www.fems-microbiology.org

FEMS Microbiology Letters 240 (2004) 87–97

Evaluation of randomly amplified polymorphic DNA and pulsedfield gel electrophoresis techniques for molecular typing of

Dermatophilus congolensis

Jose Larrasa a, Alfredo Garcıa-Sanchez b, Nicholas C. Ambrose c,1,Alberto Parra a, Juan M. Alonso d, Joaquın M. Rey d, Miguel Hermoso-de-Mendoza d,

Javier Hermoso-de-Mendoza d,*

a Departamento de Microbiologıa, Laboratorios Larrasa S.L., Corredera Hernando de Soto 13-A, Jerez de los Caballeros, 06380 Badajoz, Spainb Bacteriology Division, Moredun Research Institute, Pentlands Science Park, Bush Loan, Midlothian, EH26 0PZ, Scotland, UKc Centre for Tropical Veterinary Medicine, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Scotland, UK

d Catedra de Patologıa Infecciosa, Facultad de Veterinaria, Universidad de Extremadura,

Campus U. EX., Av. de la Universidad s/n, 10071Caceres, Spain

Received 31 May 2004; received in revised form 14 September 2004

First published online 28 September 2004

Edited by M.R. Soria

Abstract

This study aimed to evaluate molecular typing methods useful for standardization of strains in experimental work on dermato-

philosis. Fifty Dermatophilus congolensis isolates, collected from sheep, cattle, horse and a deer, were analyzed by randomly ampli-

fied polymorphic DNA (RAPD) method using twenty-one different primers, and the results were compared with those obtained by

typing with a pulsed field gel electrophoresis (PFGE) method using the restriction digest enzyme Sse8387I. The typeability, repro-

ducibility and discriminatory power of RAPD and Sse8387I-PFGE typing were calculated. Both typing methods were highly repro-

ducible. Of the two techniques, Sse8387I-PFGE was the least discriminating (Dice Index (DI), 0.663) and could not distinguish

between epidemiologically related isolates, whereas RAPD showed an excellent discriminatory power (DI, 0.7694–0.9722). Overall,

the degree of correlation between RAPD and PFGE typing was significantly high (r, 0.8822). We conclude that the DNA profiles

generated by either RAPD or PFGE can be used to differentiate epidemiologically unrelated isolates. The results of this study

strongly suggest that at least two independent primers are used for RAPD typing in order to improve its discriminatory power,

and that PFGE is used for confirmation of RAPD results.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Dermatophilus; RAPD; PFGE; Molecular typing

0378-1097/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2004.09.016

* Corresponding author. Tel.: +34 927 25 71 29; fax: +34 927 25 71

10.

E-mail address: jhermoso@unex.es (J. Hermoso-de-Mendoza).1 Present address: Scottish Executive Environment and Rural

Affairs Department (SEERAD), Pentland House, 47 Robbs Loan,

Edinburgh EH14 1TY, Scotland, UK.

1. Introduction

Dermatophilosis is an exudative dermatitis that af-

fects a wide range of animal species, including humans.

The aetiological agent of dermatophilosis is the branch-

ing filamentous actinomycete bacterium Dermatophilus

congolensis. It has a significant economic impact on

. Published by Elsevier B.V. All rights reserved.

88 J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97

cattle production in West and Central Africa and in the

Caribbean islands, and on sheep production in Aus-

tralia. Acute, subacute, chronic and also latent forms

have been described in many of the affected species

and between breeds in cattle and sheep [1], affecting in

a generalised form or located in diverse body areas: dor-sal region, feet areas, external genital areas, mammary

skin and head area [2–4]. In the tropics, the disease in

cattle is associated with tick-mediated immunosuppres-

sion with extent and nature of lesions varying consider-

ably between breeds. In Australia, dermatophilosis

manifests as lumpy wool in fine-wooled sheep breeds

as Merinos. In horses the disease takes several forms

the most typical being rain scald. In all species the com-monly observed features are proliferation of the epider-

mis to produce thickened crusts or scabs formed from

palisaded layers of keratinocytes, serous exudates and

infiltrates of neutrophils [5].

To date, strategies to control dermatophilosis have

included immunoprophylaxis and treatment with anti-

biotics. However, the available literature indicates that

these strategies have not been successful. In additionto the aforementioned species and breed variation in

clinical symptoms one reason for failure of vaccina-

tion and therapy may be the antigenic, enzymatic, vir-

ulence or pathogenic factor differences between strains

of D. congolensis described by several authors [5–13].

Evidence also points to genetic-based differences be-

tween strains, for example, in a recent study Larrasa

et al. [14], developed a simple RAPD method for gen-otyping field isolates of D. congolensis, where strain

differences were evident. Typing D. congolensis isolates

is a priority for dermatophilosis research. It is re-

quired in order to standardise the experimental use

of different strains for vaccine, diagnostic or antimi-

crobial susceptibility trials between different research

groups and for inter-laboratory exchange of tech-

niques. Standardization of strain characterisation im-prove the chances of success in the field application

of results [15].

According to recent guidelines, the typing efficiency

of RAPD can be improved by the parallel use of sev-

eral primers, and to be certain that two isolates with

the same fingerprint are genetically linked results

should be compared with ‘‘gold standard’’ molecular

typing methods such as pulsed field gel electrophoresis(PFGE) [16]. Comparisons are based in criteria like

typeability, or the ability of the typing method to pro-

duce unmistaken results [17]; reproducibility or ability

to produce the same results in different moments,

places, using different devices or performed by differ-

ent operators [16,18,19]; discriminatory power or the

probability that two randomly selected isolates from

a population of epidemiologically unrelated ones willbe recognized as actually different by the technique

[20].

In addition, special attention should be paid to the

selection of an appropriate set of isolates as studies to

evaluate the typeability and discriminatory power of a

typing system should be carried out with collections of

epidemiologically unrelated isolates [17].

In this study, we evaluated the typeability, reproduc-ibility and discriminatory power of RAPD using 21 dif-

ferent primers, and PFGE using the restriction enzyme

Sse8387I as methods to distinguish between 50 D. cong-

olensis isolates from different geographic origins and

host species. The efficacy of the two techniques to type

D. congolensis strains was then compared.

2. Materials and methods

2.1. Bacterial strains and culture conditions

The fifty D. congolensis isolates used in this study

came from collections held at the University of Edin-

burgh and the University of Extremadura, except two

horse isolates which came from the Institut fur Mikrobi-ologie und Tierseuchen, Tierarztlichen Hochschule

Hannover, Germany, and three type isolates from Brit-

ish and American type culture collections. The isolates,

their host species and geographic origin are listed in

Table 1.

The isolates were cultured on brain heart infusion

agar and in 30 ml of 2% (w/v) brain heart infusion/

1.7% neutralised soya peptone (Oxoid Ltd, Basingstoke,UK), using glass McCartney bottles. Cultures were incu-

bated at 37 �C in 5% CO2 for 24–48 h to produce a dense

growth of hyphae and filaments with a clear supernatant

in broth.

The broth cultures were centrifuged at 4.000g for 15

min at 4 �C using Corning tubes. The pellet was resus-

pended in 10 ml of TE to wash the cells again by

centrifugation.

2.2. RAPD

Template DNA was extracted using a fast non-phe-

nolic method as previously described [14]. A total of

21 arbitrary primers were selected from a group of

33 (see Table 2), on the basis of their ability to pro-

duce polymorphism, visible as a number of clearly de-fined electrophoretic bands in trial experiments using a

generic RAPD protocol [14]. Sequential optimization

of each component of the reaction and the amplifica-

tion conditions were carried out following a previously

described protocol [14]. The final reaction composition

and amplification conditions are shown in Tables 3

and 4.

Randomly amplified products (10 ll) were size sepa-rated on 2% agarose gels by electrophoresis and were

visualized with ethidium bromide.

Table 1

Dermatophilus congolensis isolates

Isolate Host Origin

OA1 (NCTC 7915) Sheep UK

OPOA Sheep Spain

OPOB Sheep Spain

OPOE Sheep Spain

OPOF Sheep Spain

OMR Sheep Spain

ORL Sheep Spain

OT8 Sheep Spain

OT10 Sheep Spain

OTS1 Sheep Spain

OG1 Sheep Spain

OA3 (16793) Sheep UK

OA4 (S3) Sheep UK

OA5 (A1) Sheep UK

OA6 (S598) Sheep UK

OA7 (A5N) Sheep UK

OA8 (NM) Sheep Australia

OA9 (S164) Sheep UK

BE3 (ATCC 14637) Cattle Zimbabwe

B556 Cattle Spain

BTB1 Cattle Spain

BG45 (IMTV M6445) Cattle Guadeloupe

BF13 (5.11A) Cattle Nigeria

BE5 (16.3) Cattle Nigeria

BE7 (Gh�88) Cattle Ghana

BE11 (Gh�89) Cattle Ghana

BE6 (Z8) Cattle Zimbabwe

BE2 (ANU931) Cattle Antigua

BE12 (ANU932) Cattle Antigua

BE4 (SB�86) Cattle Antigua

BE10 (SC�86) Cattle Antigua

BE1 Cattle Santa Lucıa

BE8 (Gh�93B) Cattle Ghana

BE9 (Gh�93C) Cattle Ghana

BC87 (IMVT) Cattle France

BH6 (IMVT) Cattle France

EA2 (NCTC 5175) Horse UK

EDC (43037) Horse UK

EEQ Horse Spain

EWAN Horse Spain

EATI Horse Spain

EISL Horse Spain

EH1 (17174) Horse UK

EH2 (1161) Horse UK

EH3 (1274) Horse UK

EA11 (3.86) Horse UK

ED201 Horse Germany

EK628 Horse Germany

EA10 (Dec84) Horse UK

CH8 Deer UK

Table 2

RAPD: Oligonucleotide primers used

Primer Target DNA Sequence 50 ! 3 0

IS 1* IS 6110 [78] GGCTGAGGTCTCAGATCAG (19 b)

IS 2* IS 6110 [78] ACCCCATCCTTTCCAAGAAC (20 b)

MPTR 1 MPRT [78] GCCGGTGTTGGTGTG (15 b)

Pntb 1* PGRS [79] CCGTTGCCGTACAGCTG (17 b)

Pntb 2* PGRS [79] CCTAGCCGAACCCTTTG (17 b)

DAF 7 Arbitrary [78] GCGCACGGTC (10 b)

RAPD 5 Arbitrary [78] AATGCAGCTGGCTCG (15 b)

OPA 2 Arbitrary [80] TGCCGAGCTG (10 b)

OPC 20 Arbitrary [80] ACTTCGCCAC (10 b)

OPM2 Arbitrary TGCCGAGCTG (10 b)

AP1 Arbitrary GCCACGCCAGTCCAGCTGTG (20 b)

D1 Arbitrary CTGGTCGACT (10 b)

D2* Arbitrary AAGTCCTGCC (10 b)

D3* Arbitrary GTCGGTGTCA (10 b)

D4* Arbitrary CTGGTCACGT (10 b)

D5* Arbitrary AGGTCACCGA (10 b)

D6 Arbitrary TCCAGGACAG (10 b)

D7 Arbitrary GCACCTGGAA (10 b)

D8 Arbitrary GGTAGCCACT (10 b)

D9 Arbitrary CCAGCGTTGA (10 b)

D10 Arbitrary GTTACCCGGA (10 b)

DP1* Arbitrary CCTACCTCAC (10 b)

DP2 Arbitrary TTCCGATGCC (10 b)

DP3 Arbitrary GAAGCAGGGA (10 b)

DP4* Arbitrary CTCCACCTTC (10 b)

DP5 Arbitrary AGAAGCAGCC (10 b)

DP6 Arbitrary TGGTGCGAGT (10 b)

DP7* Arbitrary GCCAGAGTGA (10 b)

DP8* Arbitrary ATTGGCTCGG (10 b)

DP9 Arbitrary ACCTTGCCAG (10 b)

DP10 Arbitrary GCCAAGCAGT (10 b)

DL1 Arbitrary AGAGGTGGCAACAGGTGCGA(20 b)

DL2 Arbitrary CTTCACCTCGTTGTCCACCC (20 b)

Discarded ones are marked with an asterisk.

J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97 89

2.3. PFGE-sample preparation

Initially, in order to standardize a procedure for

PFGE analysis we assessed four different methods to

prepare intact chromosomal DNA embedded in low-

melting-point agarose. The methods were those de-

scribed by Levy-Frebault et al. [21], Udo and Grubb

[22], Matushek et al. [23], and Cornillot et al. [24]. Agar-ose plugs containing a range of DNA concentrations

were tested in order to determine the optimum.

The efficacy of the DNA preparation methods was

evaluated using the following quality criteria [21]: (a)

lack of ‘‘sandy’’ appearance in the blocks, indicative of

enough enzymatic treatment; (b) lack of a DNA ‘‘track’’

after electrophoresis, a sign of efficacy of the enzymes

used to break cells.

Although not wholly successful in its unmodified

form, only Levy-Frebault�s protocol had some apparentefficacy on D. congolensis cells. Therefore, it was modi-

fied by additional homogenization and washing steps,

adjustments of cell concentration, increasing the lyso-

zyme concentration, increasing treatment time with liso-

zyme and proteinase K and increasing the number of

wash steps after enzymatic treatment with simultaneous

reduction of the washing solution concentration. The

modified protocol proved successful for sample prepara-tion, and is described in the results below.

2.4. PFGE-restriction enzyme digestion

Twenty-two restriction enzymes (Amersham Bio-

sciences) (see Table 5) and a variety of electrophoresis

parameters were examined in order to determine the

Table 3

RAPD: Composition of reaction mixture for each primer (50 ll, finalreaction volume)

Primer MgCl2(mM)

DNA

(ng)

Primer

(lM)

dNTPs

(lM)

Polymerase

(U)

MPTR 1 3 75 1.25 150 1.5

DAF 7 3 75 1.25 150 1

RAPD 5 3 75 1.25 150 1.25

OPM 2 4 100 1.5 250 1.5

OPC 20 4 150 1.25 300 1.5

AP1 3 10 1.75 150 1.5

OPA 2 3 10 1 150 1.5

D1 2.5 75 1.25 200 1.5

D6 2.5 150 1 150 1.5

D7 2 125 1.5 150 1.5

D8 3 100 1 150 1.25

D9 2.5 125 1.5 150 1.5

D10 2.5 100 1.5 200 1.5

DP2 3 75 1.25 150 1.5

DP3 4 50 1.25 250 1.5

DP5 3 25 1 200 1.5

DP6 2 75 0.5 250 1.5

DP9 4 100 1.25 300 1.25

DP10 4 50 1.25 300 1.25

DL1 2 75 2.75 200 1.5

DL2 2 100 1 300 2.5

90 J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97

optimal conditions for PFGE typing of the D. congolen-

sis strains. Bacterial DNA was digested with 40 U of

restriction enzyme following the manufacturer�s instruc-tions. After digestion the plugs were loaded into a TE

solution for at least 1 h and were then placed into a

1% (w/v) agarose gel.

2.5. PFGE-separation parameters

Large restriction fragments were separated using a

CHEF MAPPER XA (Bio-Rad Laboratories) appara-

Table 4

RAPD: Amplification specific conditions for each primer

Primer Initial denaturation Denaturation

MPTR 1 – 94 �C/45 s

DAF 7 – 94 �C/1 min 15 s

RAPD 5 94 �C/5 min 94 �C/30 s

OPM2 – 94 �C/1 min 30 s

OPC 20 – 94 �C/45 s

OPA 2 – 94 �C/5 s

AP1 – 94 �C/5 s

D1 94 �C/5 min 94 �C/1 min 30 s

D6 – 94 �C/5 s

D7 94 �C/5 min 94 �C/30 s

D8 – 94 �C/1 min 30 s

D9 – 94 �C/5 s

D10 94 �C/5 min 94 �C/30 s

DP2 94 �C/5 min 94 �C/45 s

DP3 94 �C/2 min 30 s 94 �C/30 s

DP5 – 94 �C/1 min 30 s

DP6 94 �C/5 min 94 �C/30 s

DP9 – 94 �C/1 min 30 s

DP10 – 94 �C/1 min 30 s

DL1 94 �C/5 min 94 �C/30 s

DL2 94 �C/5 min 94 �C/15 s

tus at 14 �C and 6 V/cm for 24 h with a switch time of

1.19–12.92 s (for restriction enzyme Sse8387I). A lamb-

da ladder (Bio-Rad Laboratories) was used as the

molecular size marker. After electrophoresis, the gels

were stained for 50 min with 0.5 mg of ethidium bro-

mide per litre. DNA bands were visualized on a UVtransiluminator and images were digitally recorded with

a gel documentation system (Visionworks, UVP,

Cambridge).

2.6. Reproducibility of RAPD and PFGE

Reproducibility of RAPD was tested using batches of

DNA from the different extraction methods amplified inparallel assays, employing four different thermal cyclers:

A Mastercycler 5330 (EPPENDORF), a Uno-Thermo-

block (BIOMETRA), a DNA Thermal Cycler 480

(PERKIN ELMER) and a Thermal Reactor TR (HYB-

AID). Results were run in parallel in agarose gels and

digitally recorded.

We also tested the reproducibility over time of differ-

ent DNAs extracted successively from an isolate, in dif-ferent stages of their growth curve and for different Taq

polymerases, namely Taq polymerase (Amersham-Bio-

sciences), BioTaq (Bioline) and Taq polymerase (Sigma

Chemicals Co., St. Louis, MO).

Reproducibility of the PFGE fingerprinting was

examined by repeated testing of different subcultures

(20 times subcultured) of the same isolates.

2.7. Discriminatory power of RAPD and PFGE

The discriminatory power of RAPD and PFGE fin-

gerprinting methods were both estimated by the use of

Hybridisation Extension No. cycles

55 �C/45 s 72 �C/45 s 30

45 �C/1 min 15 s 72 �C/45 s 30

40 �C/30 s 72 �C/45 s 30

45 �C/1 min 72 �C/1 min 30

45 �C/45 s 72 �C/45 s 30

40 �C/1 min 72 �C/1 min 30

40 �C/1 min 72 �C/1 min 30

35 �C/1 min 30 s 72 �C/1 min 30 s 30

40 �C/1 min 72 �C/1 min 30

40 �C/30 s 72 �C/45 s 30

45 �C/1 min 30 s 72 �C/1 min 30 s 30

40 �C/1 min 72 �C/1 min 15 s 30

40 �C/1 min 30 s 72 �C/1 min 30 s 30

45 �C/1 min 72 �C/45 s 30

40 �C/1 min 72 �C/45 s 30

50 �C/1 min 72 �C/45 s 30

40 �C/30 s 72 �C/45 s 30

40 �C/30 s 72 �C/1 min 30

50 �C/1 min 72 �C/45 s 30

45 �C/1 min 72 �C/30 s 35

35 �C/40 s 72 �C/30 s 30

Table 6

Diversity indexes (DI), number of D. congolensis types (profiles) by RAPD

Molecular typing method Number of profiles Number of single

RAPD

Primers

AP1 12 8

D1 13 5

D6 17 8

D7 4 0

D8 8 0

D9 12 3

D10 5 0

DP2 6 0

DP3 13 3

DP5 23 15

DP6 16 4

DP9 21 12

DP10 21 14

DL1 13 4

DL2 15 7

DAF 7 16 8

MPTR1 10 5

OPA2 14 6

OPC20 16 8

OPM2 12 6

RAPD5 7 1

All primers 17 11

PFGE 3 0

Table 5

Restriction enzymes used for PFGE

Enzyme Restriction sequence Reaction

temperature

(�C)

Isoschizomeres

AgeI 5 0-AflCCGGT-3 0 25 PinAI

ApaI 5 0-GGGCCflC-30 37 Bsp120I

BglII 5 0-AflCGATCT-3 37

Bpu1102I 5 0-GCflTNAGC-30 37 BlpI, CelII,

EspI

CpoI 5 0-CGflGACCG-30 30 CspI, RsrII

CspI 5 0-CGflG(A/T)CCG-3 0 30 CpoI, RsrII

DraI 5 0-TTTflAAA-30 37

Eco81I 5 0-CCflTNAGG-30 37 AocI, Bsu36I,

CvnI, MstII,

SauI

FseI 5 0-GGCCGGflCC-30 30

MluI 5 0AflCGCGT-3 0 37

NotI 5 0-GCflGGCCGC-30 37

NruI 5 0-TCGflCGA-3 0 37 SpoI

PstI 5 0-CTGCAflG-3 0 37

PvuII 5 0-CAGflCTG-30 37

SacII 5 0-CCGCflGG-30 37 KspI, SstII

SfiI 5 0-GGCCN4flNGGCC-3 0 50

SmaI 5 0-CCCflGGG-30 25 Crf9I, PspAI,

XmaI

SpeI 5 0-AflCTAGT30 37

SrfI 5 0-GCCCflGGGC-30 37

Sse8387I 5 0-CCTGCAflGG-30 37

SspI 5 0AATflATT-30 37

XbaI 5 0-TflCTAGA-30 37

J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97 91

Simpson�s index of diversity, as defined by Hunter and

Gaston (1988) (DI) [20].

Similarity between fingerprints was calculated with

the Pearson product moment correlation coefficient (r).

3. Results

3.1. RAPD

Twenty-one out of 33 primers tested were shown to be

useful for RAPD typing of D. congolensis isolates. Each

primer was able to generate reproducible and highly dis-

criminating RAPD profiles. The DIs ranged from 0.9640(DP10) to 0.7694 (D7) as is shown in Table 6.

3.2. PFGE

The protocol for preparation of samples resulting

from our modifications to Levy-Frebaults�s protocol

was as follows: bacterial culture was harvested by cen-

trifugation and resuspended in a lysis solution contain-ing lysozyme at 0.5 mg/ml and RNase (DNase free) at

10 mg/ml. This mixture was immediately added to an

equal volume of tempered 1.6% low-melting-tempera-

ture agarose. Plugs were then incubated at 37 �C for

24 h in a 5 ml of lysis buffer. The lysis buffer consisted

and PFGE and Pearson�s correlation coefficient (r)

isolate profiles Diversity Index (DI) r r2

0.8935 0.6910 0.4775

0.8424 0.7309 0.5343

0.9202 0.7762 0.6095

0.6694 0.8299 0.6888

0.7886 0.8647 0.7478

0.9240 0.8660 0.7510

0.7371 0.9025 0.8146

0.8277 0.6170 0.3807

0.8612 0.7364 0.5423

0.9542 0.8216 0.6751

0.9265 0.7861 0.6180

0.9461 0.7783 0.6068

0.9640 0.7574 0.5737

0.9387 0.8645 0.7474

0.9469 0.8539 0.7292

0.9208 0.8599 0.7395

0.8057 0.6894 0.4753

0.9378 0.5551 0.3082

0.9371 0.6878 0.4731

0.8017 0.8091 0.6548

0.7755 0.8080 0.6529

0.9722 0.8822 0.7783

0.663

Fig. 1. Electrophoresis patterns obtained by PFGE on several ovine origin strains of Dermatophilus congolensis. M (k ladder); m (k DNA-HindIII);

m 0 (kilobase DNA marker).

92 J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97

of 5 ml of proteolysis buffer (1% sodium lauryl sarco-

syne, 0.5 M EDTA, pH 9.5) and 60 mg of proteinase

K (Sigma Chemicals Co., St. Louis, MO). This solution

was incubated with gentle shaking at 55 �C for 2 days.

Finally, the blocks were washed 25 times for 20 min each

at 4 �C in 50 ml of TE buffer.

Only Sse8387I restriction enzyme was effective for

PFGE typing. All D. congolensis isolates were typeableby Sse8387I-PFGE. The DNA typing profiles of each

isolate generated by PFGE were found to be stable

and reproducible. PFGE of Sse8387I digests yielded

13–23 bands in the 10–200 kb size range for D. congolen-

sis isolates. Three banding profile types were evident,

corresponding in general with the animal source of the

strain, thus the ovine type exhibited 13 bands (see Fig.

1), the bovine type 18 bands, and equine type 23 bands.The discriminatory power of PFGE as well as the poly-

morphism were lower than in RAPD, as indicated by the

comparison of the indexes of diversity and number of

types (see Table 6).

4. Discussion

4.1. Typeability of RAPD

Subtyping or strain classification can be accom-

plished by a number of different techniques. All of these

methods must meet several criteria in order to be

broadly useful: typeability, reproducibility, discrimina-

tory power and simplicity to perform.

In our study, RAPD has shown an excellent typeabil-ity (100%), following the exclusion of primers that did

not generate reproducible and discriminative profiles.

This typeability accords with other authors� findings

that RAPD is superior to ribotyping, southern blotting

or even to PFGE. For example, Van Belkum et al. [25]

consider that PCR-mediated typing is preferable, in

principle, over phage typing, plasmid typing, some of

the RFLP approaches, and IS mapping, as all of these

leave an appreciable percentage of strains un-typed.

4.2. Reproducibility of RAPD

Reproducibility refers to the ability of a technique toyield the same result when a particular strain is repeat-

edly tested. Reproducibility is especially important for

the construction of reliable databases containing all

known strains within a species to which unknown

organisms can be compared for classification.

In order to obtain good reproducibility it is essential

to define the appropriate PCR reagents, conditions,

primers, and analysis methods that will produce reliable,discriminatory, and reproducible results in different lab-

oratories [18].

In the current study, the reproducibility of RAPD

analysis was evaluated, as this is an essential character-

istic to confirm performance as acceptable.

Thus, under our experimental conditions, of the 33

primers assayed we retained 21 primers, which produced

discriminatory and reproducible profiles.RAPDs for all isolates examined in this study were

reproducible over time. Furthermore profiles were stable

for DNAs extracted from successive cultures of an iso-

late and in different stages of their life cycle.

The reproducibility of the RAPD patterns was also

consistent by using different DNA preparations, various

thermal cyclers and diverse Taq polymerases.

For D. congolensis this reproducibility was in agree-ment with other studies [26–38], showing that RAPD

can be reliable at the practical level if the following con-

ditions are addressed: (i) standardized reagents (quality

controlled), (ii) standardized extraction of DNA, and

(iii) standardized amplification conditions. In this study,

J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97 93

12 out of 33 primers were rejected as they were found to

produce non-reproducible RAPD results probably due

to the critical or suboptimal reagent concentrations or

reaction conditions [39,40], or perhaps because the tar-

get amplification is extremely rare in the D. congolensis

genome [41,42].It is important that a RAPD typing method should

be reliable enough to allow between-laboratory compar-

isons. Several reports have found difficulties in obtaining

reproducible RAPD banding patterns in different labo-

ratories [19]. Our results emphasize again that each pri-

mer to be used in RAPD should be carefully tested for

reproducibility of the banding pattern, because, for

RAPD typing, the selection of primers that producereproducible and easily interpretable DNA fingerprints

is essential. Only primers that provide consistent band-

ing patterns in different environments should be chosen

for inter-laboratory use. Primers showing variability in

the banding patterns can only be used within one labo-

ratory, if they produce consistent results in the thermo-

cycler used.

4.3. Discriminatory power of RAPD

In 1988, Hunter and Gaston [20] used a single numer-

ical index of discrimination, the discriminatory index

(DI), based on the probability that two unrelated iso-

lates would be classified as the same type. Since then,

the DI has been widely used to compare the discrimina-

tory power of different typing methods, and the determi-nation of this index is now recommended in guidelines

for the evaluation of typing methods. This study is the

first to use DI to compare D. congolensis typing

methods.

In order to evaluate the discriminatory power of

RAPD analysis for typing of D. congolensis isolates,

we studied 50 unrelated D. congolensis strains isolated

over a significant period of time and from different geo-graphic origins. We also included and three type strains

from American Type Culture Collection and British

Type Culture Collection.

According to recent guidelines [17,20,43], a typing

system should achieve a DI of >0.95 for reliable assess-

ment of the clonal relatedness of isolates or, if typing re-

sults are to be interpreted with confidence, a DI of

greater than 0.90 is desirable [20,44,45].Our study has shown that RAPD offers significant

discrimination among D. congolensis isolates (DI,

0.9722). However, the level of discrimination depends

on the primer being used (see Table 6). Primer DP10

exhibited the greatest discriminatory power (DI,

0.9640) while primer D7 was the less discriminating

(DI, 0.7694).

These results are in agreement with those of otherauthors who found RAPD a satisfactory method for

typing microorganisms [36,43,44,46–61].

For comparison, we have applied Hunter and Gas-

ton formula on results of previously published com-

parisons of D. congolensis isolates, many of them

included in the present study, based on phenotype fea-

tures and carried out by other methods. Thus, the dis-

criminatory power of SDS–PAGE for characterizationof D. congolensis exoproteins [6] ranged from 0.6004

to 0.8464 while the discrimination power of API

ZYM system [9] was 0.9341. Our results showed that

RAPD is more discriminating than these, although

caution is required as these included a lower number

of isolates.

Considering its combination of discriminatory power

and ease of application, RAPD emerges as a particularlyattractive molecular technique especially if the simplified

RAPD technique using heated bacterial DNA templates

[14] is employed to reduce the time and labour required.

This study shows that when an appropriately chosen set

of primers is employed, RAPD analysis provides a ra-

pid, reproducible, and powerful genomic typing method

for D. congolensis.

4.4. PFGE sample preparation

The preparation and manipulation of very large

DNA molecules for pulsed field gel electrophoresis

(PFGE) is a laborious procedure which requires more

care than for smaller molecules. Generally DNA is

prepared in solid agarose blocks (plugs). However,

this is often difficult due to many factors, 4 of whichare discussed below: (a) Difficulty emulsifying cells.

The cells should be suspended homogeneously because

aggregation, evident as a lumpy appearance reduces

the efficiency of cell digestion. For example, the bands

generated by PFGE during typing of Flavimonas ory-

zihabitans were sometimes distorted, because it was

difficult to emulsify the colonies of this species into

homogeneous suspensions. As a consequence repeatedtesting was necessary before the patterns could be

compared with confidence [62]. In the present study,

we found it was easier to emulsify the colonies of

D. congolensis taken from solid media cultures where

the filaments tend to fragment into cocci more easily

than those from liquid media. Liquid media cultures

required more washes with detergent and gentle

shaking.(b) The samples are too concentrated. Pulsed field

gels are especially sensitive to sample overload. As the

amount of DNA increases, its rate of migration is re-

tarded correspondingly, resulting in larger than true

sizes. In general, it is recommended that an agarose plug

should contain 106–1010 cells; equivalent to between 100

ng and 1 lg [51,63]. In our study, we have optimised the

number of cells per plug, at 107 D. congolensis. This ena-bled us to assess the appropriate conditions to optimise

PFGE resolution.

94 J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97

(c) Inadequate enzymatic treatment. Following inad-

equate enzymatic treatment plugs often have a sandy or

gritty aspect. In the present study, we firstly used DNA

prepared by Levy-Frebault et al. protocol [21]. How-

ever, the enzymatic treatment did not degrade the cell

wall of D. congolensis. On the other hand, when thegenomic DNA of the test strains was prepared in agar-

ose plugs by the rapid DNA extraction procedure de-

scribed by Matushek et al. [23] a small percentage of

the organisms did not lyse during the first 2 h incuba-

tion. However, adequate lysis did occur (the plugs had

a transparent aspect) following a second incubation in

lysis buffer for 24 h. Thus, mixing the bacterial suspen-

sion with lysis solution prior to adding low meltingpoint agarose was essential to complete the lysis of the

cell wall.

(d) Degradation of the DNA during extraction. A

number of studies have reported difficulty PFGE typing

bacterial species due to difficulties obtaining non-

degraded DNA [26,59,64]. The reason for this may be

the low yields associated of DNA isolation in these spe-

cies, further hampered by DNA degradation problemscaused by extracellular DNases. Proposed solutions to

prevent DNAase-related problems include formalde-

hyde fixation of cells, heat treatment of cells [65–67],

the use of lysis solution for the resuspension of cells

prior to mixing with the insert gel [23], inclusion of

hypertonic sucrose in the lysis solution [68], and shorten-

ing of the lysis and DNA plug wash steps [23,69,70].

We evaluated the effect of different in situ preparationmethods on the quality of DNA in order to optimize the

PFGE typing of D. congolensis strains. The protocol re-

ported here has been developed and tested to address the

above problematic factors. It provides an efficient and

reproducible method for preparation of D. congolensis

genomic DNA for PFGE.

4.5. PFGE-Restriction enzyme digestion

The selection of restriction enzymes for PFGE is spe-

cific for each microorganism, and must take account of

the G+C contents of the target DNAs [71]. For efficient

initial mapping of bacterial chromosomes it is advisable

to use enzymes, which have relatively few restriction

sites and give larger fragments from the target DNA.

It must be taken into account that pulsed field gel elect-rophoresis allows clear separation of very-large-molecu-

lar-length DNA fragments ranging from 10 to 800 kb

[51].

By contrast, enzymes producing a large number of

small fragments (10 kb) are unlikely to be useful for

PFGE and mapping. In general, only restriction enzymes

with six base-pair recognition sites, or greater, are useful.

In thios study we tested 24 restriction enzymes with 6–8base-pair recognition sites. Only Sse8387I yielded well-

resolved patterns composed of a limited number (1–20)

of fragments, as recommended [72]. Other enzymes

tested yielded excessive numbers of small fragments, that

were impossible to resolve by PFGE.

It is important to recognize the problems of partial

DNA digestion when using restriction enzymes in PFGE

analysis. Partial digestion can be overcome by an ex-tended overnight (20 h) incubation or by replacing the

reaction buffer after 6 h, adding fresh enzyme, and incu-

bating the mixture for another 6 h [73]. Many sub-

stances, such as the lysed bacterial material, proteinase

K, PMSF, and TE buffer, can decrease the activity of

the restriction enzymes. Hence, these substances must

be eliminated as efficiently as possible. Furthermore,

for optimal enzyme activity, it is important to washthe DNA blocks in the restriction enzyme reaction buf-

fer at 4 �C for 30 min before incubating the DNA blocks

in fresh restriction enzyme reaction buffer containing

endonuclease.

Results from using our modified protocol, which in-

cludes washing steps at the end of the DNA sample

preparation procedure and a distilled water washing

step prior to restriction enzyme digestion, suggest thatthe lack of proteinase K, PMSF, and TE buffer im-

proves efficient digestion of D. congolensis DNA.

4.6. Typeability of PFGE

Numerous factors influence the preparation of intact

chromosomal DNA for PFGE analysis and contribute

to the low typeability of PFGE reported in several stud-ies [43]. By contrast, the results of the present study, like

those of Louie et al [74] show that PFGE can have excel-

lent typeability: all strains of D. congolensis were amena-

ble to PFGE analysis.

4.7. Reproducibility of PFGE

Guidelines for PFGE typing indicate that variationsin some bands occur when strains of some species are cul-

tured repeatedly over time [75]. By contrast in this study

genome patterns (PFGE types) D. congolensis strains

were unchanged after 20 passages showing the reproduc-

ibility of the PFGE technique with D. congolensis.

Moreover, using our protocol we found the banding

pattern was also consistent when using DNA samples

prepared 5 months, in common with McEllistrem et al.(2000) [76] when PFGE typing Streptococcus

pneumoniae.

4.8. Discriminatory power of PFGE

Applying the guidelines [75] to our results, the dis-

criminatory power of Sse8387I-PFGE in the present

study was low (DI, 0.663). Although it is desirablethat any subtyping method has a high differentiation

power, epidemiological data should be taken in ac-

J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97 95

count when deciding whether genetically related

strains are also epidemiologically related. Thus, the

generation of excessive numbers of types introduces

the possibility that the relationship between the typing

data and epidemiological characteristics will start to

deteriorate [25].Results of a PFGE typing study of Staphylococcus

aureus [55] showed that the resolution of this method ex-

ceeded that of restriction fragment length polymorphism

analysis with ribosomal or toxin A DNA probes and

that it did not correlated with epidemiological data.

Gori et al. [77] showed that RAPD and PFGE were

useful for typing Klebsiella pneumoniae strains in epide-

miological investigations, and although RAPD analysiswas more efficient, more subclonal variants were deter-

mined among epidemic clones by PFGE analysis than

by RAPD analysis.

In our opinion, the PFGE typing data obtained in the

present study interpreted in the context of epidemiolog-

ical information on the host and geographic origin dem-

onstrates the relationship of D. congolensis isolates,

while correlating with RAPD results. Indeed the degreeof correlation between RAPD and PFGE typing was

significantly high (r, 0.8822).

The low discriminatory power of PFGE can be ex-

plained because Sse8387I-PFGE could not distinguish

between D. congolensis strains from the same host.

Interestingly this association with host species accords

with results of an examination of D. congolensis pro-

teases [6]. In that study distinct patterns of enzymemigration in PAGE gels were observed to be consistent

within isolates from the 3 main host species (r, 0.9416).

In conclusion, we have found RAPD and PFGE to

be satisfactory methods for typing D. congolensis that

can distinguish between D. congolensis strains with a

high degree of correlation between two techniques. We

recommend that at least two independent primers

should be used for RAPD typing in order to improveits discriminatory power and that PFGE be used for

confirmation of RAPD results.

Acknowledgements

This research was supported by the Spanish Govern-

ment Ministerio de Educacion y Cultura, grant PB96-0478 and by the European Commission INCO-DC Pro-

gram Project Contract CT980334.

The authors would like to thank Alex Morrow and

Ian Heron, University of Edinburgh, for providing part

of the D. congolensis isolates used in this study. Thanks

also to Dr. K.H. Bohm, Institut fur Mikrobiologie und

Tierseuchen, Tierarztlichen Hochschule Hannover, Ger-

many, for providing German horse isolates of D.

congolensis.

References

[1] Roberts, D.S. (1965) The histopathology of epidermal infection

with the actinomycete Dermatophilus congolensis. J. Pathol.

Bacteriol. 90, 213–216.

[2] Thierry, G. and Memery, G. (1961) La streptothricose cutanee IV.

Etiologie-traitement-prophylaxie. Rev. Elev. Med. Vet. Pays

Trop. 14, 413–427.

[3] Perreau, P. (1981) La dermatophilose infection a Dermatophilus

congolensis. Polycopie d�enseignement. I.E.M.V.T.

[4] Barouh, B.J.E. (1984) La dermatophilose animale. Situation en

France. These Doct. Vet., Ecole Nationale Veterinaire d�Alfort.,

Alfort.

[5] Ambrose, N., Lloyd, D. and Maillard, J.C. (1999) Immune

responses to Dermatophilus congolensis infections. Parasitol.

Today 15, 295–300.

[6] Ambrose, N.C., Mijinyawa, M.S. and Hermoso de Mendoza, J.

(1998) Preliminary characterisation of extracellular serine pro-

teases of Dermatophilus congolensis isolates from cattle, sheep and

horses. Vet. Microbiol. 62, 321–335.

[7] Ellis, T.M., Masters, A.M., Sutherland, S.S., Carson, J.M. and

Gregory, A.R. (1993) Variation in cultural, morphological,

biochemical properties and infectivity of Australian isolates of

Dermatophilus congolensis. Vet. Microbiol. 38, 81–102.

[8] Hanel, H., Kalisch, J., Keil, M., Marsch, W.C. and Buslau, M.

(1991) Quantification of keratinolytic activity from Dermatophilus

congolensis. Med. Microbiol. Immunol. 180, 45–51.

[9] Hermoso de Mendoza, J., Arenas, A., Alonso, J.M., Rey, J.M.,

Gil, M.C., Anton, J.M. and Hermoso de Mendoza, M. (1993)

Enzymatic activities of Dermatophilus congolensis measured by

API ZYM. Vet. Microbiol. 37, 175–179.

[10] How, S.J. and Lloyd, D.H. (1990) The effect of recent vaccination

on the dose-response to experimental Dermatophilus congolensis

infection in rabbits. J. Comp. Pathol. 102, 157–163.

[11] Makinde, A.A. and Gyles, C.L. (1999) A comparison of extracted

proteins of isolates of Dermatophilus congolensis by sodium

dodecyl sulphate-polyacrylamide gel electrophoresis and Western

blotting. Vet. Microbiol. 67, 251–262.

[12] Skalka, B. and Pospisil, L. (1992) Hemolytic interactions of

Dermatophilus congolensis. Zentralbl Veterinarmed [B] 39, 139–

143.

[13] Skalka, B. and Votava, M. (1997) Hemolysis and hemolytic

interactions of bacteria. Epidemiol. Mikrobiol. Imunol. 46, 87–98.

[14] Larrasa, J., Garcıa, A., Ambrose, N.C., Alonso, J.M., Parra, A.,

Hermoso de Mendoza, M., Salazar, J., Rey, J. and Hermoso de

Mendoza, J. (2002) A simple random amplified polymorphic

DNA genotyping method for field isolates of Dermatophilus

congolensis. J. Vet. Med. B, 135–141.

[15] Makinde, A.A. (1991) Immunoserology of Dermatophilus congo-

lensis infection. In: Presented at the 2nd International Symposium

on Dermatophilosis, Vom, Nigeria.

[16] Olive, D.M. and Bean, P. (1999) Principles and applications of

methods for DNA-based typing of microbial organisms. J. Clin.

Microbiol. 37, 1661–1669.

[17] Struelens, M.J. (1996) Consensus guidelines for appropriate use

and evaluation of microbial epidemiologic typing systems. In:

Presented at the European Estudy Group of epidemiological

Markers (ESGEM), of European Society for Clinical Microbiol-

ogy and Infectious Diseases (ESCMID).

[18] Arbeit, R.D. (1995) Laboratory procedures for the epidemiologic

analysis of microorganisms, sixth ed. ASM Press, Washington,

DC.

[19] Tyler, K.D., Wang, G., Tyler, S.D. and Johnson, W.M. (1997)

Factors affecting reliability and reproducibility of amplification-

based DNA fingerprinting of representative bacterial pathogens.

J. Clin. Microbiol. 35, 339–346.

96 J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97

[20] Hunter, P.R. and Gaston, M.A. (1988) Numerical index of

the discriminatory ability of typing systems: an application of

Simpson�s index of diversity. J. Clin. Microbiol. 26, 2465–

2466.

[21] Levy-Frebault, V.V., Thorel, M.F., Varnerot, A. and Gicquel, B.

(1989) DNA polymorphism in Mycobacterium paratuberculosis,

‘‘wood pigeon mycobacteria, and related mycobacteria analyzed

by field inversion gel electrophoresis. J. Clin. Microbiol. 27, 2823–

2826.

[22] Udo, E.E. and Grubb, W.B. (1993) Genetic analysis of methicil-

lin-resistant Staphylococcus aureus from a Nigerian hospital. J.

Med. Microbiol. 38, 203–208.

[23] Matushek, M.G., Bonten, M.J. and Hayden, M.K. (1996) Rapid

preparation of bacterial DNA for pulsed-field gel electrophoresis.

J. Clin. Microbiol. 34, 2598–2600.

[24] Cornillot, E., Croux, C. and Soucaille, P. (1997) Physical and

genetic map of the Clostridium acetobutylicum ATCC824 chro-

mosome. J. Bacteriol. 179, 7426–7434.

[25] van Belkum, A., Kluytmans, J., van Leeuwen, W., Bax, R., Quint,

W., Peters, E., Fluit, A., Vandenbroucke-Grauls, C., van den

Brule, A. and Koeleman, H., et al. (1995) Multicenter evaluation

of arbitrarily primed PCR for typing of Staphylococcus aureus

strains. J. Clin. Microbiol. 33, 1537–1547.

[26] Zhang, Y., Rajagopalan, M., Brown, B.A. and Wallace Jr., R.J.

(1997) Randomly amplified polymorphic DNA PCR for compar-

ison of Mycobacterium abscessus strains from nosocomial out-

breaks. J. Clin. Microbiol. 35, 3132–3139.

[27] Yao, J.D., Conly, J.M. and Krajden, M. (1995) Molecular typing

of Stenotrophomonas (Xanthomonas) maltophilia by DNA macro-

restriction analysis and random amplified polymorphic DNA

analysis. J. Clin. Microbiol. 33, 2195–2198.

[28] Van Couwenberghe, C.J., Cohen, S.H., Tang, Y.J., Gumerlock,

P.H. and Silva Jr., J. (1995) Genomic fingerprinting of epidemic

and endemic strains of Stenotrophomonas maltophilia formerly

Xanthomonas maltophilia by arbitrarily primed PCR. J. Clin.

Microbiol. 33, 1289–1291.

[29] Sloos, J.H., Dijkshoorn, L., Vogel, L. and van Boven, C.P. (2000)

Performance of phenotypic and genotypic methods to determine

the clinical relevance of serial blood isolates of Staphylococcus

epidermidis in patients with septicemia. J. Clin. Microbiol. 38,

2488–2493.

[30] Salama, S.M., Jiang, Q., Chang, N., Sherbaniuk, R.W. and

Taylor, D.E. (1995) Characterization of chromosomal DNA

profiles from Helicobacter pylori strains isolated from sequential

gastric biopsy specimens. J. Clin. Microbiol. 33, 2496–2497.

[31] Saito, M., Umeda, A. and Yoshida, S. (1999) Subtyping of

Haemophilus influenzae strains by pulsed-field gel electrophoresis.

J. Clin. Microbiol. 37, 2142–2147.

[32] Okazaki, M., Watanabe, T., Morita, K., Higurashi, Y., Araki, K.,

Shukuya, N., Baba, S., Watanabe, N., Egami, T., Furuya, N.,

Kanamori, M., Shimazaki, S. and Uchimura, H. (1999) Molecular

epidemiological investigation using a randomly amplified poly-

morphic DNA assay of Burkholderia cepacia isolates from

nosocomial outbreaks. J. Clin. Microbiol. 37, 3809–3814.

[33] Mahenthiralingam, E., Campbell, M.E., Foster, J., Lam, J.S. and

Speert, D.P. (1996) Random amplified polymorphic DNA typing

of Pseudomonas aeruginosa isolates recovered from patients with

cystic fibrosis. J. Clin. Microbiol. 34, 1129–1135.

[34] Giovannacci, I., Ragimbeau, C., Queguiner, S., Salvat, G.,

Vendeuvre, J.L., Carlier, V. and Ermel, G. (1999) Listeria

monocytogenes in pork slaughtering and cutting plants. Use of

RAPD, PFGE and PCR-REA for tracing and molecular epide-

miology. Int. J. Food Microbiol. 53, 127–140.

[35] Connor, K.M., Quirie, M.M., Baird, G. and Donachie, W. (2000)

Characterization of United Kingdom isolates of Corynebacterium

pseudotuberculosis using pulsed-field gel electrophoresis. J. Clin.

Microbiol. 38, 2633–2637.

[36] Clemons, K.V., Feroze, F., Holmberg, K. and Stevens, D.A.

(1997) Comparative analysis of genetic variability among Candida

albicans isolates from different geographic locales by three

genotypic methods. J. Clin. Microbiol. 35, 1332–1336.

[37] Bansal, N.S. and McDonell, F. (1997) Identification and DNA

fingerprinting of Legionella strains by randomly amplified poly-

morphic DNA analysis. J. Clin. Microbiol. 35, 2310–2314.

[38] Atia, M. (1981) Preliminary investigation on the ecology of

Dermatophilus congolensis. Mykosen. 24, 153–155.

[39] Bradley, A.F. (1992). Tecnologıa PCR: Fundamentos. Perkin

Elmer Hispania.

[40] Innis, M.S., Myambo, K.B., Gelfand, D.H. and Brown, M.A.

(1992) DNA sequencing with Thermus acquaticus DNA polym-

erase and direct sequencing of polymerase chain reaction-ampli-

fied DNA. 1988. Biotechnology 24, 6–10.

[41] Karlin, S. and Brendel, V. (1992) Chance and statistical signif-

icance in protein and DNA sequence analysis. Science 257, 39–49.

[42] Burge, C., Campbell, A.M. and Karlin, S. (1992) Over- and

under-representation of short oligonucleotides in DNA sequences.

Proc. Natl. Acad. Sci. USA 89, 1358–1362.

[43] Burucoa, C., Lhomme, V. and Fauchere, J.L. (1999) Performance

criteria of DNA fingerprinting methods for typing of Helicobacter

pylori isolates: experimental results and meta-analysis. J. Clin.

Microbiol. 37, 4071–4080.

[44] Van Looveren, M., Ison, C.A., Ieven, M., Vandamme, P., Martin,

I.M., Vermeulen, K., Renton, A. and Goossens, H. (1999)

Evaluation of the discriminatory power of typing methods for

Neisseria gonorrhoeae. J. Clin. Microbiol. 37, 2183–2188.

[45] Martinez, G., Harel, J., Higgins, R., Lacouture, S., Daignault, D.

and Gottschalk, M. (2000) Characterization of Streptococcus

agalactiae isolates of bovine and human origin by randomly

amplified polymorphic DNA analysis. J. Clin. Microbiol. 38, 71–

78.

[46] Weel, J.F., van der Hulst, R.W., Gerrits, Y., Tytgat, G.N., van

der Ende, A. and Dankert, J. (1996) Heterogeneity in suscepti-

bility to metronidazole among Helicobacter pylori isolates from

patients with gastritis or peptic ulcer disease. J. Clin. Microbiol.

34, 2158–2162.

[47] Wada, S., Matsuda, M., Kikuchi, M., Kodama, T., Takei, I.,

Ogawa, S., Takahashi, S., Shingaki, M. and Itoh, T. (1994)

Genome DNA analysis and genotyping of clinical isolates of

Helicobacter pylori. Cytobios 80, 109–116.

[48] Speijer, H., Savelkoul, P.H., Bonten, M.J., Stobberingh, E.E. and

Tjhie, J.H. (1999) Application of different genotyping methods for

Pseudomonas aeruginosa in a setting of endemicity in an intensive

care unit. J. Clin. Microbiol. 37, 3654–3661.

[49] Soto, S.M., Guerra, B., Gonzalez-Hevia, M.A. and Mendoza,

M.C. (1999) Potential of three-way randomly amplified polymor-

phic DNA analysis as a typing method for twelve Salmonella

serotypes. Appl. Environ. Microbiol. 65, 4830–4836.

[50] Schutze, K., Hentschel, E., Dragosics, B. and Hirschl, A.M.

(1995) Helicobacter pylori reinfection with identical organisms:

transmission by the patients� spouses. Gut 36, 831–833.

[51] Monaco, A.P. (1995) Pulse Field Electrophoresis: A Practical

Approach, first ed. Oxcford University Press, New York.

[52] Marois, C., Dufour-Gesbert, F. and Kempf, I. (2001) Comparison

of pulsed-field gel electrophoresis with random amplified poly-

morphic DNA for typing of Mycoplasma synoviae. Vet. Micro-

biol. 79, 1–9.

[53] Malorny, B., Schroeter, A., Bunge, C., Hoog, B., Steinbeck, A.

and Helmuth, R. (2001) Evaluation of molecular typing methods

for Salmonella enterica serovar typhimurium DT104 isolated in

Germany from healthy pigs. Vet. Res. 32, 119–129.

[54] Limansky, A.S., Sutich, E.G., Guardati, M.C., Toresani, I.E. and

Viale, A.M. (1998) Genomic diversity among Streptococcus

agalactiae isolates detected by a degenerate oligonucleotide-

primed amplification assay. J. Infect. Dis. 177, 1308–1313.

J. Larrasa et al. / FEMS Microbiology Letters 240 (2004) 87–97 97

[55] Jorgensen, M., Givney, R., Pegler, M., Vickery, A. and Funnell,

G. (1996) Typing multidrug-resistant Staphylococcus aureus:

conflicting epidemiological data produced by genotypic and

phenotypic methods clarified by phylogenetic analysis. J. Clin.

Microbiol. 34, 398–403.

[56] Dzierzanowska, D., Gzyl, A., Rozynek, E., Augustynowicz, E.,

Wojda, U., Celinska-Cedro, D., Sankowska, M. and Wad-

strom, T. (1996) PCR for identification and typing of

Helicobacter pylori isolated from children. J. Physiol. Pharma-

col. 47, 101–114.

[57] Chatellier, S., Ramanantsoa, C., Harriau, P., Rolland, K.,

Rosenau, A. and Quentin, R. (1997) Characterization of Strep-

tococcus agalactiae strains by randomly amplified polymorphic

DNA analysis. J. Clin. Microbiol. 35, 2573–2579.

[58] Calcagno, A.M., Nino-Vega, G., San-Blas, F. and San-Blas, G.

(1998) Geographic discrimination of Paracoccidioides brasiliensis

strains by randomly amplified polymorphic DNA analysis. J.

Clin. Microbiol. 36, 1733–1736.

[59] Bidet, P., Lalande, V., Salauze, B., Burghoffer, B., Avesani, V.,

Delmee, M., Rossier, A., Barbut, F. and Petit, J.C. (2000)

Comparison of PCR-ribotyping, arbitrarily primed PCR, and

pulsed-field gel electrophoresis for typing Clostridium difficile. J.

Clin. Microbiol. 38, 2484–2487.

[60] Bert, F., Branger, C. and Lambert-Zechovsky, N. (1997) Pulsed-

field gel electrophoresis is more discriminating than multilocus

enzyme electrophoresis and random amplified polymorphic DNA

analysis for typing pyogenic streptococci. Curr. Microbiol. 34,

226–229.

[61] Akopyanz, N., N.O, Bukanov, T.U., Westblom, S., Kresovich, A.

and Berg, D.E. (1992) DNA diversity among clinical isolates of

Helicobacter pylori detected by PCR-based RAPD fingerprinting.

Nucl. Acids Res. 20, 5137–5142.

[62] Liu, P.Y., Shi, Z.Y., Lau, Y.J., Hu, B.S., Shyr, J.M., Tsai, W.S.,

Lin, Y.H. and Tseng, C.Y. (1996) Epidemiological typing of

Flavimonas oryzihabitans by PCR and pulsed-field gel electropho-

resis. J. Clin. Microbiol. 34, 68–70.

[63] Birren, B.W., Lai, E., Clark, S.M., Hood, L. and Simon, M.I.

(1988) Optimized conditions for pulsed field gel electrophoretic

separations of DNA. Nucl. Acids Res. 16, 7563–7582.

[64] Owen, R.J., Sutherland, K., Fitzgerald, C., Gibson, J., Borman,

P. and Stanley, J. (1995) Molecular subtyping scheme for

serotypes HS1 and HS4 of Campylobacter jejuni. J. Clin.

Microbiol. 33, 872–877.

[65] Lin, W.J. and Johnson, E.A. (1995) Genome analysis of Clostri-

dium botulinum type A by pulsed-field gel electrophoresis. Appl.

Environ. Microbiol. 61, 4441–4447.

[66] Lawson, P.A., Gharbia, S.E., Shah, H.N. and Clark, D.R. (1989)

Recognition of Fusobacterium nucleatum subgroups Fn-1, Fn-2

and Fn-3 by ribosomal RNA gene restriction patterns. FEMS

Microbiol. Lett. 53, 41–45.

[67] Kristjansson, M., Samore, M.H., Gerding, D.N., DeGirolami,

P.C., Bettin, K.M., Karchmer, A.W. and Arbeit, R.D. (1994)

Comparison of restriction endonuclease analysis, ribotyping,

and pulsed-field gel electrophoresis for molecular differentiation

of Clostridium difficile strains. J. Clin. Microbiol. 32, 1963–

1969.

[68] Wilkinson, S.R. and Young, M. (1993) Wide diversity of genome

size among different strains of Clostridium acetobutylicum. J. Gen.

Microbiol, 1069–1076.

[69] Gibson, J.R., Sutherland, K. and Owen, R.J. (1994) Inhibition of

DNAse activity in PFGE analysis of DNA from Campylobacter

jejuni. Lett. Appl. Microbiol. 19, 357–358.

[70] Chachaty, E., Saulnier, P., Martin, A., Mario, N. and Andre-

mont, A. (1994) Comparison of ribotyping, pulsed-field gel

electrophoresis and random amplified polymorphic DNA for

typing Clostridium difficile strains. FEMS Microbiol. Lett. 122,

61–68.

[71] Hood, M.T. and Stachow, C.S. (1995) Electroporation of

Schizosaccharomyces pombe. Methods Mol. Biol. 47, 273–278.

[72] Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A.,

Murray, B.E., Persing, D.H. and Swaminathan, B. (1995)

Interpreting chromosomal DNA restriction patterns produced

by pulsed-field gel electrophoresis: criteria for bacterial strain

typing. J. Clin. Microbiol. 33, 2233–2239.

[73] Haertl, R. and Bandlow, G. (1993) Molecular typing of Enterob-

acter cloacae by pulsed-field gel electrophoresis of genomic

restriction fragments. J. Hosp. Infect. 25, 109–116.

[74] Louie, M., Jayaratne, P., Luchsinger, I., Devenish, J., Yao, J.,

Schlech, W. and Simor, A. (1996) Comparison of ribotyping,

arbitrarily primed PCR, and pulsed-field gel electrophoresis for

molecular typing of Listeria monocytogenes. J. Clin. Microbiol.

34, 15–19.

[75] Tenover, F.C., Arbeit, R.D. and Goering, R.V. (1997) How to

select and interpret molecular strain typing methods for epidemi-

ological studies of bacterial infections: a review for healthcare

epidemiologists. Molecular Typing Working Group of the Society

for Healthcare Epidemiology of America. Infect. Control Hosp.

Epidemiol. 18, 426–439.

[76] McEllistrem, M.C., Pass, M., Elliott, J.A., Whitney, C.G. and

Harrison, L.H. (2000) Clonal Groups of Penicillin-Nonsusceptible

Streptococcus pneumoniae in Baltimore, Maryland: a Population-

Based, Molecular Epidemiologic Study. J. Clin. Microbiol. 38,

4367–4372.

[77] Gori, A., Espinasse, F., Deplano, A., Nonhoff, C., Nicolas, M.H.

and Struelens, M.J. (1996) Comparison of pulsed-field gel

electrophoresis and randomly amplified DNA polymorphism

analysis for typing extended-spectrum-beta-lactamase- producing

Klebsiella pneumoniae. J. Clin. Microbiol. 34, 2448–2453.

[78] Glennon, M., Jager, B., Dowdall, D., Maher, M., Dawson, M.,

Quigley, F., Costello, E. and Smith, T. (1997) PCR-based

fingerprinting of Mycobacterium bovis isolates. Vet Microbiol.

54, 235–245.

[79] Friedman, C.R., Stoeckle, M.Y., Johnson Jr., W.D. and Riley,

L.W. (1995) Double-repetitive-element PCR method for subtyp-

ing Mycobacterium tuberculosis clinical isolates. J Clin Micro-

biol. 33, 1383–1384.

[80] Aranaz, A., Liebana, E., Mateos, A., Dominguez, L., Vidal, D.,

Domingo, M., Gonzolez, O., Rodriguez-Ferri, E.F., Bunschoten,

A.E., Van Embden, J.D. and Cousins, D. (1996) Spacer oligonu-

cleotide typing of Mycobacterium bovis strains from cattle and

other animals: a tool for studying epidemiology of tuberculosis. J

Clin Microbiol. 34, 2734–2740.