Ž .Molecular Brain Research 74 1999 55–68www.elsevier.comrlocaterbres

Research report

Developmental changes in the expression of Shaker- and Shab-relatedKq channels in neurons of the rat trigeminal ganglion

Gerald Seifert ), Elena Kuprijanova, Min Zhou 1, Christian Steinhauser¨Experimental Neurobiology, Neurosurgery, UniÕersity of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn, Germany

Accepted 24 August 1999

Abstract

q Ž .We have investigated properties of voltage-gated K channels in neurons of the pre- and postnatal rat trigeminal ganglion TG . Tocorrelate functional data with information on gene expression of Shaker- and Shab-related channels in these pseudo-unipolar neurons, the

Ž . Ž .patch-clamp technique was combined with the single-cell reverse transcription-polymerase chain reaction RT-PCR . A majority 80% ofprenatal TG neurons possessed only sustained delayed rectifier currents with half-maximal current inactivation at y30 mV. In the

Ž .postnatal cells, steady-state inactivation of sustained currents occurred at more negative voltages half-maximal inactivation at y58 mV .About 65% of the postnatal cells displayed a transient outward component in addition to the sustained currents. With increasing age, the

Ž .sensitivity of sustained currents to 4-aminopyridine 4-AP decreased significantly. The Shaker channel toxins, a-dendrotoxin andŽ . Ž .agitoxin-2 50 and 10 nM , were much less effective. Discrimination between both stages with tetraethylammonium chloride 5 mM was

not possible since the currents were reduced generally by about 50%. After recording, the cell content was harvested and single-cellRT-PCR was performed to compare Kq current properties and mRNA expression within the same cell. Most cells simultaneouslyexpressed several different Shaker- and Shab-like transcripts. At postnatal day 14, the frequency of cells carrying transcripts encodingKv1.1 decreased. Detailed analysis revealed a higher 4-AP sensitivity of TG neurons expressing Kv1.1 transcripts. q 1999 ElsevierScience B.V. All rights reserved.

Keywords: Patch-clamp; Single-cell RT-PCR; Kv1; Kv2; Pharmacology

1. Introduction

Ž .Voltage-gated potassium channels Kv channels areubiquitously distributed in the mammalian nervous systemand are composed of various a-subunits. They serve manyfunctions in cell physiology, including stabilization ofresting potential, determination of neuronal spike fre-quency and regulation of proliferation and differentiation.At least 18 genes belonging to the four subfamilies Kv1–Kv4 have, to date, been identified, corresponding to fourDrosophila potassium channel genes Shaker, Shab, Shaw,

w xand Shal, respectively 22,32 . The large number of iso-forms indicates a considerable diversity in the compositionand functioning of these channels. Additional variability ofKv channel structure and function is produced by coex-pression of ‘auxiliary’ a- or b-subunits. The composition

) Corresponding author. Fax: q49-228-287-9121; e-mail:gese@mailer.meb.uni-bonn.de

1 Min Zhou is now in the Division of Neurosurgery, Albany MedicalCollege, Albany, NY 12208, USA.

and stoichiometry of native Kv channels are, however,largely unknown and the question of the temporal changesin the expression of distinct Kv subunits accounting forchanges during Kq current development in vivo is unan-swered.

Ž .The mammalian trigeminal ganglion TG is relativelylarge, and is reliably discernible and accessible even atearly stages of ontogenesis. Rat TG neurons are born

w xbetween embryonic days 9.5 and 14.5 57 . Despite thecontroversy concerning the presence or absence of synap-

w xtic inputs in TG neurons 26,59 , their perikarya could playa role in the modulation of afferent signal transductionw x33 . Using sharp electrodes, the latter authors provided thefirst analysis of Kq currents in adult TG neurons of guineapig in situ. These investigations have revealed Kq outwardcurrents with unusual pharmacological properties that werespeculated to contribute to prevention of excessive spikeactivity during pathophysiological conditions such as

w xtrigeminal neuralgia 45 .To learn more about these currents, we extended the

analysis by comparing Kq current properties in TG neu-

0169-328Xr99r$ - see front matter q 1999 Elsevier Science B.V. All rights reserved.Ž .PII: S0169-328X 99 00268-5

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6856

rons at different stages of development. The patch-clamptechnique was applied to cells at prenatal days 13–15Ž . Ž .F14 and postnatal days 12–15 P14 . Subsequent tofunctional analysis, the cell content was harvested and asingle-cell reverse transcription-polymerase chain reactionŽ .RT-PCR was performed to correlate functional propertiesof Kv channels with information on the transcript level inthe same individual cell. Primers were used recognizing

Ž . Ž .a-subunits of the Kv1 Shaker and Kv2 Shab subfami-lies. Several Kv channel blockers were tested for phar-macological characterization. We found that a majority ofprenatal cells possessed only sustained outward currentsbut lacked transient Kq currents while the latter werepresent in most P14 cells. Concomitantly, sustained currentsteady-state inactivation significantly shifted to more nega-tive voltages. With increasing age, the 4-aminopyridineŽ . q4-AP sensitivity of sustained K currents decreased.Correlation of transcript expression with functional proper-ties revealed a higher 4-AP sensitivity of TG neuronscarrying Kv1.1 transcripts.

2. Materials and methods

2.1. Brain slice preparation and cell isolation

ŽPregnant Wistar rats were anaesthetized 50%.CO r50% O and sacrificed by decapitation. Embryos at2 2Ž . Ž .prenatal day F 14 range F13–F15 were dissected and

Ž . Ž .washed 68C . Brain slices 500 mm thick containing theembryonic TG were prepared by two cuts in horizontalorientation at eye level using a manual chopper. The slices

2q Žwere stored in nominally Ca -free solution containing in.mM 150 NaCl, 5 KCl, 2 MgSO , 1 sodium pyruvate, 104

Ž . X Žglucose, 10 N- 2-hydroxyethyl piperazine-N - 2-ethane-. Ž . Žsulfonic acid HEPES , and gassed with O pH 7.4,2

.228C . For patch-clamp analysis in situ, slices were placedin a perfusion chamber on the stage of a microscope

Žequipped with water immersion optics Axioskop FS, Zeiss,.Jena, Germany . The chamber was continuously perfused

with oxygenated external recording solution.For preparation of isolated cells, rats at postnatal day

Ž . Ž .P 14 range P12–P15 were sacrificed, the brain wasremoved and the TG were isolated using fine scissorsunder microscopic control. The dissected ganglia were

Žincubated for 30 min in external solution containing in.mM 124 NaCl, 5 KCl, 2 MgSO , 2 CaCl , 10 glucose,4 2

1.25 NaH PO , 26 NaHCO , supplemented with 24 Urml2 4 3Žpapain and 0.24 mgrml L-cysteine gassed with carbogen,

.pH 7.4, 228C . After washing, the ganglia were stored inthe Ca2q-free solution described above, and the cells were

Ž .dissociated under microscopic control Telaval 2, Zeisswith tungsten needles. To confirm that the isolation proce-dure did not alter current properties, we re-evaluated our

w xresults by recording from P14 neurons in situ 33 . Thesedata confirmed the findings of the isolated cells because

q Žneither the K current density 63.6"13.3 pArpF at. Žq40 mV, ns3 , the steady-state current activation Vn,0.5

.sy4.8"9.8 mV; k s18.8"4.1 mV, ns3 , nor thenŽsensitivity to a-dendrotoxin DTX; block to 83"13% at

.q20 mV, ns2 differed significantly. Nevertheless, toreduce putative space clamp errors in the larger postnatalcells, we preferred the isolated cell preparation to charac-terize TG neurons at P14.

Table 1Oligonucleotide primers used for nested RT-PCRPosition 1 is the first nucleotide of the initiation codon. se and as mark sense and antisense primers. The nested antisense primer used for amplification oftranscripts encoding Kv1.2, Kv1.3, Kv1.4, and Kv1.6 fully matched Kv1.4, having three mismatches with Kv1.2, Kv1.3, and Kv1.6.

Gene Sequence Position Product Accession no. ReferenceŽ .length bp

Ž . w xKv1.1 nested se CACCGCATCGATAACACCACAGTC 607 416 X12589 1as AGAAAACAGTATGACGCCAATGAA 1000

Ž . w xKv1.2 nested se ATCTTCCGGGATGAGAACGAGGA 559 470 X16003 49as GGAAAAGAGGATGACCCCGATGAA 1006

Ž . w xKv1.3 nested se CGCGACGAGAAGGACTATCCC 628 461 X16001 49as GGAAAAGAGGATGACCCCGATGAA 1066

Ž . w xKv1.4 nested se AGCGCAGGTGGACACAGCAGATTA 1033 452 X16002 49as GGAAAAGAGGATGACCCCGATGAA 1462

Ž . w xKv1.5 nested se ATGGCAGCGTCTCTGGAGCACTTTC 869 420 M27158, 51as GGAAGAAGATGAGTAGCCCGAGTT 1265 M31745

Ž . w xKv1.6 nested se TTGGGGACCGGAGGAACTT 869 446 X17621 14as GGAAAAGAGGATGACCCCGATGAA 1153

Ž . Ž . Ž . Ž . w xKv2.1 nested se ATGAAC AT T AG AAGGA TC GC 1330 270 X16476 11Ž .CTT CT GC 1578

as GGCCATCTTACTGTACATGTCTŽ . Ž . Ž . Ž . w xKv2.2 nested se ATGAAC AT T AG AAGGA TC GC 1354 344 M77482 19

Ž .CTT CT GC 1678as CTCTCTGGCTGTTCTTGGCA

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 57

2.2. Electrophysiology

Membrane currents were measured with the patch-clamptechnique in the whole-cell configuration. Signals were

Žamplified EPC-7 or EPC-9, HEKA Elektronik, Lam-.brecht, Germany , filtered at 3 or 10 kHz, and sampled at 5

or 30 kHz by an interface connected to an AT-compatiblecomputer system that also served as a stimulus generator.

ŽThe resistance of the patch pipettes was 2–3 MV isolated. Ž .cells or 5–6 MV analysis in situ .

Ž .The sodium-free recording solution contained in mM150 choline chloride, 5 KCl, 2 MgSO , 2 CaCl , 0.14 2

Table 2Steady-state activation of I and I in TG neuronssus trans

F14 P14

Ž . Ž . Ž . Ž .V mV k mV n V mV k mV nn,0.5 n n,0.5 n

I y2.5"9.9 18.2"3.3 58 y2.2"9.5 22.7"4.1 19susa b cI q3.6"12.1 19.0"3.6 14 y13.1"15.8 15.5"4.1 36transaI y10.1"9.8 17.9"2.7 q4.4"14.0 21.8"3.8sus

a In cells with a transient component, I was separated by subtractingsusŽ .I from the whole outward current see Section 3 . n gives celltrans

numbers.b Ž .Significant differences between I and I F14 .trans susc Ž .Significant differences between I and I P14 .trans sus

q Ž .Fig. 1. Functional properties of sustained K currents in prenatal TG neurons lacking a transient component. A The reversal potential was estimated byŽ . Ž .activating outward currents at q20 mV and subsequently stepping the membrane between q20 and y90 mV cf. inset . The IrV curve right was

Ž . Žconstructed from the tail current amplitudes taken 2 ms after the onset of the test pulses dashed line . In the cell illustrated F15, resting potential y51. Ž . Ž .mV , currents reversed at y67 mV. B The membrane was de- and hyperpolarized to y40 and y110 mV prior to recording prepulse duration 300 ms ,

Ž . Ž .stepped back to y70 mV 3 ms , and subsequently was clamped between y130 mV and q70 mV insets . Note that subtracting both current families atŽ . Ž .corresponding voltages did not isolate any inactivating component right . C In this cell, the absence of an inactivating component was confirmed by

Ž . Ž . Žvarying the duration of conditioning de- y40 mV; lower panel and hyperpolarizing y110 mV, upper panel prepulses 5, 10, 50, 100, 250, 500 ms;. Ž . Ž . Ž1, 2 s which did not change the amplitude of a subsequent test current q40 mV . D Steady-state activation of the sustained currents grg ,max

.diamonds was determined from the currents elicited after the y40 mV prepulses. Membrane conductances were calculated dividing peak currents elicitedŽ .at different membrane potentials y70 to q70 mV by the corresponding driving force, VyE . Conductances were normalized to maximum values,K

Ž . Ž .averaged ns58 , and fitted by a Boltzmann equation smooth line; V sy2.5"9.9 mV; k s18.2"3.3 mV . The inactivation curve IrIn,0.5 n maxŽ . Ž . Ž .triangles was recorded by changing prepulse potentials duration 3 s between y130 and q20 mV, stepping back to y70 mV 3 ms and evoking test

Ž .currents at q40 mV 200 ms . The current response after the q20 mV prepulse was then subtracted from all traces of the same cell. Data were taken atŽ . Žthe end of the test current responses, normalized for maximum amplitude, averaged ns17 , and fitted smooth line; V sy29.8"10.5 mV;g ,0.5

.k s10.5"4.2 mV .g

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6858

Table 3Steady-state inactivation of Kv currents in TG neurons

Ž .Data were taken at the end of the 200-ms lasting current responses Vsq40 mV .

F14 P14a aŽ . Ž . Ž . Ž . Ž . Ž .V mV k mV Inactivation % n V mV k mV Inactivation % ng ,0.5 g g ,0.5 g

b cCells lacking I y29.8"10.6 10.5"4.2 34.0"7.5 17 y57.5"18.0 20.7"6.1 37.6"15.3 10transbCells with I y38.5"10.5 12.5"2.6 35.3"9.0 9 y59.5"16.6 16.1"5.8 45.4"20.0 28trans

a w Ž .xInactivation of the test current was calculated according to 1y I rI =100%. n gives cell numbers.q2 0 mV prepulse y130 mV prepulsebSignificant differences between V at F14 and P14.g ,0.5cSignificant differences between k at F14 and P14.g

CdSO , 10 HEPES, 10 glucose, 5=10y4 tetrodotoxin4Ž .TTX , pH 7.4 and was gassed with oxygen. The pipette

Ž .solution was composed of in mM 130 KCl, 0.5 CaCl , 22Ž . X XMgCl , 5 1,2-bis 2-aminophenoxy ethane-N, N, N , N -te-2

Ž .traacetic acid BAPTA , 10 HEPES, 3 ATP disodium salt,pH 7.25.

Ž .DTX was from RBI Natick, MA, USA , agitoxin-2Ž . Ž .AgTX and TTX from Alomone Labs Jerusalem, Israel ,2

Žand all other reagents were purchased from Sigma St..Louis, MO, USA . To avoid non-specific sticking of the

Ž .toxins to the perfusion system, 0.05% wrv bovine serumŽ .albumin BSA was added to the bath. Control experiments

confirmed that at this concentration, BSA did not affectKq currents. Recording pipettes were fabricated from

Ž .borosilicate capillaries Hilgenberg, Malsfeld, Germany .

2.3. Data analysis

Ž .Membrane capacitance C of TG neurons was deter-M

mined from current transients evoked by 10 mV test pulsesŽdepolarizing the cells from y70 to y60 mV sampling

.rate 30 kHz, filter 10 kHz . Time constants were deter-mined by fitting a single exponential to the current decay.The mean values of C at F14 and P14 were 8.8"1.7 pFM

q Ž .Fig. 2. Prenatal cells possessing sustained and inactivating K currents. A Currents were evoked in a F14 neuron as described in the legend to Fig. 1B.Ž . Ž .Subsequent subtraction of the current family evoked after y40 mV prepulses middle from that obtained after y110 mV prepulses left isolated a

Ž . Ž . Ž .transient outward component right . B The magnitude of the transient component of the cell shown in A was dependent on the duration of conditioningŽ . Ž . Žprepulses as indicated for pulse protocols, see Fig. 1C . C Steady-state activation curves were determined for the sustained currents y40 mV prepulses;

. Ž .squares and the transient component subtraction protocol; circles according to the protocols of Fig. 1D, yielding V sy10.1"9.8 mV,n,0.5Ž .k s17.9"2.7 mV and V s3.6"12.1 mV, k s19"3.6 mV ns14 , respectively.n n,0.5 n

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 59

Ž . Ž .ns61 , and 31.2"12.2 pF ns31 , respectively. Dur-ing the same period, the input resistance declined from

Ž .4.3"2.6 GV range 1.7 to 6.9 GV; ns57 to 0.8"0.7Ž .GV range 0.1 to 3.7 GV; ns56 .

Steady-state activation of Kq currents was obtained bydividing maximum currents by the corresponding drivingforce, VyE , where E is the Kq equilibrium potential.K K

Subsequently, data points were fitted by:y1

grg s 1qexp V yV rk 1� 4Ž . Ž .max n ,0 .5 n

with V being the test potential, V the voltage ofn,0.5

half-maximum activation, and k a slope factor. Steady-n

state inactivation was fitted by a Boltzmann equation ofthe form:

y1IrI s 1qexp VyV rk 2Ž .Ž .� 4max g ,0 .5 g

where I is the voltage-dependent current amplitude, Imax

maximum current, V prepulse potential, V voltage ofg ,0.5

half-maximum inactivation, and k the slope factor. Sig-g

nificant differences between data were evaluated by theuse of Student’s t-test. All data are given as mean"S.D.The level of significance was set at pF0.05.

2.4. Cell identification

Recordings at F14 were obtained from TG neuronslocated adjacent to the eyes. These cells mainly give rise tomandibular and maxillary rather than ophthalmic projec-

tions since the latter remain distinct at the dorsal tip of thew xganglion throughout development 48 . Compared to P14,

the neurons in the embryonic TG are relatively smallŽ . qdiameter F10 mm and express a low Na currentdensity. It has been previously shown that these neurons

w xexpress the intermediate filament protein peripherin 53 ,which is an early neuronal-specific marker in the PNS.Specifically, noticeable peripherin immunoreactivity was

w xdetected in trigeminal nerves after F12 9 . Therefore, afterfunctional analysis, immunostaining was occasionally per-formed to confirm the neuronal origin of the embryoniccells. While recording in situ, cells were filled with Lucifer

Ž .Yellow 0.1% by dialyzing the cytoplasm with the patchpipette solution. After recording, the pipette was pulledback and the tissue was fixed in phosphate-buffered salt

Ž . Žsolution PBS containing 4% paraformaldehyde 3 to 5 h,. Ž .pH 7.4, 68C . After washing in PBS 1 h , Triton X-100

Ž . Ž .0.5% and swine serum 10%, Dako, Glostrup, DenmarkŽ .were added 2 h to permeabilize the tissue and block

non-specific staining. The tissue was thoroughly washed,Ž .swine serum 10% was added and the slices were incu-

Žbated in a peripherin antibody 1:100, rabbit anti-bovineimmunoglobulin; gift of B. de Nechaud and A. Wolff,

.Biochimie Cellulaire, College de France, Paris, Franceovernight at 58C by gently shaking. This antibody has been

w xcharacterized in detail previously 9 . The slices wererinsed several times in PBS, 10% swine serum was addedand the tissue was incubated in tetramethylrhodamine iso-

Ž .Fig. 3. Negative shift of sustained current inactivation in postnatal neurons. A A P12 neuron lacking transient outward currents was analyzed as describedŽ . Ž .in Fig. 1B. Note that hyperpolarizing prepulses y110 mV, 300 ms activated an additional sustained current component. B Steady-state activation and

Ž .inactivation were determined according to Fig. 1D. Currents were half-maximal activated at V sy2.2"9.5 mV, k s22.7"4.1 mV ns19 .n,0.5 nŽ .Half-maximal inactivation of the sustained currents was reached at V sy57.5"18 mV, k s20.7"6.1 mV ns10 . The dashed line gives theg ,0.5 g

Ž .inactivation curve of the prenatal cells cf. Fig. 1D .

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6860

Ž .thiocyanate TRITC -conjugated swine anti-rabbit immuno-Ž .globulins 1:100, Dako; overnight, shaking . Finally, after

Ž .being washed 2 h , the cells were inspected in a ZeissAxiophot light microscope equipped with fluorescence op-

Žtics and fluorescein isothiocyanate FITC; BP 450–490,. ŽFT 510, BP 515–565 and TRITC BP 546, FT 580, LP

.590 filter combinations. Peripherin-negative cells werenot included in the present study.

At P14 we recorded from medium-sized neurons. In themandibular projection, such cells innervate the oral regionwhile the facial region is innervated by small-sized neu-

w xrons in the TG 50 .

2.5. Single-cell RT-PCR technique

The single-cell RT-PCR mainly followed the strategyw xfirst described by Lambolez et al. 25 with the modifica-

w xtions recently reported 41 and an initial DNase treatmentw xto prevent genomic DNA contamination 15 . After record-

ing in situ, the cell was drawn out of the tissue and

Ž .harvested with a second pipette diameter about 20 mmunder microscopic control. For comparison, some cellswere harvested by sucking the cytoplasm into the record-ing pipette. All the isolated neurons were harvested using a

w xsecond pipette 41 . Subsequently, the tip of the harvestingpipette or the recording pipette was broken and the contentwas expelled into a reaction tube filled with 4 ml sterilewater. Immediately after exposure to water, the tube wasfrozen in liquid nitrogen and RT was performed as de-

w x Žscribed 41 using 1 U DNaseI ‘Amplification Grade’ Life.Technologies, Gaithersburg, MD, USA . The mixture was

incubated at 378C for 30 min and then DNase was inacti-vated at 958C for 5 min. Another 20 U ribonuclease

Ž .inhibitor Promega, Madison, WI, USA and 100 U Super-Ž .scripte II reverse transcriptase Life Technologies were

added and this mixture was incubated for 1 h at 378C.In our multiplex PCR approach we used primers that

did not span intron regions. Therefore, to prevent amplifi-cation of genomic DNA, which would result in PCRproducts of the same length as the corresponding mRNA,

q Ž .Fig. 4. A majority of postnatal cells coexpressed sustained and inactivating K currents. A Sustained and transient outward currents were separated in aŽ .P15 neuron as described in the legend to Fig. 1. B Subsequently, steady-state activation was calculated for both components, revealing a negative shift ofŽ . Žhalf-maximal activation of the transient currents circles; V sy13.1"15.8 mV; ns36 vs. the sustained component squares; V s4.4"14.0n,0.5 n,0.5

. Ž . Ž . Ž .mV . C gives the steady-state inactivation curve of the cell shown in A V sy61.7 mV, k s9.0 mV together with an original current familyg ,0.5 gŽ . Žobtained with the pulse protocol explained in the legend to Fig. 1D. D The columns demonstrate the different distribution of V in prenatal openg ,0.5

. Ž .columns and postnatal neurons closed columns .

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 61

RT-PCR was preceded by a DNase step. The efficacy ofDNA degradation was tested by DNaseI treatment of

Ž .increasing amounts of rat genomic DNA Promega andsubsequent PCR amplification. These control experimentsconfirmed that 1 U DNaseI completely digested at least

Ž .500 ng of rat genomic DNA not shown .To test for the specificity of the RT-PCR procedure,

total RNA was isolated from rat brain at postnatal day 10w x5,41 . For the first PCR round, a primer pair was designedto amplify the six Kv1-subunits Kv1.1–Kv1.6 and the twoKv2 subunits Kv2.1 and Kv2.2, respectively. All mis-matches between the Kv1 and Kv2 family have beenconsidered by nucleotide substitution. The cDNA resultingfrom the RT reaction was used as a template for PCR

w x Ž .amplification 41 . After denaturation at 958C 4 min andŽcooling down to 858C, 3.5 U Taq polymerase Life Tech-

. Ž . Žnologies were added. The first multiplex PCR round 45.cycles was performed with one primer pair for the Kv1

subunits and another one for the Kv2 subunits. Kv1: sense

X Ž .Ž . Ž . Ž .primer: 5 -TGGTCAT TC TC T AGC ATCTC GTC -Ž .Ž . X X Ž .AT ATC GA TCA-3 ; antisense primer: 5 -AC GTC AC-

Ž . Ž . Ž . XGATC GCCCACCA GA AA GAC GCATC-3 . Kv2:X Ž . Ž . Ž .sense primer: 5 -AG AG GAGGCTCT GT GA AG AGA-

X X Ž .GCCAA-3 ; antisense primer: 5 -TGGCACAGCTG AG T-X Ž .GAAGCTGTCAA-3 . The upstream sense and down-

Ž .stream antisense primers of Kv1 were located in thehighly conserved regions encoding S1 and the S5–S6 loopŽ .H5 region of the corresponding polypeptide, the primersof Kv2 in the C-terminal region that differed from Kv1.

An aliquot of the purified PCR product was used as aw xtemplate for the second amplification 41 . The Kv tran-

scripts were separately amplified by using nested upstreamprimers specifically recognizing each of the six Kv1 tran-scripts and downstream primers specifically recognizing

Ž .the two Kv2 transcripts 35 cycles . The annealing temper-ature was 578C for the subunits Kv1.1–1.4, Kv1.6, Kv2.1,Kv2.2, and 628C for Kv1.5. The primer pairs are given inTable 1.

q Ž .Fig. 5. Pharmacological properties of K currents in TG neurons. A For current activation, the membrane was stepped between q20 and y130 mVŽ . q Ž .holding potential y70 mV; left . In this prenatal cell, addition of 50 nM DTX to the bath reduced the K currents at q20 mV by 23%. B Onsetkinetics was estimated by fitting a single exponential to the rising phase of the capacitance subtracted outward current. Data of each cell was normalized to

Ž .the value obtained in control solution filled circles at q20 mV. With increasing depolarization, current activation speeded up but was not influenced byŽ . Ž . Ž . q ŽDTX open squares . C AgTX was tested as described above. D summarizes the effects of various channel blockers on K currents in prenatal open2

. Ž . ŽU .columns and postnatal TG neurons closed columns . Data were taken at the end of responses evoked at a test potential of q20 mV. marks significantdifferences, parentheses give the cell number, bars indicate S.D.

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6862

The PCR products were identified by agarose gel elec-w xtrophoresis 41 . The specificity of the amplified cDNAs

was confirmed by subsequent restriction analysis. There-fore, the second PCR was repeated, and the cDNAs were

Ž . Ž . Ž .digested with Tru9I Kv1.1 , KpnI Kv1.2 , CelII Kv1.3 ,Ž . Ž . Ž .EcoRV Kv1.4 , EcoRI Kv1.5 , ScaI Kv1.6 , BamHI

Ž . Ž .Kv2.1 and HaeII Kv2.2 using standard buffers andprotocols. Cel II does not only cut Kv1.3 but Kv1.1 aswell. Therefore, to ensure primer-specificity, the Kv1.3product was also exposed to Tru9I which fails to cleaveKv1.3 or any of the other fragments. No digestion wasobserved under these conditions. Enzymes were purchased

Ž .from Life Technologies KpnI, EcoRV, EcoRI, ScaI ,Ž . ŽBoehringer Tru9I and CelII , and Stratagene Heidelberg,

.Germany; BamHI and HaeII . For a negative control,reverse transcriptase was omitted or amplification wasperformed with cell-free bath solution. No PCR productswere obtained under either conditions.

3. Results

3.1. Functional analysis of outward currents in embryonicganglion neurons

Kq currents were separated in Naq-free bath solutionssupplemented with 0.5 mM TTX and 0.1 mM CdCl .2

Starting from a holding potential of y70 mV, depolarizingvoltage steps activated outward currents in the embryonicTG neurons while only minor inward currents were ob-served upon hyperpolarization. Outward currents reversed

Ž .at y64.6"2.2 mV ns6 , indicating that they wereq Ž .predominantly carried by K Fig. 1A . The current den-

sity was calculated by dividing amplitudes elicited at q40mV by the corresponding C . Data were taken at the endM

of the 200-ms voltage steps, yielding a mean value ofŽ .89.1"49.4 pArpF ns66 .

Ž . ŽFig. 6. 4-AP preferentially blocks transient outward currents and slows down onset kinetics. A The membrane was hyperpolarized to y110 mV 300. Ž . Ž . Ž . Ž .ms , stepped back to y70 mV 3 ms and then currents were evoked between y130 and q70 mV upper inset . A gives control currents, A currents1 2

Ž .remaining during bath application of 5 mM 4-AP, and A the 4-AP sensitive currents. Subtraction of the current families evoked after y40 mV3Ž . Ž .prepulses from those obtained after y110 mV prepulses in control solution A and in the presence of 4-AP A demonstrated that the additional4 5

Ž .outward component activated after pre-hyperpolarization was completely blocked by 4-AP. B Outward currents were evoked between y30 and q20 mVŽ .holding potential y70 mV and after capacitance subtraction, onset kinetics was estimated as described in the legend to Fig. 5B. Note a significant slow

Ž . Ž . Ž .down of current activation in the presence of 4-AP open squares as compared to the control filled circles . C Voltage dependence of 4-AP blockade inŽ . Ž . Ž .pre- left, ns8 and postnatal right, ns8 cells. The ordinate depicts relative current amplitudes blocked by 4-AP. Data were taken 15 ms triangles and

Ž .200 ms squares after the beginning of the responses.

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 63

Standard protocols were applied to separate Kq cur-rents with different stationary and kinetic properties. The

Žmajority of F14 cells ns58, i.e., 80% of all cells ana-.lyzed exclusively possessed sustained delayed rectifier

outward currents. These currents did not inactivate withinŽ .our time window of observation 200 ms . Neither hyper-

Ž . Ž .polarizing y110 mV nor depolarizing y40 mV pre-Ž .pulses duration up to 2 s changed test current amplitudes

Ž .Fig. 1B,C . To get the steady-state activation of thesustained Kq currents, the membrane was depolarized to

Ž .y40 mV for 300 ms, stepped back to y70 mV 3 ms ,Ž . Žand then a test pulse 200 ms was applied range y70 to

.70 mV . For each individual cell, test current amplitudeswere divided by the corresponding driving force and nor-malized to maximum conductance. Currents reached half-

Ž .maximum activation at V sy2.5"9.9 mV ns58 ,n,0.5Ž .Table 2; Fig. 1D . Steady-state inactivation was deter-

Žmined by applying prepulses range y130 to q20 mV,.duration 3 s and subsequently stepping the membrane to a

test pulse of q40 mV. Test currents were subtracted bythe non-inactivating current elicited after the q20 mVprepulse in the same cell, normalized to maximum ampli-

Žtude, and fitted by a Boltzmann equation smooth line in.Fig. 1D . The mean value of V was y29.8"10.5 mVg ,0.5

Ž . Ž .ns17 Table 3; Fig. 1D .In addition to the sustained component, the remaining

cells at F14 possessed Kq outward currents that inacti-vated during the 200-ms test pulses. The transient currentcould be isolated from total outward current by subtractingthe sustained current activated after a prepulse to y40 mV

Žfrom the current induced after a y110 mV prepulse Fig.. q2A . Steady-state activation of sustained and transient K

outward currents was calculated as described above. Thevoltage of half-maximum activation of the sustained cur-rents was more negative as compared with the transient

Ž .currents Fig. 2C while in both prenatal cell populations,Žthe inactivation curves did not differ significantly Tables

.2 and 3 .

3.2. DeÕelopmental shift of steady-state inactiÕation

Despite a significant increase in C , the current densityMŽ .at P14 69.6"35.6 pArpF; ns30 was not different

from that at F14. At P14, the number of neurons withtransient currents exceeded those solely expressing sus-

q Ž .tained K currents 36 vs. 19 cells, i.e., 65% . The mostprominent difference to the prenatal cells was a markedshift of the steady-state inactivation towards negative volt-

Ž .ages in the older cells Table 3; Fig. 3B, Fig. 4D .Accordingly, Kq current amplitudes in postnatal TG neu-rons will strongly depend on the respective resting poten-tial in the individual cells. Steady-state inactivation wasthe same in postnatal cells carrying or lacking a transient

Ž .component Table 3 .In contrast to the F14 stage, in postnatal cells with

q Ž .transient K currents Fig. 4A , steady-state activation of

the sustained currents was reached only at more positivemembrane potentials as compared with the corresponding

Ž .transient component Table 2; Fig. 4B . We noticed that incontrast to the F14 neurons, our protocol for currentseparation did not isolate a ‘clean’ fast transient. Obvi-ously, in the postnatal neurons, the difference currentswere contaminated by a slow inactivating delayed rectifier

Ž .component cf. Fig. 3A .

3.3. DeÕelopmental changes of sustained current phar-macology

To further characterize Kq currents of TG neurons, wetested several Kv channel blockers. The membrane was

Ž .stepped between y70 mV holding potential and q20Ž .mV duration 50 or 200 ms, 10 mV increments . DTX, a

peptide purified from mamba snake venom, is a potentblocker of slowly inactivating Shaker-related a-subunits

Fig. 7. Pharmacological properties and RT-PCR analysis of Kv channelsin individual prenatal TG neurons. Kq currents were activated in two

ŽF15 cells by depolarizing the membrane from y70 to q20 mV 10 mV. Ž .increments, duration 200 ms; A , B . External application of 4-AP A1 1 2

Ž .and TEA B ; 5 mM each blocked outward currents. Subtracting corre-2Žsponding current families isolated the blocker-sensitive component A ,3

.B . Subsequent to functional analysis, the cell content was harvested and3

Kv channel expression was analyzed on a transcript level in both cellsŽ .A , B . Lanes 1–6 were assigned to Kv1.1–Kv1.6 and lanes 7, 8 to4 4

Ž .Kv2.1, and Kv2.2. FX-174-RF DNA Hinc II digest FX was used as aŽ . Ž .length marker bp bands are indicated to the right . In cell A , gel

electrophoresis revealed cDNA products encoding Kv1.1–Kv1.3, Kv1.6,Ž .Kv2.1, and Kv2.2. The neuron shown in B contained Kv1.2, Kv1.3, and

Kv2.2.

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6864

w x7 . Comparing data at the end of the q20 mV test pulse,bath application of 50 nM DTX reduced the sustained

Ž . Ž .current to 79"13% F14 and 81"8% P14 of theŽ .control Fig. 5A,D . In contrast, the transient component

was much less affected by the toxin, and no difference inonset kinetics of the leak- and capacitance-subtracted cur-rents was observed in control vs. DTX-containing solu-

Ž .tions Fig. 5B . AgTX is a scorpion venom peptide that2

selectively inhibits Shaker-related Kv channels at very lowŽ . w xconcentrations -1 nM 12 . Adding 10 nM AgTX to2

q Žthe bath did not affect K currents in F14 neurons Fig..5C , but a reduction of sustained currents by 20% was

Ž .observed at P14 Fig. 5D . The tetraethylammonium chlo-Ž .ride TEA -sensitivity was not different at both develop-

mental stages while sustained current inhibition by 4-APŽ .was more complete in embryonic neurons Fig. 5D . In

contrast to the preferential affection of the sustained cur-Ž . Žrents by TEA, DTX and AgTX Figs. 5 and 7B , 4-AP 52

.mM also completely suppressed the transient componentŽ .Figs. 6 and 8C . Concomitantly, the blocker markedlyslowed down kinetics of current activation of the 4-AP

Ž .resistant component Fig. 6A,B . Despite a significant

reduction of sustained currents, steady-state inactivationŽwas not influenced by 4-AP F14: V sy32.0"12.2g ,0.5

mV, control and y35.6"21.7 mV, in 5 mM 4-AP, ns5;P14: V sy61.6"12.5 mV, control and y70.5"19.7g ,0.5

.mV in 5 mM 4-AP, ns4 .

3.4. Identification of K q channel mRNA expression inembryonic and postnatal TG neurons

After electrophysiological characterization, the expres-sion of Kv1.1–Kv1.6, Kv2.1 and Kv2.2 mRNAs wasexamined in the same cell. Prior to RT, the cell contentwas treated with RNase-free DNaseI to eliminate genomicDNA. To identify all the Kv1 and Kv2 transcripts thatcould theoretically be coexpressed in an individual cell,non-specific, degenerated primer pairs were used for thefirst amplification round. The second PCR was performedwith nested primers specifically recognizing each of thesubunits. The specificity of the amplified cDNAs wasconfirmed by subsequent restriction analysis.

Functional and molecular properties of the same indi-Ž .vidual cell were investigated at F14 ns22 and P14

Fig. 8. Correlation of 4-AP sensitivity and Kv subunit expression in individual postnatal neurons. Membrane currents were obtained as described in Fig. 7.Ž . Ž .In cell A , bath application of 4-AP produced a block of sustained currents by about 68% A ; Vsq20 mV while in the other two neurons, reduction of3

Ž . Ž . Žthe late component was less cf. B , C . Note that subsequent RT-PCR analysis identified Kv1.1 in cell A but not in the other two neurons cf. A with3 3 4. Ž .B , C . In the cell shown to the right, a transient component was isolated inset in C when applying the protocols described in Fig. 1B. The transient4 4 1

Ž . Ž .currents were almost completely blocked by 4-AP C , C . In this cell, mRNA analysis detected transcripts encoding Kv1.4 C .2 3 4

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 65

Ž . Ž .ns19 Figs. 7 and 8 . A majority of neurons expressedtranscripts encoding the subunits Kv1.1 and Kv 1.2. Kv1.3transcripts were also present in many embryonic and post-natal cells while Kv1.4, which gives rise to transient Kq

Ž .currents, only appeared after birth ns4 . In contrast, theportion of Kv1.1 containing cells markedly decreased dur-

Ž .ing development Fig. 9A . At F14, the combinationsŽ .Kv1.1rKv1.2 59% of all cells analyzed dominated the

expression pattern; most of these cells in addition con-tained Kv1.3. Transcripts encoding the heart-specific Kv1.5

Ž .subunit were rarely found P14, ns2 .Transcripts of the two Shab-related subunits, Kv2.1 and

Kv2.2, were discerned in most cells. Kv1 and Kv2 sub-units do not co-assemble with each other. Since most ofthe cells expressed transcripts of either Kv family, Shaker-and Shab-related Kv channels probably co-exist to mediateoutward currents in TG neurons. Kv2.1 and Kv2.2 tran-scripts overlapped in many prenatal cells while a segre-gated expression of Kv2 transcripts was typical of almostall the P14 neurons.

Our approach did not reveal a simple correlation be-Ž .tween expression of distinct transcript s and specific func-

tional properties of the individual cells. As an example,despite the significant developmental shift in the half-max-imum of steady-state inactivation, P14 cells carrying orlacking Kv1.4 did not possess a different V . However,g ,0.5

comparing their pharmacological properties, we noticedthat sustained currents of cells provided with Kv1.1 were

Fig. 9. Transcript expression and 4-AP sensitivity of Kq currents in TGŽ .neurons. A Relative frequency of Kv1 mRNAs expressed in 22 prenatal

Ž . Ž . Žopen bars and 19 postnatal cells closed bars . Most of the cells 17 and.11 cells, respectively were simultaneously examined for Kv2. Note that

significantly fewer Kv1.1 transcripts were detected in postnatal cells,Ž .while Kv1.4 and Kv1.5 were more frequent. B Sustained currents

ŽU .activated in cells carrying Kv1.1 transcript were significantly moresensitive to 4-AP as compared with cells lacking Kv1.1. Current ampli-tudes were compared at the end of 200-ms test pulses to V sq20 mV.Values in parentheses give the cell number.

significantly more sensitive to 4-AP than those of neuronsŽ .lacking Kv1.1 compare Fig. 7A, Fig. 8A with Fig. 8B,C .

ŽIn Kv1.1-containing cells, bath application of 4-AP 5.mM reduced the late component of the outward currents

Ž .to 33.7"14.2% Vs20 mV; ns11 , whereas a block toŽ .68.8"11.5% ns7 was observed in TG neurons with-

Ž .out Kv1.1 Fig. 9B . Accordingly, sustained currents inP14 cells with less frequent expression of Kv1.1, displayeda lower 4-AP sensitivity than those of embryonic TG

Ž .neurons Fig. 5D .

4. Discussion

We compared properties of voltage-gated Kq currentsin TG neurons of embryonic and juvenile rats. To searchfor molecular correlates mediating the developmentalchanges in current properties, subsequent to functionalanalysis, single-cell RT-PCR was performed. The mostobvious pharmacological change was a significant loss in4-AP sensitivity of sustained Kq currents in the postnatalcells. Comparison of the expression pattern of Shaker- andShab-related Kv transcripts revealed a concomitant down-regulation of Kv1.1, suggesting a correlation of functionaland molecular properties of Kv channels in developing TGneurons.

4.1. Functional properties of K q channels in TG neurons

The majority of F14 cells expressed delayed rectifierKq currents that did not inactivate during the 200-mspulses. The half-maximal voltage of inactivation was in therange of that described for delayed rectifier type Shaker-

w xand Shab- related a-subunits 43,49,55 . Steady-state acti-vation of the TG neurons resembled properties of the

w xsubunits Kv1.5 and Kv2.1 51,55 , whereas activation ofhomomeric Kv1.1, Kv1.2, and Kv1.3 occurred at more

w xnegative voltages 13,49 . A few of the prenatal cells wereendowed with transient outward currents with an activationshifted to positive voltages. A similar shift as well asacceleration of inactivation was reported for coexpressionof a-subunits with regulatory subunits, e.g., Kv1.5 with

w x w xKvb1 39 or Kv2.1 with Kv2.3r 4 . However, steady-stateactivation can also be influenced by the expression systemw x43 which makes it difficult to deduce subunit expressionin native cells from a comparison of their activation pa-rameters with those of cloned channels.

At P14, half-maximal current inactivation was signifi-cantly more negative as compared to the embryonic cells.Such a strong negative shift could be indicative of increas-

Žing coexpression of regulatory a-subunits e.g., Kv5.1,. w xKv6.1 and Kv8.1 with Kv2 a-subunits 37,38 . These

subunits have an overlapping expression pattern with func-w xtional a-subunits, e.g., Kv1.1, Kv1.6, and Kv2.1 8,18,56 .

The coexpression of Kv5.1, Kv6.1, Kv8.1, and Kv9 exhib-w xited only minor effects on V 37,38 . Many postnataln,0.5

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6866

neurons possessed both transient and sustained Kq cur-rents. In contrast to F14 cells, these transient currentsactivated at significantly more negative membrane poten-tials than the corresponding stationary component. Besides

w xmodulation through coexpression of auxiliary subunits 17 ,transient outward currents can be generated by heteromeric

w xchannels comprising Kv1.4 36 . Thus, since Kv1.4 tran-scripts were found more frequently at the postnatal stage,insertion of this subunit into Kv channels could accountfor the appearance of the transient component. The exam-ple shown in Fig. 6C seems to support such an assumption.This cell possessed transient as well as sustained currentsand subsequent RT-PCR detected transcripts encodingKv1.4, Kv1.2, and Kv1.5.

4.2. Pharmacological properties

Cloned potassium channels of the Shaker and Shabfamilies can be distinguished according to their distinct

w xsensitivity to TEA, DTX, or AgTX 11–14,19,49,51 . In2

the TG, current inhibition by TEA and DTX in embryoniccells was not different from postnatal cells. AgTX , even2

at a concentration as high as 10 nM, reduced the sustainedcurrents in postnatal cells only to about 80% while prena-tal currents were not affected at all. This was surprisingsince single-cell RT-PCR detected transcripts of Kv1.1 and

Ž .Kv 1.3 in many prenatal cells Fig. 9A . The weak effectof Kv1 specific peptide blockers in our native preparationcould have several reasons. First, the efficacy of peptideblockers probably depends on the expression system. Asan example, the IC of AgTX on Kv1.1 channels stably50 2

expressed in HEK 293 cells was more than 100 timeshigher as compared to the data obtained in Xenopus

Žoocytes K. Matthias and C. Steinhauser, unpublished ob-¨.servations . Second, the effectiveness of these blockers on

heteromultimeric Kv1 channels including those comprisingregulatory subunits is not yet known. Finally, we do notknow the relative portion of Kv1 and Kv2 subunits in agiven cell and unfortunately, the selective Shab toxin,

w xhanatoxin 52 , was not available to us. No correlation wasfound between TEA sensitivity and presence of Kv1.1although expression studies would suggest a higher sensi-

w xtivity in cells carrying this subunit 13,49 . Only 4-APstrongly distinguished between embryonic and postnatalcells. Although high 4-AP sensitivity is a property com-mon to all Shaker- and Shab-related subunits and thusdoes not allow to infer the molecular structure of thechannels, a comparison of current inhibition by 4-AP withtranscript expression in the individual TG neurons revealeda significantly stronger block of 4-AP in cells containingKv1.1. It would be interesting to study effects of 4-AP onchannels comprising b-subunits because the latter alsobind to a-subunits intracellularly which could compromise4-AP blockade.

We did not detect the TEA-sensitive transient outwardcurrents, termed ‘T-current’ in a previous report conducted

w x Žon postnatal TG neurons 45 . Varying species guinea pig. Ž .vs. rat or ages adult vs. juvenile might account for these

differences. Nevertheless, our results confirmed the latterstudy with regard to the high 4-AP sensitivity of sustainedKq currents in the postnatal neurons.

4.3. Transcript expression and temporal Õariation of K q

channel functioning in TG neurons

Our analysis only provided information on the transcriptlevel but not on the assembly of channel proteins. Inaddition, we have to consider that subunits other than thoseinvestigated here influenced functional properties of thecells under study. Although a high number of subunitcombinations is theoretically possible within the Shakerfamily, immunoprecipitation and Western blotting have

w xshown that only a subset seems to be realized 42 . Similarw xto these and other data 2,40 , we found preferential ex-

pression of Kv1.2 at both stages of development whichseems to be necessary for the formation of functional Kq

w xchannels and co-assembly of b-subunits 34,35 . In closew xagreement with the results of Shamotienko et al. 42 ,

coexpression of Kv1.1 with Kv1.2, and Kv1.3 with Kv1.2was abundantly observed.

Almost all TG neurons were endowed with Shab-likechannels, the distribution of which was clearly different inpre- vs. postnatal cells. While 40% of the F14 cellscoexpressed both Kv2 subunits, all but one of the postnatalcells contained either Kv2.1 or Kv2.2. Such a segregatedlocalization of Kv2 subunits has also been demonstrated

w xwith immunolabeling and in situ hybridization 19–21 .Members of the Kv2 family, which can form heteromulti-

w xmers despite their distinct expression 3 , were abundantlyw xfound at early and late stages of brain development 54 .

They were shown to be a target of many auxiliary subunitsw x4,10,37,38 and thus might serve as gatekeepers to enablefine tuning of channel functioning.

The presence of multiple Kv transcripts in the TGneurons suggested a heteromeric subunit arrangement andhence it was difficult to find a correlation between func-tional properties and expression of distinct transcripts. Arecent single-cell RT-PCR study also demonstrated thatchanges in Kv transcript expression during developmentmust not necessarily infer distinct current properties. Incultured embryonic Xenopus spinal neurons, no correla-tion was found between the presence of Kv1.1 and current

w xproperties 15 .Ontogenetic changes in Kq current expression were

w xdescribed in many neuronal 28,46,47 and glial cellsw x24,44 , and the latter were shown to modulate the appear-

q w xance of K currents in neurons 27,58 . Evidence is accu-mulating hinting for a role of Kv channels in regulation of

w xproliferation 6,23,29–31 . Recently, Kv1.1 was shown tobe temporally regulated and it was suggested that early indevelopment, this subunit influences cellular processes like

w xcell–cell adhesion, migration, and proliferation 16 . This

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–68 67

idea would be in line with our findings demonstrating alower portion of Kv1.1 mRNA containing neurons in thepostnatal TG.

Acknowledgements

We gratefully acknowledge the excellent technical as-sistance of I. Krahner. Drs. B. de Nechaud and A. Wolffkindly provided peripherin antibodies. We thank Dr. S.Reinhardt for advice on preparation of embryonic tissue.This research was supported by Deutsche Forschungsge-

Ž .meinschaft Ste 552r2-1, SFB 400 , Bundesministeriumfur Forschung und Technologie, and Fonds der Chemis-¨

Ž .chen Industrie grants to C.S. .

References

w x1 A. Baumann, A. Grupe, A. Ackermann, O. Pongs, Structure of thevoltage-dependent potassium channel is highly conserved from

Ž .drosophila to vertebrate central nervous system, EMBO J. 7 19882457–2463.

w x2 S. Beckh, O. Pongs, Members of the RCK potassium channel familyare differentially expressed in the rat nervous system, EMBO J. 9Ž .1990 777–782.

w x3 J.T. Blaine, A.B. Ribera, Heteromultimeric potassium channelsŽ .formed by members of the Kv2 subfamily, J. Neurosci. 18 1998

9585–9593.w x4 A. Castellano, M.D. Chiara, B. Mellstrom, A. Molina, F. Monje,¨

J.R. Naranjo, J. Lopez-Barneo, Identification and functional charac-´terization of a Kq channel a-subunit with regulatory properties

Ž .specific to brain, J. Neurosci. 17 1997 4652–4661.w x5 P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by

acid guanidinium thiocyanate–phenol–chloroform extraction, Anal.Ž .Biochem. 162 1987 156–159.

w x6 T.E. DeCoursey, K.G. Chandy, S. Gupta, M.D. Calahan, Voltage-gated Kq channels in human T lymphocytes: a role in mitogenesis?,

Ž .Nature 311 1984 156–157.w x7 J.O. Dolly, J. Rettig, V.E.S. Scott, D.N. Parcej, R. Wittkat, S.

Sewing, O. Pongs, Oligomeric and subunit structures of neuronalq Ž .voltage-sensitive K channels, Biochem. Soc. Trans. 22 1994

473–478.w x8 J.A. Drewe, S. Verma, G. Frech, R.H. Joho, Distinct spatial and

temporal expression patterns of Kq channel mRNAs from differentŽ .subfamilies, J. Neurosci. 12 1992 538–548.

w x9 M. Escurat, K. Djabali, M. Gumpel, F. Gros, M.-M. Portier, Differ-ential expression of two neuronal intermediate-filament proteins,

Ž .peripherin and the low-molecular-mass neurofilament protein nf-l ,Ž .during the development of the rat, J. Neurosci. 10 1990 764–784.

w x10 M. Fink, F. Duprat, F. Lesage, C. Heurteaux, G. Romey, J. Barhanin,M. Lazdunski, A new Kq channel b subunit to specifically enhance

Ž . Ž .Kv2.2 CDRK expression, J. Biol. Chem. 271 1996 26341–26348.w x11 G.C. Frech, M.J. VanDongen, G. Schuster, A.M. Brown, R.H. Joho,

A novel potassium channel with delayed rectifier properties isolatedŽ .from rat brain by expression cloning, Nature 340 1989 642–645.

w x12 M.L. Garcia, M. Garcia-Calvo, P. Hidalgo, A. Lee, R. MacKinnon,Purification and characterization of three inhibitors of voltage-de-pendent Kq channels from Leiurus quinquestriatus var. hebraeus

Ž .venom, Biochemistry 33 1994 6834–6839.w x13 S. Grissmer, A.N. Nguyen, J. Aiyar, D.C. Hanson, R.J. Mather,

G.A. Gutman, M.J. Karmilowicz, D.D. Aupergin, G. Chandy, Phar-

macological characterization of five cloned voltage-gated Kq chan-nels, types Kv1.1,1.2,1.3,1.5, and 3.1, stably expressed in mam-

Ž .malian cell lines, Mol. Pharmacol. 45 1994 1227–1234.w x14 A. Grupe, K.H. Schroter, J.P. Ruppersberg, M. Stocker, T. Drewes,¨

S. Beckh, O. Pongs, Cloning and expression of a human voltage-gated potassium channel. A novel member of the RCK potassium

Ž .channel family, EMBO J. 9 1990 1749–1756.w x15 D. Gurantz, A.B. Ribera, N.C. Spitzer, Temporal regulation of

Shaker- and Shab-like potassium channel gene expression in singleembryonic spinal neurons during Kq current development, J. Neu-

Ž .rosci. 16 1996 3287–3295.w x16 J.L. Hallows, B.L. Tempel, Expression of Kv1.1, a Shaker-like

channel, is temporally regulated in embryonic neurons and glia, J.Ž .Neurosci. 18 1998 5682–5691.

w x17 S.H. Heinemann, J. Rettig, H.R. Graack, O. Pongs, Functionalcharacterization of K channel b-subunits from rat brain, J. Physiol.v

Ž .493 1996 625–633.w x18 J.-P. Hugnot, M. Salinas, F. Lesage, E. Guillemare, J. De Weille, C.

Heurteaux, M.-G. Mattei, M. Lazdunski, Kv8.1, a new neuronalpotassium channel subunit with specific inhibitory properties to-

Ž .wards Shab and Shaw channels, EMBO J. 15 1996 3322–3331.w x19 P.M. Hwang, C.E. Glatt, D.S. Bredt, G. Yellen, S.H. Snyder, A

novel Kq channel with unique localizations in mammalian brain:Ž .molecular cloning and characterization, Neuron 8 1992 473–481.

w x20 P.M. Hwang, A.M. Cunningham, Y.W. Peng, S.H. Snyder, CDRKand DRK1 Kq channels have contrasting localizations in sensory

Ž .systems, Neuroscience 55 1993 613–620.w x21 P.M. Hwang, M. Fotuhi, D.S. Bredt, A.M. Cunningham, S.H.

Snyder, Contrasting immunohistochemical localizations in rat brainof two novel Kq channels of the Shab subfamily, J. Neurosci. 13Ž .1993 1569–1576.

w x22 L.Y. Jan, Y.N. Jan, Cloned potassium channels from eukaryotes andŽ .prokaryotes, Annu. Rev. Neurosci. 20 1997 91–123.

w x q23 P. Knutson, C.A. Ghiani, J.M. Zhou, V. Gallo, C.J. McBain, Kchannel expression and cell proliferation are regulated by intra-cellular sodium and membrane depolarization in oligodendrocyte

Ž .progenitor cells, J. Neurosci. 17 1997 2669–2682.w x24 K. Kressin, E. Kuprijanova, R. Jabs, G. Seifert, C. Steinhauser,¨

Developmental regulation of Naq and Kq conductances in glialŽ .cells of mouse hippocampal brain slices, Glia 15 1995 173–187.

w x25 B. Lambolez, E. Audinat, P. Bochet, F. Crepel, J. Rossier, AMPA´receptor subunits expressed by single Purkinje cells, Neuron 9Ž .1992 247–258.

w x Ž .26 A.R. Lieberman, Sensory ganglia, The Peripheral Nerve 4 1976188–278.

w x27 S. McFarlane, E. Cooper, Extrinsic factors influence the expressionof voltage-gated Kq currents on neonatal rat sympathetic neurons, J.

Ž .Neurosci. 13 1993 2591–2600.w x28 J.M. Mienville, J.L. Barker, Potassium current expression during

Ž .prenatal corticogenesis in the rat, Neuroscience 81 1997 163–172.w x q29 B. Nilius, G. Droogmans, A role for K channels in cell prolifera-

Ž .tion, NIPS 9 1994 105–110.w x30 C.A. Pappas, N. Ullrich, H. Sontheimer, Reduction of glial prolifera-

tion by Kq channel blockers is mediated by changes in pH ,iŽ .NeuroReport 6 1994 193–196.

w x31 C.A. Pappas, J.M. Ritchie, Effect of specific ion channel blockers onŽ .cultured Schwann cell proliferation, Glia 22 1998 113–120.

w x32 O. Pongs, Molecular biology of voltage-dependent potassium chan-Ž .nels, Physiol. Rev. 72 1992 S69–S88.

w x33 E. Puil, R.M. Miura, I. Spigelman, Consequences of 4-aminopyri-dine applications to trigeminal root ganglion neurons, J. Neurophys-

Ž .iol. 62 1989 810–820.w x34 K.J. Rhodes, S.A. Keilbaugh, N.X. Barrezueta, K.L. Lopez, J.S.

Trimmer, Association and colocalization of Kq channel a- and b-Ž .subunit polypeptides in rat brain, J. Neurosci. 15 1995 5360–5371.

w x35 K.J. Rhodes, B.W. Strassle, M.M. Monaghan, Z. Bekele-Arcuri,M.F. Matos, J.S. Trimmer, Association and colocalization of the

( )G. Seifert et al.rMolecular Brain Research 74 1999 55–6868

Kvb1 and Kvb2 b-subunits with Kv1 a-subunits in mammalianq Ž .brain K channel complexes, J. Neurosci. 17 1997 8246–8258.

w x36 J.P. Ruppersberg, K.H. Schroter, B. Sakmann, M. Stocker, S. Sewing,¨O. Pongs, Heteromultimeric channels formed by rat brain

Ž .potassium-channel proteins, Nature 345 1990 535–537.w x37 M. Salinas, J. De Weille, E. Guillemare, M. Lazdunski, J.P. Hugnot,

Modes of regulation of Shab Kq channel activity by the Kv8.1Ž .subunit, J. Biol. Chem. 272 1997 8774–8780.

w x38 M. Salinas, F. Duprat, C. Heurteaux, J.P. Hugnot, M. Lazdunski,New modulatory a subunits for mammalian Shab Kq channels, J.

Ž .Biol. Chem. 272 1997 24371–24379.w x39 Y. Sasaki, K. Ishii, K. Nunoki, T. Yamagishi, N. Taira, The

q Ž .voltage-dependent K channel Kv1.5 cloned from rabbit heart andfacilitation of inactivation of the delayed rectifier current by the rat

Ž .b subunit, FEBS Lett. 372 1995 20–24.w x40 V.E.S. Scott, Z.M. Muniz, S. Sewing, R. Lichtinghagen, D.N.

Parcej, O. Pongs, J.O. Dolly, Antibodies specific for distinct Kvsubunits unveil a heterooligomeric basis for subtypes of a-dendro-

q Ž .toxin-sensitive K channels in bovine brain, Biochemistry 33 19941617–1623.

w x41 G. Seifert, L. Rehn, M. Weber, C. Steinhauser, AMPA receptor¨subunits expressed by single astrocytes in the juvenile mouse hip-

Ž .pocampus, Mol. Brain Res. 47 1997 286–294.w x42 O.G. Shamotienko, D.N. Parcej, J.O. Dolly, Subunit combinations

defined for Kq channel Kv1 subtypes in synaptic membranes fromŽ .bovine brain, Biochemistry 36 1997 8195–8201.

w x43 G. Shi, A.K. Kleinklaus, N.V. Marrion, J.S. Trimmer, Properties ofKv2.1 Kq channels expressed in transfected mammalian cells, J.

Ž .Biol. Chem. 269 1994 23204–23211.w x44 H. Sontheimer, J. Trotter, M. Schachner, H. Kettenmann, Channel

expression correlates with differentiation stage during the develop-ment of oligodendrocytes from their precursor cells in culture,

Ž .Neuron 2 1989 1135–1145.w x q45 I. Spigelman, E. Puil, K -channel blockade in trigeminal root

ganglion neurons: effects on membrane outward currents, J. Neuro-Ž .physiol. 62 1989 802–809.

w x46 I. Spigelman, L. Zhang, P.L. Carlen, Patch-clamp study of postnataldevelopment of CA1 neurons in rat hippocampal slices: membrane

q Ž .excitability and K currents, J. Neurophysiol. 68 1992 55–69.w x47 N.C. Spitzer, A developmental handshake: neuronal control of ionic

currents and their control of neuronal differentiation, NeurobiologyŽ .22 1991 659–673.

w x48 D.Y.R. Stainier, W. Gilbert, Neuronal differentiation and maturationin the mouse trigeminal sensory system, in vivo and in vitro, J.

Ž .Comp. Neurol. 311 1991 300–312.w x49 W. Stuhmer, J.P. Ruppersberg, K.H. Schroter, B. Sakmann, M.¨ ¨

Stocker, K.P. Giese, A. Perschke, A. Baumann, O. Pongs, Molecularbasis of functional diversity of voltage-gated potassium channels in

Ž .mammalian brain, EMBO J. 8 1989 3235–3244.w x50 T. Sugimoto, M. Takemura, A. Sakai, M. Ishimaru, Cell size

analysis of trigeminal primary afferent neurons comprising individ-ual peripheral branches of the rat mandibular nerve, Exp. Neurol. 93Ž .1986 565–573.

w x51 R. Swanson, J. Marshall, J.S. Smith, J.B. Williams, M.B. Boyle, K.Folander, C.J. Luneau, J. Antanavage, C. Oliva, S.A. Buhrow, C.Bennett, R.B. Stein, L.K. Kaczmarek, Cloning and expression ofcDNA and genomic clones encoding three delayed rectifier potas-

Ž .sium channels in rat brain, Neuron 4 1990 929–939.w x52 K.J. Swartz, R. MacKinnon, An inhibitor of the Kv2.1 potassium

channel isolated from the venom of a Chilean tarantula, Neuron 15Ž .1995 941–949.

w x53 M.A. Thompson, E.B. Ziff, Structure of the gene encoding periph-erin, an NGF-regulated neuronal-specific type III intermediate fila-

Ž .ment protein, Neuron 2 1989 1043–1053.w x q54 J.S. Trimmer, Expression of Kv2.1 delayed rectifier K channel

Ž .isoforms in the developing rat brain, FEBS Lett. 324 1993 205–210.w x55 A.M.J. VanDongen, G.C. Frech, J.A. Drewe, R.H. Joho, A.M.

Brown, Alteration and restoration of Kq channel function by dele-Ž .tions at the N- and C-termini, Neuron 5 1990 433–443.

w x56 S. Verma-Kurvari, B. Border, R.H. Joho, Regional and cellularexpression patterns of four Kq channel mRNAs in the adult rat

Ž .brain, Mol. Brain Res. 46 1997 54–62.w x57 F.A. White, N.L. Chiaia, G.J. MacDonald, R.W. Rhoades, Birth

dates and survival after axotomy of neurochemically defined subsetsŽ .of trigeminal ganglion cells, J. Comp. Neurol. 352 1995 308–320.

w x58 R.-L. Wu, M.E. Barish, Astroglial modulation of transient potassiumcurrent development in cultured mouse hippocampal neurons, J.

Ž .Neurosci. 14 1994 1677–1687.w x Ž .59 M. Yamamoto, H. Kondo, Calcitonin gene-related peptide CGRP -

immunoreactive nerve varicosities in synaptic contact with sensoryneurons in the trigeminal ganglion of rats, Neurosci. Lett. 104Ž .1989 253–257.