GFAP-positivefibrous astrocytes (asterisk, j–l).Scale bar: 50 μm

J Mol Neurosci

Author's personal copy

Since eN is the rate-limiting enzyme in the ectonucleotidasecascade (Cuhna and Ribeiro 2000), which controls the balancebetween the pro-inflammatory ATP and anti-inflammatoryadenosine (Zimmermann 2000), the enzyme is considered akey regulator of a direction and extent of inflammatory pro-cess within the CNS (Eltzschig et al. 2012). Indeed, numerousevidence confirms neuroprotective, anti-inflammatory, andimmunosuppressive actions of adenosine via attenuationof excitatory neurotransmission, secretion of pro-inflammatory cytokines, T cell proliferation, and migra-tion of leukocyte across endothelial barriers (Bours2006; Kobie et al. 2006; Thompson et al. 2008). Thus,prominent induction of eN activity in the lumbar spinalcord during the symptomatic and postsymptomaticphases of EAE implicates enhanced adenosine produc-tion which most likely directs inflammation toward theresolution of the monophasic illness.

Our study demonstrates that eN upregulation is closelycoupled at transcriptional, translational, and functional levels.Several-fold increase in eN mRNA, protein, and functionallevels is evidenced at D15 in comparison to control, whereas

the effect is less prominent at D28. The eN protein isexpressed in all experimental groups as 71-kDa band of uni-form abundance, whereas at D15, second prominent 75-kDaband appears which mostly accounts for the increase in totaleN protein expression. eN protein variants differing in theapparent molecular weight have been already identified, aswell as changes in their expression during physiological ofpathological conditions (Christensen 1996; Navarro et al.1998; Cunha et al. 2000; Garcıa-Ayllon et al. 2001; Morote-Garcia et al. 2006; Grkovic et al. 2014). Specifically, eN is aglycoprotein with five potential N-glycosylation sites that allcan be modified, resulting in distinct variants differing inrespect to the carbohydrate moieties attached to the proteincore (Fini et al. 2000; Zimmermann et al. 2012). It is wellappreciated that glycosylation is essential for folding, intra-cellular sorting, and externalization of proteins (Roth et al.2010). Therefore, a degree and type of glycan moieties at-tached to eN probably affect its solubility, stability, and cata-lytic activity (Garcıa-Ayllon et al. 2001; Morote-Garcia et al.2006). Beyond its catalytic activity, altered pattern of glyco-sylation may also affect other eN properties, such as cell

Fig. 7 Immunolocalization of eNat lumbar spinal cord sections atD28. Strong eN reactivity (red)(arrow, d) is localized at GFAP-positive (green) protoplasmicastrocytes with typical reactiveappearance in the gray matter(asterisk, c, f), sometimes inassociation with blood vessel(asterisk, f). In the white matter,eN reactivity completely overlaps(yellow) with hypertrophiedGFAP-positive fibrous astrocytes(asterisk, g–l). Scale bar: 50 μm

J Mol Neurosci

Author's personal copy

recognition, cell-cell, and/or cell-matrix interactions (GarciaRedondo et al. 2004), affecting in such a way various physi-ological and pathophysiological processes. Taken together,our study suggests that acute symptomatic phase of EAE isassociated with the upregulation of eN and expression of adistinct eN glycoconjugate variant, whereas the molecularbasis and functional outcomes of altered glycosylation needto be explained.

Several lines of evidence demonstrate that eN activity,function, and regulation by inflammatory factors differ inspecific cell types and tissues (Airas et al. 2007; Niemelaet al. 2008). Thus, to evaluate the exact physiological outcomeof the eN induction during EAE, it is necessary to consider atissue context in which the induction takes place. Namely,upregulation of eN by peripheral lymphocytes and the pres-ence of the enzyme on either T cells or vascular endothelialcells are absolutely required for the efficient entry of lympho-cytes into the CNS during EAE (Mills et al. 2008, 2012).These results led to the conclusion that eN is critical fordevelopment of EAE. Our study shows, quite the reverse, thatwithin the CNS, eN is expressed in low levels in the presymp-tomatic phase, whereas the upregulation begins at the peak of

the disease and progresses toward its resolution, along withthe upregulation of GFAP and development of full-blownreactive astrocyte phenotype. Results also reveal that upregu-lation of eN overlaps with anti-inflammatory gene expression,such as TGF-β and IL-10, which are distinctive for the pro-resolving phase of EAE (Jun et al. 2012; Blazevski et al. 2013;Zhang et al. 2013), as well as with a decrease in TNF-α,known to precede the recovery from EAE (Warford et al.2014). Additionally, the pattern of eN expression displaysstrong negative correlation with equilibrative nucleosidetransporter 1 (ENT1) gene expression and positive correlationwith NTPDase1 gene expression. In regard to the latter, it wasalready evidenced that EAE coordinates both transcriptional(this study) and functional expression of NTPDase1 (Lavrnjaet al. 2009). Therefore, concomitant increase in eN andNTPDase1 activity and downregulation of ENT1, which me-diates adenosine transport down the concentration gradient,significantly amplifies extracellular production and accumu-lation of adenosine in the CNS parenchyma. Taken together,our results suggest that within the CNS, overexpression of eN,mainly at reactive astrocytes, may be a part of a pro-resolvingphase of inflammation and protective repertoire of astrocytes.

Fig. 8 Doubleimmunofluorescence labelingagainst eN and ED1 at lumbarspinal cord sections. a Controlsection immunolabeled againsteN (red) does not displaynoticeable ED1 immunoreactivity(green). b At D8, ED1-positivecells were found scatteredbetween eN-positive structures(arrowhead). cAt D15, numerousED1-positive cells areaccumulated throughout theparenchyma, displayingdistinctive reactive amoeboidmorphology (arrowhead). dAbundant ovoid ED1-positivemacrophages in the perivascularspace around thinly eN-labeledblood vessels (arrow). e, f AtD28, ED1-positive reactivemicroglia (arrowhead) dispersedamong abundant strongly eN-positive astrocytic processes(arrow). Scale bar: 50 μm

J Mol Neurosci

Author's personal copy

Moreover, since the enzyme may be involved in both devel-opment and resolution of acute inflammation in EAE, we canspeculate that eN constitutes the regulatory element of afeedback loop in which its pro-inflammatory actions produceappropriate spatial and temporal induction of its anti-inflammatory activity, according to “the beginning programsthe end” concept of inflammation (Serhan and Savill 2005).

In summary, results of the study revealed that eN expres-sion significantly increases over the course of EAE, in adisease phase-specific manner. The transcriptional, transla-tional, and functional upregulation of eN is most pronouncedin the symptomatic phase and less prominent in thepostsymptomatic phase of the disease. The bulk of eN duringthe phases of the disease is localized at reactive astrocytes,abundantly present in the lumbar spinal cord of EAE rats. Theenzyme overexpression in the peak of the disease is mainlydue to appearance of the 75-kDa protein variant not present incontrol animals and animals in the presymptomatic phase ofEAE. Further studies are required on alterations of the glyco-sylation pathways in the Golgi apparatus/endoplasmic reticu-lum, in transport pathways, or in localization of eN glycoformsto define molecular basis of observed alterations and to ascer-tain how enhanced eN expression contributes to the resolutionof the monophasic inflammation during EAE. Our studyalso supports the view that functions of astrocytes dur-ing acute inflammation are complex and context-

dependent and cannot be regarded as simply pro-inflammatory or anti-inflammatory.

Acknowledgments This study is supported by the Ministry of Educa-tion, Science and Technological Development of the Republic of Serbia,Project No. III41014.

References

Airas L, Niemela J, Yegutkin GG, Jalkanen S (2007) Mechanism ofaction of IFN-β in the treatment of multiple sclerosis: a specialreference to CD73 and adenosine. Ann NYAcad Sci 1110:641–648

Aloisi F, Penna G, Cerase J, Menendez IB, Adorini L (1997) IL-12production by central nervous system microglia is inhibited byastrocytes. J Immunol 159:1604–1612

Ascherio A, Munger KL (2007) Environmental risk factors for multiplesclerosis. II. Noninfectious factors. Ann Neurol 61:504–513

Bjelobaba I, Parabucki A, Lavrnja I, Stojkov D, Dacic S, Pekovic S,Rakic L, Stojiljkovic M, Nedeljkovic N (2011) Dynamic changes inthe expression pattern of ecto-5′-nucleotidase in the rat model ofcortical stab injury. J Neurosci Res 89:862–873

Blazevski J, Petkovic F, Momcilovic M, Jevtic B, Miljkovic D,Mostarica-Stojkovic M (2013) High interleukin-10 expression with-in the central nervous system may be important for initiation ofrecovery of Dark Agouti rats from experimental autoimmune en-cephalomyelitis. Immunobiology 218:1192–1199

Bours MJ (2006) Adenosine 5′-triphosphate and adenosine as endoge-nous signalingmolecules in immunity and inflammation. PharmacolTher 112:358–404

Fig. 9 Doubleimmunofluorescence labelingagainst eN and Iba1 microglialmarker at lumbar spinal cordsections. a At D15, numerousIba1-positive cells (green)displaying typical morphology ofreactive microglia (arrowhead)accumulated in the gray matterand b the white matter of lumbarspinal cord between eN-positiveelements (red). Sporadically,colocalization of eN at Iba1-positive cells is observed(asterisk). At D28, number ofIba1-positive cells decreased,both in the gray (c) and the whitelumbar spinal cord matter (d).Scale bar: 50 μm

J Mol Neurosci

Author's personal copy

Braun N, Zhu Y, Krieglstein J, Culmsee C, Zimmermann H (1998)Upregulation of the enzyme chain hydrolyzing extracellular ATPafter transient forebrain ischemia in the rat. J Neurosci 18:4891–4900

Brisevac D, Bjelobaba I, Bajic A, Clarner T, Stojiljkovic M, Beyer M,Andjus P, Kipp M, Nedeljkovic N (2012) Regulation of ecto-5′-nucleotidase (CD73) in cultured cortical astrocytes by differentinflammatory factors. Neurochem Int 61:681–688

Brück W (2005) The pathology of multiple sclerosis is the result of focalinflammatory demyelination with axonal damage. J Neurol 252S:v3–v9

Chen Y, Swanson RA (2003) Astrocytes and brain injury. J Cereb BloodFlow Metab 23:137–149

Christensen LD (1996) No correlation between CD73 expression andecto-5′-nucleotidase activity on blood mononuclear cells in vitro.Evidence of CD73 (ecto-5′-nucleotidase) on blood mononuclearcells with distinct antigenic properties. APMIS 10:126–134

Cuhna RA, Ribeiro JA (2000) ATP as a presynaptic modulator. Life Sci68:119–137

Cunha RA, Brendel P, Zimmermann H, Ribeiro JA (2000)Immunologically distinct isoforms of ecto-5′-nucleotidase in nerveterminals of different areas of the rat hippocampus. J Neurochem 74:334–338

Dong Y, Benveniste EN (2001) Immune function of astrocytes. Glia 36:180–190

Eltzschig HK, Sitkovsky MV, Robson SC (2012) Purinergic signalingduring inflammation. N Engl J Med 367:2322–2333

Eng LF, Gerstl B, Vanderhaeghen JJ (1970) A study of proteins in oldmultiple sclerosis plaques. Trans Am Soc Neurochem 1:42

Farina C, Aloisi F, Meinl E (2007) Astrocytes are active players incerebral innate immunity. Trends Immunol 28:138–145

Fiebich BL, Akter S, Akundi RS (2014) The two-hit hypothesis forneuroinflammation: role of exogenous ATP in modulating inflam-mation in the brain. Front Cell Neurosci 8(260):1–11. doi:10.3389/fncel.2014.00260

Fini C, Amoresano A, Andolfo A, D’Auria S, Floridi A, Paolini S, PucciP (2000) Mass spectrometry study of ecto-5′-nucleotidase from bullseminal plasma. Eur J Biochem 267:4978–4987

Franke H, Verkhratsky A, Burnstock G, Illes P (2012) Pathophysiologyof astroglial purinergic signalling. Purinergic Signal 8:629–657

Garcia Redondo PA, Nakamura CV, de SouzaW,Morgado–Díaz JA (2004)Differential expression of sialic acid and N-acetyl galactosamine resi-dues on the cell surface of intestinal epithelial cells according to normalor metastatic potential. J Histochem Cytochem 52:629–640

Garcıa-Ayllon MS, Campoy FJ, Vidal CJ, Munoz-Delgado E (2001)Identification of inactive ecto-5′-nucleotidase in normal mouse mus-cle and its increased activity in dystrophic Lama2dymice. J NeurosciRes 66:656–665

Gray EG,Whittaker VP (1962) The isolation of nerve endings from brain:an electron microscopic study of cell fragments derived by homog-enization and centrifugation. J Anat 96:79–88

Grkovic I, Bjelobaba I, Nedeljkovic N, Mitrovic N, Drakulic D,Stanojlovic M, Horvat A (2014) Developmental increase in ecto-5′-nucleotidase activity overlaps with appearance of two immuno-logically distinct enzyme isoforms in rat hippocampal synapticplasma membranes. J Mol Neurosci 54:109–118

Henttinen T, Jalkanen S, Yegutkin GG (2003) Adherent leukocytesprevent adenosine formation and impair endothelial barrier functionby ecto-5′-nucleotidase/CD73-dependent mechanism. J Biol Chem278:24888–24895

Hide I, Tanaka M, Inoue A, Nakajima K, Kohsaka S, Inoue K, Nakata Y(2000) Extracellular ATP triggers tumor necrosis factor-alpha re-lease from rat microglia. J Neurochem 75:965–972

Hostenbach S, Cambron M, D’haeseleer M, Kooijman R, De Keyser J(2014) Astrocyte loss and astrogliosis in neuroinflammatory disor-ders. Neurosci Lett 565:39–41

Ingram G, Loveless S, Howell OW, Hakobyan S, Dancey B, Harris CL,Robertson NP, Neal JW, Morgan BP (2014) Complement activationin multiple sclerosis plaques: an immunohistochemical analysis.Acta Neuropathol Commun 2:53

John GR, Lee SC, Song X, Rivieccio M, Brosnan CF (2005) IL-1-regulated responses in astrocytes: relevance to injury and recovery.Glia 49:161–176

Jun S, Ochoa-Reparaz J, Zlotkowska D, Hoyt T, Pascual DW (2012)Bystander-mediated stimulation of proteolipid protein-specific reg-ulatory T (Treg) cells confers protection against experimental auto-immune encephalomyelitis (EAE) via TFG-β. J Neuroimmunol245:39–47

Keegan BM, Noseworthy JH (2002) Multiple sclerosis. Annu Rev Med53:285–302

Kobie JJ, Shah PR, Yang L, Rebhahn JA, Fowell DJ, Mosmann TR(2006) T regulatory and primed uncommitted CD4 Tcells expressCD73, which suppresses effector CD4 T cells by converting 5′-adenosine monophosphate to adenosine. J Immunol 177:6780–6786

Lassmann H, Bruck W, Lucchinetti CF (2007) The immunopathology ofmultiple sclerosis: an overview. Brain Pathol 17:210–218

Lavrnja I, Bjelobaba I, Stojiljkovic M, Pekovic S, Mostatica-StojkovicM, Stosic-Grujicic S, Nedeljkovic N (2009) Time-course changes inectonucleotidase activities during experimental autoimmune en-cephalomyelitis. Neurochem Int 55:193–198

Lavrnja I, Savic D, Bjelobaba I, Dacic S, Bozic I, Parabucki A,Nedeljkovic N, Pekovic S, Rakic L, Stojiljkovic M (2012)The effect of ribavirin on reactive astrogliosis in experimen-tal autoimmune encephalomyelitis. J Pharmacol Sci 119:221–232

Liedtke W, Edelmann W, Chiu FC, Kucherlapati R, Raine CS (1998)Experimental autoimmune encephalomyelitis in mice lacking glialfibrillary acidic protein is characterized by a more severe clinicalcourse and an infiltrative central nervous system lesion. Am J Pathol152:251–259

Matute C (2011) Glutamate and ATP signalling in white matter patholo-gy. J Anat 219:53–64

Mills JH, Thompson LF, Mueller C, Waickman AT, Jalkanen S,Niemela J, Airas L, Bynoe MS (2008) CD73 is required forefficient entry of lymphocytes into the central nervous systemduring experimental autoimmune encephalomyelitis. PNAS 105:9325–9330

Mills JH, Alabanza LM, Mahamed DA, Bynoe MS (2012) Extracellularadenosine signaling induces CX3CL1 expression in the brain topromote experimental autoimmune encephalomyelitis. JNeuroinflammation 9:193

Misumi Y, Ogata S, Hirose S, Ikehara Y (1990) Primary structureof rat liver 5′-nucleotidase deduced from the cDNA. Presenceof the COOH-terminal hydrophobic domain for possible post-translational modification by glycophospholipid. J Biol Chem265:2178–2183

Morote-Garcia JC, Sanchez Del Campo LF, Campoy FJ, Vidal CJ,Munoz-Delgado E (2006) The increased ecto-5′-nucleotidase activ-ity in muscle, heart and liver of laminin alpha2-deficient mice is notcaused by an elevation in the mRNA content. Int J Biochem CellBiol 38:1092–1101

Nair A, Frederick TJ, Miller SD (2008) Astrocytes in multiple sclerosis: aproduct of their environment. Cell Mol Life Sci 65:2702–2720

Navarro JM, Olmo N, Lopez-Conejo MT, Lizarbe MA (1998) Ecto-5′-nucleotidase from a human colon adenocarcinoma cell line.Correlation between enzyme activity and levels in intact cells. MolCell Biochem 187:121–131

Nedeljkovic N, Bjelobaba I, Subasic S, Lavrnja I, Pekovic S, Stojkov D,Vjestica A, Rakic L, Stojiljkovic M (2006) Upregulation ofectonucleotidase activity after cortical stab injury in rat. Cell BiolInt 30:541–546

J Mol Neurosci

Author's personal copy

Niemela J, Ifergan I, Yegutkin GG, Jalkanen S, Prat A, Airas L (2008)IFN-b regulates CD73 and adenosine expression at the blood–brainbarrier. Eur J Immunol 38:2718–2726

Niino M, Fukazawa T, Kikuchi S, Sasaki H (2007) Recent advances ingenetic analysis of multiple sclerosis: genetic associations and ther-apeutic implications. Expert Rev Neurother 7:1175–1188

Roth J, Zuber C, Park S, Jang I, Lee Y, Kysela KG, Le Fourn V,Santimaria R, Guhl B, Cho JW (2010) Protein N-glycosylation,protein folding, and protein quality control. Mol Cells 30:497–506

Serhan CN, Savill J (2005) Resolution of inflammation: the beginningprograms the end. Nat Immunol 6:1191–1197

Thompson LF, Takedachi M, Ebisuno Y, Tanaka T, Miyasaka M, MillsJH, Bynoe MS (2008) Regulation of leukocyte migration acrossendothelial barriers by ecto-5′-nucleotidase-generated adenosine.Nucleosides Nucleotides Nucleic Acids 27:755–760

Virgilio FD, Ceruti S, Bramanti P, Abbracchio MP (2009) Purinergicsignalling in inflammation of the central nervous system. TrendsNeurosci 32:79–87

Vogel M, Kowalewski HJ, Zimmermann H, Janetzko A, Margolis RU,Wollny HE (1991) Association of the HNK-1 epitope with 5′-nucleotidase from Torpedo marmorata (electric ray) electric organ.Biochem J 278:199–202

Voskuhl RR, Peterson S, Song B, Ao Y, Morales LBJ, Tiwari-WoodruffS, Sofroniew MV (2009) Reactive astrocytes form scar-like

perivascular barriers to leukocytes during adaptive immune inflam-mation of the CNS. J Neurosci 29:11511–11522

Wada I, Himeno M, Furuno K, Kato K (1986) Biosynthesis and intracel-lular transport of rat liver 5′-nucleotidase. J Biol Chem 261:2222–2227

Warford J, Jones QR, Nichols M, Sullivan V, Rupasinghe HP, RobertsonGS (2014) The flavonoid-enriched fraction AF4 suppresses neuro-inflammation and promotes restorative gene expression in a mousemodel of experimental autoimmune encephalomyelitis. JNeuroimmunol 268:71–83

Zhang Q, Cui F, Fang L, Hong J, Zheng B, Zhang JZ (2013) TNF-αimpairs differentiation and function of TGF-β-induced Treg cells inautoimmune diseases through Akt and Smad3 signaling pathway. JMol Cell Biol 5:85–98

Zimmermann H (1992) 5′-Nucleotidase—molecular structure and func-tional aspects. Biochem J 285:345–365

Zimmermann H (2000) Extracellular metabolism of ATP and othernucleotides. Naunyn Schmiedebergs Arch Pharmacol 362:299–309

Zimmermann H, Braun N (1999) Ecto-nucleotidases: molecular struc-tures, catalytic properties, and functional roles in the nervous sys-tem. Prog Brain Res 120:371–385

Zimmermann H, Zebisch M, Strater N (2012) Cellular functions andmolecular structure of ecto-nucleotidases. Purinergic Signal 8:437–502

J Mol Neurosci

Author's personal copy