Da

SM

a

ARRAA

KAABcS

1

2tdta

ladaip�1h

(

0d

Molecular Immunology 46 (2009) 2029–2038

Contents lists available at ScienceDirect

Molecular Immunology

journa l homepage: www.e lsev ier .com/ locate /mol imm

iscovery of Anas platyrhynchos avian �-defensin 2 (Apl AvBD2) withntibacterial and chemotactic functions

oja Saghar Soman, D.S. Arathy, E. Sreekumar ∗

olecular Immunology & Virology Laboratory, Department of Molecular Microbiology, Rajiv Gandhi Centre for Biotechnology (RGCB), Thycaud PO, Trivandrum 695014, Kerala, India

r t i c l e i n f o

rticle history:eceived 1 February 2009eceived in revised form 28 February 2009ccepted 4 March 2009vailable online 11 April 2009

eywords:ntimicrobial peptidesvianacterial expression

a b s t r a c t

The cationic, cysteine-rich peptides called �-defensins play a major role in the innate immune response.Here, we describe the identification and characterization of the duck �-defensin-2 homologue, Anasplatyrhynchos avian �-defensin 2 (Apl AvBD2). The 195 base pair open reading frame (ORF) of Apl AvBD2has 83% identity with Gga AvBD2 (chicken) and 85% identity with Mga AvBD2 (turkey) at nucleotidelevel. The gene corresponding to the coding region is comprised of three exons and two introns inboth Apl AvBD2 and Gga AvBD2. The predicted secondary structure of Apl AvBD2 has the classical “�-defensin core motif” formed by the �-sheet rich structure. Apart from mild expression in tissues likekidney, lung, brain, bursa of Fabricious and ovary, Apl AvBD2 mRNA show a very high level constitutiveexpression in bone marrow and spleen, indicating that it is a myeloid defensin. Purified recombinant

DNA libraryubtraction

Apl AvBD2 demonstrated in vitro antibacterial activity against both Gram-positive and Gram-negativebacteria, with a minimum bactericidal concentration (MBC) of 3.7 �M against Micrococcus luteus NCIM2871 and Escherichia coli NCIM 2685, and of 2.2 �M against Reimerella anatipestifer. The immunomodula-tory potential of Apl AvBD2 was shown by chemotaxis of DT-40 chicken B-lymphocytes. The widespreadtissue distribution and the potent bactericidal and chemotactic activity make Apl AvBD2 an importantmolecule in the innate immune response in ducks. It may play a vital role in the immune response ofthese birds against bacterial and viral pathogens.

. Introduction

The emergence of antibiotic-resistant bacteria (Vicente et al.,006) and highly virulent viruses (Kuiken et al., 2003) demandshe discovery of novel strategies to fight infectious diseases. Theefensin family peptides, which can kill pathogens and, at the sameime, augment the host immune responses (Ganz, 2003) are idealrsenal for new weapons in our fight for existence.

Defensins are small peptides, usually 30–45 amino acids inength and are rich in positively charged amino acids like argininend lysine. They share some common characteristics including 3–4isulphide bonds, polarized hydrophobic and hydrophilic domainsnd a �-sheet rich structure (Zasloff, 2002). Defensins are dividednto three subfamilies, �, � and �, based on their cysteine disul-

hide bonding (Selsted and Ouellette, 2005). Among the three,-defensins are the primitive members in vertebrates (Hughes,999). A common ancestor gene of �-defensins is considered toave undergone duplication, positive selection and chromosomal

∗ Corresponding author. Tel.: +91 471 2529517; fax: +91 471 2348096.E-mail addresses: esreekumar@rgcb.res.in, esreekumar@gmail.com

E. Sreekumar).

161-5890/$ – see front matter © 2009 Elsevier Ltd. All rights reserved.oi:10.1016/j.molimm.2009.03.003

© 2009 Elsevier Ltd. All rights reserved.

translocations (Semple et al., 2006) to evolve into � and � formsthat are found exclusively in mammals (Lehrer and Ganz, 1999).Defensins act as a first line of defense against invading pathogens(Kapetanovic and Cavaillon, 2007) and execute the anti-microbialactivity by non-oxidative mechanisms (Sahl et al., 2005). Somedefensins are chemoattractant for monocytes, lymphocytes anddendritic cells, and act as a link between innate and adaptiveimmune responses (Yang et al., 1999; Ganz, 2003). Recent stud-ies showed that they are important mediators of innate immunityagainst viruses (Klotman and Chang, 2006).

There is a paucity of information on the mediators of immuneresponse in domestic ducks, including that of innate immunity. Thecarrier status of highly pathogenic avian influenza virus (Hulse-Postet al., 2005) and the susceptibility to various bacterial infec-tions, such as duck pasteurellosis caused by Reimerella anatipestifer(Sandhu and Rimler, 1997), make this information very importantin duck production. Different strategies have been employed forimmune gene discovery in domestic ducks. We have previously

reported use of subtraction cloning technique for identificationof three CC-chemokines from domestic duck (Sreekumar et al.,2005a). Recently, expressed sequence tag analysis was used toidentify and characterize immune genes of these birds (Xia et al.,2007).

2 mmun

ae1eotNNb

tsra

2

2

pscBOsff

2

ofBaNMmpiceopud

2s

2

TP

P

AAA

��D

D

030 S.S. Soman et al. / Molecular I

�-defensins are actively studied in birds, and so far thirteenvian �-defensins are identified in chicken (Lynn et al., 2007; Xiaot al., 2004). Beta defensins are also identified in turkey (Evans et al.,994), ostrich (Sugiarto and Yu, 2006) and king penguin (Thouzeaut al., 2003). However, there is no report on the characterizationf duck �-defensins. The duck �-defensins identified so far, otherhan from the present study, are Apl AVBD6 (Genbank accessiono. EF431957; Unpublished) and Apl AvBD10 (Genbank accessiono. EU833478; Unpublished). However, these molecules have noteen functionally characterized.

The present study describes the functional characterization ofhe �-defensin-2 homologue from domestic ducks identified by theubtraction cloning technique. The molecule exhibited antibacte-ial activity against both Gram-positive and Gram-negative bacteriand chemotaxis of DT-40 cells.

. Materials and methods

.1. Screening of a subtracted cDNA library

Construction of a duck spleen subtracted-cDNA library has beenreviously reported (Sreekumar et al., 2005a). This library wascreened by random nucleotide sequencing of the clones (∼200lones) and the nucleotide sequences were analyzed by on-lineLAST (http://www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1990).ne clone (Apl AvBD2; initially named as AB102) that showed

ignificant sequence identity with reported avian defensins wasurther analyzed by bioinformatics and was characterized atunctional level.

.2. Apl AvBD2 cDNA sequence analysis and molecular modeling

Complementary DNA (cDNA) and derived amino acid sequencesf Apl AvBD2 and homologous sequences of other species obtainedrom NCBI Genbank were aligned using Clustal W program ofioEdit software (Hall, 1999). The amino acid distances of theligned sequences were used to reconstruct a phylogenetic tree byeighbor-Joining method with 10,000 bootstrap replications usingEGA3.1 (Kumar et al., 2004) software. Potential sites for secondaryodifications, predicted secondary conformation and the signal

eptide were analyzed using PCGENE software (M/S IntelliGenet-cs, Geneva, Switzerland). The predicted secondary structures wereompared with the output from Predictprotein server (http://www.mbl-heidelberg.de/predictprotein/predictprotein.html). Homol-gy modeling of Apl AvBD2 was done in the SWISS modelrotein server (http://swissmodel.expasy.org/SWISS-MODEL.html)sing the structure of Apa AvBD103b (Spheniscin-2, a penguin �-efensin; PDB No. 1ut3A) as the template.

.3. Isolation of duck genomic DNA and Apl AvBD2 geneequencing

Genomic DNA was isolated as per Sambrook et al. (1989) from00 �l of venous blood collected from a Vigova Super M broiler

able 1rimer sequences used in the study.

rimer name Sequence (5′ → 3′) Target amplifie

B102 F GAGGTGCTTGAGACATTGTTGTAGC Apl AvBD2B102R ATCCTTTACCTGCTCTTCTCTGTCCB102kFa ACCATGGGGATCCTTTACCTGC

-Actin F ACCAACTGGGACGACATGGAG �-Actin-Actin R GCATTTGCGGTGGACAATGGAPV Pol F TCGTACTTGTCGTGAGGCGC

PV Pol R CCCATCGAAATTAAGGTCGCAC DHV-1 Polyme

a Start codon is marked in bold letters. Kozak consensus sequences are underlined.

ology 46 (2009) 2029–2038

duckling obtained from a government duck farm. The full-lengthApl AvBD2 gene was amplified using Elongase amplification sys-tem (GIBCO-BRL, Paisley, UK) as per manufacture’s protocol usinggene specific forward and reverse primers (Table 1). PCR was donefor 35 cycles in an iCycler (BioRad, Hercules, CA), with a denat-uration at 94 ◦C for 30 s; primer annealing at 55 ◦C for 1 min andprimer extension at 72 ◦C for 2 min. An initial denaturation of 94 ◦Cfor 2 min and a final extension of 10 min were also included in thePCR reaction. The PCR product was purified (GFX DNA Gel bandelution kit, Amersham/GE) and was cloned using pGEM-T Easy vec-tor system (Promega, Madison, WI, USA). Two positive clones weresequenced in either direction using vector specific or gene specificprimers in an ABI 3730 Genetic Analyzer automated DNA sequencer(PE Applied Biosystems, Foster City, CA).

2.4. Analysis of Apl AvBD2 mRNA expression profiles in ducktissues

Freshly collected tissues of four 2-week old healthy ducklingswere used for total RNA isolation. Birds were sacrificed as per Insti-tute Animal Ethics Committee Guidelines. Each of the tissues fromfour birds was pooled and the total RNA was isolated using Trizolmethod (Invitrogen, Carlsbad, CS) as per manufacture’s directions.Reverse transcription and PCR was done as previously described(Sreekumar et al., 2005a). Apl AvBD2 and �-Actin specific forwardand reverse primers (Table 1) and 1.5 �l of the reverse transcrip-tion product were used for PCR. PCR conditions included an initialdenaturation at 94 ◦C for 2 min followed by 35 cycles with denatu-ration at 94 ◦C for 30 s, annealing at 55 ◦C for 1 min, and extensionat 72 ◦C for 1 min 30 s. Equal volumes of amplified products wereanalyzed in 2% agarose gel.

2.5. Expression of recombinant Apl AvBD2 in E. coli

The strategy used for expression of the recombinant Apl AvBD2in E. coli cells is shown in Fig. 5A. Two types of constructs were madefor standardizing the recombinant protein expression. The first onehad an N-terminal His-tag coding region, followed with sequencescoding the exact mature peptide region of the Apl AvBD2. The sec-ond construct also had the N-terminal His-tag coding region, andan extra region coding for nine amino acids (four from the primaryvector, pGEM-T-Easy, back-bone and five from the signal peptidecoding region) before the mature protein-coding region.

The coding region of Apl AvBD2 was sub-cloned into theNdeI–Hind III restriction sites in pET-32 expression vector(Novagen, Madison, WI) adopting standard cloning procedures. Ahexa-histidine tag was engineered at the NH2-terminal end of theprotein by modifying the forward primer (Table 1). The plasmid

DNA was transformed to competent BL21 (DE3) pLys S (Promega,Madison, WI) E. coli cells and transformants were grown on LuriaBertani (LB) medium containing 50 �g/ml ampicillin. For checkingthe production of recombinant Apl AvBD2 protein, log phase cul-tures (approximate OD600 0.6) were induced at 30 ◦C by adding IPTG

d Size of product Ta Reference

195 bp 55 ◦C AY641439

257 bp 55 ◦C

893 bp 55 ◦C L08165

rase gene 128 bp 60 ◦C AF064639

mmun

(olWdcrud

2h

cacb8c(r1tmttpc7chopTwPc(wi

2A

A(cotfTo1AKwfgbtptMt

S.S. Soman et al. / Molecular I

isopropyl-�-d-thiogalactoside; Promega) to a final concentrationf 0.4 mM. Aliquots collected at 0 and 5 h post induction were ana-

yzed on a 15% SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE).estern blotting of the proteins on to nitrocellulose membrane was

one as per Towbin et al. (1979) using an electrophoretic transferell (Bio-Rad). Anti-His monoclonal antibody (Sigma; 1:15,000) andabbit anti-mouse IgG alkaline phosphatase antibody (Sigma) weresed as the primary and the secondary antibodies, respectively, toetect the induced protein.

.6. Purification of recombinant Apl AvBD2 and production ofyperimmune serum

Recombinant Apl AvBD2 was purified from 100 ml of inducedultures under denaturing conditions by the nickel-nitrilotriaceticcid resin affinity chromatography. The bacterial cells pelleted byentrifugation at 1800 × g were re-suspended in 5 ml denaturinginding buffer (8 M Urea, 100 mM NaH2PO4, and 10 mM Tris; pH.0) and the suspension was frozen at −80 ◦C. Subsequently, theells were thawed at 37 ◦C for 15 min and were lysed by sonicationBranson Sonifier, Danbury). 200 �l of a 50% suspension of Probondesin (Invitrogen) pre-equilibrated with the buffer was mixed withml of the protein solution. The recombinant protein was allowed

o bind to the resin by incubating at 4 ◦C for 1 h, with intermittentixing. The unbound protein was removed by extensive washing of

he resin using denaturing binding buffer (pH 6.3). The bound pro-ein was eluted using denaturing binding buffer with pH 4.0. Therotein was desalted with a PD-10 column (Amersham/GE Health-are; Piscataway, NJ) against phosphate buffered saline (PBS; pH.4) and was quantified by Bradford assay (Bradford, 1976). Poly-lonal antibodies against the Apl AvBD2 were raised in rabbits byyper-immunizing two male New Zealand White rabbits. 100 �gf the purified protein was used for immunization as per standardrotocols approved by the Institutional Animal Ethics committee.he presence of anti-Apl AvBD2 antibody in rabbit immune seraas analyzed by an enzyme linked immunosorbent assay (ELISA).

urified, recombinant Apl AvBD2 protein (50 �g/well) was used foroating the ELISA plate (Maxisorp; Nunc). Horseradish peroxidaseHRPO) conjugated mouse anti-rabbit IgG monoclonal antibodyas used to detect the bound anti-Apl AvBD2 antibody in the

mmune serum.

.7. Evaluation of antibacterial activity of recombinantpl AvBD2

Minimum Bactericidal Concentration (MBC) of recombinantpl AvBD2 was determined by microtitre broth dilution method

Amsterdam, 1996). Microbial strains E. coli (NCIM 2865) and Micro-occus luteus (NCIM 2871) were obtained from National Collectionf Industrial Microorganisms (NCIM), National Chemical Labora-ory, Pune, India. R. anatipestifer (Duck Pasteurella) was obtainedrom Institute of Animal Health & Veterinary Biologicals, Palode,hiruvananthapuram, India. Mid-log-phase cultures of the testrganisms were diluted in LB broth to reach a density of 106 CFU/ml.0 �l of this diluted culture was treated with 250 �l recombinantpl AvBD2 (5–25 �g/ml in PBS; with 136 mM NaCl and 2.68 mMCl) in a 96-well microtitre plate for 3 h at 37 ◦C. 100 �l of LB brothas added after 3 h and the plates were further incubated for 12 h

or E. coli and M. luteus, and for 24 h for R. anatipestifer. The bacterialrowth was detected by measuring the absorbance at 570 nm andy Bac-titre-glo assay (Promega) as per the protocol described by

he manufacturer. The growth inhibition was further confirmed bylating the contents of the wells, showing no visible growth of bac-eria, onto LB agar plates and incubating at 37 ◦C for 12–18 h. The

BC of each microbe was calculated as the lowest concentration ofhe Apl AvBD2 that prevents any residual colony formation.

ology 46 (2009) 2029–2038 2031

2.8. Expression of recombinant Apl AvBD2 in mammalian cellcultures

The full-length open reading frame (ORF) of Apl AvBD2 was PCRamplified from the primary clone obtained from the cDNA libraryusing the primers AB102kF and AB102R (Table 1). In order to facil-itate the secretion of the recombinant protein into the medium,the signal peptide-coding region was maintained intact while mak-ing the expression constructs. Kozak consensus sequences werealso included in the primers (Table 1) to enhance the expressionof the protein in the mammalian cells. The amplified product wascloned into pCR3.1 Topo vector (Invitrogen). HEK293T cells weremaintained in Dulbeco’s Modified Eagles medium (DMEM; Gibco-BRL, UK) containing 25 mM HEPES, 44 mM sodium bicarbonate,0.25 mM l-glutamine, 1× antibiotic–antimycotic solution and 10%fetal bovine serum (FBS) (all from Sigma) at 37 ◦C in a 5% CO2 atmo-sphere. Cells were transfected with 10 �g of the Apl AvBD2 pCR3.1plasmid or empty vector plasmid using Lipofectamine 2000 (Invit-rogen) as per manufacturer’s directions. After transfection, the cellswere maintained in medium containing 2% BSA, instead of FBS.The conditioned medium containing the Apl AvBD2 was collectedafter 72 h and stored at −20 ◦C. The transfected cells were scrapedout using a cell scraper, and were re-suspended in SDS-samplebuffer and subjected to Western Blot. Expression of Apl AvBD2 wasdetected using the hyper-immune serum raised in rabbits.

2.9. Quantification of Apl AvBD2 in the transfected HEK 293T cellsupernatant

Concentration of the Apl AvBD2 in transfected HEK293T cellsupernatant was estimated by quantitative ELISA using differentconcentrations of E. coli expressed recombinant Apl AvBD2 as stan-dard, and the rabbit polyclonal serum raised against the purifiedprotein as the primary antibody. Based on the absorbance obtainedfor the standards, a graph was plotted. The linear portion of thegraph was used to assess the amount of Apl AvBD2 in the cell cul-ture supernatant by extrapolation.

2.10. Chemotaxis assay

DT-40 cells (a chicken B-cell line, a kind gift from Dr. SharonMatthews, University of Dundee, UK) were maintained in DMEMwith 10% FBS, 1% chicken serum, 50 �M �-mercaptoethanol(all from Sigma) at 37 ◦C in a 5% CO2 atmosphere. Chemotaxisassays were done as previously described (McLeod et al., 2002)in 24-well plates using 8 �m polycarbonate trans-well inserts(Falcon, Becton-Dickinson, NJ, USA). 500 �l of HEK 293T cellculture supernatant (containing 2 �g/ml of Apl AvBD2) was addedto the lower chamber and 100 �l of DT-40 cells (5 × 105 cells)were added to the upper chamber of the cell culture insert. Theassembly was incubated at 37 ◦C for 3 h in a 5% CO2 incubator.Appropriate positive (fMLP at a concentration of 10−4 M) and neg-ative (supernatant from empty vector transfected cells) controlswere used for the assay. The number of cells that migrated into thelower chamber was analyzed through a BD FACSAria Special OrderSystem (BD Biosciences, CA, USA) flow cytometer. The average offour independent experiments was calculated and results werestatistically analyzed by Student’s t-test.

3. Results

3.1. Initial characterization of the duck ˇ-defensin by nucleotide

sequencing, molecular modeling, phylogenetic analysis andgenome organization study

The screening of the subtracted duck-spleen cDNA library byrandom sequencing identified 35 new expressed sequence tags

2032 S.S. Soman et al. / Molecular Immunology 46 (2009) 2029–2038

Table 2aNucleotide sequence characteristics of major avian �-defensin-2 cDNAs.

Sequence name Size of cDNA upto polyA (bp)

Lengthof 3′UTR

‘ATTTA’ motifsin 3′UTR

Poly-adenylationsignals (AATAAA)

Length of codingregion (bp)

% Identity GenBank accessionnumber

Apl AvBD2 486 215 nil 1 192 100 AY641439Mga AvBD2 424 204 nil 1 192 85 AF033338Gga AvBD2 409 189 nil 1 192 83 AF033336

Table 2bPredicted amino acid sequence characteristics of major avian �-defensin-2 proteins.

Sequencename

No. of amino acids Molecular weight(calculated) (kDa)

Predicted isoelectricpoint (pI)

Comparison offull-length

Comparison ofmature peptide

GenBank accessionnumber

Mature Signalpeptide

Full length Matureprotein

% Identity % Similarity % Identity % Similarity

AMG

(ssPNf6wf7aiaa

Ahdhdmr

Fg(

pl AvBD2 64 22 7.3 4.8 8.8ga AvBD2 64 22 7.3 4.8 9.6ga AvBD2 64 22 7.1 4.6 9.2

ESTs; data not shown). In on-line BLAST analysis, the 505 bp cDNAequence (Genbank Accession No. AY641439) of the clone AB102howed significant alignment with Mga AvBD2 (Turkey Heterophilepetide-2; THP-2) from Meleagris gallopova (Genbank Accessiono. AF033338; E-value 4e-49) and Gga AvBD2 (Gallinacin-2; Gal-2)

rom Gallus domesticus (Genbank Accession No. AF033336; E-valuee-39). The result of comparative sequence analysis of this sequenceith Gga AvBD2 and Mga AvBD2 is shown in Tables 2a and 2b. The

ull-length sequence showed 78% identity with Mga AvBD2 and6.5% identity with Gga AvBD2 at amino acid level. With humannd other mammalian �-defensins, it had 37% amino acid leveldentity. The predicted amino acid sequence of AB102 clone hadll the six cysteine residues and the GXC motif that are conservedcross defensins (Fig. 1A).

Homology modeling carried out using the NMR structure ofpa AvBD103b as a template in SWISS Model server revealed aighly conserved structure among the newly identified duck �-

efensin, Gga AvBD2 and Mga AvBD2 (Fig. 1B). All the moleculesad the three anti-parallel �-sheets that formed the typicalefensin fold. Phylogenetic analysis of the reported avian and mam-alian defensin-predicted amino acid sequences (mature protein)

evealed two major clusters. The duck �-defensin along with the

ig. 1. (A) Predicted amino acid sequence alignment of Apl AvBD2 with related avian �-lycines are highlighted in grey and black shades, respectively. ‘GXC’ motifs are underlineKing penguin avian �-defensin 103b) as the template.

100 100 100 100 AAV5279978 87.5 71 83 P8039276.5 88 69 81 P46158

Gga AvBD2 and Mga AvBD2 grouped together in a single sub-cluster in the analysis (Fig. 2). Comparative analysis of the duckdefensin cDNA sequence and the 1696 base-pair gene sequenceshowed that the amplified gene region formed 3 exons and 2introns. The comparable regions of the Gga AvBD2 and duck ˇ-defensin gene sequences had the same exon–intron organization(Fig. 3), with similar lengths of the exons in both sequences.The intron 2 in duck-defensin sequence was comparatively longer(799 bp vs. 183 bp) than the corresponding region in the Gga AvBD2sequence.

Based on these analyses, the new defensin sequence was con-clusively identified as the �-defensin orthologue in ducks and wasnamed as Apl AvBD-2, considering its similarity with Gga AvBD2and Mga AvBD2, as per the nomenclature suggested for avian �-defensins (Lynn et al., 2007).

3.2. Apl AvBD2 mRNA expression analysis in different duck tissues

The analysis of mRNA expression of Apl AvBD2 in different ducktissues showed a varied expression pattern (Fig. 4). Strong expres-sion of Apl AvBD2 mRNA was noted in organs like bone marrowand spleen. Other tissues like bursa of Fabricius, kidney, lung,

defensins; identical residues are represented as dots. The conserved cysteine andd. (B) Homology models of major avian �-defensin-2 molecules using Apa AvBD2

S.S. Soman et al. / Molecular Immunology 46 (2009) 2029–2038 2033

Fig. 2. Phylogenetic tree of major �-defensin sequence entries obtained from NCBI GenBank. Accession numbers of the sequences are shown in the figure. Scale bar represents0.1 amino acid substitutions per site. The sequence identified in the current study is indicated by an arrow. The phylogenetic tree was reconstructed using the amino acidsequences of mature protein by Neighbor-Joining method, with 10,000 bootstrap replications.

2034 S.S. Soman et al. / Molecular Immunology 46 (2009) 2029–2038

Fig. 3. Comparison of exon–intron organization of the Apl AvBD2 and Gga AvBD2 gene sequences corresponding to the protein-coding region. The genomic regions of 5′ Un-translated region (UTR) and 3′ UTR were not included in the analysis. The sequences used for the analysis are: Apl AvBD2 (GenBank Accession No. FJ769025) and Gga AvBD2(GenBank Accession No. AY672652). The exons are represented as black rectangles and introns as a line. The numbers (bp) indicate the length of the corresponding regionsin the gene.

F 15-dayu roduc

begm

3b

tci(iot

toespmifttc9gw

3

aainaua

3.5. Expression of Apl AvBD2 in HEK293T cells

HEK293T cell culture supernatant containing the recombinantprotein, rather than the protein expressed in the bacterial system,

Fig. 5. (A) Strategy used for PCR amplification of the mature-protein coding regionof Apl AvBD2 cDNA, incorporating an N-terminal hexa-histidine tag and extra aminoacid residues. A primary clone of the cDNA in pGEM-T Easy vector (Promega), witha partial signal-sequence coding region, was used as the template for PCR. The for-ward and reverse primers used are indicated. Highlighted residues constitute theamino acids in the final expressed protein. Portion of the signal peptide and vec-tor sequences that are incorporated in the final expressed protein are boxed. (B)

ig. 4. RT-PCR analysis of Apl AvBD2 mRNA basal level expression in the tissues ofsed in the RT-PCR. Expression of �-actin mRNA was used as the control. The PCR p

rain, ovary, and small intestine also showed detectable level ofxpression. Oesophagus, gizzard, proventriculus, pancreas, liver,all bladder and cloaca showed no detectable level of Apl AvBD2RNA.

.3. Production and purification of recombinant Apl AvBD2 fromacterial cultures

Induction of the recombinant Apl AvBD2 protein did not affecthe viability of E. coli cells transformed with pET32-Apl AvBD2onstructs. No toxic effect of the protein was observed in the un-nduced and induced cultures during the 5 h growth period studiedFig. 5B). The growth kinetics of the un-induced cultures were sim-lar in both transformed and control cells. In induced cultures, theverall growth was low; however, the bacterial growth trends inhe control and transformed cells were not significantly different.

SDS-PAGE analysis of the bacterial pellet obtained from cul-ures transformed with the recombinant plasmid showed presencef a 6.7 kDa additional protein (Fig. 6A). The amount of proteinxpressed was significantly more in samples transformed with theecond plasmid that contained the extra sequences from the signaleptide region of the Apl AvBD2. Western blot using an anti-His6onoclonal antibody could detect the His-tagged-Apl AvBD2 in

nduced cultures (Fig. 6B). Analysis of the supernatants and pelletraction of bacterial cells after disruption by sonication indicatedhat all the recombinant Apl AvBD2 was present in the pellet frac-ion in an insoluble form. So a purification scheme using denaturingonditions was employed and the protein was purified to more than0% purity as evidenced by the coommasie staining of the SDS-PAGEels after electrophoresis (Fig. 6C). The yield of the purified proteinas about 4–5 mg from a litre of induced E. coli culture.

.4. Antibacterial activity of recombinant Apl AvBD2

The recombinant Apl AvBD2 showed antibacterial activitygainst the Gram-negative organisms E. coli NCIM 2685, and R.natipestifer, and against Gram-positive M. luteus NCIM 2871 (Fig. 7)

n all the three assays used. In micro broth dilution assay recombi-ant Apl AvBD2 demonstrated complete killing of the test microbest 20–25 �g/ml in 3 h. The minimum bactericidal concentration val-es (MBC) of the protein were 25 �g/ml (3.7 �M) for both E. colind M. luteus, and 15 �g/ml (2.2 �M) for R. anatipestifer. The pep-

old ducklings. Pooled total RNA from the tissues of four 2-week old ducklings wast sizes of �-actin and Apl AvBD2 mRNA were 893 and 195 bp, respectively.

tide showed more than three log reduction in the growth of thesetest microbes as evidenced by the standard plate count assay.

Effect of recombinant Apl AvBD2 expression on the growth kinetics of the E. colihost strain BL21(DE3)pLysS. Bacterial cells, transformed with either Apl AvBD2 cDNAincorporated or empty pET-32 vector, were grown in LB-broth containing 50 �g/mlAmpicillin at 30 ◦C for recombinant protein induction. The growth kinetics wasmeasured at different time points by measuring the optical density (OD600) uponinduction with 0.4 mM IPTG. Un-induced cultures were kept as controls.

S.S. Soman et al. / Molecular Immunology 46 (2009) 2029–2038 2035

Fig. 6. (A) Expression of recombinant Apl AvBD2 using PET-32 expression system-SDS-PAGE analysis of the induced and un-induced BL21 (DE3) pLysS cells. Bacterial cellsf ded iT s indih ed asc

wthdmi

F2bi

rom 1 ml culture were pelleted at the end of indicated time-points and re-suspenhe higher level expression of recombinant Apl AvBD2 with partial signal peptide iistidine antibody. Pre-stained marker (New England Biolabs, Beverly, MA) was ushromatography. M-Benchmark Protein ladder (Amersham, Piscataway, NJ).

as used in chemotaxis experiments. This was specifically done

o obtain Apl AvBD2 with proper secondary conformation, as thisas been reported to be important for chemotactic functions ofefensins (Wu et al., 2003). Also, use of the protein expressed inammalian cell culture system helped to maintain the compatibil-

ty of the medium for chemotaxis and to avoid deleterious effects

ig. 7. Antibacterial activity of recombinant Apl AvBD2. Apl AvBD2 showed concentratio871) and Reimerella anatipestifer in three different assays. Test microbes were incubatedy (A) Microbroth dilution assay (Absorbance at 570 nm) (B) Bac-Titre-glo assay (Promega)n triplicates. Data represent mean ± S.D.

n 50 �l of PBS. 10 �l of the samples were loaded in SDS-loading buffer in the gel.cated with an ‘→’. (B) Western blot of recombinant Apl AvBD2 detected with anti-the reference standard. (C) SDS PAGE of His-tagged Apl AvBD2 purified by Ni-NTA

of low levels endotoxin that may contaminate bacterially expressed

protein, even after purification. Western blot, using anti-Apl AvBD2hyper-immune serum, confirmed the expression of the Apl AvBD2protein in the transfected cells. It detected a specific protein ofaround 4.8 kDa in the Apl AvBD2 vector transfected cells (Fig. 8A).In the culture supernatants from transfected cells, an amount of

n dependant inhibition of growth of E. coli (NCIM 2685), Micrococcus luteus (NCIMfor 3 h with different concentration of Apl AvBD2 and the inhibition was evaluatedand (C) Standard plate count assay (CFU/ml). Each experiment was done four times

2036 S.S. Soman et al. / Molecular Immunology 46 (2009) 2029–2038

Fig. 8. (A) Western blot of Apl AvBD2 in transfected HEK293T cells- 70–80% confluent monolayers of HEK293T cells in 40 mm culture dishes were transfected with pCR3.1Apl AvBD2 or empty vectors. Cells scraped out at 72 h post-transfection were re-suspended in 50 �l of SDS-sample buffer. 10 �l (@ 25 �g total protein) was subjected to SDS-P useda indicaw er wasa . The

at

3

Atcwc

4

ft(aiwl�cmaatTacwGvc

AGE and western blot. Polyclonal anti-Apl AvBD2 antibodies raised in rabbits weressay for chemotaxis: DT-40 cells suspended in the upper chamber were used as theas loaded in the lower chamber. The number of cells migrated to the lower chamb

fter 3 h incubation at 37 ◦C. Mean ± S.D. of four independent experiments is shown

pproximately 2 �g/ml of the specific protein could be detected byhe Apl AvBD2 specific ELISA.

.6. Chemotaxis assay with DT40 cells

The conditioned medium containing the recombinantpl AvBD2 (at a final concentration of 2 �g/ml) showed chemo-

actic activity to the DT-40 cells (Fig. 8B). The chemotaxis wasomparable to fMLP used at a concentration of 10−4 M. The effectas significant (p < 0.01) compared to the chemotaxis mediated by

ulture supernatant obtained from mock-vector transfected cells.

. Discussion

Subtraction cloning is a powerful technique to identify dif-erentially expressed genes (Sagerstrom et al., 1997). Usinghis technique, we identified a novel �-defensin orthologueApl AvBD2) from domestic duck. The preliminary bioinformaticnalysis of the cDNA sequence of Apl AvBD2 revealed strikingdentity of the nucleotide and predicted amino acid sequences

ith other reported avian �-defensin-2 molecules. The molecu-ar features of Apl AvBD2 were comparable to the other known-defensins with respect to its smaller size and predicted netationic charge. Also, strict conservation of the ‘�-defensin coreotif’ (Harwig et al., 1994) formed by the three GXC sequences

nd the Pro-44 (Fig. 1A) was observed in Apl AvBD2. Phylogeneticnalysis of the mature-protein sequences of �-defensins revealedhat there is no clear clustering of the proteins as per speciation.wo major clusters were identified in the analysis, and the aviannd mammalian defensins were distributed uniformly in these two

lusters. However, the bootstrap support for this clustering was veryeak (only around 12%). The sub-cluster comprising the Apl AvBD2,ga AvBD2 and Mga AvBD2 was supported by a strong bootstrapalue (>90%), pointing to a very close evolutionary relation and aommon ancestry of these avian genes.

for the detection. The ‘→’ indicates the expressed protein. (B) Transwell migrationtor cells and the HEK293T cell culture supernatant containing Apl AvBD2 (2 �g/ml)counted by flow cytometry and compared with a standard chemoattractant, fMLP,

data were analyzed by Students’t-test and p < 0.01 is indicated by an asterisk ‘*’.

Analysis of the gene organization revealed a conserved pat-tern of the chicken and duck defensin-2 genes. The splice sitesin the Apl AvBD2 and Gga AvBD2 were present within the codonof the corresponding amino acid forming the site. This is unlikewhat is observed in duck IL-2 (Sreekumar et al., 2005b), wherethe splice sites are present exactly between two codons, whichleave the amino acids at the intron–exon junctions intact. It wasalso observed that the sequences coding for the major function-ally important residues, including the six cysteine residues and theresidues forming the �-sheets, were present in a single exon (Exon3). Significant conservation of the signal peptide coding region andconsiderable variability in the exons coding for the mature pro-tein have been noticed in defensin genes (Morrison et al., 2003).In these lines, in Apl AVBD2 and Gga AvBD2, the signal-peptidecoding region (Exon 2) had an identity of 88%, whereas the mature-protein coding region (Exon 3 and 4) had an identity of only 80%.In amino acid level, it corresponds to 90% identity (95% similarity)and 69% identity (81% similarity), respectively, thus corroboratingthe positive selection observed in defensins (Morrison et al., 2003).

Antimicrobial peptides show specific pattern of expression indifferent anatomical sites in relation to their functionality againstinvading pathogens (van Dijk et al., 2008). Except for a very weakexpression in the small intestine, the Apl AvBD2 mRNA expres-sion was not detectable in any of the tissues from the digestivetract, which may indicate the lack of its role in primary defense inthe digestive tract. Though trace amount of Apl AvBD2 mRNA wasdetectable in other non-epithelial duck tissues, very strong mRNAexpression was noted in bone marrow and spleen. This suggeststhat it is a myeloid defensin that may play role in systemic immuneresponse apart from the direct antimicrobial activity. A number of

chicken �-defensins including AvBD2, have been reported to showstrong expression in bone marrow. However, in spleen tissue, theexpression of the reported chicken �-defensins was found to beweak or nil (van Dijk et al., 2008). Only AvBD13 has been reportedto show a strong constitutive expression in the spleen (Higgs et al.,

mmun

2dihdei

cmacm3Ae2sd�cpTmsaAbvt

ibnuewtntbbHabi(

inTeT2atatsatratot

S.S. Soman et al. / Molecular I

005). The myeloid defensins, also classified as avian heterophil �-efensins in birds (Sugiarto and Yu, 2004), are crucial to combat

nvading pathogens than protecting the epithelial surfaces. Avianeterophils are deficient in oxidative mechanisms for pathogenestruction (Harmon, 1998). Hence, the non-oxidative mechanismsmployed by these peptides (Sahl et al., 2005) may play a major rolen the innate immune response of birds.

Excessive production of proteins with high biological activityan lead to damage of the cells that produce them. The majorechanisms employed by the cells to avoid this operate at mRNA

nd protein level. In many cytokine genes the presence of twoonserved sequence stretches called adenylate–uridylate-rich ele-ents (AREs) ‘TTATTTATT’ and pentameric elements ‘ATTTA’ in the

′UTR of the mRNA facilitates rapid degradation (Xu et al., 1997).vian interleukin-2 and chemokine mRNA sequences contain suchlements that ensure rapid turn over of the mRNA (Sreekumar et al.,005a,b). 3′UTR regions of the Gga AvBD2 and Apl AVBD2 did nothow the presence of these elements, indicating that mRNA degra-ation may not be the predominant mechanism operating for avian-defensins. It has been reported that in antimicrobial peptides, theleavage of the signal peptide yields a relatively unstable matureeptide that degrades fast (Ganz and Lehrer, 1994; Ganz, 2003).his short half-life of �-defensins is suggestive of a natural safetyechanism against the possible deleterious effects on host cells on

pontaneous degranulation of the cells (Ganz, 2003). The in siliconalysis of the predicted protein sequences of the Gga AvBD2 andpl AVBD2 using Expasy protparam tool (http://au.expasy.org/cgi-in/protparam.html) also showed that the mature proteins had aery high instability index (75–85) that may lead to rapid degrada-ion.

Expression of the anti-microbial proteins in recombinant formn prokaryotic system can be difficult due to their toxicity to theacterial cells (Piers et al., 1993). Toxic effects of Apl AvBD2 wereot observed in our study, may be because the protein formed insol-ble inclusion bodies during recombinant expression. The level ofxpression of the fully mature protein, with an N-terminal His tag,as considerably low. Attempt to express the protein with a C-

erminal His-tag also did not improve the yield of the protein (dataot shown). Subsequently, when we added a part of the signal pep-ide and extra residues after the His-tag, the level of expressionecame sufficiently high to allow purification. In our study, thoughoth the proteins had the first seven residues identical (MHHH-HH), the residues that formed the rest of the N-terminal varied,nd this might have affected the stability of the protein in theacterial cytoplasm. The role of N-terminal residues (N-degron)

n affecting the stability of proteins has been studied extensivelyVarshavsky, 1996).

Previous reports on antimicrobial activity of avian �-defensinsndicate that they are active against both Gram-positive and Gram-egative bacteria (Sugiarto and Yu, 2004; van Dijk et al., 2008).he Gga AvBD2 is active against E. coli and exerts the antimicrobialffect at peptide concentrations of 16 �g/ml (Evans et al., 1995).he Apl AvBD2 inhibits the growth of E. coli at a concentration of5 �g/ml (3.7 �M). However, the Mga AvBD2, which has a very highmino acid similarity with Apl AvBD2 (83.3% of the mature pep-ide region), did not kill E. coli (Evans et al., 1994). Predicted aminocid sequence analysis indicated that the major variations in thewo proteins lie in the N-terminal region, which forms the first �-heet in the secondary structure prediction. Further experimentsre needed to understand whether these differences contributeo the observed functional difference of the two peptides. The

ecombinant Apl AvBD2 also demonstrated potent antibacterialctivity against Gram-positive bacteria M. luteus NCIM 2871 athe same concentration as that was for E. coli. In general, thebserved antibacterial activity of Apl AvBD2 was comparable tohe activity range of other known avian beta-defensins (van Dijk

ology 46 (2009) 2029–2038 2037

et al., 2008; Higgs et al., 2005), though these experiments weredone under different settings. It is interesting to note that the MBCvalues of Apl AvBD2 against a duck specific pathogen (R. anatipes-tifer) was much lower than that against E. coli or M. luteus, whichare more ubiquitous. Apl AvBD2 exhibited complete bactericidalaction against R. anatipestifer at a concentration of 15 �g/ml level(2.2 �M). This further supports the observation that the �-defensinmolecules are subjected to adaptive evolution in nature in syn-chrony with the host-specific pathogens (Maxwell et al., 2003;Semple et al., 2006; Higgs et al., 2007). Salt sensitivity is one of thekey features of �-defensins, and many of these peptides are inacti-vated at physiological concentration of sodium chloride (∼150 mMor 300 mOsm) (Tomita et al., 2000). In our study, the bacteria weretreated with the Apl AvBD2 in PBS, which had a sodium chlorideconcentration of 136 mM, and the protein exhibited antibacte-rial activity against all the bacteria tested. This indicates that theduck �-defensin is fairly salt resistant, though the resistance can-not be compared with that exhibited by the Apa AvBD103b at160 mM (348 mOsm) (Thouzeau et al., 2003). Among the chicken �-defensins previously studied, only AvBD9 has found to be relativelysalt resistant at 150 mM concentration of sodium chloride (van Dijket al., 2007). Information on the salt sensitivity of Gga AvBD2 andMga AvBD2, which are closely related to the Apl AvBD2, is currentlynot available.

The high level expression of Apl AvBD2 in tissues of immuno-logical importance, such as spleen and bone marrow, prompted usto look into the chemotactic activity of this molecule. Defensinsare extensively studied for their chemotactic ability of immaturedendritic cells and memory T cells, which will make them attrac-tive candidates as vaccine adjuvants (Biragyn, 2005). The significantchemotactic activity exhibited by Apl AvBD2 in our study to DT-40cells, a chicken B-lymphocyte cell line, is promising. It implies thatapart from direct antimicrobial activity, it may play role in recruitingimmune cells to the sites of pathogen entry, thereby facilitating thedevelopment of adaptive immune response. Other avian defensinshave not been studied for the chemotactic functions. Studies areprogressing in order to understand the immune cell population thatis sensitive to the chemotaxis by Apl AvBD2, and its potential as avaccine adjuvant against duck diseases.

In conclusion, the present study discovered the avian beta-defensin-2 orthologue from domestic duck, which can kill bothGram-positive and Gram-negative bacteria, and mediate chemo-taxis. These properties make Apl AvBD2 an ideal candidate forthe development of new anti-bacterials, vaccine adjuvants andimmunomodulators. Also, the important role played by defensinsin air-way immunity (Laube et al., 2006), makes the newly charac-terized Apl AvBD2 a valuable tool in studying the innate immuneresponse against respiratory pathogens in duck, such as highlypathogenic avian influenza virus.

Acknowledgements

The authors acknowledge the Department of Science and Tech-nology, Government of India for financial assistance (Grant No.SR/FT/L-157/2004) to this project. The authors are thankful to Prof.M. Radhakrishna Pillai, Director, RGCB for the facilities providedfor the study, and Dr. T.J. Rasool, Assistant Director General (AP&B),Indian Council of Agricultural Research, New Delhi for critical guid-ance during the inception of the work. Soja Saghar Soman wassupported with Senior Research Fellowship from Council of Scien-tific and Industrial Research (CSIR), Government of India.

References

Amsterdam, D., 1996. Susceptibility testing of antimicrobials in liquid media. In:Loman, V. (Ed.), Laboratory Medicine, 4th ed. Williams and Wilkins, Baltimore,MD, pp. 52–111.

2 mmun

A

B

B

E

E

G

GH

H

H

H

H

H

H

K

K

K

K

L

L

L

M

M

M

P

S

Yang, D., Chertov, O., Bykovskaia, S.N., Chen, Q., Buffo, M.J., Shogan, J., Anderson, M.,

038 S.S. Soman et al. / Molecular I

ltschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local align-ment search tool. J. Mol. Biol. 215, 403–410.

iragyn, A., 2005. Defensins-non-antibiotic use for vaccine development. Curr. Pro-tein Pept. Sci. 6, 53–60.

radford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein–dye binding. Anal.Biochem. 72, 248–254.

vans, E.W., Beach, F.G., Moore, K.M., Jackwood, M.W., Glisson, J.R., Harmon, B.G.,1995. Antimicrobial activity of chicken and turkey heterophil peptides CHP1,CHP2, THP1, and THP3. Vet. Microbiol. 47, 295–303.

vans, E.W., Beach, G.G., Wunderlich, J., Harmon, B.G., 1994. Isolation of antimicrobialpeptides from avian heterophils. J. Leukoc. Biol. 56, 661–665.

anz, T., 2003. Defensins: antimicrobial peptides of innate immunity. Nat. Rev.Immunol. 3, 710–720.

anz, T., Lehrer, R.I., 1994. Defensins. Curr. Opin. Immunol. 6, 584–589.all, T.A., 1999. Bio-Edit: a user-friendly biological sequence alignment editor and

analysis program forWindows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.armon, B.G., 1998. Avian heterophils in inflammation and disease resistance. Poult.

Sci. 77, 972–977.arwig, S.S., Swiderek, K.M., Kokryakov, V.N., Tan, L., Lee, T.D., Panyutich, E.A.,

Aleshina, G.M., Shamova, O.V., Lehrer, R.I., 1994. Gallinacins: cysteine-richantimicrobial peptides of chicken leukocytes. FEBS Lett. 342, 281–285.

iggs, R., Lynn, D.J., Cahalane, S., Alana, I., Hewage, C.M., James, T., Lloyd, A.T.,O’Farrelly, C., 2007. Modification of chicken avian beta-defensin-8 at positivelyselected amino acid sites enhances specific antimicrobial activity. Immuno-genetics 59, 573–580.

iggs, R., Lynn, D.J., Gaines, S., McMahon, J., Tierney, J., James, T., Lloyd, A.T.,Mulcahy, G., O’Farrelly, C., 2005. The synthetic form of a novel chicken beta-defensin identified in silico is predominantly active against intestinal pathogens.Immunogenetics 57, 90–98.

ughes, A.L., 1999. Evolutionary diversification of the mammalian defensins. CellMol. Life Sci. 56, 94–103.

ulse-Post, D.J., Sturm-Ramirez, K.M., Humberd, J., Seiler, P., Govorkova, E.A., Krauss,S., Scholtissek, C., Puthavathana, P., Buranathai, C., Nguyen, T.D., Long, H.T.,Naipospos, T.S., Chen, H., Ellis, T.M., Guan, Y., Peiris, J.S., Webster, R.G., 2005.Role of domestic ducks in the propagation and biological evolution of highlypathogenic H5N1 influenza viruses in Asia. Proc. Natl. Acad. Sci. U.S.A. 102,10682–10687.

apetanovic, R., Cavaillon, J.M., 2007. Early events in innate immunity in the recog-nition of microbial pathogens. Expert Opin. Biol. Ther. 7, 907–918.

lotman, M.E., Chang, T.L., 2006. Defensins in innate antiviral immunity. Nat. Rev.Immunol. 6, 447–456.

uiken, T., Fouchier, R., Rimmelzwaan, G., Osterhaus, A., 2003. Emerging viral infec-tions in a rapidly changing world. Curr. Opin. Biotechnol. 14, 641–646.

umar, S., Tamura, K., Nei, M., 2004. MEGA3: Integrated software for MolecularEvolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5,150–163.

aube, D.M., Yim, S., Ryan, L.K., Kisich, K.O., Diamond, G., 2006. Antimicrobial pep-tides in the airway. Curr. Top. Microbiol. Immunol. 306, 153–182.

ehrer, R.I., Ganz, T., 1999. Antimicrobial peptides in mammalian and insect hostdefence. Curr. Opin. Immunol. 11, 23–27.

ynn, D.J., Higgs, R., Lloyd, A.T., O’Farrelly, C., Herve-Grepinet, V., Nys, Y., Brinkman,F.S., Yu, P.L., Soulier, A., Kaiser, P., Zhang, G., Lehrer, R.I., 2007. Avian beta-defensinnomenclature: a community proposed update. Immunol. Lett. 110, 86–89.

axwell, A.I., Morrison, G.M., Dorin, J.R., 2003. Rapid sequence divergence in mam-malian beta-defensins by adaptive evolution. Mol. Immunol. 40, 413–421.

cLeod, S.J., Li, A.H., Lee, R.L., Burgess, A.E., Gold, M.R., 2002. The Rap GTPasesregulate B cell migration toward the chemokine stromal cell-derived factor-1(CXCL12): potential role for Rap2 in promoting B cell migration. J. Immunol. 169,1365–1371.

orrison, G.M., Semple, C.A., Kilanowski, F.M., Hill, R.E., Dorin, J.R., 2003. Signal

sequence conservation and mature peptide divergence within subgroups of themurine beta-defensin gene family. Mol. Biol. Evol. 20, 460–470.

iers, K.L., Brown, M.H., Hancock, R.E., 1993. Recombinant DNA procedures for pro-ducing small antimicrobial cationic peptides in bacteria. Gene 134, 7–13.

agerstrom, C.G., Sun, B.I., Sive, H.L., 1997. Subtractive cloning: past, present, andfuture. Annu. Rev. Biochem. 66, 751–783.

ology 46 (2009) 2029–2038

Sahl, H.G., Pag, U., Bonness, S., Wagner, S., Antcheva, N., Tossi, A., 2005. Mammaliandefensins: structures and mechanism of antibiotic activity. J. Leukoc. Biol. 77,466–475.

Sambrook, J., Fritsch, E.F., Maniatis, T., Hrsg, 1989. Molecular Cloning—A LaboratoryManual, 2nd edition. Cold Spring Harbour Laboratory Press, New York.

Sandhu, T.S., Rimler, R.B., 1997. Riemerella anatipestifer infection. In: Diseases of Poul-try, 10th ed. Iowa State University Press, pp. 161–166.

Selsted, M.E., Ouellette, A.J., 2005. Mammalian defensins in the antimicrobialimmune response. Nat. Immunol. 6, 551–557.

Semple, C.A., Taylor, K., Eastwood, H., Barran, P.E., Dorin, J.R., 2006. Beta-defensinevolution: selection complexity and clues for residues of functional importance.Biochem. Soc. Trans. 34, 257–262.

Sreekumar, E., Premraj, A., Arathy, D.S., Rasool, T.J., 2005a. Identification, sequencecharacterization, and analysis of expression profiles of three novel CCchemokines from domestic duck (Anas platyrhynchos). Immunogenetics 57,364–373.

Sreekumar, E., Premraj, A., Rasool, T.J., 2005b. Duck (Anas platyrhynchos), Japanesequail (Coturnix coturnix japonica) and other avian interleukin-2 reveal significantconservation of gene organization, promoter elements and functional residues.Int. J. Immunogenet. 32, 355–365.

Sugiarto, H., Yu, P.L., 2006. Identification of three novel ostricacins: an update onthe phylogenetic perspective of beta-defensins. Int. J. Antimicrob. Agents 27,229–235.

Sugiarto, H., Yu, P.L., 2004. Avian antimicrobial peptides: the defense role of beta-defensins. Biochem. Biophys. Res. Commun. 323, 721–727.

Thouzeau, C., Le Maho, Y., Froget, G., Sabatier, L., Le Bohec, C., Hoffmann,J.A., Bulet, P., 2003. Spheniscins, avian beta-defensins in preserved stomachcontents of the king penguin, Aptenodytes patagonicus. J. Biol. Chem. 278,51053–51058.

Tomita, T., Hitomi, S., Nagase, T., Matsui, H., Matsuse, T., Kimura, S., Ouchi, Y., 2000.Effect of ions on antibacterial activity of human beta defensin 2. Microbiol.Immunol. 44, 749–754.

Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins frompolyacrylamide gels to nitrocellulose sheets: procedure and some applications.Proc. Natl. Acad. Sci. U.S.A. 76, 4350–4354.

van Dijk, A., Veldhuizen, E.J., Haagsman, H.P., 2008. Avian defensins. Vet. Immunol.Immunopathol. 124, 1–18.

van Dijk, A., Veldhuizen, E.J., Kalkhove, S.I., Tjeerdsma-van Bokhoven, J.L., Romijn,R.A., Haagsman, H.P., 2007. The beta- defensin gallinacin-6 is expressed inthe chicken digestive tract and has antimicrobial activity against food-bornepathogens. Antimicrob. Agents Chemother. 51, 912–922.

Varshavsky, A., 1996. The N-end rule: functions, mysteries, uses. Proc. Natl. Acad. Sci.U.S.A. 93, 12142–12149.

Vicente, M., Hodgson, J., Massidda, O., Tonjum, T., Henriques-Normark, B., Ron,E.Z., 2006. The fallacies of hope: will we discover new antibiotics to combatpathogenic bacteria in time? FEMS Microbiol. Rev. 30, 841–852.

Wu, Z., Hoover, D.M., Yang, D., Boulègue, C., Santamaria, F., Oppenheim, J.J.,Lubkowski, J., Lu, W., 2003. Engineering disulfide bridges to dissect antimicro-bial and chemotactic activities of human beta-defensin 3. Proc. Natl. Acad. Sci.U.S.A. 100, 8880–8885.

Xia, J., Radford, C., Guo, X., Magor, K.E., 2007. Immune gene discovery by expressedsequence tag analysis of spleen in the duck (Anas platyrhynchos). Dev. Comp.Immunol. 31, 272–285.

Xiao, Y., Hughes, A.L., Ando, J., Matsuda, Y., Cheng, J.F., Skinner-Noble, D., Zhang, G.,2004. A genome-wide screen identifies a single beta-defensin gene cluster inthe chicken: implications for the origin and evolution of mammalian defensins.BMC Genomics 5, 56.

Xu, N., Chen, C.Y., Shyu, A.B., 1997. Modulation of the fate of cytoplasmic mRNA byAU-rich elements: key sequence features controlling mRNA deadenylation anddecay. Mol. Cell. Biol. 17, 4611–4621.

Schroder, J.M., Wang, J.M., Howard, O.M., Oppenheim, J.J., 1999. Beta-defensins:linking innate and adaptive immunity through dendritic and T cell CCR6. Science286, 525–528.

Zasloff, M., 2002. Antimicrobial peptides of multicellular organisms. Nature 415,389–395.