1

Cytokine Profiles in the Testes of Rats Treated with Lipopolysaccharide Reveal

Localized Suppression of Inflammatory Responses1

Moira K. O’Bryan1,2, Orapin Gerdprasert1, David J. Nikolic-Paterson3, Andreas Meinhardt4,

Julie A. Muir1, Lynda M. Foulds1, David J. Phillips1, David M. de Kretser1,2 and Mark P. Hedger1

Monash Institute of Reproduction and Development1 and the ARC Centre of Excellence in

Biotechnology and Development2, Monash University, Department of Nephrology,

Monash Medical Centre3, Clayton, Victoria 3168, Australia and the Institut für Anatomie und

Zellbiologie, Justus-Liebig-University of Giessen4, D-35385 Giessen, Germany.

Running head: Cytokines in testicular inflammation

Corresponding author:

Associate Professor Mark P Hedger Monash Institute of Reproduction and Development Monash Medical Centre 246 Clayton Road Clayton, Victoria 3168 Australia Phone: 61-3-9594-7124 FAX 61-3-9594-7114 Email: mark.hedger@med.monash.edu.au

Articles in PresS. Am J Physiol Regul Integr Comp Physiol (January 20, 2005). doi:10.1152/ajpregu.00651.2004

Copyright © 2005 by the American Physiological Society.

2

Abstract

Evidence indicates that the testis possesses a reduced capacity to mount inflammatory and

rejection responses, which undoubtedly contributes to the ongoing survival of the highly

immunogenic germ cells. The contribution of local cytokine expression to this condition was

investigated in adult male rats treated with lipopolysaccharide to induce inflammation. Cytokine

mRNA and protein expression were determined in tissue extracts and fluids by Northern blot

analysis, quantitative PCR or RNAse protection assay and specific ELISAs. Testicular

expression of the pro-inflammatory cytokines, interleukin-1β (IL-1β) and tumor necrosis factor-α

(TNFα) was considerably attenuated compared with the liver (control tissue); in contrast, the

testicular IL-6 response was enhanced. Expression of IL-10, a type 2 immunoregulatory

cytokine, was similar in both testis and liver, while the immunoregulatory/anti-inflammatory

cytokines, transforming growth factor-β1 (TGFβ1) and activin A were constitutively elevated in

both normal and inflamed testes. The IL-1β and TGFβ1 proteins were present principally in their

latent (inactive) forms, indicating that enzymic processing is an important control mechanism for

these two cytokines within the testis. These data indicate that inflammatory and regulatory

cytokine activity is regulated at both transcriptional and post-translational levels in a testis-

specific manner. It is concluded that a novel pattern of suppression of pro-inflammatory cytokine

responses and normal or elevated expression of immunoregulatory cytokines may be responsible

for reduced inflammatory responses and enhanced graft survival in the testis. These data have

important implications for the understanding and treatment of male autoimmune infertility,

testicular inflammation and carcinogenesis.

Keywords: immunoregulation, interleukins, fertility, transforming growth factor-β

3

Introduction

The survival of the meiotic and post-meiotic male germ cells, which first appear at the time of

puberty and consequently express a broad range of spermatogenesis-specific autoantigens, has

long been attributed to local immunoregulation (65). Local immunoregulatory mechanisms also

have been implicated in the extended survival of transplants to the testicular interstitial tissue in

experimental rodents (17,26), and the ability of testicular cells to confer protection to grafts at

various external sites (36,58). The mechanisms of this immunoregulation remain poorly defined.

It has been suggested that this unique immunological property of the testis may be due to

selective destruction of antigen-specific T cells through expression of Fas ligand on the testicular

Sertoli cells (2), but this hypothesis has been challenged by subsequent studies (1,13). More

recently, we have proposed an alternative hypothesis that inflammatory responses in the testis are

modified by deviation from the production of key pro-inflammatory cytokines, such as

interleukin-1β (IL-1β) and tumor necrosis factor-α (TNFα), towards immunoregulatory,

immunosuppressive or anti-inflammatory cytokine production (27). This possibility was first

suggested by observations that isolated rat testicular macrophages have a reduced capacity to

produce IL-1β and TNFα in vitro compared with macrophages from other tissues (25,32,33) and

exhibit immunosuppressive characteristics in vivo (3,48).

A number of in vitro studies have shown that the somatic (Leydig, Sertoli or peritubular) cells

and germ cells are also a source of cytokine production in the testis. Leydig cells express

macrophage inhibitory factor (MIF) constitutively (43), and IL-1β, IL-1α and IL-6 upon

stimulation with the inflammatory stimulus, lipopolysaccharide (LPS) in vitro (39,51,67).

Isolated Sertoli cells produce IL-1α constitutively, and IL-6 following stimulation with either

4

LPS or exogenous IL-1 (12,18,51). Spermatocytes and spermatids express TNFα (14).

Expression of immunosuppressive cytokines of the transforming growth factor-β family, TGFβ1

and activin A, has been observed in isolated peritubular cells and Sertoli cells (15,47). These last

two cytokines inhibit a number of pro-inflammatory activities of macrophages and lymphocytes,

including the production and/or actions of IL-1, TNFα and IL-6 (37,53). Although a precise

biological role for many of these cytokines in normal spermatogenesis remains to be defined,

there is no doubt they all may play a role in the response of the testis to immunological and

pathogenic challenges. It is important to recognize, however, that evidence for the involvement

of most of these cytokines in testicular inflammation is based largely on studies in vitro. The use

of isolated cells for such studies can lead to cryptic up-regulation of expression due to the

isolation procedures or culture conditions themselves. A small number of studies have examined

IL-1β and TNFα responses to inflammation in the intact testis in vivo (21,24,31,45,62), but a

direct quantitative comparison between cytokines in the testis and those of other tissues has

never been carried out before.

With these facts in mind, we felt it was vital to obtain quantitative data on cytokine mRNA

expression and protein production in the intact adult testis both before and during inflammation

in vivo. In the case of IL-1β, TGFβ1 and activin A in particular, assessment of mRNA and the

resulting protein product is essential: IL-1β and TGFβ1 are produced as inactive precursors that

require activation by local proteases (4,42), while the monomeric subunit of activin A is able to

dimerize with the α subunit of inhibin to form a functional antagonist of activin bioactivity (54).

Moreover, production of the type 2 immunoregulatory cytokines IL-10 and IL-4, which are

5

important regulators of cellular immune responses (52), has never been investigated in the testis

previously.

The aim of the present study was to examine both pro-inflammatory and regulatory cytokine

production profiles in the whole rat testis in vivo, using our well-characterized LPS-induced

inflammation model (19,20,48,49). This model mimics the human response to inflammation and

infection of the male reproductive tract, leading to suppression of the hypothalamic-pituitary

axis, reduction in androgen production by the Leydig cells and disruption of the developing germ

cells that correlates with the severity of the inflammation (49). We previously have shown that

this inhibition of testis function is accompanied by a transcriptional up-regulation of the

inflammatory mediators IL-1β (21), monocyte chemoattractant protein-1 (MCP-1) (20) and

inducible nitric oxide synthase (iNOS) (48). However, the resident macrophages of the testis

appear not to participate in the inflammatory response and the result is a minor, transient

infiltration of circulating monocytes, with little or no neutrophil or lymphocyte recruitment (49).

Indeed, the data are indicative of a restrained inflammatory response, which has implications for

understanding the ability of antigens to avoid detection in this organ, as well as the response to

various infections and tumors in the testis. The hypothesis to be tested was as follows: that the

testis displays a unique basal and inflammatory cytokine profile compared with other tissues, and

more specifically, that production of pro-inflammatory cytokines is suppressed while anti-

inflammatory/immunoregulatory cytokines are maintained or up-regulated. This study also

represents the first detailed quantitative investigation of a broad range of cytokine responses to

inflammation in the intact testis.

6

Materials and methods

Animals

Adult male Sprague-Dawley rats (100-120 days old) and adult C3H/HeJ mice (50-70 days old)

were obtained from the Monash University Central Animal Services or from Charles River

(Kislegg, Germany). Experimental procedures were approved by the Monash University

Standing Committee on Ethics in Animal Experimentation and the Regionungs Praesidium,

Giessen and conformed to the respective Codes of Practice for the Care and Use of Animals for

Experimental Purposes and the National Research Council’s Guide for Care and Use of

Laboratory Animals. For all experiments the liver was chosen as a control tissue because this

organ contains a substantial resident macrophage population, comparable to that of the testis.

Experimental Procedures

Experiment 1: LPS dose and extended time-course comparison (0-72 hours).

Systemic inflammation was induced in the rats by an injection (i.p.) of pyrogen-free saline (1

ml/kg body weight) containing 0.1 mg/kg (low dose) or 5 mg/kg (high dose) of LPS from

Escherichia coli, serotype 0127:B8 (Sigma Chemical Company, St. Louis, MO). The effects of

these doses of LPS on the pituitary and testicular axis are induction of a mild inflammatory event

and severe endotoxemia, respectively (49). For the control group (0 hours), rats were injected

(i.p.) with pyrogen-free saline only (1.0 ml/kg body weight). At 0, 3, 6, 12, 18, 24 and 72 hours

post-injection, the rats (3 animals/time-point and LPS dose) were killed by CO2 overdose, and

one testis and a fragment of liver were snap-frozen for subsequent RNA extraction.

7

Experiment 2: Acute inflammation time-course (0-6 hours).

Rats were injected (i.p.) with pyrogen-free saline (control group; 3 animals/time-point), or saline

containing 0.1 mg LPS/kg body weight (5 animals/time-point). At 1, 2, 3, 4, 5 and 6 hours post-

injection, the rats were killed by decapitation and trunk blood was collected into tubes without

anticoagulant. The blood was allowed to clot and serum was obtained by centrifugation (1500 x

g, 10 minutes, 4°C) and stored at -20°C until assay. One testis was used for collection of

testicular IF by drainage under unit gravity via a small incision at the caudal end of the capsule

(16 hours, 4°C), as previously described (28). The collected fluid was centrifuged (800 x g, 10

minutes, 4°C) to remove cellular debris and stored at -20°C. The remaining testis was snap-

frozen and stored at -70°C.

Experiment 3: Tissue sampling study.

Rats were injected (i.p.) with pyrogen-free saline (control group), or 0.1 mg LPS/kg body weight

(treatment group). Six rats from each group were killed 3 hours post-injection by CO2 overdose,

and blood was obtained by cardiac puncture for both serum (as already described) and plasma by

collection into tubes containing 100 U heparin, followed by immediate centrifugation (800 x g,

10 minutes, 4°C) to remove blood cells and platelets. The testes were removed, and one testis

from each animal was perfused for one minute with sterile saline via the testicular artery to clear

the vascular bed (64). The contralateral testis was not perfused. Testicular IF was collected from

both the perfused and non-perfused testes as described above, and stored at -20°C. A further 6

animals from each group were anaesthetized with ether and the thorax and abdomen exposed.

The testicular artery on one side was clamped and the ipsilateral testis collected, snap-frozen and

stored at -70°C for protein extraction. The remaining testis was perfused with saline by whole-

8

body perfusion via the descending aorta, followed by periodate-lysine-paraformaldehyde (PLP)

fixative (approximately 10-15 minutes), as previously described (68). The perfused testis was

collected, post-fixed in PLP solution for a further 3 hours, followed by immersion at 4°C in 7%

sucrose for 36 hours, then snap-frozen in liquid nitrogen, and embedded in OCT compound

(Tissue-TEK, Elkhart, IN). The fixed, frozen testes were cut at 10 µm thickness using a Leica

cryostat (Leica Instruments, Heidelberg, Germany), mounted on Superfrost* Plus glass slides

(Menzel, Braunschwig, Germany), air dried for 20 minutes then stored at -20°C.

Experiment 4: Inflammation after Leydig cell ablation.

Rats (12/treatment group) were injected (i.p.) with ethane dimethane sulfonate (EDS; 75 mg/kg

body weight) dissolved in DMSO:water (1:3) to ablate the Leydig cells, or DMSO:water alone

(carrier control) as previously described (34,68). Ten days later, half of the rats in each group

were injected (i.p.) with pyrogen-free saline (controls), and the remaining animals were injected

with 0.1 mg LPS/kg body weight. All rats were killed 3 hours after this second injection by CO2

overdose. One testis and a fragment of liver (control) were collected into liquid N2 for

subsequent RNA extraction and the remaining testis was used for collection of IF as described

above.

RNA Extraction and Northern Blot Analysis

Total RNA was extracted from testis and liver samples using the acid-guanidinium thiocyanate-

phenol chloroform extraction method (11). Northern blotting was carried out as described

previously (20). The following plasmids were used: 1264bp rat IL-1β cDNA in pMosBlue-T

(Amersham Biosciences, Buckinghamshire, UK); 526bp rat IL-10 cDNA in pBlueScript

9

(Stratagene, La Jolla, CA); 793bp rat TNFα cDNA in pBlueScript; and 950bp rat TGFβ1 cDNA

in pMosBlue-T. Glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNA was as described

previously (20). β-actin cDNA was amplified from testicular mRNA using the primers 5’-

CTCTTCCAGCCTTCCTTCCT-3’ and 5’-AAAGCCATGCCAAATGTCTC-3’, followed by

subcloning into PCRII dual promoter plasmid (Promega, Southhampton, UK) using standard

methods. cDNA sequences were confirmed using dye terminator reactions at the Monash

Medical Centre Wellcome Trust Sequencing Facility.

The membranes from both low dose (0.1 mg/kg) and high dose (5 mg/kg) LPS-treated testes and

liver were exposed at the same time overnight to a phospho-imaging screen (Fuji Photo Film

Corporation, Tokyo, Japan). After reading the intensity of signal, the membranes were exposed

to BioMax film (Eastman Kodak, Rochester, NY) in the same X-ray cassette in the presence of

an intensifying screen (Kodak). Normalization of the variations in RNA loading between

samples was performed by re-probing the same RNA blot with cDNAs encoding GAPDH and β-

actin mRNA (‘housekeeping’ controls), and all Northern blot data were normalized against each

control. The signal intensity of radioactive molecules hybridized to the RNA blot was quantified

using phospho-image analysis. After exposure to the phospho-imaging screen, the image was

scanned in a Fuji BAS1000 MacBAS Bio-Imaging Analyzer and analyzed using MacBAS V 2.5

software (Fuji). After background membrane intensity was subtracted from cytokine signal

intensity, the real cytokine intensity was corrected against the intensity of GAPDH and β-actin

separately in each sample. Repeat experiments (n=3 per animal and time point) were done in

parallel and placed on the same phospho-imaging screen and used the same exposure time for

each cytokine, so it was possible to compare cytokine expression in the testis and liver. The liver

10

control (0 hours) signal included on each membrane was assigned an arbitrary value of 1.0. For

IL-6 and IL-10, where there was no detectable band in the normal liver (0 hours) samples,

relative absorbance values were expressed in comparison to the background intensity in the

control lane. All experiments included a minimum of three animals per treatment group and

time-point. Very similar expression profiles were obtained using either GAPDH or β-actin as a

loading control, as both housekeeping genes were unchanged in testis and liver following LPS-

treatment. Whereas GAPDH mRNA levels in testis and liver were comparable, testis extracts

contained considerably higher levels of β-actin mRNA transcripts than did the liver samples.

Consequently, all Northern data are presented relative to GAPDH.

Real-time Quantitative PCR Using the LightCyclerTM

Quantitative analysis of IL-1β, IL-10 and IL-4 mRNA expression was performed using standard

methods in a LightCyclerTM (Roche Diagnostic, Mannheim, Germany). 1-2 µg of total RNA

obtained from testis and liver was reverse-transcribed using Omniscript (Qiagen, Hilden,

Germany). The primers used for amplification of the cDNAs are listed in Table 1 (Sigma-

Genosys, Castle Hill, Australia). Amplified PCR products were sequenced using the dye

terminator method to confirm amplification of the correct product (data not shown). Standard

curves using the recombinant plasmids of known concentrations (0.01 pg/µl to 1 ng/µl), and

samples containing RNA without reverse transcriptase were included for every run. All samples

were normalized against β-actin expression, and subsequently corrected for the tissue-specific

difference in β-actin expression, which was between 7- and 10-fold higher in the testis compared

with the liver (data not shown). Confirmation of expression levels was performed using

normalization to total RNA in each extract, which gave almost identical results. The corrected

11

data were then standardized against liver from control animals (assigned the arbitrary value of

1.0) to allow quantitative comparisons between liver and testis expression and direct comparison

with the Northern blot analysis data. Each quantitative PCR experiment included a minimum of

three animals per treatment group and time-point.

RNase Protection Assay for IL-1β and IL-1α

Ribonuclease protection analysis of cytokine expression was performed using a commercially

available kit (RiboQuant Multi-Probe, BD Biosciences, Heidelberg, Germany) according to the

manufacturer’s instructions. The custom template set contained DNA templates for both IL-1β

and IL-1α, as well as GAPDH and another ‘housekeeping’ gene, L32. Although there is an

alternate transcript of IL-1α in the rat testis that lacks exon 5 (23,61), the IL-1α probe used in the

present study hybridized to a region of mRNA from exon 1 of the gene and would pick up both

testicular transcripts.

Total RNA was isolated with the single-step acid phenol-guanidinium thiocyanate-chloroform

extraction method (11) using Trizol reagent (Invitrogen, Karlsruhe, Germany). Briefly, 32[P]

radiolabeled antisense riboprobes were generated by multiplex in vitro transcription using [α-

32P]UTP (Amersham, Braunschweig, Germany) and T7 RNA polymerase. Radiolabeled probes

were hybridised with 5 µg of total testicular or liver RNA samples at 56°C overnight. After

RNase A/T1 treatment for digestion of single-stranded RNA, samples together with undigested

probes and in vitro transcribed 100bp RNA markers (Century Marker, Ambion, Huntingdon,

UK) were resolved on a 50 x 30 cm 5-6% polyacryamide/7M urea gel. The gel was dried for 1

hour at 80°C under vacuum (BioRad, München, Germany), exposed to a phosphorimage screen

12

overnight and analyzed on a Fuji PhosphorImager FLA3000G (Raytest, Straubenhardt,

Germany). Subsequently, RNase protected bands were quantified using Fuji Image Gauge

software. For each treatment group analyzed, RNA was prepared from four randomly selected

animals. The probe set was labeled three or four separate times for analyses of samples from

each testis examined. Liver RNA (± LPS) was included as control for cytokine expression. All

cytokine data was normalized for loading against both GAPDH and L32, with similar results

obtained.

Preparation of Tissue Extracts for Protein and Cytokine Measurements

Samples of frozen testes were homogenized (1:3, w:v) in 5 mM phosphate-buffered saline (PBS)

pH 7.5, 1% nonidet P-40, 0.5% Tween 20 and 0.1% SDS, containing CompleteTM protease

inhibitor cocktail (Roche) at 4°C. For detection of IL-1β protein only, testes were homogenized

(1:2, w/v) in 5 mM PBS pH 7.5 containing a protease inhibitor cocktail (2 mM AEBSF, 1 mM

EDTA, 0.13 mM bestatin, 0.014 mM E-64, 1 mM leupeptin, 0.0003 mM aprotinin; Sigma).

Lysates were centrifuged twice at 15,000 x g for 30 minutes at 4oC. Supernatants were collected

and stored at -20°C until analyzed. Protein concentrations of supernatants of homogenized testes

were determined by using DC Protein Assay Kit (BioRad) by comparison to a bovine serum

albumin (BSA) standard.

Enzyme Linked Immunosorbent Assays

IL-1β ELISA

IL-1β in testicular IF, testicular extracts, serum and plasma was measured using a Quantikine M

Rat IL-1β Immunoassay (R&D Systems, Minneapolis, MN) (66), according to the

13

manufacturer’s protocol. All samples were assayed at 2-3 serial dilutions in freshly prepared

assay buffer, and samples of rat testicular extract, IF, blood and serum diluted in parallel with the

standard across the effective assay dose-response range. The assay had a sensitivity of 60 pg/ml and

an intra-assay coefficient of variation of 7.6%.

IL-10 ELISA

IL-10 was measured in testicular IF, testicular extracts, serum and plasma using a Biosource rat

IL-10 assay kit (Biosource, Camarillo, CA), according to the manufacturer’s protocol. The assay

had a sensitivity of 50 pg/ml and an intra-assay coefficient of variation of 10.2%.

Activin A ELISA

Activin A was measured in testicular IF, testicular extracts, serum and plasma using a specific

ELISA (Oxford Bio-Innovations, Oxfordshire, UK) according to the manufacturer’s instructions

with some modifications and using human recombinant activin A as standard as previously

described (8). The assay had a sensitivity of 5 pg/ml and an intra-assay coefficient of variation of

4.2%.

TGFβ1 ELISA

TGFβ1 was assayed using a two-site ELISA kit (R&D Systems), with recombinant human TGFβ1 as

standard (40), according to the manufacturer’s instructions. This assay shows 57% cross-reactivity

with human TGFβ1.2, 0.15% with TGFβ2 and 0.96% with TGFβ3. Rat TGFβ1 possesses 91%

homology with human TGFβ1 at the precursor protein level (56). All samples were assayed at 2-3

serial dilutions against the standard. In order to measure total TGFβ1 levels, latent TGFβ1 in the

14

samples was acid-activated by addition of 2.5M acetic acid/10M urea for 15 minutes, followed by

neutralization with 2.7 M NaOH/1 M HEPES. Samples of acid-activated rat testicular extract, IF,

plasma and serum showed significant parallelism with the human TGFβ1 standard across the

effective assay dose-response range. The assay had a sensitivity of 150 pg/ml and an intra-assay

coefficient of variation of 10.9%.

All assay plates were read on a Multiskan RC plate reader (Labsystems, Helsinki, Finland) at the

appropriate wavelength, and data were processed using the Genesis Lite EIA software

(Labsystems). All samples were assayed in duplicate and assessed against the standard using

routine parallel-line assay statistics. Values for testis extracts and blood are presented as mean ±

SEM of replicate samples. Due to the small volumes of IF obtained per animal relative to the

volume required for assay, cytokine concentrations in testicular IF were obtained from pools of

equal volume samples from all animals in each experimental group, unless otherwise indicated.

The pooled samples were assayed at serial dilutions against the standard and data are expressed

as mean activity with 95% confidence intervals, as appropriate.

Testosterone assay

Testicular IF was assayed for testosterone without extraction using a direct 125I-testosterone

radioimmunoassay (44).

Immunohistochemistry

Frozen sections were washed twice with PBS. Endogenous peroxidase activity was quenched by

incubation in 5mM periodate solution for 5 minutes and subsequently immersed in 0.03 M

15

sodium borohydride for 30 minutes to reduce aldehyde groups formed by the periodic acid (7).

Non-specific binding was minimized by incubation of the sections in CAS-Block (Zymed, San

Francisco, CA) with 10% normal goat serum for 30 minutes. Endogenous biotin was blocked by

incubation of sections with an avidin-biotin blocking solution (Vector, Houston, TX) for 30

minutes. IL-1β was detected using a rabbit anti-rat IL-1β antiserum (Endogen, Woburn, MA)

diluted 1:200 in 1% BSA in PBS and incubated overnight at 4oC in a humid chamber. The

antibody was raised against recombinant rat IL-1β and does not cross react with IL-1α. Antibody

localization was detected using a biotinylated goat anti-rabbit IgG (DakoCytomation, Glostrup,

Denmark), amplification with ABC-horseradish peroxidase complex (Vectastain Elite ABC kit,

Vector) and visualized using diaminobenzidine tetrahydrochloride as substrate. Sides were

counterstained with 0.1% Mayer’s hematoxylin. The specificity of staining was determined by

replacing the primary antibody with 5% rabbit serum.

IL-1 Bioassay

Bioactive IL-1 was measured by an in vitro lymphocyte proliferation assay, using thymocytes

from LPS-resistant C3H/HeJ mice, as previously described (25,29). Briefly, the thymocytes were

cultured in a 96-well plate (1.2 x 106 cells/250 µl well; 37°C) in Dulbecco’s modified Eagle’s

medium with 2.5% fetal calf serum and 1 µg/ml phytohaemagglutinin, alone or with various

dilutions of testicular IF. After 72 hours of culture, [3H]-thymidine (0.5 µCi/µl) was added to

each well, and the cells cultured for a further 16 hours, after which the cells were harvested using

a Packard Micromate 196 automated cell harvester (Packard Instrument, Downers Grove, Il) and

counted in a Packard 1900 TR scintillation counter.

16

Size Exclusion HPLC Fractionation of Testicular IF

Two pools (200 µl each) were prepared by combining equal volumes of testicular IF collected

from 6 rats injected with 0.1 mg/kg LPS 3 hours previously, and from 6 saline-treated control

rats as described in experiment 2 above. The control IF pool was spiked with 800 pg

recombinant rat Mr 17x103 IL-1β in order to mark the elution position of processed native IL-1β

within testicular IF. Both pools were fractionated by size exclusion chromatography on a

Phenomenex (Torrance, CA) BioSep SEC-S2000 column (300 x 7.8 mm) in 10 mM PBS, pH

7.25 at a flow-rate of 0.5 ml/min. Fractions of 0.5 min (0.25 ml) were collected for assay by IL-

1β ELISA. The column was calibrated with gel filtration standards from BioRad.

Statistical Analysis

All statistical analyses were performed using SigmaStat version 1.0 software (Jandel Scientific

Software, San Rafael, CA). Data was analyzed by one-way ANOVA or two-way ANOVA after

appropriate transformation to equalize the variance between experimental groups, in conjunction

with the Student Newman-Keuls multiple range tests. Comparisons between experimental groups

were considered statistically significant at the p<0.05 level.

Results

Cytokine mRNA Expression Time-course during Inflammation (Experiment 1)

Using Northern blot analysis, appropriate size transcripts were detected for IL-1β, TNFα, IL-6

and TGFβ1 in testes from normal and LPS-treated rats (Fig.1A-D). A signal of the appropriate

size for IL-10 was also observed in the testis following LPS-treatment (Fig. 1E), but levels of

17

expression were too low for comparative quantification. The data indicated the presence of

multiple transcripts of IL-6 in the rat testis, corresponding to identical multiple transcripts in the

liver (Fig. 1C) as previously reported (51). For simplicity of the data presentation, only

quantification of the upper band is shown, although both bands displayed similar expression

patterns. In addition to the 2.5 kb TGFβ1 signal usually seen, the TGFβ1 probe also hybridized

with a smaller band (1.5 kb) in the testis. (Fig. 1D). This smaller transcript has also been

observed in the rat prostate (59).

IL-1β, TNFα and IL-6 were all expressed at low levels in the control testis, and were up-

regulated by LPS over a time-frame similar to that seen for the liver controls (3-6 hours).

Testicular expression of both IL-1β and TNFα was maximally stimulated even at the lower dose

of LPS and showed significantly (approximately 5-fold in both cases) lower levels of expression

compared to the liver controls. In contrast, testicular IL-6 expression was stimulated by LPS in a

dose-dependent manner, and to a much greater level than that seen in the liver. Testicular TGFβ1

was constitutively expressed at very high levels (approximately 10-fold higher) compared with

the liver and was unaffected by LPS. As both doses of LPS caused similar effects on the main

cytokines of interest, all subsequent studies used the lower dose of LPS only. It should be noted

that the physiological response to this lower dose more closely approximates that experienced

during mild systemic inflammation.

Real-time quantitative PCR was used to quantify IL-10 and IL-4 expression, as this provides a

more sensitive method of detection. IL-1β expression was also re-evaluated by this method in

order to determine if results were directly comparable between the two mRNA detection

18

methods (Fig. 2). There was very good correspondence between the results obtained for IL-1β

using quantitative PCR and Northern blot analysis, with IL-1β expression in the testis

consistently much lower (approximately 5- to 7-fold lower) than the liver in control and LPS-

treated samples (Fig. 2A). IL-10 was expressed at similar levels in both the testis and liver before

and after LPS-treatment, although expression levels were quite variable between animals. The

peak of IL-10 mRNA expression appeared to be slightly later than that of IL-1β, ie. 6 hours

compared to 3 hours for both testis and liver (Fig. 2B). IL-4 was detectable in all liver samples

by real-time PCR, but was only detectable in about 30% of all testis samples and did not appear

to be up-regulated by LPS-treatment (data not shown).

Cytokine Protein Time-course during Inflammation (Experiment 2)

Activin A is formed from a dimer of two identical βA subunits. Since these subunits can also bind

to the inhibin α-subunit to form inhibin A, production of activin A can only be measured in any

meaningful way at the level of the mature protein (22). Consequently, the production of activin

A following LPS-treatment was measured by ELISA and compared with IL-1β expression over

the first 6 hours following treatment. Activin A levels in testicular IF were found to be 5-10 fold

higher than in blood (serum) under normal conditions (Fig. 3A). After LPS-treatment, activin A

showed a gradual increase in the circulation with concentrations peaking at 2-4 hours later, but

there was no increase of activin A in testicular IF (Fig. 3A). It should be noted, however, that at

no point did serum levels of activin A reach those seen within testicular IF. In contrast to activin

A, there was a substantial increase in the concentration of IL-1β protein in testicular IF as

measured by ELISA, over the same time-frame (Fig. 3B).

19

Distribution of Cytokine Proteins in Control and Inflamed Testis and Blood

Although cytokine concentrations in IF reflect secretion into the interstitial space of the testis,

these concentrations are potentially affected by cytokine levels in the circulation and by changes

in IF volume, such as that known to occur during LPS-induced inflammation (49). Measurement

of cytokine levels in whole testis extracts provides the real testicular content (both intracellular

and secreted), but cannot discriminate differences in distribution between testicular cells and

compartments. Consequently, the levels of several cytokines were measured and compared in

both IF and total testis extracts (experiment 3) (Table 2). Neither IL-10 nor the active TGFβ1

protein were detectable in either IF or testis extracts from either normal or LPS-treated animals,

indicating endogenous levels of <50 pg/ml and <150 pg/ml, respectively in the adult testis even

after LPS-treatment. Acid-activation of the testis samples, however, revealed the presence of

relatively high levels of latent TGFβ1 in these samples (Table 2).

It was noted that at 3 hours after LPS treatment, IF volume was reduced by more than 2SD

below control levels (ie. < 85 µl/testis) in 5 out of the 12 animals, although the average IF

volume (94 ± 12 µl/testis; mean ± SEM) in these animals remained not significantly different

from normal controls (118 ± 8 µl/testis; p > 0.05). These changes in volume in a minority of the

testes had negligible or marginal effects on mean TGFβ1 or activin A concentrations in IF at this

time-point. It is possible, however, that the reduction in IF volume may have had a concentrating

effect on the IL-1β levels. Similar levels of all three cytokines were found in the IF from both

non-perfused and perfused testes (data not shown), indicating that the presence of blood cells

during IF collection had little or no effect on measurable cytokine levels in the samples. The

levels of both IL-1β or activin A were similar in plasma and serum (data not shown). However,

20

serum contained much higher levels of latent TGFβ1 than did plasma (23 ± 8 ng/ml versus 3.9 ±

0.9 ng/ml; mean ± SEM, n = 6 rats), due to platelet activation following collection.

The data confirm the presence of IL-1β, activin A and TGFβ1 proteins in the normal testis (Table

2), with only IL-1β showing a large increase after LPS administration, consistent with the

mRNA data (Figs. 1 and 2). Although activin A displayed a very slight elevation (25%) in

testicular IF after LPS treatment in this experiment, this was not reflected by changes in the

whole testis, while total TGFβ1 was unchanged in either compartment. The concentration of IL-

1β in both normal and LPS-treated testes was considerably higher than that observed in the

blood, and IL-1β levels in whole testis extracts were also significantly greater than in IF in the

normal controls. After LPS treatment, there was an increase in IL-1β in all compartments, but

testicular levels remained considerably higher than circulating levels. Activin A levels were

significantly higher in the IF than in either the total testis or in blood, while TGFβ1 levels were

highest in the whole testis extracts. The concentrations of TGFβ1 in plasma and IF were almost

identical. These data indicate that there are substantial differences in the compartmentalization,

production, secretion and/or clearance of all three cytokines in the normal and inflamed testis.

Characterisation of Factors Determining IL-1β Activity in Testis

The relative up-regulation of total IL-1β protein in the inflamed testis compared with

correspondingly low levels of mRNA expression levels led us to examine the production of this

cytokine in the testis in more detail. Immunoreactive IL-1β was localized to the cytoplasm of

small numbers of macrophages and the majority of Leydig cells following LPS-treatment, but

was not detectable in the normal testis using immunohistochemistry (Fig. 4). The

21

immunopositive macrophages and Leydig cells were readily identified by their highly

characteristic nuclear morphologies, as previously described (16). The seminiferous epithelium

was negative for IL-1β immunoreactivity in both control and inflamed testes, with the exception

of some staining over residual bodies in the LPS-treated testes (data not shown).

Ablation of the Leydig cells by administration of EDS (experiment 4) reduced intratesticular

testosterone levels from 473 ± 115 ng/ml in control animals (mean ± SEM, n = 6) to 12 ± 6

ng/ml in the Leydig cell-depleted group. This treatment did not significantly affect testicular IL-

1β mRNA expression or IF protein levels in normal or LPS-treated animals (Fig. 5A and C). In

contrast, EDS-treatment caused a significant decline in IL-1α mRNA expression (Fig. 5B). LPS-

treatment had no effect on IL-1α mRNA expression (Fig. 5B). These data implicate a subset of

testicular macrophages as the principal source of IL-1β in the inflamed testis, and suggest that

the contribution from the Leydig cells is comparatively minor.

Measurement of total IL-1 bioactivity in testicular IF, ie. the secretion of both the α and β forms

of IL-1 (Fig. 6), confirmed an earlier study showing that the IF contains significant bioactive IL-

1 that can be specifically and completely inhibited by the native IL-1 antagonist (IL-1ra)(29), but

that higher doses of IF become inhibitory in the bioassay (25). However, in apparent

contradiction to the small but significant increase in testicular IL-1β mRNA following LPS-

treatment and the relatively large increase in IL-1β protein in the IF, there was no corresponding

change in the IL-1 bioactivity levels in testis IF in these animals.

22

Fractionation of testicular IF from LPS-treated rats by size exclusion HPLC confirmed that most,

if not all, of the IL-1β immunoreactivity in this fluid was associated with a peak that eluted

earlier than the processed IL-1β protein and corresponded to the size of the biologically inactive

IL-1β precursor (Mr of 30 x 103) (Fig. 7B). These data indicate that the large increase in IL-1β

immunoreactivity in testicular IF after LPS-treatment is due to production and secretion of the

precursor molecule, which is not converted subsequently to active IL-1β within the testis.

Discussion

This study describes the first quantitative and comparative investigation of both mRNA and protein

responses of a panel of pro- and anti-inflammatory cytokines to an inflammatory stimulus in the rat

testis. The data in the present study establish that compared to the liver, the adult rat testis

constitutively expresses anti-inflammatory cytokines of the TGFβ family (ie. TGFβ1 and activin A)

at elevated levels even under normal conditions, but has a diminished capacity for production of the

two key pro-inflammatory cytokines, IL-1β and TNFα. In the case of IL-1β, moreover, there

appears to be reduced post-translational processing of the inactive precursor, which normally occurs

at the time of its secretion from the cell (4). This is an entirely novel observation. In contrast, IL-6, a

cytokine with both pro-inflammatory and anti-inflammatory properties, displayed elevated

responsiveness to LPS in the testis. Basal and inflammatory expression of the type 2

immunoregulatory cytokine, IL-10 mRNA in the testis appears to be comparable to the liver.

Expression of the other type 2 cytokine, IL-4 was detectable only in a minor proportion of testicular

extracts. Production of these two immunoregulatory cytokines have not been investigated in the

testis previously, either under normal or inflammatory conditions. Altogether, these data confirm

our hypothesis that there is effective immunological deviation of cytokine production in the rat

23

testis, represented by a diminished capacity to produce key pro-inflammatory cytokines and normal

or constitutive expression of several immunoregulatory cytokines. This pattern of cytokine

production in response to an inflammatory stimulus is consistent both with the relatively limited

cellular inflammatory responses observed in the LPS-treated rat testis in vivo (3,19,48), and the

ability of the rat testis to support grafts for extended periods (17,26).

Most previous studies on cytokine expression in the testis have been either non-quantitative or semi-

quantitative. A direct comparison between the levels of expression in the testis with control tissues

and serum using both mRNA and protein was undertaken in the present study in order to assess both

synthesis and the biologically relevant concentrations of the key cytokines produced. In the case of

IL-1β, it was necessary to measure the bioactivity of the protein as well, as the precursor protein is

biologically inactive (4). Measurement of cytokine protein levels in the testicular IF provides a more

direct indication of their physiological significance relative to receptor binding affinity, which

mRNA measurements alone cannot provide. By assessment of the differences in concentrations in

whole testis, interstitial fluid and blood it is clear that some differential compartmentalization of

cytokines exists, consistent with different sites of production and action. Moreover, the relative

stability of TGFβ1 and activin A concentrations even in the face of dramatically changing IF

volume in some testis samples indicates that an effective feedback regulation exists for these two

cytokines, and that intratesticular levels of these constitutively produced cytokines seem to be

tightly controlled even when IF volume changes during inflammation.

In spite of obvious structural and functional differences between the testis and liver, the use of the

liver as a comparative control in the present study can be justified by the fact that both tissues

24

possess a large resident macrophage population. The volume densities of macrophages in the rat

liver and testis as determined by stereological and other analysis are similar (6,35,68). While

there is some evidence that the liver itself possesses a degree of immunological protection

against graft rejection, based on the relative success rates for transplantation of this organ (9), it

is nonetheless clear that the pro-inflammatory response of the testis is severely compromised

relative to the liver. Unlike the testis, the macrophages of the liver possesses normal

inflammatory activity, and can respond to LPS with a strong pro-inflammatory response (41), a

response consistent with other organs such as lung, kidney and skin. Previous in vitro studies have

shown that macrophages, which are usually the principal source of IL-1β and TNFα in other tissues,

are deficient in production of these cytokines in the rat testis (25,32,33). Data suggest that this

deficiency is related to heterogeneity of the testicular macrophage population, which comprises a

large, poorly inflammatory resident population and a much smaller population of macrophages with

relatively normal inflammatory functions (19,27,48,68). The reduced production of these cytokines

in whole testis extracts, as observed in the present study, also may be attributed largely to this

deficiency.

Other cellular sources of these cytokines have been reported in the testis previously, most notably

the Leydig cells in the case of IL-1β, and the developing germ cells for TNFα (14,39). In the present

study, we observed IL-1β protein expression in a subset of macrophages after LPS-treatment.

Although IL-1β also was observed in the Leydig cells, the fact that ablation of Leydig cells by EDS

did not reduce IL-1β expression in the whole testis clearly indicates macrophages, most likely a

subset with normal inflammatory functions (48), as the major source. Using a different antibody,

Jonsson and colleagues also detected expression of IL-1β in a subset of testicular macrophages in rat

25

testis, although not in the Leydig cells (31). A recent study of IL-1 family member mRNA

expression in the human testis also indicated that IL-1β expression is largely confined to the

interstitial tissue, at least under normal conditions (57). In contrast, Huleihel and colleagues

examined the mouse testis and reported observing IL-1β staining in interstitial cells, including the

Leydig cells, but also in spermatogonia, spermatocytes and Sertoli cells (30). Whether these

observations suggest that the mouse testis is substantially different from the rat and human, or the

differences are the result of different methods or reagents used is not clear. However, localisation of

immunoreactive IL-1β in residual bodies was observed in the present study, which may be

indicative of very low level expression in the germ cells, since cytoplasmic proteins tend to become

concentrated in the residual bodies. This still requires confirmation, as residual bodies also are a

common site of ‘non-specific’ binding of antibodies. Ablation of Leydig cells had no effect on IL-

1β, but did cause a reduction in IL-1α expression. This is an novel observation establishing the

importance of Leydig cells or their hormones to maintaining expression of IL-1α, but not IL-1β in

the normal testis.

In spite of the apparently low level of IL-1β mRNA expression in the testis, physiologically relevant

concentrations of IL-1β protein were detected in testicular extracts and IF. Moreover, production

and secretion of IL-1β into the testicular IF increased after LPS treatment, but occurred without any

change in either total IL-1 bioactivity or IL-1α mRNA expression. A very similar result has been

reported previously (31), and the authors suggested that the lack of alteration in bioactivity might be

due to a compensatory increase in antagonists of IL-1, such as the IL-1 receptor antagonist (IL-1ra),

in the LPS-treated testis. The data in the present study, however, support an alternative explanation.

Clearly, LPS induces production of IL-1β precursor and its subsequent secretion into the IF. This

26

precursor, however, is not substantially cleaved to its biologically active form, a process that in

other tissues occurs at the time of secretion by the action of IL-1 converting enzyme (ICE)/caspase-

1 (63). Since the precursor is not bioactive, this would account for the elevated levels of IL-1β

protein without corresponding changes in bioactivity, after LPS-treatment. Thus, the data implicate

down-regulation of both IL-1β transcription and the activity of its specific processing enzyme as

two distinct mechanisms for reducing the pro-inflammatory actions of this cytokine in the testis.

This is an entirely novel finding, and opens up a separate line of inquiry regarding the processing of

cytokines as a regulatory mechanism operating in the rat testis. A similar regulation of TGFβ1 also

appears to operate in the testis, since large amounts of this cytokine are produced but are not

immediately processed into the mature bioactive form.

In contrast to IL-1β and TNFα, production of IL-6 in the testis during inflammation does not appear

to be down-regulated. This may be due to the fact that contributions from cells other than

macrophages, including both Leydig and Sertoli cells (5,12,51,60), are more important for this

cytokine. In fact, we have found that testicular macrophages are relatively poor producers of IL-6 in

vitro (Hedger, unpublished data). More significant for immunoregulation in the testis, however, is

the fact that IL-6 is not a classical pro-inflammatory cytokine like IL-1 and TNFα. While IL-6

displays some pro-inflammatory actions, it also plays an important immunoregulatory role by

inducing acute phase protein production and type 2 T cell responses, and regulating antigen-

presenting cell development (10,46). Most significantly for testis immunoregulation, administration

of IL-6 has been shown to be able to reduce the development and severity of autoimmune orchitis in

C3H/HeJ mice (38).

27

Although a role for TGFβ1 in testicular immunoregulation has been suggested previously

(29,55), this is the first demonstration that this cytokine is expressed at constitutively high levels

in the normal adult testis. Similar to IL-1β, most TGFβ1 in the testis is present as the latent,

inactive precursor form, and active TGFβ1 in the testis was below the detection limit of the assay

in the present study. However, it should be noted that TGFβ1 is a very potent immunosuppressive

cytokine even at very low pg/ml levels (29,42). Moreover, in contrast to IL-1β, which is usually

processed at the time of its secretion, TGFβ1 is normally secreted as the precursor and is

activated at its site of action by local proteases (42). In spite of the evidence for a very high level

of local TGFβ1 production in the testis, with the comparatively higher levels of protein in the

whole testis reflecting the contribution from the peritubular cells and Sertoli cells, the fact that

the levels of the TGFβ1 precursor in the testicular IF were almost identical to circulating levels

also suggest a close relationship between concentrations of this cytokine in the testis and the

blood.

Activin A has profound inhibitory effects on T and B cell function and both IL-1 and IL-6

mediated inflammatory responses (53). The increase of activin A levels in the circulation

following LPS treatment in adult rats confirms earlier observations in mice and sheep (53). Like

TGFβ1, activin A is produced by the Sertoli cells and possibly the peritubular cells in the adult

testis (15). Its presence at levels in the IF in excess of those found in the blood even during

inflammation suggest a relatively high constitutive level of expression in the normal testis.

Together, the high levels of production of activin A and TGFβ1 in the adult testis strongly

suggest a role for both these cytokines in local immunoregulation. This hypothesis is given

support by several of the observations of the present study, most notably because inhibition of

28

ICE/caspase-1 activity is one of the known anti-inflammatory actions of activin A (50). The fact

that both cytokines failed to show significant up-regulation after LPS treatment in the testis,

might be due to the possibility that expression of these cytokines is at a maximum level even

under normal conditions. The relative distribution of TGFβ1 and activin A in the testicular IF

relative to the whole testis also suggests that there is some differential compartmentalization of

the activity and functions of the two cytokines.

In summary, it appears that the on-going suppression of inflammatory and immune responses in

the testis contributes to reduced pro-inflammatory cytokine production and constitutive

expression of immunoregulatory cytokines of the TGFβ family. On the other hand, production of

IL-10 appears normal and also may contribute substantially to testicular immunoregulation. IL-4

was not detectable, although highly localized interactions between immune cells in the

interstitium mediated by this cytokine cannot be excluded. It remains to be determined which

factors within the testicular environment are responsible for directing this unique pattern of

cytokine responses in the adult testis. These cytokine responses not only have implications for

understanding extended graft survival and protection of the developing germ cells from

autoimmune attack, but also may play a role in the susceptibility to, and progression of,

infections and tumors in the testis.

Acknowledgments

Thanks are due to Anne O’Connor, Kim Sebire, Rita Foti, Jörg Klug and Suada Fröhlich for expert

technical assistance. The EDS used in this study was manufactured by Dr. Michael Fuller,

Department of Chemistry, Monash University.

29

Grants

This work was supported by an Australian National Health and Medical Research Council Program

Grant (NHMRC Grant #143786) and NHMRC Fellowships to Drs. O’Bryan (Grant #143781),

Nikolic-Paterson (Grant#289307), Phillips (Grant#194274) and Hedger (Grant #143788).

30

References

1. Allison J, Georgiou HM, Strasser A and Vaux DL. Transgenic expression of CD95 ligand

on islet beta cells induces a granulocytic infiltration but does not confer immune privilege upon

islet allografts. Proc Natl Acad Sci USA 94: 3943-3947, 1997.

2. Bellgrau D, Gold D, Selawry H, Moore J, Franzusoff A and Duke RC. A role for CD95

ligand in preventing graft rejection. Nature 377: 630-632, 1995.

3. Bergh A, Damber JE and van Rooijen N. The human chorionic gonadotrophin-induced

inflammation-like response is enhanced in macrophage-depleted rat testes. J Endocrinol 136:

415-420, 1993.

4. Black RA, Kronheim SR, Cantrell M, Deeley MC, March CJ, Prickett KS, Wignall J,

Conlon PJ, Cosman D and Hopp TP. Generation of biologically active interleukin-1β by

proteolytic cleavage of the inactive precursor. J Biol Chem 263: 9437-9442, 1988.

5. Boockfor FR, Wang D, Lin T, Nagpal ML and Spangelo BL. Interleukin-6 secretion from

rat Leydig cells in culture. Endocrinology 134: 2150-2155, 1994.

6. Bouwens L, Baekeland M, De Zanger R and Wisse E. Quantitation, tissue distribution and

proliferation kinetics of Kupffer cells in normal rat liver. Hepatology 6: 718-722, 1986.

7. Brown WR, Isobe K, Nakane PK and Pacini B. Studies on translocation of

immunoglobulins across intestinal epithelium. IV. Evidence for binding of IgA and IgM to

secretory component in intestinal epithelium. Gastroenterology 73: 1333-1339, 1977.

8. Buzzard JJ, Loveland KL, O'Bryan MK, O'Connor AE, Bakker M, Hayashi T, Wreford

NG, Morrison JR and de Kretser DM. Changes in circulating and testicular levels of inhibin A

and B and activin A during postnatal development in the rat. Endocrinology 145: 3532-3541,

2004.

31

9. Calne RY, Sells RA, Pena JR, Davis DR, Millard PR, Herbertson BM, Binns RM and

Davies DA. Induction of immunological tolerance by porcine liver allografts. Nature 223: 472-

476, 1969.

10. Chomarat P, Banchereau J, Davoust J and Palucka AK. IL-6 switches the differentiation

of monocytes from dendritic cells to macrophages. Nature Immunol 1: 510-514, 2000.

11. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987.

12. Cudicini C, Lejeune H, Gomez E, Bosmans E, Ballet F, Saez J and Jégou B. Human

Leydig cells and Sertoli cells are producers of interleukins-1 and -6. J Clin Endocrinol Metab 82:

1426-1433, 1997.

13. D'Alessio A, Riccioli A, Lauretti P, Padula F, Muciaccia B, De Cesaris P, Filippini A,

Nagata S and Ziparo E. Testicular FasL is expressed by sperm cells. Proc Natl Acad Sci USA

98: 3316-3321, 2001.

14. De SK, Chen HL, Pace JL, Hunt JS, Terranova PF and Enders GC. Expression of tumor

necrosis factor-α in mouse spermatogenic cells. Endocrinology 133: 389-396, 1993.

15. de Winter JP, Vanderstichele HM, Verhoeven G, Timmerman MA, Wesseling JG and

de Jong FH. Peritubular myoid cells from immature rat testes secrete activin-A and express

activin receptor type II in vitro. Endocrinology 135: 759-767, 1994.

16. Duckett RJ, Hedger MP, McLachlan RI and Wreford NG. The effects of gonadotropin-

releasing hormone immunization and recombinant follicle-stimulating hormone on the Leydig

cell and macrophage populations of the adult rat testis. J Androl 18: 417-423, 1997.

17. Ferguson J and Scothorne RJ. Extended survival of pancreatic islet allografts in the testis

of guinea-pigs. J Anat 124: 1-8, 1977.

32

18. Gérard N, Syed V and Jégou B. Lipopolysaccharide, latex beads and residual bodies are

potent activators of Sertoli cell interleukin-1α production. Biochem Biophys Res Commun 185:

154-161, 1992.

19. Gerdprasert O, O'Bryan MK, Muir JA, Caldwell AM, Schlatt S, de Kretser DM and

Hedger MP. The response of testicular leukocytes to lipopolysaccharide-induced inflammation:

further evidence for heterogeneity of the testicular macrophage population. Cell Tissue Res 308:

277-285, 2002.

20. Gerdprasert O, O'Bryan MK, Nikolic-Paterson DJ, Sebire K, de Kretser DM and

Hedger MP. Expression of monocyte chemoattractant protein-1 and macrophage colony-

stimulating factor in normal and inflamed rat testis. Mol Human Reprod 8: 518-524, 2002.

21. Gow RM, O'Bryan MK, Canny BJ, Ooi GT and Hedger MP. Differential effects of

dexamethasone treatment on lipopolysaccharide-induced testicular inflammation and

reproductive hormone inhibition in adult rats. J Endocrinol 168: 193-201, 2001.

22. Groome NP, Tsigou A, Cranfield M, Knight PG and Robertson DM. Enzyme

immunoassays for inhibins, activins and follistatins. Mol Cell Endocrinol 180: 73-77, 2001.

23. Gustafsson K, Sultana T, Zetterström CK, Setchell BP, Siddiqui A, Weber G and Söder

O. Production and secretion of interleukin-1α proteins by rat testis. Biochem Biophys Res

Commun 297: 492-497, 2002.

24. Hales DB, Xiong Y and Tur-Kaspa I. The role of cytokines in the regulation of Leydig cell

P450c17 gene expression. J Steroid Biochem Molec Biol 43: 907-914, 1992.

25. Hayes R, Chalmers SA, Nikolic-Paterson DJ, Atkins RC and Hedger MP. Secretion of

bioactive interleukin 1 by rat testicular macrophages in vitro. J Androl 17: 41-49, 1996.

33

26. Head JR and Billingham RE. Immune privilege in the testis. II. Evaluation of potential

local factors. Transplantation 40: 269-275, 1985.

27. Hedger MP. Macrophages and the immune responsiveness of the testis. J Reprod Immunol

57: 19-34, 2002.

28. Hedger MP and Hettiarachchi S. Measurement of immunoglobulin G levels in adult rat

testicular interstitial fluid and serum. J Androl 15: 583-590, 1994.

29. Hedger MP, Nikolic-Paterson DJ, Hutchinson P, Atkins RC and de Kretser DM.

Immunoregulatory activity in adult rat testicular interstitial fluid: roles of interleukin-1 and

transforming growth factor β. Biol Reprod 58: 927-934, 1998.

30. Huleihel M, Lunenfeld E, Blindman A, Prinsloo I and Potashnik G. Over expression of

interleukin-1α, interleukin-1β and interleukin-1 receptor antagonist in testicular tissues from

sexually immature mice as compared to adult mice. Eur Cytokine Netw 14: 27-33, 2003.

31. Jonsson CK, Setchell BP, Martinelle N, Svechnikov K and Söder O. Endotoxin-induced

interleukin 1 expression in testicular macrophages is accompanied by downregulation of the

constitutive expression in Sertoli cells. Cytokine 14: 283-288, 2001.

32. Kern S and Maddocks S. Indomethacin blocks the immunosuppressive activity of rat

testicular macrophages cultured in vitro. J Reprod Immunol 28: 189-201, 1995.

33. Kern S, Robertson SA, Mau VJ and Maddocks S. Cytokine secretion by macrophages in

the rat testis. Biol Reprod 53: 1407-1416, 1995.

34. Kerr JB, Donachie K and Rommerts FF. Selective destruction and regeneration of rat

Leydig cells in vivo. A new method for the study of seminiferous tubular-interstitial tissue

interaction. Cell Tiss Res 242: 145-156, 1985.

34

35. Knook DL and Sleyster EC. Separation of Kupffer and endothelial cells of the rat liver by

centrifugal elutriation. Exp Cell Res 99: 444-449, 1976.

36. Korbutt GS, Elliott JF and Rajotte RV. Cotransplantation of allogeneic islets with

allogeneic testicular cell aggregates allows long-term graft survival without systemic

immunosuppression. Diabetes 46: 317-322, 1997.

37. Letterio JJ and Roberts AB. Regulation of immune responses by TGF-β. Annu Rev

Immunol 16: 137-161, 1998.

38. Li L, Itoh M, Ablake M, Macri B, Bendtzen K and Nicoletti F. Prevention of murine

experimental autoimmune orchitis by recombinant human interleukin-6. Clin Immunol 102: 135-

137, 2002.

39. Lin T, Wang D and Nagpal ML. Human chorionic gonadotropin induces interleukin-1 gene

expression in rat Leydig cells in vivo. Mol Cell Endocrinol 95: 139-145, 1993.

40. Loras B, Vételé F, El Malki A, Rollet J, Soufir JC and Benahmed M. Seminal

transforming growth factor-β in normal and infertile men. Human Reprod 14: 1534-1539, 1999.

41. Luster MI, Germolec DR, Yoshida T, Kayama F and Thompson M. Endotoxin-induced

cytokine gene expression and excretion in the liver. Hepatology 19: 480-488, 1994.

42. Lyons RM, Keski-Oja J and Moses HL. Proteolytic activation of latent transforming

growth factor-β from fibroblast-conditioned medium. J Cell Biol 106: 1659-1665, 1988.

43. Meinhardt A, Bacher M, McFarlane JR, Metz CN, Seitz J, Hedger MP, de Kretser DM

and Bucala R. Macrophage migration inhibitory factor production by Leydig cells: evidence for

a role in the regulation of testicular function. Endocrinology 137: 5090-5095, 1996.

44. Meinhardt A, Bacher M, Metz C, Bucala R, Wreford N, Lan H, Atkins R and Hedger

M. Local regulation of macrophage subsets in the adult rat testis: examination of the roles of the

35

seminiferous tubules, testosterone, and macrophage-migration inhibitory factor. Biol Reprod 59:

371-378, 1998.

45. Moore C and Hutson JC. Physiological relevance of tumor necrosis factor in mediating

macrophage-Leydig cell interactions. Endocrinology 134: 63-69, 1994.

46. Moshage H. Cytokines and the hepatic acute phase response. J Pathol 181: 257-266, 1997.

47. Mullaney BP and Skinner MK. Transforming growth factor-β (β1, β2, and β3) gene

expression and action during pubertal development of the seminiferous tubule: potential role at

the onset of spermatogenesis. Mol Endocrinol 7: 67-76, 1993.

48. O'Bryan MK, Schlatt S, Gerdprasert O, Phillips DJ, de Kretser DM and Hedger MP.

Inducible nitric oxide synthase in the rat testis: evidence for potential roles in both normal

function and inflammation-mediated infertility. Biol Reprod 63: 1285-1293, 2000.

49. O'Bryan MK, Schlatt S, Phillips DJ, de Kretser DM and Hedger MP. Bacterial

lipopolysaccharide-induced inflammation compromises testicular function at multiple levels in

vivo. Endocrinology 141: 238-246, 2000.

50. Ohguchi M, Yamato K, Ishihara Y, Koide M, Ueda N, Okahashi N, Noguchi T, Kizaki

M, Ikeda Y, Sugino H and Nisihara T. Activin A regulates the production of mature

interleukin-1β and interleukin-1 receptor antagonist in human monocytic cells. J Interferon

Cytokine Res 18: 491-498, 1998.

51. Okuda Y, Bardin CW, Hodgskin LR and Morris PL. Interleukins-1α and -1β regulate

interleukin-6 expression in Leydig and Sertoli cells. Recent Prog Horm Res 50: 367-372, 1995.

52. Paul WE and Seder RA. Lymphocyte responses and cytokines. Cell 76: 241-251, 1994.

36

53. Phillips DJ, Jones KL, Scheerlinck JY, Hedger MP and de Kretser DM. Evidence for

activin A and follistatin involvement in the systemic inflammatory response. Mol Cell

Endocrinol 180: 155-162, 2001.

54. Phillips DJ and Woodruff TK. Inhibin: actions and signalling. Growth Factors 22: 13-18,

2004.

55. Pöllänen P, von Euler M, Jahnukainen K, Saari T, Parvinen M, Sainio-Pöllänen S and

Söder O. Role of transforming growth factor β in testicular immunosuppression. J Reprod

Immunol 24: 123-137, 1993.

56. Qian SW, Kondaiah P, Roberts AB and Sporn MB. cDNA cloning by PCR of rat

transforming growth factor beta-1. Nucl Acids Res 18: 3059, 1990.

57. Rozwadowska N, Fiszer D and Kurpisz M. Interleukin-1 system in testis--quantitative

analysis. Expression of immunomodulatory genes in male gonad. Adv Exp Med Biol 495: 177-

180, 2001.

58. Sanberg PR, Borlongan CV, Saporta S and Cameron DF. Testis-derived Sertoli cells

survive and provide localized immunoprotection for xenografts in rat brain. Nat Biotechnol 14:

1692-1695, 1996.

59. Steiner MS, Zhou ZZ, Tonb DC and Barrack ER. Expression of transforming growth

factor-β1 in prostate cancer. Endocrinology 135: 2240-2247, 1994.

60. Stéphan JP, Syed V and Jégou B. Regulation of Sertoli cell IL-1 and IL-6 production in

vitro. Mol Cell Endocrinol 134: 109-118, 1997.

61. Sultana T, Svechnikov K, Weber G and Söder O. Molecular cloning and expression of a

functionally different alternative splice variant of prointerleukin-1α from the rat testis.

Endocrinology 141: 4413-4418, 2000.

37

62. Takao T, Culp SG and De Souza EB. Reciprocal modulation of interleukin-1β (IL-1β) and

IL-1 receptors by lipopolysaccharide (endotoxin) treatment in the mouse brain-endocrine-

immune axis. Endocrinology 132: 1497-1504, 1993.

63. Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ,

Miller DK, Molineaux SM, Weidner JR, Aunins J, Elliston KO, Ayala JM, Casano FJ,

Chin J, Ding GJ, Egger LA, Gaffney EP, Limjuco G, Palyha OC, Raju SM, Rolando AM,

Salley JP, Yamin TT, Lee TD, Shively JE, MacCross M, Mumford RA, Schmidt JA and

Tocci MJ. A novel heterodimeric cysteine protease is required for interleukin-1β processing in

monocytes. Nature 356: 768-774, 1992.

64. Tompkins AB, Hutchinson P, de Kretser DM and Hedger MP. Characterization of

lymphocytes in the adult rat testis by flow cytometry: effects of activin and transforming growth

factor β on lymphocyte subsets in vitro. Biol Reprod 58: 943-951, 1998.

65. Tung KSK. Regulation of testicular autoimmune disease. In: Cell and molecular biology of

the testis., edited by Desjardins C and Ewing LL. New York: Oxford Press, 1993, p. 474-490.

66. Wang CX, Olschowka JA and Wrathall JR. Increase of interleukin-1β mRNA and protein

in the spinal cord following experimental traumatic injury in the rat. Brain Res 759: 190-196,

1997.

67. Wang DL, Nagpal ML, Calkins JH, Chang WW, Sigel MM and Lin T. Interleukin-1β

induces interleukin-1α messenger ribonucleic acid expression in primary cultures of Leydig

cells. Endocrinology 129: 2862-2866, 1991.

68. Wang J, Wreford NG, Lan HY, Atkins R and Hedger MP. Leukocyte populations of the

adult rat testis following removal of the Leydig cells by treatment with ethane dimethane

sulfonate and subcutaneous testosterone implants. Biol Reprod 51: 551-561, 1994.

38

Figure Legends

Figure 1: Northern blot analysis of IL-1β (A), TNFα (B), IL-6 (C), TGFβ1 (D) and IL-10 (E)

expression over 0-72 hours in testes and livers of rats injected with a low dose (0.1 mg/kg) or high

dose (5.0 mg/kg) of LPS. Blots (left-hand panels) show representative expression of cytokine and

GAPDH loading control mRNA at 0 hours and 3 hours after high dose LPS treatment. Values in

histograms (right-hand panels) are mean ± SEM of relative densitometric measurements from 3

separate animals at each time-point and dose. Note that there are no densitometric data shown for

IL-10. The apparently greater level of IL-10 expression in the testis sample relative to the liver

sample in the Northern blot is due to a relatively higher RNA loading in the testis lanes, as indicated

by the GAPDH loading controls. Statistical comparisons were between the relevant combined

control (0 hours) data and the combined data at each post-treatment time-point as determined by

two-way ANOVA; *: significantly different from control (p < 0.05); lack of superscript indicates no

significant difference from control (p > 0.05)

Figure 2: Real-time quantitative PCR measurement of IL-1β (A) and IL-10 (B) mRNA

expression in testis and liver of rats injected with a low dose (0.1 mg/kg) of LPS. Values in

histograms are mean ± SEM of measurements from 3-5 separate animals collected at 0 hours, 3

hours, 6 hours and 12 hours after LPS administration. Statistical notation indicates comparison

between testis and liver value at each time-point; *: significantly different (p < 0.05); lack of

superscript indicates no significant difference (p > 0.05).

Figure 3: Profile of activin A and total IL-1β protein levels over 0-6 hours in testis and blood

of rats injected with a low dose (0.1 mg/kg) of LPS. A: Activin A in testicular IF and serum. Values

39

are mean ± SEM of 5 animals at each time-point. Cytokine levels in saline-treated control animals

did not change significantly across the experimental period and have been omitted for clarity.

Statistical notation indicates comparison with the relevant 0 h value; *: significantly different from 0

h (p < 0.05); lack of superscript indicates value no significant difference from 0 h (p > 0.05). B: IL-

1β in a single pool of testicular IF collected from the 5 animals at each time-point, assayed at serial

dilutions. Values are mean activity relative to the IL-1β ELISA standard.

Figure 4: IL-1β immunohistochemical staining in fixed, frozen sections of testes from saline-

injected control and low dose (0.1 mg/kg) LPS-treated rats. A: Saline-injected control rat. No

primary antibody. B: Saline injected control rat, probed with IL-1β antibody. C and D: replicate

LPS-treated rats (6 hours post-injection), probed with IL-1β antibody. LC: Leydig cell; M:

macrophage; N: neutrophil. Bar = 20 µm in all panels.

Figure 5: IL-1 mRNA and protein in testes of rats treated with DMSO alone (control) or EDS,

and injected with saline (no LPS) or low dose (0.1 mg/kg) LPS 3 hours prior to collection. A:

Expression of IL-1β mRNA measured by RNase protection assay. B: Expression of IL-1α mRNA

measured by RNase protection assay. Values in histograms are mean ± SEM of 6 animals. C: IL-1β

in a single pool of testicular IF collected from all animals in each group, assayed at serial dilutions.

Values are mean only, relative to the IL-1β ELISA standard. Broken line: limit of assay detection.

For clarity, only statistical comparisons between the combined DMSO and EDS treatment group

data as determined by two-way ANOVA are presented. Values for IL-1β in the DMSO control

versus EDS treated groups were not significantly different (ns: p > 0.05). Values for IL-1α were

significantly different at p < 0.05.

40

Figure 6: IL-1 bioactivity in dilutions of testicular IF from saline-injected control and LPS-

treated rats, 3h after treatment. Values are mean ± SEM of 4 replicate wells. Values with same letter

subscript are not significantly different (p > 0.05).

Figure 7: Fractionation of testicular IF from LPS-treated rats 3h after treatment, and IF from

saline-injected control rats spiked with rat recombinant IL-1β by size exclusion HPLC. A: UV

profile (A280) of rat IF. Absorbance profiles were identical for both IF samples. Molecular weight

marker elution points are indicated: thyroglobulin (Thy; 670 x 103), bovine γ-globulin (bGG; 158 x

103), ovalbumin (Ova: 44 x 103), myoglobin (Myo; 17 x 103) and vitamin B12 (VitB; 1350). B: IL-

1β immunoactivity of low dose LPA-stimulated testicular IF (●-●) and normal rat IF spiked with

native IL-1β (○-○). Fraction numbers in panel B are positioned to align with the corresponding time

axis in panel A (as indicated by the vertical broken lines).

41

Table 1: Sequence of primers for RT-PCR of rat IL-1β, IL-4, IL-10 and β-actin cDNA

Gene Target GeneBank

Accession

number

product size

(base pairs)

5' → 3' Sequences

(Forward primer)

(Reverse primer)

IL-1β E05490 519 CCAGGATGAGGACCCAAGCA

TCCCGACCATTGCTGTTTCC

IL-4 X16058 277 TGCACCGAGATGTTTGTACC

GGATGCTTTTTAGGCTTTCC

IL-10 X60675 181 GCAGGACTTTAAGGGTTACTTGG

GGGGAGAAATCGATGACAGC

β-actin V01217 202 GATATCGCTGCGCTCGTC

TGGGGTACTTCAGGGTCAGG

42

Table 2: Measurement of cytokines by ELISA in the testis and in blood 3h after injection of saline (-LPS) or lipopolysaccharide (+LPS).

IL-1β (ng/ml) Activin A (ng/g testis) Total TGFβ1 (ng/ml)

Sample n -LPS +LPS -LPS +LPS -LPS +LPS

Testis IF Pool 0.075 (0.063:0.087) 3.92 (3.32:4.51) 0.48 (0.44:0.52) 0.64 (0.59:0.69) 4.2 (3.3:5.1) 3.8 (3.0:4.6)

Testis extract 6 0.348 ± 0.100 2.799 ± 0.808** 0.118 ± 0.017 0.112 ± 0.008ns 11.1 ± 0.9 11.6 ± 0.6ns

Plasma 6 0.024 ± 0.007 0.123 ± 0.035** 0.091 ± 0.005 0.162 ± 0.038* 3.9 ± 0.9 5.6 ± 0.8ns

Values are mean ± 95% CI (IF only) or mean ± SEM (testis extract and plasma). Statistical comparisons are between un-stimulated (-LPS) and

LPS-stimulated (+LPS) values: * p < 0.05; ** p < 0.01; ns not significantly different at p > 0.05.

43

Figure 1:

44

Figure 2:

0h 3h 6h 12h0

10

20

30TestisLiver

*

*

*

A

Time post-treatment

IL-1

β (r

elat

ive

expr

essi

on)

0h 3h 6h 12h0

10

20

30

B

Time post-treatment

IL-1

0 (r

elat

ive

expr

essi

on)

45

Figure 3:

0 1 2 3 4 5 60

500

1000

1500 Testis IF

Serum*

** * *

Post-treatment (h)

activ

in A

(pg/

ml)

A

0 1 2 3 4 5 60

250

500

750

Post-treatment (h)

IL-1

β (p

g/m

l)

B

46

Figure 4:

47

Figure 5:

DMSO EDS0

10

20

SalineLPS (0.1 mg/kg)

Ans

IL-1

β (r

elat

ive

expr

essi

on)

DMSO EDS0.0

0.5

1.0

1.5

2.0B

p<0.05

IL-1

α (r

elat

ive

expr

essi

on)

DMSO EDS0

1

2

3

4

5C

IL-1

β (n

g/m

l)

48

Figure 6:

0 0.1 0.3 1.0 3.00

10000

20000

30000

40000

50000SalineLPS (0.1 mg/kg)

a

b

b

b bb

b

a a

IF (µl)

[3 H]-th

ymid

ine

inco

rpor

atio

n (c

pm)

49

Figure 7: