A

vs1iltaMw2t7sas©

K

1

tltoa

DGf

0d

Aquatic Toxicology 86 (2008) 459–469

Effects of the pesticide methoxychlor on gene expression in the liverand testes of the male largemouth bass (Micropterus salmoides)

Jason L. Blum a, Beatrice A. Nyagode b, Margaret O. James b,d, Nancy D. Denslow c,d,∗a Department of Pharmacology and Therapeutics, University of Florida, Gainesville, FL 32611, United States

b Department of Medicinal Chemistry, University of Florida, Gainesville, FL 32611, United Statesc Department of Physiological Sciences, University of Florida, Gainesville, FL 32611, United States

d Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL 32611, United States

Received 8 September 2007; received in revised form 17 December 2007; accepted 20 December 2007

bstract

The organochlorine pesticide methoxychlor (MXC) is an environmental estrogen known to stimulate the expression of the egg-yolk protein,itellogenin (Vtg) in fish species. To begin to understand the underlying mechanisms for how MXC exerts its deleterious effects on the endocrineystem, male largemouth bass (Micropterus salmoides) were treated with 2.5, 10, or 25 mg/kg MXC and compared to fish pair-treated with 1 mg/kg7�-estradiol (E2), and vehicle control. Fish were sacrificed 24, 48, or 72 h following treatment. The liver and testes were then assayed for changesn expression of the three bass estrogen receptors (ERs�, �a, and �b) in tissues, as well as Vtg and cytochrome P450 (CYP) 3A isoform 68 in theiver and steroidogenic acute regulatory protein (StAR) in the testes. In the liver, significant increases in gene expression were seen for each ofhe genes measured by 24 h and each returned to the level of the vehicle by 72 h. Total testosterone 6�-hydroxylase activity, reflective of CYP3Activity, was also increased by 24 h for all of the exposures. In the testes, ER� was unaffected by any treatment, ER�a was up-regulated only byXC, peaking at 24 h for the 2.5 and 10 mg/kg MXC and at 48 h for the 25 mg/kg MXC treatment. By 72 h, the MXC effects had disappeared,hile E2 significantly decreased the expression of ER�a mRNA. ER�b expression in the testes was stimulated by all concentrations of MXC by4 h and the effect remained up to 72 h, whereas E2 had no effect. Finally, StAR expression was also found to be decreased by E2 and all MXCreatments. However, the effect on StAR expression by E2 occurred within 24 h, while the effect by all concentrations of MXC was not seen until2 h after treatment. The stimulatory effects of E2 and 25 mg/kg MXC on the expression of the ERs in the liver were opposite to the responses

een in the testes, suggesting an inverted relationship between these two tissue types. These results provide a possible mechanism showing thatlterations in reproductive signaling in male fish by xenoestrogens not only increase Vtg expression in the liver, but may also decrease reproductiveuccess by muting some of the estrogen signals required for sperm production.

2008 Elsevier B.V. All rights reserved.

ne exp

(gem(

eywords: Methoxychlor; Estradiol; Estrogen receptors; Largemouth bass; Ge

. Introduction

The advent of pesticide use in agriculture has been, and con-inues to be, one of the most important developments for the highevel of food production required for our modern society. Unfor-

unately, many of these chemicals have had unintended effectsn wildlife species in the environment. Many of these effectsre due to the pesticides interacting with the estrogen receptors

∗ Corresponding author at: Center for Environmental and Human Toxicology,epartment of Physiological Sciences, University of Florida, PO Box 110885,ainesville, FL 32611-0885, United States. Tel.: +1 352 392 2243x5563;

ax: +1 352 392 4707.E-mail address: ndenslow@ufl.edu (N.D. Denslow).

UbefdeC(

166-445X/$ – see front matter © 2008 Elsevier B.V. All rights reserved.oi:10.1016/j.aquatox.2007.12.008

ression

ERs) and other regulators of reproduction. These xenoestro-ens are able to stimulate transcriptional activation of the ERs,ither through direct interaction with them, or through an indirectechanism. One of these agents is the pesticide methoxychlor

MXC).MXC was introduced following the banning of DDT in the

nited States in 1972. It is structurally similar to DDT (Fig. 1),ut is less environmentally persistent, having an approximatenvironmental half-life of 120 days (versus 2–15 years reportedor DDT (Augustijn-Beckers et al., 1994; US E.P.A., 1989)),

epending on the amount of aerobic activity in the soil (Fogelt al., 1982; Wauchope et al., 1992). According to the Nationalenter for Food and Agricultural Policy National Summary

1997), almost 78,000 pounds of MXC were applied principally

460 J.L. Blum et al. / Aquatic Toxico

Fig. 1. Structures of DDT and MXC. DDT and MXC are similar moleculeswhich vary in two positions. The underlined chlorine atoms in DDT werereplaced with the underlined methoxy groups in MXC. This modificationdt

tb9t6FD

vb1c(mae

f(a1(rsaeatst2

tohorMdtdamns

mwtsitigdrvdaEaa(t

susairwACmdtC2(teL

2

2

ewAtffmtwcaine methane sulfonate, MS-222 (Sigma, St. Louis, MO). All

ecreases the environmental and biological half-life of MXC when comparedo DTT.

o fruit crops in the United States in 1997, with about 86%eing applied to apple trees. It is highly toxic to fish with a6-hour LC50 value for the technical grade (90% pure) of lesshan 20 �g/l for largemouth bass (LMB) and between 20 and5 �g/l for fathead minnows (for comparison) (Johnson andinley, 1980). It is also more highly metabolized in vivo thanDT (Kapoor et al., 1970).MXC has been classified as a pro-estrogen, requiring acti-

ation through demethylation of the methoxy groups. This haseen shown to be catalyzed by cytochrome P450 (CYP) enzymesA in rats (Dehal and Kupfer, 1994), 1 and 3A in channelatfish (Stuchal et al., 2006), or 1A2 and 2C19 in humansStresser and Kupfer, 1998). The estrogenic metabolites are theono- and bis-demethylmethoxychlor compounds (OH-MXC

nd HPTE, respectively) produced by the action of the CYPnzymes.

In male fish, MXC has been shown to stimulate the geneor the estrogen-responsive egg-yolk precursor vitellogeninVtg). These reports include the zebra fish (Ortiz-Zarragoitand Cajaraville, 2005), channel catfish (Nimrod and Benson,997), carp (Rankouhi et al., 2004) and sheepshead minnowHemmer et al., 2001). Using gene arrays, Larkin et al. (2003)eported changes in gene expression due to MXC exposure inheepshead minnow. The genes that were up-regulated on therrays from MXC-treated fish resembled those up-regulated bystradiol (E2)-treated fish and included Vtgs 1 and 2, as wells ER�. In addition, MXC treatment also up-regulates one ofhe zona radiata proteins in sheepshead minnows as has beenhown by SELDI–TOF–MS (surface-enhanced laser desorp-ion ionisation–time of flight–mass spectroscopy) (Walker et al.,007).

Much of the other work in non-mammals has focused onhe biotransformation of MXC and the downstream effectsn steroid biosynthesis. Either or both of these pathways canave downstream endocrine disrupting effects by increasingr decreasing the levels of endogenous steroid hormones. Oneeport by Ohyama et al. (2004) compared the metabolism of

XC in rodents, bird, and fish liver slices. They found someifferences in the metabolites produced. Each species producedhe OH-MXC metabolite, while the HPTE metabolite was onlyetected in rodents and fish. Using channel catfish, Stuchal etl. (2006) found that pre-treatment with MXC led to decreased

etabolite formation by intestinal microsomes, while there was

o significant effect on the biotransformation by liver micro-omes.

tuF

logy 86 (2008) 459–469

Far more work has been done looking at the effects in mam-als. However, like in non-mammals, much of the in vivoork has gone into examining the phenotypic effects of MXC

reatment, rather than the effects on gene expression. In vivotudies have shown that prepubertal male rats receiving MXCn the diet had greater mammary gland development than pair-reated controls (You et al., 2002). Uterine growth weight wasncreased, as well as uterine expression of vascular endothelialrowth factor-2 and angiotensin-1, while the pituitary size wasecreased (Goldman et al., 2004). Several other reproductive-elated effects have also been documented in rats like precociousaginal opening (Eroschenko and Cooke, 1990) and in mice,ifficulties with initiating and maintaining pregnancy (Swartznd Eroschenko, 1998). Each of these effects is associated withR activity. MXC was shown to bind to both the constitutivendrostane receptor (CAR) and the pregnane X receptor (PXR)nd induce CYP2B and CYP3A mRNA and protein in ratsBlizard et al., 2001; Mikamo et al., 2003). Induction of thesewo CYPs may affect steroid hormone metabolism.

In order to gain some insight into the phenotypic effectseen with MXC exposure in largemouth bass it is important tonderstand how it may alter gene expression. MXC is known totimulate gene expression through the ER in both fish (Nimrodnd Benson, 1997) and mammals (Miller et al., 2006). We werenterested in comparing ER stimulation by MXC and E2 inegard to their effects on the expression of the ERs themselves asell as the principle estrogen biomarker, Vtg 1, in male LMB.n additional gene of interest was CYP3A isoform 68, sinceYP3A is implicated in the biotransformation of MXC to itsore estrogenic metabolites. The aims of this study were to

etermine if MXC affects expression of the three ERs in eitherhe liver or testes in male LMB, the expression of Vtg 1 andYP3A68 (a recently cloned isoform of CYP3A (Barber et al.,007)) in the liver, and the steroidogenic acute regulatory proteinStAR) in the testes. Each of these genes represents an impor-ant facet of regulation of the reproductive process, and alteredxpression may lead to diminished reproductive success in maleMB.

. Materials and methods

.1. Animals

Adult LMB were purchased from American sport fish hatch-ry (Montgomery, AL). Fish were maintained in accordanceith the NIH guide for the care and use of laboratory animals.dult male LMB were separated from females by massaging

he ventral surface of the fish to cause visualization of semenrom the genital opening. This was necessary because male andemale bass are not sexually dimorphic. Following sexing, theales were placed into a separate holding tank for 24 h until

reatment. Prior to injections, fish were first anaesthetized inater containing 50–100 ppm of the fish anaesthetic agent tri-

reatment solutions of E2 (Sigma) and MXC (Sigma) were madep to deliver the treatment via injection of 1 �L/g bodyweight.ollowing injection, the fish were dipped into a saltwater bath

Toxico

tm

21

vutstBMaoc6ss

av1ifiigacia

2

wdean2icnwwN1Swb89ats

ncst

2

OSatuoB1i0awtwki

2

apcLwspCp(pt

2

tr(aATIRf

J.L. Blum et al. / Aquatic

o kill any pathogens introduced by handling and to stimulateucus layer secretion on the skin.

.2. Exposure of adult male LMB to MXC and7β-estradiol (E2)

A pilot study to find a vehicle suitable to administer MXCia injection was performed to find one that could be safelysed in bass. Initially DMSO was tested, resulting in high mor-ality of LMB, probably due to rapid release of MXC into theystem (unpublished observation). Since sesame oil was effec-ively used in mice to deliver MXC (Eroschenko et al., 1996;orgeest et al., 2004), it was used for LMB. A stock solution ofXC of 400 mg/mL was made in acetone from which appropri-

te dilutions were then made in acetone and mixed with sesameil (purchased from a local grocery store) to give final con-entrations of 2.5, 10, 25 mg/kg MXC in a vehicle containing.25% acetone and 93.75% sesame oil. There were no visibleigns of distress in treated LMB for the duration of the pilottudy.

After finding no visual signs of acute toxicity in the pilot fish,total of 81 male LMB were simultaneously treated with eitherehicle (n = 9), 1 mg/kg E2 (n = 9), 2.5 mg/kg MXC (n = 18),0 mg/kg MXC (n = 18), or 25 mg/kg MXC (n = 18). After thenjection, the fish were placed in tanks sorted by treatment. Thesh were all injected on the same day (time = 0) and then put

nto tanks for 24, 48, or 72 h. One third from each treatmentroup was collected at each of the time points. The fish werenaesthetized and killed by blunt head trauma and blood wasollected, along with liver and testes. The tissues were choppednto pieces, frozen in liquid nitrogen, and stored at −80 ◦C untilnalyzed or extracted for RNA.

.3. Extraction of methoxychlor and metabolites from liver

Standards for the MXC metabolites, OH-MXC and HPTE,ere obtained by boron tribromide demethylation of MXC, asescribed previously (Stuchal et al., 2006) for validating thextraction procedure. Portions of liver, approximately 1 g, wereccurately weighed and homogenized in 3 mL of 10 mM ammo-ium acetate pH 4.6 buffer. Acetonitrile:ethanol (2:1 by volume),mL, was added and the mixture was vortex-mixed then son-

cated for 10 min and vortex-mixed again. The mixture wasentrifuged for 20 min at approximately 5000 × g, the super-atant was transferred to clean vials, and the pellet re-extractedith 2 mL acetonitrile:ethanol. The combined organic extractsere evaporated to dryness in a Speed-Vac (Savant, Holbrook,Y). The residue was dissolved in 5 mL of 20% acetonitrile in0 mM ammonium acetate pH 4.6 buffer and applied to a C18ep-Pak (Waters) that had been pre-conditioned with methanol,ater and 20% acetonitrile in 10 mM ammonium acetate pH 4.6uffer. The Sep-Pak was washed with 5 mL 20% acetonitrile:0% 10 mM ammonium acetate pH 4.6 buffer then with 5 ml

0% acetonitrile: 10% 10 mM ammonium acetate pH 4.6 buffernd finally with 5 ml 100% acetonitrile. The fraction containinghe analytes (90% acetonitrile) was evaporated to dryness, recon-tituted in 300 �L of mobile phase, filtered through a 0.45 �m

gwf

logy 86 (2008) 459–469 461

ylon filter and analyzed by reverse-phase HPLC. To test the effi-iency of extraction, portions of liver from untreated fish werepiked with known amounts of MXC, OH-MXC and HPTE andreated as for samples of dosed liver.

.4. HPLC analysis

HPLC analysis of MXC and its demethylated metabolites,H-MXC and HPTE was carried out on a Beckman Goldystem equipped with UV (Beckman Coulter, Fullerton, CA)nd radioactivity (IN/US systems �-RAM, Tampa, FL) detec-ors. Reverse-phase (C18) separation was carried out at 40 ◦C,sing a 25 cm × 4.6 mm Discovery® column with a particle sizef 5 �m fitted with a 2 cm × 4.6 mm guard column (Supelco,ellefonte, PA). A gradient elution program was operated atmL/min flow rate, starting with a solution of 30% acetonitrile

n 10 mM ammonium acetate/acetic acid buffer (pH 4.6) held for.5 min then gradually increased to 90% acetonitrile for 20 minnd then to 100% acetonitrile for another 5 min. Compoundsere detected at 245 nm and identified by comparison of reten-

ion times with those of authentic standards. Calibration curvesere prepared from solutions of MXC, OH-MXC and HPTE ofnown concentration over the range 40–2500 pmol per 200 �Lnjection (Nyagode, 2007).

.5. Direct gene cloning

A fragment of LMB 18S rRNA was cloned by amplifyingsegment from LMB liver cDNA using the Human 18S rRNArimers (Applied Biosystems Cat #4,310,893E). The purifiedDNA was cloned into pGEM-T easy and sequenced, allowingMB-specific primers to be designed. For Vtg 1, a fragmentas re-cloned corresponding to position 635–1133 of the Vtg 1

equence, (Genbank Accession AF169287) using the forwardrimer GGATACAGTCCCTGCCATTG and reverse primerATTCTGGGTTCCTTCTTTTGC which flank the previouslyublished primer set for real time PCR from Sabo-Attwood et al.2004). For each of these gene products, the PCR product was gelurified, cloned into pGEM-T easy (Promega), and sequencedo ensure that the expected sequences were obtained.

.6. Tissue RNA extraction and cDNA synthesis

Total RNA was isolated using TriZOL (Gibco) as directed byhe manufacturer using ∼100 mg of tissue/mL of TriZOL. Theesulting RNA pellet was solubilized in RNA Secure reagentAmbion) and quantified by measuring the absorbance at 260 nmnd the relative purity was evaluated by computing the ratio of260 to A280 where a ratio of 1.8–2.0 was considered highly pure.en micrograms of total RNA were then treated with DNaseusing DNA-free (Ambion) as described by the manufacturer.andom samples were checked by gel electrophoresis in MOPS-

ormaldehyde gels to evaluate RNA integrity.

Total RNA was reverse transcribed using Stratascript (Strata-

ene). A total of 2 �g of DNase I treated RNA was combinedith 1.8 �L of random hexamer primers (100 ng/�L) and water

or a final volume of 24.6 �L. This mixture was incubated at

462 J.L. Blum et al. / Aquatic Toxicology 86 (2008) 459–469

Table 1Primers used for quantitative real time PCR

Gene Forward primer Reverse primer Concentration (nM) Ref

18S CGGCTACCACATCCAAGGAA CCTGTATTGTTATTTTTCGTCACTACCT 400ER� CGACGTGCTGGAACCAATGACAGAG TCCGGTCACTGATGATTTTCCTCCTCCA 400 Sabo-Attwood et al. (2004)ER�a GTGACCCGTCTGTCCACA TCTGGGGCTAGTGCAGGAGA 200 Sabo-Attwood et al. (2004)ER�b CCGACACCGCCGTGGTGGACTC AGCGGGGCAAGGGGAGCCTCAA 200 Sabo-Attwood et al. (2004)Vtg 1 AAGCCCATCCAGGATCTC GCTGCAGTGCCATGTATG 900 Sabo-Attwood et al. (2004)StAR ACCCCTCTGCTCAGGCATTT GGGCTCCACCTGCTTCTTTG 400 Kocerha, 2005;

Garcia-Reyero et al. (2006)CYP3A68 TGCACCGGGACCCTGAT TGCTGAACCTCTCAGGTTTGAA 400 Garcia-Reyero et al. (2006);

61ob1tTa

2

pu(frwvvtdrp

osew1crtnTcrfcS(te

2

vthpe21h3pl(auams

2

ol2a0w

2

scowt

5 ◦C for 5 min and cooled slowly to room temperature for0 min to anneal the primers to RNA. After cooling, 5.4 �Lf reverse transcription master mix (3 �L 10× Stratascriptuffer (Stratagene), 0.6 �L RNase Block (40 U/�L, Stratagene),.2 �L dNTP (100 mM, Invitrogen), 0.6 �L stratascript reverseranscriptase (50 U/�L, Stratagene) were added to each reaction.he reaction mixture was mixed and incubated at 42 ◦C for 1 hnd then the enzyme was inactivated at 90 ◦C for 5 min.

.7. Quantitative real time PCR

To determine the number of copies for each gene of interestresent in the samples, 1 �L of cDNA (synthesized above) wassed in a 25 �L reaction containing 1× SYBR green master mixApplied Biosystems), forward and reverse primers (see Table 1or sequences and concentrations), 0.01 �M fluorescein (Bio-ad) and nuclease-free water. Each hepatic or testicular cDNAas assayed on a single reaction plate to reduce plate to plateariability, and then each plate was duplicated to get replicatealues per sample. In addition to the samples, each plate con-ained a standard curve for the gene of interest made from serialilutions of the vector construct containing the gene, a standardeference pool, to correct for any differences between duplicatelates, and a no template control.

Linearity of the standard curve was determined from the slopef a plot of threshold cycle (Ct) versus the concentration. Alope of 3.322 represents complete doubling of the cDNA inach cycle (23.322 = 10). For genes of interest, standard curvesere diluted in water using serial 10-fold dilutions ranging from0 to 106 copies and for the housekeeping gene, 18S rRNA, theurve ranged from 105 to 108 copies per microliter. For the 18SRNA, the standard curve was linear only through a concentra-ion of 108 copies per microliter. The 18S rRNA was used toormalize the data as described in the statistics section below.he standard curves were made from stock solutions of plasmidsontaining a portion of the particular gene and were linear (cor-elation coefficient > 0.98). Calculated PCR efficiencies rangedrom 99.6 to 105.3%. The gene segments used for the standardurve for 18S rRNA, Vtg 1, CYP3A68 (Barber et al., 2007), and

tAR (Kocerha, 2005) were cloned into the pGEM-T easy vectorPromega). The curves for the three ERs were made from dilu-ions of pCMV4 expression vectors (Stratagene) (Sabo-Attwoodt al., 2007).

by(t

Barber et al. (2007)

.8. Subcellular fractionation

Subcellular fractionation of LMB liver was done as pre-iously described (James and Little, 1983). Frozen liver washawed on ice and combined with four volumes of ice-cold liveromogenization buffer (150 mM potassium chloride, 50 mMotassium phosphate (pH 7.4), and 0.2 mM PMSF) and homog-nized. Homogenates were first centrifuged at 13,000 × g for0 min. The supernatant was centrifuged again for 45 min at40,000 × g. The resulting microsomal pellet was washed inomogenization buffer and then centrifuged at 140,000 × g for0 min. The pellet containing washed microsomes was resus-ended in a volume equal to the original wet weight of theiver in resuspension buffer (250 mM sucrose, 10 mM HEPESpH 7.4), 5% glycerol, 0.1 mM dithiothreitol, 0.1 mM EDTA,nd 0.1 mM PMSF). The resuspended microsomes were storednder nitrogen at −80 ◦C until use in enzyme assays. Prior tossaying for activity, the microsomal protein concentration waseasured using Lowry assay (Lowry et al., 1951) with bovine

erum albumin as the standard.

.9. Measurement of testosterone 6β-hydroxylase activity

Testosterone hydroxylation was measured using the methodf Lou et al. (2002). Assay tubes contained 1 mg of LMBiver microsomes, 0.1 M HEPES pH 7.6, 2 mM MgCl2,mM NADPH and 0.2 mM [4-14C]-testosterone (0.13 �Ci perssay—Dupont NEN TM, Boston MA) in a total volume of.5 mL. Tubes were incubated for 10 min at 35 ◦C, and productsere extracted and quantified as described (Lou et al., 2002).

.10. Statistical analysis

For PCR data analysis in these experiments, the log10 of thetarting quantity of message was obtained from the standardurves. The i-cycler software gives the standard curve in the formf y = mx + b. This equation can be re-organized to x = (y − b)/m,here x is the log10 of the number of copies of the message in

he particular sample, y is the Ct value of the particular sample,

is the y-intercept of the line, and m is the slope. A slope and

-intercept were obtained for each gene and the equation log10copy number) = [Ct−(y-intercept)]/slope was used to calculatehe log10 of the copy number based on a Ct value for each sam-

Toxico

pc1ptetcaccotust

3

3d

gaetaidta

p2utltw(f

Coa1TtBneta22w

tv

t(1itEM

t(2t

3i

immad2Awttb

3i

iote

sMtcw7imc

MB

J.L. Blum et al. / Aquatic

le. The mean Ct value for each sample run in duplicate wasomputed and normalized to the log10 (copy number) of the8S. Then the log10 (copy number) was adjusted to 1 �g RNAer reaction. To test the effects of MXC, the model includedhe main effects of treatment, time, and the interaction of theseffects, treatment X time. When the treatment effect was foundo be significant (p < 0.05), the data were then sorted by time andompared by ANOVA using treatment as the main effect. Whensignificant effect was found by ANOVA, the treatments were

ompared using Duncan’s multiple range test to determine spe-ific differences among the treatment groups. The fold-changesf the treatment groups compared to vehicle were computed byaking the differences of the log10 (copy number) and analyzedsing ANOVA. All statistical analyses were performed using thetatistical analysis software (SAS) package. Data presented arehe mean log10 (copy number) of the gene expression ±S.E.M.

. Results

.1. Changes in gene expression in the liver by treatment isependent on time

It was of interest to determine how the expression of theseenes would vary over the 72 h time course. The results of thesenalyses are presented in Fig. 2A–E. In general, increases in genexpression compared to the vehicle alone were seen by 24 h post-reatment and they returned to the level of vehicle by 72 h. Were unsure as to why treatment with the vehicle alone tended toncrease gene expression of our target genes. Possibly this wasue to impurities in the sesame oil. However, in every case, thereatment effects were compared to the effects of vehicle alonend were statistically significant as discussed below.

ER� expression (Fig. 2A) was most increased at 24 host-treatment by E2 (39.8-fold), followed by treatment with5 mg/kg MXC (12.6-fold). After 48 h, the magnitude of stim-lation for the E2 treatment group had begun to decrease, whilehat for 25 mg/kg MXC continued to increase to its maximumevel (34.7-fold). Fish treated with 10 mg/kg MXC were foundo have a maximal response by 48 h, at which time ER� levelsere approximately equal in magnitude to the stimulation by E2

6.0-fold). By 72 h, all treatment groups were no longer differentrom vehicle.

ER�a (Fig. 2B), ER�b (Fig. 2C), Vtg 1 (Fig. 2D) andYP3A68 (Fig. 2E) showed similar expression patterns. For allf these genes, the highest expression over control was observedt 24 h for all of the treatments. For ER�a, E2, 2.5 mg/kg, and0 mg/kg MXC stimulated expression by an average of 4.4-fold.he 25 mg/kg MXC group was significantly higher than the other

reatment groups, reaching a level of 15.5-fold induction by 24 h.y 48 h, the responses seen across all treatment groups wereo longer different from vehicle control although the level ofxpression was still higher for 25 mg/kg MXC than the otherreatment groups. For ER�b the responses for E2, the 2.5 mg/kg

nd 10 mg/kg MXC were about 9.5-fold greater than vehicle at4 h. Treatment with 25 mg/kg MXC increased expression by2.4-fold. By 72 h, all treatments except the 2.5 mg/kg MXCere indistinguishable from vehicle with the 2.5 mg/kg MXC

gMtv

logy 86 (2008) 459–469 463

reatment significantly down-regulating ER�b (to about 20% ofehicle).

Vtg 1 was the most highly up-regulated mRNA. E2-inducedhe greatest increase (6,166-fold), followed by 25 mg/kg MXC776-fold) and then by the 2.5 mg/kg and 10 mg/kg MXC (about58-fold). By 48 h, the only treatment still causing a significantncrease was E2 (21.2-fold). At the 72 h time point, the effects ofhe treatments were no longer different from vehicle, although2 still caused an effect that was significantly greater than theXC treatment groups.CYP3A68 was significantly up-regulated only at 24 h by all

reatments with 25 mg/kg MXC giving the greatest increase20.4-fold), followed by E2 which was no different from the.5 mg/kg to 10 mg/kg MXC groups (about 6.7-fold comparedo the vehicle control).

.2. Hepatic testosterone 6β-hydroxylase activity isncreased by treatment

In the liver, testosterone 6�-hydroxylase activity wasncreased by each of the treatments by 24 h following treat-

ent (Fig. 3). This suggests that the increase in CYP3A68RNA is translated into protein and into increased activity for

ll treatment groups. Compared to vehicle, 1 mg/kg E2 pro-uced a 2.3-fold induction in activity, which was similar to the.4-fold increase induced by treatment with 10 mg/kg MXC.t 25 mg/kg, MXC caused an increase of 2.7-fold in activity,hile the greatest increase was seen with the 2.5 mg/kg MXC

reatment which induced activity by 3.3-fold. The effects of allreatments on mRNA induction compared to vehicle were goney 48 h after treatment.

.3. Changes in gene expression in the testes by treatments dependent on time

Like the changes seen in the liver, changes in gene expressionn the testes are time-dependent following a single IP injectionf each treatment. The graphs in Fig. 4A–D show the results ofhese analyses. None of the treatments had an effect on testicularxpression of ER� (Fig. 4A) at any time point.

Unlike ER�, ER�a did show time-dependence in its expres-ion following treatment (Fig. 4B). Both 2.5 mg/kg and 10 mg/kg

XC-induced the expression of ER�a significantly higherhan E2, but none of the treatments were different from vehi-le. At 48 h post-treatment, only the 25 mg/kg MXC groupas significantly higher than the vehicle (32.1-fold). By2 h, E2 caused a significant decrease (to 10% of vehicle)n the expression of ER�a, while none of the MXC treat-

ent groups were significantly different from the level of theontrol.

ER�b (Fig. 4C) was up-regulated equally by each of the threeXC treatments compared to vehicle by 24 h (about 7.9-fold).y 48 h, 25 mg/kg MXC was able to stimulate expression of this

ene (11.0-fold) and this effect was not different from 2.5 mg/kgXC. After 72 h, ER�b was again up-regulated by the MXC

reatments compared to E2, but this effect was not different fromehicle.

464 J.L. Blum et al. / Aquatic Toxicology 86 (2008) 459–469

Fig. 2. The effects of E2 or MXC on gene expression in the liver. Data presented are the means ±S.E.M. of the log10 (copy number) for each gene normalized to thelog10 (copy number)18S rRNA present in the sample. Differences between treatments within each time point were determined using Duncan’s multiple range test.The line graphs next to each of the bar graphs show the fold-change from vehicle over time by subtracting the log10 of the vehicle from each treatment. The zerotime point used the means of untreated fish. Bars with different letters are significantly different. (A) ER� expression. (B) ER�a expression. (C) ER�b expression.(B ( ) 2L kg M

aamp

3

D) Vtg 1 expression. (E) CYP3A68 expression.ars: ( ) vehicle; ( ) 1 mg/kg E2; ( ) 2.5 mg/kg MXC; ( ) 10 mg/kg MXC;ines: (�) vehicle ( ); 1 mg/kg E2 ( ); 2.5 mg/kg MXC ( ); 10 mg/

The expression of StAR (Fig. 4D) was down-regulated by E2

lone at 24 h (10.75-fold). After 48 h, all treatment groups werebout equal in the expression of StAR. Then at 72 h, all treat-ents caused a down-regulation in the expression of StAR com-

ared to vehicle (11.6% of vehicle across the treatment groups).

a

f

5 mg/kg MXC.XC and (�) 25 mg/kg MXC.

.4. MXC and E2 affect ER expression differently in liver

nd testes

Fig. 5 shows the results of side-by-side comparisons of theold-changes from vehicle for each of the LMB ERs in the liver

J.L. Blum et al. / Aquatic Toxicology 86 (2008) 459–469 465

Fig. 3. The effects of E2 or MXC on CYP3A activity after 24 h. Data pre-sented are the mean ±S.E.M. of the total CYP3A activity after 24 h of treatmentftα

asBlowtsbbc

oHisasE

3

wtcdiHTsvHo1u

Table 2Methoxychlor metabolites detected in largemouth bass liver following IP injec-tion with 25 mg/kg MXC

Metabolite 24 h 48 h 72 h

HPTE N.D.–96a N.D N.D.OH-MXC 87 ± 36 45 ± 26 154 ± 111MXC 2720 ± 960 3370 ± 2250 4350 ± 1060

Values shown are pmol/g wet wt, mean ± S.E., n = 3, except as indicated. Therecovery of MXC, OH-MXC and HPTE from spiked liver samples was 91 ± 1%.T

2

4

stlct(cth(ddEsaobriTc(a

r�tlMetbbowr

rom liver microsomes of LMB as described in Section 2. Differences betweenhe treatment groups were determined using Duncan’s multiple range test with= 0.05. Bars with different letter are statistically different.

nd testes at the 24 h time point. For ER�, E2 stimulated expres-ion in the liver, while it decreased expression in the testes.oth 2.5 mg/kg and 10 mg/kg MXC seemed to cause similar

evels of increase between these two tissues. The highest dosef MXC gave a pattern of increasing ER� expression, in the liverhile not really affecting expression in the testes. ER�a showed

he same pattern of change in expression by the treatment aseen for ER�. ER�b expression was more highly stimulatedy E2 and 25 mg/kg MXC in the liver than in the testes, whileoth 2.5 mg/kg and 10 mg/kg MXC caused approximately equalhanges.

There is a relatively linear dose response effect with MXCn the expression of the three estrogen receptors in the liver.owever, in the testis, the dose response curve appears as an

nverted U, where the lower concentrations increase ER expres-ion above the level of the highest concentration of MXC. E2t 1 mg/kg also appears to have a negative effect on the tran-cription of the ERs � and �a, and only a small up regulation ofR�b in the testis.

.5. Residues of MXC and metabolites in liver

Extraction and HPLC analysis of liver showed that MXCas present in the livers of bass dosed with 25 mg/kg at the

hree time points studied (Table 2). The concentrations foundorresponded to between 0.1 and 0.2% of the administeredose. The mono-demethylated metabolite, OH-MXC was foundn all liver samples, whereas the bis-demethylated metabolite,PTE was detected in only one liver sample, taken at 24 h.he efficiency of extraction of MXC and its metabolites frompiked liver samples was 91 ± 1% (mean ± S.D., n = 3). The

alues shown in Table 2 are not corrected for recovery. ThePLC method separated HPTE, OH-MXC and MXC fromther components in the liver, with retention times of 13.3 min,7.1 min and 20.9 min, respectively under the conditionssed.

h2w2t

he results shown are not corrected for recovery.a N.D. Not detected (<20 pmol/g); HPTE was not detected in two of the three4 h samples.

. Discussion

The goal of this study was to measure changes in the expres-ion of some genes related to reproduction following exposure tohe pesticide MXC and to compare its effects to E2 in male LMBiver and testes. Initial trials to test the effects of three differentoncentrations of MXC on gene expression involved challenginghe LMB with concentrations of MXC at a higher range of doses250 mg/kg, 100 mg/kg, and 25 mg/kg) which were based on theoncentration of 254 mg/kg previously published to be effec-ive for channel catfish (Schlenk et al., 1997). However, a fewours following treatment, all of the fish treated with 250 mg/kg22/22) were dead, while with 100 mg/kg, all but three of the fishied (19/22), and with the 25 mg/kg treatment, only three fishied (3/21). Individuals treated with vehicle (DMSO) or 1 mg/kg2 survived. From these data we conclude that LMB are moreensitive to MXC than channel catfish. Before they died, the fishppeared to have trouble with orientation (swimming erraticallyr upside down). In addition, they appeared to be having somereathing difficulties. It is possible that DMSO allowed rapidelease of the MXC into the tissues resulting in the acute toxic-ty, as these symptoms are known signs of acute MXC exposure.herefore we tested the response of the fish using other vehi-les and determined that the combination of acetone:sesame oil6.25%:93.75% v/v) was adequate for this experiment, as nocute toxicity was seen with this mixture.

It has previously been shown that the male LMB liveresponds to E2 with respect to the expression of ERs � andb and Vtg 1 (Sabo-Attwood et al., 2004). This study is the first

o show that MXC also alters expression of ERs and Vtg 1 in theiver in the LMB. ER� was up-regulated by E2 and by 25 mg/kg

XC after 24 and 48 h and by 10 mg/kg MXC after 48 h. Thexpression of the two ER�s were similar to one another, wherehey were each stimulated by all treatments compared to vehicley 24 h and returned to the level of control by 48 h. The majoriomarker in male fish for the estrogen response is the expressionf Vtg 1 in the liver. We found that MXC, at all concentrations,as able to up-regulate the expression of Vtg 1 by 24 h. This

esponse is likely largely dependent on existing ERs in the liver,owever, as we have demonstrated in the past (Bowman et al.,

002), even further increase in Vtg expression can be associatedith an increase in expression of ER�, as seen for the E2 and5 mg/kg MXC treatments. We speculate that these data suggesthat the sensitivity of the ER� promoter to MXC is less than that

466 J.L. Blum et al. / Aquatic Toxicology 86 (2008) 459–469

Fig. 4. The effects of E2 or MXC on gene expression in the testes. Data presented are the means ±S.E.M. of the log10 (copy number) for each gene normalized tothe log10 (copy number)18S rRNA present in the sample. Differences between treatments within each time point were determined using Duncan’s multiple rangetest. The line graphs next to each of the bar graphs show the fold-change from vehicle over time by subtracting the log10 of the vehicle from each treatment. The zerotime point used the means of untreated fish. Bars with different letters are significantly different. (A) ER� expression. (B) ER�a expression. (C) ER�b expression.(D) StAR expression.B ( ) 2L kg M

oatt

lMliofiiLo

Mtclicrasa

ars: ( ) vehicle; ( ) 1 mg/kg E2; ( ) 2.5 mg/kg MXC; ( ) 10 mg/kg MXC;ines: (�) vehicle; ( ) 1 mg/kg E2; ( ) 2.5 mg/kg MXC; ( ) 10 mg/

f the Vtg 1 promoter, since all concentrations of MXC wereble to increase Vtg at the 24 h time point, while only E2 andhe highest concentration of MXC (25 mg/kg) increased ER� athis time point.

The much greater transcriptional activation of the ER�s in theiver by 25 mg/kg MXC compared to 1 mg/kg E2, suggests that

XC is more potent than E2 for these two genes. These effectsasted through 24 h for ER�a and 48 h for ER�b. Alternatively, its possible that the differences are due to the biological half-livesf the two compounds. The half-life for E2 is relatively short in

sh; for example in fathead minnow (Pimephales promelas) it

s about 2–4 h (Korte et al., 2000). The half-life of MXC inMB has not been reported, but is likely to be longer than thatf E2. In this study, the livers of the LMB treated with 25 mg

etc

5 mg/kg MXC.XC and (� ) 25 mg/kg MXC.

XC/kg contained residues of MXC for at least 72 h followingreatment. The residues included unchanged MXC and smalleroncentrations of OH-MXC and very little, if any HPTE. It isikely that the OH-MXC and HPTE metabolites were formedn all MXC-treated fish, and then eliminated as the glucuronideonjugates. Studies with channel catfish showed that MXC waseadily demethylated in hepatic microsomes forming OH-MXCnd HPTE (Stuchal et al., 2006). Both OH-MXC and HPTE wereubstrates for glucuronidation in channel catfish liver (James etl., 2006).

A longer biological half-life for MXC compared to E2 mayxplain a decreased or delayed estrogenic effect, especially sincehe demethylated metabolites are more potent than the parentompound with the LMB ERs (Blum et al., 2008). This may

J.L. Blum et al. / Aquatic Toxicology 86 (2008) 459–469 467

F s betwV s ±S

e1MrEraoog1nta

6tiaTi6(owirfooappmbol(

oo

tatriHii2ealrmLi(itfrtETfs(

iic

ig. 5. Comparison of the changes in gene expression for each of the LMB ERalues are the mean fold-change from vehicle on the log10 scale. Data are mean

xplain the delayed stimulation of ER� seen with treatment with0 mg/kg MXC compared to E2. But, it may also be possible thatXC regulates the ER�s through a mechanism that does not

equire the ERs. It is not clear in fish how the promoters for theR�s are regulated, whether they can be self-regulated or cross-

egulated, or if they are regulated through ER activity at all. Thisppears to be true for the human ERs as well upon inspectionf the current literature. There are many reports showing co-perativity between the receptors themselves regulating otherenes as both homo- and hetero-dimers (Hall and McDonnell,999; Sabo-Attwood et al., 2007; Tremblay et al., 1999), butothing on how they regulate their own promoters directly, andherefore their regulation may be through other mechanisms ofction.

We found that the expression of mRNA for CYP3A isoform8 was increased by all treatments in the liver by 24 h afterreatment. There was similarly an increase in CYP3A activ-ty with all treatments by 24 h, but this increase occurred in

pattern that was different from the gene expression levels.he CYP3A activity measured was likely the sum of activ-

ties from multiple isoforms, including for example isoform9 which has been shown to be present in the liver of LMBBarber et al., 2007). Further studies assessing the specific rolesf the individual CYP3A isoforms need to be performed. Itas interesting to see that CYP3A68 is quickly up-regulated

n the liver within 24 h of treatment. This appears to match theegulation of the ER�s (ER�b in particular). The CYP3A iso-orms are important for metabolizing endogenous steroids andther lipoid hormones (Guengerich, 1991) as well as xenobi-tic agents (Schuetz et al., 1998; James et al., 2005; Meuccind Arukwe, 2006; Mortensen and Arukwe, 2006) and theirromoter organization and regulation in mammals have beenartially characterized (Anakk et al., 2003), but there is no infor-ation on the promoters in LMB. CYP3A has been shown to

e up-regulated by MXC in rats (Mikamo et al., 2003) and byther endocrine disruptors in MCF-7 and HepG2 human cellines (Coumoul et al., 2002) through the pregnane-X-receptorPXR). However, it is not clear whether it is the parent compound

dapt

een liver and testes. The effects of E2 or MXC are tissue and dose-dependent..E. of the 18S rRNA normalized values.

r the bioactivated metabolites that are causing the up-regulationf CYP3A.

MXC is readily metabolized into OH-MXC and HPTE inhe liver. The metabolites have been shown to be the main lig-nds for estrogenic responses in mammalian systems exposedo MXC. Gaido et al. (1999) showed that for both human andat ER�, HPTE is a potent agonist and in combination with E2,t is further able to increase receptor activity. At the same time,PTE is a potent human ER� antagonist, capable of decreas-

ng ER� activity. Both OH-MXC and HPTE have been detectedn trout (Ohyama et al., 2004), channel catfish (Stuchal et al.,006), and in small amounts in this study, suggesting that thestrogenic effects seen, for example the up-regulation of Vtg 1nd the ERs, could be occurring as a consequence of the metabo-ites, rather than the parent compound. The LMB ERs, however,espond differently to MXC and its metabolites compared to theammalian ERs. In vitro transcriptional activation studies withMB ERs showed that the parent compound MXC, as well as

ts metabolites are capable of activating all three of the receptorsBlum et al., 2008). In that study, we transfected the LMB ERsnto HepG2 cells (human hepatocellular carcinoma) and testedheir transactivation with MXC and the MXC metabolites andound that they behave quite differently from the human andat ERs (Gaido et al., 1999). For the LMB ERs, the potency ofhe ligand increased with the degree of demethylation for bothR� and ER�b. However, the opposite was found for ER�a.he efficacy of these ligands was also always highest for ER�b,

ollowed by ER�, while ER�a activity, although significantlytimulated, was never greater than 2-fold with any of the ligandsBlum et al., 2008).

In the testes, stimulation of expression of the measured geness different from that seen in the liver. The expression of ER�s unaffected by E2 or by MXC at any time point measured. Inontrast, the ER�s are responsive to MXC, with no significant

ifference among the doses at 24 h. After 48 h, ER�a and ER�bre significantly up-regulated, but only by 25 mg/kg MXC. It isossible that the two ER�s are regulated in similar fashion in theestes based on their patterns of expression influenced by MXC.

4 Toxico

Ttt

gltrsAtdpb7tpstp

lMeitsrw

A

DtoasfP

R

A

A

B

B

B

B

B

C

D

E

E

F

G

G

G

G

H

H

H

J

J

J

J

68 J.L. Blum et al. / Aquatic

hese results are consistent with the idea that the genes arose ashe result of gene duplication sometime during the evolution ofhe line of teleost fishes (Hawkins et al., 2000).

The expression of StAR was quite different from the otherenes. MXC did show an effect on its expression, but regard-ess of dose, it took 72 h to see the effect. The reason for theime delay is unclear, but may be due to a secondary responseesulting from a metabolite of MXC, or through alteration ofteroid biosynthesis pathways through certain feedback loops.lternatively, this effect can be due to altered activity of other

ranscription factors. In comparison to MXC, E2 was able toecrease the expression of StAR after only 24 h. After this timeoint, the response leveled off where there were no differencesy treatment at 48 h, but StAR was down-regulated again at the2 h time point. In other work from our lab, it was discoveredhat there is an estrogen receptor element half-site in the distalart of the promoter of LMB StAR (Kocerha, 2005). This half-ite ERE may be involved in the regulation of this pathway, buto date no direct interaction between the LMB ERs and the StARromoter has been shown.

In conclusion, we have found that MXC stimulates estrogen-ike responses in the liver, similar to the action of E2. In addition,

XC increased CYP3A68 mRNA expression and activity. Theffects from a single injection are relatively short-lived; suggest-ng that metabolism of MXC may efficiently reduce the levels ofoxicant in fish. The effects in the testis were quite different, withignificant up regulation of mRNAs for the ER�s and a downegulation of StAR. Taken together these data suggest that MXCorks as an endocrine disruptor and could affect reproduction.

cknowledgements

The authors thank Mr. Kevin Kroll and other members of theenslow laboratory for assistance in the treatment of the fish and

issue collection. In addition, we thank the staff of the Universityf Florida Aquatic Toxicology Facility for assistance in the carend maintenance of the fish before and during the study. Thesetudies were funded by the Superfund Basic Research Programrom the National Institute of Environmental Health Sciences,42 ES 07375 and RO1 ES015449.

eferences

nakk, S., Kalsotra, A., Shen, Q., Vu, M.T., Staudinger, J.L., Davies, P.J.A.,Strobel, H.W., 2003. Genomic characterization and regulation of CYP3a13:role of xenobiotics and nuclear receptors. FASEB J. 17, 1736–1738.

ugustijn-Beckers, P.W.M., Hornsby, A.G., Wauchope, R.D., 1994.SCS/ARS/CES pesticide properties database for environmental decision-making II. Additional properties. Rev. Environ. Contam. Toxicol. 137,1–82.

arber, D.S., McNally, A.J., Garcia-Reyero, N., Denslow, N.D., 2007. Exposureto p,p′-DDE or dieldrin during the reproductive season alters hepatic CYPexpression in largemouth bass (Micropterus salmoides). Aquat. Toxicol. 81,27–35.

lizard, D., Sueyoshi, T., Negishi, M., Dehal, S.S., Kupfer, D., 2001. Mechanismof induction of cytochrome p450 enzymes by the pro-estrogenic endocrinedisruptor pesticide-methoxychlor: interactions of methoxychlor metaboliteswith the constitutive androstane receptor system. Drug Metab. Dispos. 29,781–785.

K

logy 86 (2008) 459–469

lum, J.L., James, M.O., Stuchal, L.D., Denslow, N.D., 2008. Transactiva-tion of largemouth bass estrogen receptors alpha, beta-a, and beta-b bymethoxychlor and its mono- and bis-demethylated metabolites in HepG2cells. Steroid Metab. Mol. Biol. 108, 55–63.

orgeest, C., Miller, K.P., Gupta, R., Greenfeld, C., Hruska, K.S., Hoyer, P.,Flaws, J.A., 2004. Methoxychlor-induced atresia in the mouse involves Bcl-2 family members, but not gonadotropins or estradiol. Biol. Reprod. 70,1828–1835.

owman, C.J., Kroll, K.J., Gross, T.G., Denslow, N.D., 2002. Estradiol-inducedgene expression in largemouth bass (Micropterus salmoides). Mol. Cell.Endocrinol. 196, 67–77.

oumoul, X., Diry, M., Barouki, R., 2002. PXR-dependent induction of humanCYP3A4 gene expression by organochlorine pesticides. Biochem. Pharma-col. 64, 1513–1519.

ehal, S.S., Kupfer, D., 1994. Metabolism of the pro-estrogenic pesticidemethoxychlor by hepatic P450 monooxygenases in rats and humans: dualpathways involving novel ortho ring-hydroxylation by cyp2B. Drug Metab.Dispos. 22, 937–946.

roschenko, V.P., Cooke, P.S., 1990. Morphological and biochemical alterationsin reproductive tracts of neonatal female mice treated with the pesticidemethoxychlor. Biol. Reprod. 42, 573–583.

roschenko, V.P., Rourke, A.W., Sims, W.F., 1996. Estradiol or methoxychlorstimulates estrogen receptor (ER) expression in uteri. Reprod. Toxicol. 10,265–271.

ogel, S., Lancione, R.L., Sewall, A.E., 1982. Enhanced biodegradation ofmethoxychlor in soil under sequential environmental conditions. Appl. Env-iron. Microbiol. 44, 113–120.

aido, K.W., Leonard, L.S., Maness, S.C., Hall, J.M., McDonnell, D.P., Saville,B., Safe, S., 1999. Differential interaction of the methoxychlor metabolite2,2-bis-(p-hydroxyphenyl)-1,1,1-trichloroethane with estrogen receptors �

and �. Endocrinology 140, 5746–5753.arcia-Reyero, N., Barber, D.S., Gross, T.S., Johnson, K.G., Sepulveda, M.S.,

Szabo, N.J., Denslow, N.D., 2006. Dietary exposure of largemouth bassto OCPs changes expression of genes important for reproduction. Aquat.Toxicol. 78, 358–369.

oldman, J.M., Murr, A.S., Buckalew, A.R., Schmid, J.E., Abbott, B.D., 2004.Methoxychlor-induced alterations in the histological expression of angio-genic factors in pituitary and uterus. J. Mol. Hist. 35, 363–375.

uengerich, F.P., 1991. Reactions and significance of cytochrome P-450enzymes. J. Biol. Chem. 266, 10019–10022.

all, J.M., McDonnell, D.P., 1999. The estrogen receptor beta-isoform (ER�)of the human estrogen receptor modulates ER� transcriptional activity andis a key regulator of the cellular response to estrogens and antiestrogens.Endocrinology 145, 5566–5578.

awkins, M.B., Thornton, J.W., Crews, D., Skipper, J.K., Dotte, A., Thomas, P.,2000. Identification of a third distinct estrogen receptor and reclassificationof estrogen receptors in teleosts. Proc. Natl. Acad. Sci. 97, 10751–10756.

emmer, M.J., Hemmer, B.L., Bowman, C.J., Kroll, K., Folmar, L.C., Mar-covich, D., Hoglund, M.D., Denslow, N.D., 2001. Effects of p-nonylphenol,methoxychlor, and endosulfan on vitellogenin induction and expression inthe sheepshead minnow, Cyprinodon variegates. Environ. Toxicol. Chem.20, 336–343.

ames, M.O., Little, P.J., 1983. Modification of benzo(a)pyrene metabolism inhepatic microsomes from untreated and induced rats by imidazole deriva-tives which inhibit monooxygenase activity and enhance epoxide hydrolaseactivity. Drug Metab. Dispos. 11, 350–354.

ames, M.O., Lou, Z., Rowland-Faux, L., Celander, M.C., 2005. Properties andregional expression of a CYP3A-like protein in channel catfish intestine.Aquat. Toxicol. 72, 361–371.

ames, M.O., Faux, L.R., Stuchal, L.D., Sacco, J.C., Wang, L.Q., 2006. Interac-tion of environmental chemicals with glucuronidation pathways in channelcatfish. Mar. Environ. Res. 62, S66.

ohnson, W.W., Finley, M.T., 1980. Handbook of acute toxicity to chemicals to

fish and aquatic invertebrates, 137. United States Department of Interior, Fishand Wildlife Service, Washington, DC (Resource Publication, pp. 6–56).

apoor, I.P., Metcalf, R.L., Nystrom, R.F., Sangha, G.K., 1970. Comparativemetabolism of methoxychlor, methiochlor and DDT in mouse, insects andin a model ecosystem. J. Agric. Food Chem. 18, 1145–1152.

Toxico

K

K

L

L

L

M

M

M

M

N

N

N

O

O

R

S

S

S

S

S

S

S

T

U

W

W

J.L. Blum et al. / Aquatic

ocerha, R.J., 2005. Regulation of the steroidogenic acute regulatory protein by3′–5′ dibutyryl cyclic AMP and transforming growth factor-beta dependentpathways. Doctoral Dissertation. University of Florida, Gainesville, FL.

orte, J.J., Kahl, M.D., Jensen, K.M., Pasha, M.S., Parks, L.G., LeBlanc, G.A.,Ankley, G.T., 2000. Fathead minnow vitellogenin: complementary DNAsequence and messenger RNA and protein expression after 17�-estradioltreatment. Environ. Toxicol. Chem. 19, 972–981.

arkin, P., Folmar, L.C., Hemmer, M.J., Poston, A.J., Denslow, N.D., 2003.Expression profiling of estrogenic compounds using a sheepshead minnowcDNA macroarray. Environ. Health Perspect. 111, 29–36.

ou, Z., Johnson, J.V., James, M.O., 2002. Intestinal and hepatic microsomalmetabolism of testosterone and progesterone by a 3 alpha-hydroxysteroiddehydrogenase to the 3 alpha-hydroxy derivatives in the channel catfish,Ictalurus punctatus. J. Steroid Biochem. Mol. Biol. 82, 413–424.

owry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein mea-surement with the folin phenol reagent. J. Biol. Chem. 193, 265–275.

eucci, V., Arukwe, A., 2006. The xenoestrogen 4-nonylphenol modulates hep-atic gene expression of pregnane X receptor, aryl hydrocarbon receptor,CYP3A and CYP1A1 in juvenile Atlantic salmon (Salmo salar). Comp.Biochem. Physiol. C: Toxicol. Pharmacol. 142, 142–150.

ikamo, E., Harada, S., Nishikawa, J.-I., Nishihara, T., 2003. Endocrine dis-ruptors induce cytochrome P450 by affecting transcriptional regulation viapregnane X receptor. Toxicol. Appl. Pharmacol. 193, 66–72.

iller, K.P., Gupta, R.K., Flaws, J.A., 2006. Methoxychlor metabolites maycause ovarian toxicity through estrogen-regulated pathways. Toxicol. Sci.93, 180–188.

ortensen, A.S., Arukwe, A., 2006. The persistent DDT metabolite,1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene, alters thyroid hormone-dependent genes, hepatic cytochrome P4503A, and pregnane X receptorgene expressions in Atlantic salmon (Salmo salar) Parr. Environ. Toxicol.Chem. 25, 1607–1615.

ational Center for Food and Agricultural Policy, 1997. Table 18B: Pesticide usein crop production by active ingredient and crop pesticide: methoxychlor.http://www.ncfap.org/database/national/summary.asp.

imrod, A.C., Benson, W.H., 1997. Xenobiotic interaction with and alteration ofchannel catfish estrogen receptor. Toxicol. Appl. Pharmacol. 147, 381–390.

yagode, B.A., 2007. Biotransformation of methoxychlor and selected xeno-biotics by channel catfish (Ictalurus punctatus) and largemouth bass(Micropterus salmoides). Doctoral Dissertation. University of Florida,Gainesville, FL.

hyama, K., Maki, S., Sato, K., Kato, Y., 2004. In vitro metabolism of[14C]methoxychlor in rat, mouse, Japanese quail and rainbow trout inprecision-cut liver slices. Xenobiotica 34, 741–754.

rtiz-Zarragoita, M., Cajaraville, M.P., 2005. Effects of selected xenoestrogenson liver peroxisomes, vitellogenin levels and spermatogenic cell prolifera-tion in zebra fish. Comp. Biochem. Phys. C 141, 133–144.

ankouhi, T.R., Sanderson, J.T., van Holsteijn, I., van Leeuwen, C., Vethaak,A.D., van den Berg, M., 2004. Effects of natural and synthetic estrogens

Y

logy 86 (2008) 459–469 469

and various environmental contaminants on vitellogenesis in fish primaryhepatocytes: comparison of bream (Abramis brama) and carp (Cyprinuscarpio). Toxicol. Sci. 8, 90–102.

abo-Attwood, T.S., Kroll, K.J., Denslow, N.D., 2004. Differential expres-sion of largemouth bass (Micropterus salmoides) estrogen receptor isotypesalpha, beta, and gamma by estradiol. Mol. Cell. Endocrinol. 218, 107–118.

abo-Attwood, T., Blum, J.L., Kroll, K.J., Patel, V.J., Birkholz, D., Szabo,N.J., Fisher, S.Z., McKenna, R., Campbell-Thompson, M., Denslow, N.D.,2007. Distinct expression and activity profiles of largemouth bass estrogenreceptors in response to estradiol and nonylphenol. J. Mol. Endocrinol. 39,223–237.

chlenk, D., Stresser, D.M., McCants, J.C., Nimrod, A.C., Benson, W.H., 1997.Influence of �-naphthoflavone and methoxychlor pretreatment on the bio-transformation and estrogenic activity of methoxychlor in channel catfish(Ictalarus punctatus). Toxicol. Appl. Pharm. 145, 349–356.

chuetz, E.G., Brimer, C., Schuetz, J.D., 1998. Environmental xenobiotics andthe anti-hormones cyproterone acetate and spironolactone use the nuclearhormone pregnenolone X receptor to activate CYP3A23 hormone responseelement. Mol. Pharmacol. 54, 1113–1117.

tresser, D.M., Kupfer, D., 1998. Human cytochrome P450-catalyzed conver-sion of the pro-estrogenic pesticide methoxychlor in an estrogen. DrugMetab. Dispos. 26, 868–874.

tuchal, L.D., Kleinow, K.M., Stegeman, J.J., James, M.O., 2006. Demethyla-tion of the pesticide methoxychlor in liver and intestine from untreated,methoxychlor-treated, and 3-methylcholanthrene-treated channel catfish(Ictalarus punctatus): evidence for roles of cyp1 and cyp3A family isozymes.Drug Metab. Dispos. 34, 932–938.

wartz, W.J., Eroschenko, V.P., 1998. Neonatal exposure to technical methoxy-chlor alters pregnancy outcome in female mice. Reprod. Toxicol. 12,565–573.

remblay, G.B., Tremblay, A., Labrie, F., Giguere, V., 1999. Dominant activityof activation function 1 (AF-1) and differential stoichiometric requirementsfor AF-1 and 2 in the estrogen receptor �–� heterodimeric complex. Mol.Cell. Biol. 19, 1919–1927.

S E.P.A., 1989. Environmental Fate and Effects Division, Pesticide Environ-mental Fate One Line Summary: DDT (p, p′). Environmental ProtectionAgency, Washington, DC.

alker, C.C., Salinas, K.A., Harris, P.S., Wilkinson, S.S., Walts, J.D., Hemmer,M.J., 2007. A proteomic (SELDI–TOF–MS) approach to estrogen agonistscreening. Toxicol. Sci. 95, 74–81.

auchope, R.D., Buttler, T.M., Hornsby, A.G., Augustine-Beckers, P.W.,Burt, J.P., 1992. The SCS/ARS/CES pesticide properties database for

environmental decision-making. Rev. Environ. Contam. Toxicol. 123, 1–155.

ou, L., Sar, M., Bartolucci, E.J., McIntyre, B.S., Sriperumbudur, R., 2002. Mod-ulation of mammary gland development in prepubertal male rats exposed togenistein and methoxychlor. Toxicol. Sci. 66, 216–225.