Development of New PCR Primers by Comparative Genomics for the Detection of Helicobacter suis in...

Development of New PCR Primers by Comparative Genomics forthe Detection of Helicobacter suis in Gastric Biopsy SpecimensHidenori Matsui,*,1 Tetsufumi Takahashi,†,1 Somay Y. Murayama,‡,1 Ikuo Uchiyama,§,1 KatsushiYamaguchi,¶,1 Shuji Shigenobu,¶,1 Takehisa Matsumoto,** Masatomo Kawakubo,** Kazuki Horiuchi,**Hiroyoshi Ota,** Takako Osaki,†† Shigeru Kamiya,†† Annemieke Smet,‡‡ Bram Flahou,‡‡ RichardDucatelle,‡‡ Freddy Haesebrouck,‡‡ Shinichi Takahashi,§§ Shinichi Nakamura¶¶ and Masahiko Nakamura†

*Kitasato Institute for Life Sciences and Graduate School of Control Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku Tokyo 108-8641,

Japan, †School of Pharmaceutical Sciences, Kitasato University, 5-9-1 Shirokane, Minato-ku Tokyo 108-8641, Japan, ‡School of Pharmacy, Nihon

University, 7-7-1 Narashinodai, Funabashi-shi Chiba 274-8555, Japan, §Data Integration and Analysis Facility, National Institute for Basic Biology

(NIBB), Nishigonaka 38, Myodaiji Okazaki Aichi 444-8585, Japan, ¶Functional Genomic Facility, National Institute for Basic Biology (NIBB),

Nishigonaka 38, Myodaiji Okazaki Aichi 444-8585, Japan, **School of Health Sciences, Shinshu University School of Medicine, 3-1-1 Asahi,

Matsumoto-shi Nagano 390-8621, Japan, ††Department of Infectious Diseases, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi

Tokyo 181-8611, Japan, ‡‡Department of Pathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University, Merelbeke

Belgium, §§Third Department of Internal Medicine, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi Tokyo 181-8611, Japan,¶¶Institute of Gastroenterology, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku Tokyo 162-8666, Japan

Keywords

Helicobacter suis, next-generation

sequencing, comparative genomics, gastric

biopsy specimen, mouse infection model,

PCR diagnosis.

Reprint requests to: Hidenori Matsui, Kitasato

Institute for Life Sciences and Graduate School

of Control Sciences, Kitasato University, 5-9-1

Shirokane, Minato-ku, Tokyo 108-8641, Japan.

E-mail: [email protected]

1These authors contributed equally to this work.

Abstract

Background: Although the infection rate of Helicobacter suis is significantly

lower than that of Helicobacter pylori, the H. suis infection is associated with

a high rate of gastric mucosa-associated lymphoid tissue (MALT) lym-

phoma. In addition, in vitro cultivation of H. suis remains difficult, and

some H. suis-infected patients show negative results on the urea breath test

(UBT).

Materials and Methods: Female C57BL/6J mice were orally inoculated with

mouse gastric mucosal homogenates containing H. suis strains TKY or

SNTW101 isolated from a cynomolgus monkey or a patient suffering from

nodular gastritis, respectively. The high-purity chromosomal DNA samples of

H. suis strains TKY and SNTW101 were prepared from the infected mouse

gastric mucosa. The SOLiD sequencing of two H. suis genomes enabled com-

parative genomics of 20 Helicobacter and 11 Campylobacter strains for the iden-

tification of the H. suis-specific nucleotide sequences.

Results: Oral inoculation with mouse gastric mucosal homogenates contain-

ing H. suis strains TKY and SNTW101 induced gastric MALT lymphoma and

the formation of gastric lymphoid follicles, respectively, in C57BL/6J mice.

Two conserved nucleotide sequences among six H. suis strains were identi-

fied and were used to design diagnostic PCR primers for the detection of

H. suis.

Conclusions: There was a strong association between the H. suis infection

and gastric diseases in the C57BL/6 mouse model. PCR diagnosis using an

H. suis-specific primer pair is a valuable method for detecting H. suis in gas-

tric biopsy specimens.

Helicobacter pylori infection is involved in the pathogen-

esis of several gastric diseases in humans, such as gas-

tric and peptic ulceration, gastric mucosa-associated

lymphoid tissue (MALT) lymphoma, and stomach can-

cer [1]. It is presumed that the gastric H. pylori infection

is acquired primarily in infancy, as H. pylori is strictly

transmitted from human to human. In contrast, the

infection with Helicobacter heilmannii types 1 and 2 and

its phylogenetically related Helicobacter species (H. heil-

mannii-like organisms, HHLOs; non-H. pylori Helicobacter

species, NHPHS) is strongly associated with contact at

any age with wild, domestic, or companion animals, as

these bacteria have a large number of known mamma-

lian host species [2–4]. Helicobacter heilmannii type 1

© 2014 John Wiley & Sons Ltd, Helicobacter 19: 260–271260

Helicobacter ISSN 1523-5378

doi: 10.1111/hel.12127

represents a single Helicobacter species, namely H. suis,

whereas H. heilmannii type 2 represents a group of spe-

cies, including H. felis, H. bizzozeronii, H. salmonis, and

H. heilmannii [4,5]. Accordingly, to avoid confusion in

the nomenclature, the terms H. heilmannii sensu lato

(H. heilmannii s.l.) and H. heilmannii sensu stricto

(H. heilmannii s.s.) were proposed to refer to the HHLOs

(NHPHS) and H. heilmannii, respectively [6]. Therefore,

H. heilmannii s.l. currently includes a total of at least

seven species, that is, H. felis, H. bizzozeronii, H. salmonis,

H. cynogastricus, Helicobacter baculiformis, H. suis, and

H. heilmannii s.s. Among H. heilmannii s.l. species, only

H. bizzozeronii has been successfully cultivated from

human gastric biopsy specimens so far [4].

Epidemiological studies have revealed that although

the infection rate of H. heilmannii s.l. (0.1–6%) [7–14]is significantly lower than that of H. pylori (about 50%

lower), the infection rate of H. heilmannii s.l. seems to

mostly depend on the geographical, national, or socio-

economic status of the patients in addition to the detec-

tion technology [7,9,13,15–22]. Even so, the infection

with H. heilmannii s.l. induces a high prevalence of gas-

tric MALT lymphoma [12,23]. Meanwhile, co-infection

with H. pylori and H. heilmannii s.l. seems to be present

in the gastric mucosa of a large percentage of patients

[20,24].

It is noteworthy that an oral inoculation with gastric

mucosal homogenates containing H. suis TKY (isolated

from a cynomolgus monkey) induced gastric B-cell

MALT lymphoma with nearly 100% probability in the

C57BL/6J mouse model [25–27]. Further histochemical

studies of this gastric MALT lymphoma revealed that an

enhanced immunoreactivity of vascular endothelial

growth factor-A (VEGF-A) and VEGF-C was observed

in areas encircled by increased parietal cell apoptosis,

indicating the pathophysiological relevance of both

angiogenesis and apoptosis in the gastric MALT lym-

phoma formation [28]. It has been a subject of great

interest whether H. suis isolated from the gastric biopsy

specimen of a patient with nodular gastritis is capable

of inducing gastric injuries in a mouse model, although

this question remains unanswered. The results obtained

from the present experiments may therefore lead to a

better understanding of the relationship between H. suis

infection and gastric diseases.

The problem in investigating this issue has been that

the rapid diagnosis of H. suis infections in patients is a

difficult task, because most Japanese patients infected

with H. suis have shown negative results on the urea

breath test (UBT) [9]. In this study, we aimed to create

a new PCR assay system based on a whole-genome

analysis for the specific detection of H. suis in gastric

biopsy specimens.

Methods

Bacteria

Helicobacter suis strains TKY (EMBL/GenBank/DDBJ

database accession nos. AB252066 (16S rRNA gene)

and AB252065 (ureA and ureB)) and SNTW101

(EMBL/GenBank/DDBJ database accession no.

AB498800 (16S rRNA gene)) isolated from a cynomol-

gus monkey [26] and a 33-year-old Japanese woman

suffering from nodular gastritis (UBT-negative), respec-

tively, were used for the whole-genome sequencing.

H. suis strains SH8 and SH10 isolated from Japanese

men suffering from gastric MALT lymphoma and

chronic gastritis, respectively, were used as the refer-

ence strains of human origin [9]. These four H. suis

strains were individually maintained in the stomachs

of female C57BL/6J mice, because they have not yet

been successfully grown in vitro. The repeated inocula-

tions with gastric mucosal homogenates from infected

mice to uninfected mice have been performed at the

intervals of 3–6 months. H. felis strain ATCC 49179;

Helicobacter mustelae strain NCTC 12032; and H. pylori

strains Sydney 1 (SS1), TN2GF4, NCTC 11637, ATCC

43579, and RC-1 were grown in Brucella broth (Oxoid

Ltd., Hampshire, UK) supplemented with 7% (vol/vol)

heat-inactivated fetal calf serum (FCS) under the con-

ditions of humidified 5% O2, 10% CO2, and 85% N2

at 37 °C [29–32]. Helicobacter suis strain HS5, H. heil-

mannii s.s. strain ASB1.4, H. baculiformis strain M50,

H. bizzozeronii stain R1051, H. cynogastricus strain JKM4,

and Helicobacter salomonis strain R1053 were individu-

ally grown under each culture condition that was pre-

viously described [5,33–37].

Helicobacter suis SNTW101 Infection in Mice

Five-week-old female C57BL/6J mice were inoculated

with gastric mucosal homogenates from mice originally

infected with gastric biopsy specimens containing

H. heilmannii s.s. SNTW101. At 20 months post-inocula-

tion, the mice were sacrificed and examined histologi-

cally. A portion of each tissue sample was fixed with

4% (wt/vol) paraformaldehyde in 0.1 mol/L sodium

phosphate buffer (pH 7.2) and embedded in paraffin.

Tissue sections approximately 5 lm thick were prepared

and mounted on glass slides. The slides were stained

with hematoxylin–eosin (H&E) and scanned with a

microscope (Axiovert 135; Carl Zeiss, Oberkochen, Ger-

many). All mice were bred in the animal facility at the

Kitasato Institute, and all mouse experiments were per-

formed in accordance with institutional ethical guide-

lines under an approved study protocol.

© 2014 John Wiley & Sons Ltd, Helicobacter 19: 260–271 261

Matsui et al. PCR Detection of H. suis

Preparation of Helicobacter suis ChromosomalDNA for Whole-Genome Sequencing

The gastric mucosa of mice inoculated with mouse gas-

tric mucosal homogenates containing H. suis TKY or

SNTW101 was scraped off using a glass slide and

homogenized with ice-cold phosphate-buffered saline

(PBS; pH 7.4) containing 0.05% (vol/vol) Tween 20

using two glass slides. The mucosal homogenates were

then filtered through a cell strainer (40-lm nylon; BD

Falcon, Franklin Lakes, NJ, USA) to remove any

clumps. To avoid nonspecific adsorption, the filtrates

were treated with magnetic beads coated with nonim-

mune rabbit IgG (Sepa-Max Rabbit IgG; Wako, Osaka,

Japan). The nonadsorbed suspensions were then treated

with magnetic beads coated with rabbit anti-H. pylori

antibody (Sepa-Max Hp; Wako) for the separation of

Helicobacter bacilli. The obtained bacterial cells were sus-

pended with distilled water and lysed by heating for

5 minutes at 95 °C. Finally, the chromosomal DNA was

purified by RNase A digestion (final concentration of

10 lg/mL, for 1 hour at 37 °C), followed by phenol/

chloroform extraction and ethanol precipitation. The

determination of DNA purity was performed by quanti-

tative real-time PCR [26,38] with a CFX96 real-time

PCR detection system (Bio-Rad, Hercules, CA, USA)

using iQ SYBR green supermix (Bio-Rad) with the fol-

lowing three primer pairs: 341F/519R for the 16S rRNA

gene of enteric bacteria [39], HeilF/HeilR for the 16S

rRNA gene of H. suis [13], and MactinF/MactinR for

mouse b-actin [40], as shown in Table 1. The CFX96

run protocol was as follows: a denaturation and hot-

start enzyme activation program (95 °C for 3 minutes),

an amplification and quantification program repeated

50 times (95 °C for 10 seconds and 60 °C for 15 sec-

onds with a single fluorescence measurement), and a

melting curve program (65–95 °C with a heating rate

of 0.5 °C/second and continuous fluorescence measure-

ment). The standard dilution series were used on each

experimental plate, and semiquantification of 16S rRNA

or b-actin gene normalization was based on the aver-

aged results. The amount of the target gene was calcu-

lated using standard curves generated from purified

Streptococcus pyogenes strain GAS472 chromosomal DNA

[41]. The yield of bacterial genomic DNA was about

1 lg from a single mouse infected with H. suis TKY or

SNTW101.

Whole-Genome Sequencing

Whole-genome sequencing was performed using cycled

ligation sequencing on a SOLiD sequencer (Life Tech-

nologies, Carlsbad, CA, USA) at the Functional Geno-

mic Facility, National Institute for Basic Biology

(NIBB), Okazaki, Japan. Approximately 3–5 lg of the

purified bacterial genomic DNA was sheared into 100–150 bp with a Covaris S2 system (Covaris Inc.,

Woburn, MA, USA) in 120 lL of 10 mmol/L TE buffer

in a Covaris microTube using a program consisting of a

20% duty cycle with an intensity of 5 and 200 cycles

per burst for 60 seconds at 5 °C. The fragments were

arranged into SOLiD barcoded fragment libraries using

a SOLiD Fragment Library Construction Kit (Life Tech-

nologies). The fragment libraries were then amplified

by emulsion PCR (ePCR) at a library concentration of

0.5 pmol/L following the manufacturer’s instructions.

Template-enriched beads were modified at the 30 termi-

nus and deposited onto a SOLiD sequencer slide. The

slide was then loaded onto a SOLiD four instrument,

and paired-end reads of 50 + 35 bp were obtained.

Sequence Assembly, Gene Identification, andComparative Analysis

The color-space reads from the SOLiD sequencer were

assembled using the SOLiD de novo accessory tools

v.2.0 (Denovo 2), which internally use Velvet as an

assembly engine combined with pre- and post-processes

including error collection, gap filling, and translation

from color space to base space. The assembly with the

default parameter set gave only very short contigs. We

therefore tested combinations of several assembly

parameters and picked the one that generated the

Table 1 PCR primers used in the present study

Primer Sequence (50–30) Gene/Region References

341F ctacgggaggcagcagtggg Bacterial [39]

519R attaccgcggckgctg 16S rRNA

HeilF aagtcgaacgatgaagccta Helicobacter

heilmannii s.l.

[13]

HeilR atttggtattaatcaccatttc 16S rRNA

MactinF ggcaccacacyttctacaatg mouse [40]

MactinR ggggtgttgaaggtctcaaac b-ActinVAC3624F gagcgagctatggttatgac Helicobacter

pylori

[13]

VAC4041R cattcctaaattggaagcgaa vacA

HH-F5 tgtcatctaccatgggcttag Helicobacter

suis

This study

HH-R4 ggccaaccaaaaccttcagc Noncoding

region

carR2F tagctctagggtgcagggaata H. suis This study

carR2R ctcacccacacctgctagtatttt carR

HH292F1 gatttacccttatgcgatcc H. suis This study

HH292R1 gatgcattgctctcttagttc Noncoding

region

carRUP gttttcatctacttgtgcaccca H. suis This study

carRDW cgtgcccaagaggggtgtatt carR


PCR Detection of H. suis Matsui et al.

longest total contig size. The parameter set used here

was hsize = 23, cov cutoff = 0.3, maxcov = 1000, and

min_pair_count = 3.

The assembled contig sequences were then com-

pared with the published contig sequences of H. suis

strains HS1 (GenBank accession no. ADGY00000000)

and HS5 (GenBank accession no. ADHO00000000) [33]

using FASTA. To identify genes, the assembled

sequences were subjected to BLASTX searches against

20 Helicobacter strains (H. pylori 26695, B38, B8, G27,

HPAG1, J99, P12, PeCan4, SJM180, and Shi470; Heli-

cobacter acinonychis SHeeba; H. felis ATCC 49179; Helicob-

acter hepaticus ATCC 51449; H. mustelae 12198;

H. bizzozeronii CIII-1; H. heilmannii s.s. ASB1.4; and

H. suis HS1, HS5, TKY, and SNTW101) and 11 Campylo-

bacter strains (C. jejuni RM1221, 269.97, 81–176, NCTC11828, NCTC 11168, and ICDCCJ07001; C. concisus

13826; C. curvus 525.92; C. fetus 82-40; C. hominis ATCC

BAA-381; and C. lari RM2100), and then orthology

analysis was conducted using the research environment

for comparative genomics (RECOG) system (http://

mbgd.genome.ad.jp/RECOG/).

Preparation of Template DNA for PCR Diagnosis

The chromosomal DNA from each of the isolates H. suis

HS5, H. heilmannii s.s., H. felis, H. baculiformis, H. bizzo-

zeronii, H. cynogastricus, H. mustelae, H. salomonis, or

H. pylori cultured in the broth; cellular DNA from the

gastric mucosa of mice infected with each of H. suis

TKY, SNTW101, SH8, or SH10; and cellular DNA from

each gastric biopsy specimen (14 patients with nodular

gastritis including four UBT-negative and 10 UBT-posi-

tive cases) were extracted using a DNeasy Blood & Tis-

sue kit (Qiagen, Dusseldorf, Germany) according to the

manufacturer’s protocol.

PCR Diagnosis

PCR was performed with a Mastercycler ep (Eppendorf

AG, Hamburg, Germany) using Tfi DNA polymerase

(Invitrogen, Carlsbad, CA, USA) and the following two

or three primer pairs: VAC3624F/VAC4041R for the

vacA gene of H. pylori [13]; HH-F5/HH-R4 for the non-

coding region; and/or carR2F/carR2R for the carR gene

of H. suis (Table 1). The assay mixture contained, in a

final volume of 25 lL, 19 PCR reaction buffer, 200 lMof each dNTP, 1.5 mmol/L MgCl2, 0.2 lM of each pri-

mer pair, 10 ng of chromosomal DNA (H. suis HS5,

H. heilmannii s.s., H. felis, H. baculiformis, H. bizzozeronii,

H. cynogastricus, H. mustelae, H. salomonis, and H. pylori)

or 100 ng of cellular DNA (from mouse gastric mucosa

infected with H. suis or from gastric biopsy specimens),

and 1 unit of Tfi DNA polymerase. The PCR run proto-

col was as follows: a denaturation and hot-start enzyme

activation program (94 °C for 1 minute), an amplifica-

tion program repeated 35 times (94 °C for 15 seconds,

57 °C for 30 seconds, and 72 °C for 1 minute), and a

final extension (72 °C for 10 minutes). The 5 lL of

PCR products was mixed with 1 lL of 69 loading buf-

fer, separated on 2% (wt/vol) agarose gels, and stained

with ethidium bromide. This study was approved by

the research ethics committees of the Kitasato Institute,

Shinshu University School of Medicine, Kyorin Univer-

sity School of Medicine, and Tokyo Women’s Medical

University.

Results

Helicobacter suis SNTW101 Infection Induced theFormation of Gastric Lymphoid Follicles in aMouse Model

We have reported that H. suis TKY isolated from a

cynomolgus monkey induces gastric MALT lymphoma

associated with protrusive lesions in the fundic regions

in C57BL/6J mice [3,25–28,42,43]. Similarly, H. suis

SNTW101 isolated from a patient suffering from nodu-

lar gastritis induced a gastric disorder in C57BL/6J mice.

As shown in Fig. 1, 20 months after inoculation with

gastric mucosal homogenates containing H. suis

SNTW101, several round protrusive lesions in the fundic

A B

C D

Figure 1 Representative macroscopic view of the stomach of an age-

matched control (A) and a gastric homogenate-containing Helicobacter

suis SNTW101-inoculated mouse (B) at 20 months post-inoculation.

The representative microscopic appearance of the H&E-stained stom-

ach sections of an age-matched control (C) and an H. suis SNTW101-

infected mouse (D) at 20 months post-inoculation is also shown (origi-

nal magnification, 9100). Arrows indicate the round protrusive lesions

(B) and lymphoid follicle (D).



area of the stomach were visible to the naked eye in all

the infected mice (n = 8; Fig. 1B). Indeed, the gastric

lymphoid follicles were clearly detected in the gastric

mucus layer of infected mice (Fig. 1D). In contrast, no

lesions were detected in any of the uninfected mice

(n = 6; Fig. 1A,C). This suggests that like H. suis TKY,

H. suis SNTW101 was able to provoke gastric diseases.

Helicobacter suis Chromosomal DNA wasSuccessfully Isolated from the Mouse GastricMucosa by Treatment with ImmunomagneticBeads

We found in preliminary experiments that indigenous

Lactobacillus species (Gram-positive facultative anaerobic

or microaerobic bacteria) appeared in the gastric

mucosa of mice in unexpectedly large amounts after

inoculation with gastric mucosal homogenates contain-

ing H. suis present in gastric biopsy specimens. The gas-

tric mucosal homogenates prepared from infected mice

contained H. suis (about 104 copies of 16S rRNA genes)

and Lactobacillus species (105 copies of 16S rRNA genes).

Under these conditions, we attempted to use in vitro

cultivation of H. suis strains to isolate them from mouse

gastric mucosal homogenates according to the method

reported by Baele et al. [5]. Unfortunately, we detected

only the Lactobacillus colonies on the plates after 7 days

of culture. Meanwhile, instead of the culture proce-

dure, the treatment with anti-H. pylori antibody-coated

magnetic beads (Sepa-Max Hp) effectively reduced the

ratios of contamination (mouse gastric cells and enteric

bacteria). The H. suis purity of the final sample was cal-

culated as follows: H. suis/(bacteria + b-actin). A DNA

purity of as much as 30–60% was obtained, which was

suitable for sequencing purposes (Fig. 2).

Comparative Genome Analysis of Helicobacterand Campylobacter Strains was Used to Identifythe Helicobacter suis-Specific NucleotideSequences

The reads from the SOLiD sequencer were assembled

with the Denovo 2 program to create contigs. The total

lengths of the resulting contigs were 2.12 Mb for H. suis

TKY and 1.62 Mb for H. suis SNTW101. However, the

length of each contig was rather short: The N50 values

of the H. suis TKY and SNTW101 assemblies were 639

and 241 bp, respectively. Moreover, when we aligned

the assembled contig sequences with the previously

published contig sequences of H. suis HS1 and HS5, we

found in the alignments several blocks of mismatches

whose lengths were tens of base pairs, which appeared

to be introduced originally as a few errors in a color-

space sequence but which were expanded through the

conversion from color space to base space. Therefore,

the quality of the resulting sequence was not high

enough for detailed sequence analysis. Nonetheless,

when these contig sequences were subjected to

BLASTX searches against the nonredundant protein

sequence database, in a large majority of cases (89.9%

in total), the top hit sequences were H. suis, other Heli-

cobacter species, or Campylobacter species. Thus, most of

the assembled contig sequences can be considered to be

derived from the H. suis strains. Then, we found two

conserved nucleotide sequences among the H. suis

strains by comparative genome analysis of 20 Helicobact-

er and 11 Campylobacter strains. Although one sequence

was conserved in the H. suis TKY, SNTW101, SH8,

SH10, HS1, and HS5; the H. felis ATCC 49179; and the

H. bizzozeronii CIII-1, this sequence did not code for any

open reading frame (ORF; Fig. 3). The other sequence

included the carR gene, which did not reside on the

chromosome of any Helicobacter species except for

H. suis (Fig. 4).

The Target DNA of Helicobacter suis wasSpecifically Amplified by PCR

To determine whether the above sequences were actu-

ally specific to H. suis, we carried out conventional PCR

using the primer pairs designated above (HH-F5/HH-R4

and carR2F/carR2R). The PCR results indicated that

although both the HH-F5/HH-R4 and caR2F/carR2R

primer pairs specifically amplified the target DNA frag-

ments of H. suis strains (TKY, SNTW101, SH8, SH10,

and HS5), there were no such amplified DNA fragments

of H. heilmannii s.s., H. felis, H. baculiformis, H. bizzozero-

nii, H. cynogastricus, or H. mustelae in addition to the

absence of amplified fragments of the H. pylori strains

Figure 2 Purity of DNA samples. One microliter of final DNA solutions

prepared from the Helicobacter suis TKY or SNTW101-infected mouse

gastric mucosa was examined to determine the concentrations of the

16S rRNA gene of bacteria (including H. suis; the left columns), the

16S rRNA gene of H. suis (the center columns), and mouse b-actin(the right columns) by quantitative real-time PCR using the primer

pairs 16S341F/16S519R, HeilF/HeilR, and MactinF/MactinR, respectively.

ND, not detected.



(Fig. 5A, lanes 2–18). In contrast, the VAC3624F/

VAC4041R primer pair specifically amplified the target

DNA fragment of H. pylori strains (Fig. 5A, lanes 14–18). Moreover, when 100 ng of chromosomal DNA of

H. heilmannii s.s. was used as the template, no DNA

fragments were amplified by PCR using the HH-F5/HH-

R4, caR2F/carR2R, or VAC3624F/VAC4041R primer

pairs (data not shown). In turn, even at 20 months

after inoculation, the target DNA fragments of H. suis

SNTW101 were clearly amplified and detected in the

infected mouse gastric mucosa by PCR using both the

HH-F5/HH-R4 and carR2F/carR2R primer pairs

(Fig. 5B, lanes 9–16). In contrast, no amplified DNA

bands were detected in the age-matched uninfected

mouse gastric mucosa (Fig. 5B, lanes 3–8).

PCR Detected Helicobacter suis in Gastric BiopsySpecimens

As shown in Fig. 6, lanes 3–5 and 16 are the samples

from UBT-negative patients, and lanes 6–15 are the

samples from UBT-positive patients. The diagnostic PCR

using the specific primer pairs of VAC3624F/VAC4041R

and carR2F/carR2R clearly identified the H. pylori-

infected (lanes 6–15), H. suis-infected (lane 16), and

uninfected (lanes 3–5) samples. This finding indicates

that the diagnostic PCR using the carR2F/car2R primer

pair is useful to identify the H. suis infection in gastric

biopsy specimens.

Discussion

In the C57BL/6 mouse model of H. suis infection, a sin-

gle oral inoculation with gastric mucosal homogenates

from the H. suis TKY-infected mice induced gastric

MALT lymphoma, whereas the inoculation with gastric

mucosal homogenates from uninfected mice did not

induce any macroscopic or microscopic gastric lesions

[26]. This result supports the conclusion that even if

other bacteria existed in the inoculated gastric homo-

genates, H. suis SNTW101 but not other bacteria

induced the formation of gastric lymphoid follicles

(Fig. 1).

We attempted to identify the colony morphology of

H. suis on an agar plate according to the previously

reported method [33]. The mouse stomach involving

bacteria was subjected to acid treatment, and the

mucus was then scraped off using a glass slide and col-

lected in a sterile tube. The mucus was slightly liquefied

with Brucella broth supplemented with 20% FCS and

inoculated on Brucella agar containing 20% FCS, 5 mg/

L amphotericin B, Campylobacter-selective supplement,

Vitox supplement, 0.1% activated charcoal, and hydro-

chloride to obtain a pH of 5. The plates were incubated

for 7 days with the lids uppermost at 37 °C under a

humidified atmosphere (5% O2, 10% CO2, and 85%

N2). The plates were checked every 2 days, and Brucella

broth supplemented with 20% FCS was added to the

agar surface to ensure that they would not dry out.

Light microscopic examination, Gram staining, and PCR

revealed that H. suis were spread on the agar surface

with no apparent growth. Based on 16S rRNA gene

sequencing, the bacterial colonies growing on the solid

agar media were identified as belonging to either Lacto-

bacillus reuteri or Lactobacillus murinus. Pena et al. [44]

have previously reported that L. reuteri or L. murinus is

the most dominant Lactobacillus colonizing the C57BL/6

mouse intestine. We are currently continuing these cul-

tivation studies. Meanwhile, magnetic particles have

been used widely in both biotechnological and medical

fields, including for immunoassay, enzyme immobiliza-

tion, drug transport, and immunological diagnosis. Par-

ticles with bioactive molecules such as antibodies and

streptavidin are particularly useful tools for cell separa-

tion [45]. In this study, small amounts of the bacterial

cells of H. suis TKY and SNTW101 (<1%) were success-

fully separated from large amounts of the other cells,

including enteric bacteria and host cells, in the gastric

mucosal homogenates by the treatment of magnetic

nanoparticles (<100 nm particle size) coupled with rab-

bit anti-H. pylori antibody (Fig. 2). The present method

has potential for avoiding the main difficulties in isolat-

ing and culturing non-pylori Helicobacter from human

colonic tissues. That is, a method that combines immu-

nomagnetic separation and PCR would be useful for

the detection of unculturable and non-pylori Helicobact-

er colonization in human or animal tissues.

Helicobacter suis SNTW101 lacks urease activity, and

the ureAB genes were not amplified by PCR using the

general primer pair of U430F and U1735R or U430F and

Figure 3 Comparison of Helicobacter suis-specific arrangements in the noncoding region. The results of a parallel DNA sequencing of the con-

served noncoding region among H. suis TKY, H. suis SNTW101, H. suis SH8, H. suis SH10, H. suis HS1 (EMBL/GenBank/DDBJ accession no.

ADGY01000090.1, contig00090), H. suis HS5 (EMBL/GenBank/DDBJ accession no. ADHO01000292.1, contig00292), Helicobacter felis ATCC 49179

(EMBL/GenBank/DDBJ accession no. FQ670179.2), and Helicobacter bizzozeronii CIII-1 (EMBL/GenBank/DDBJ accession no. FR871757) are shown.

The DNA sequences of H. suis TKY, SNTW101, SH8, and SH10 were determined after the PCR amplification using the primer pair HH292F1/

HH292R1 (Table 1). For the diagnostic PCR, the primer pair HH-F5/HH-R4 was enclosed and indicated.



U2235R [46]. Recently, a new quantitative real-time

PCR method was developed to detect H. suis using the

ureA primer pair of BF_HsuisF1 and BF_HsuisR1 [47].

Indeed, the target DNA fragments of ureA genes from

H. suis strains TKY, SNTW101, SH8, and SH10 were

amplified by this PCR system (data not shown). These

results led to the conclusion that despite the presence of

urease genes, the urease activity in stomach tissue was

undetectable in H. suis SNTW101. Moreover, not only

H. suis SNTW101 but also other urease-negative H. suis

strains have been detected in gastric biopsy specimens

from UBT-negative patients [9,16]. So far, there is no

clear answer as to how urease-negative H. suis strains

can colonize in the mouse and human stomachs.

We have been attempting to develop new PCR assay

systems for the detection of H. suis in gastric biopsy

A

B

Figure 5 Evaluation of the PCR primers used to amplify the target DNA fragments from Helicobacter suis. (A) Lane M shows a 100-bp DNA ladder,

and lanes 1–18 show the PCR products made from the template DNA, as follows; lane 1, uninfected mouse gastric mucosa (100 ng); lane 2,

H. suis TKY-infected mouse gastric mucosa (100 ng); lane 3, H. suis SNTW101-infected mouse gastric mucosa (100 ng); lane 4, H. suis SH8-infected

mouse gastric mucosa (100 ng); lane 5, SH10-infected mouse gastric mucosa (100 ng); lane 6, H. suis HS5 (10 ng); lane 7, Helicobacter heilmannii

s.s. ASB1.4 (10 ng); lane 8, Helicobacter felis ATCC 49179 (10 ng); lane 9, Helicobacter baculiformis M50 (10 ng); lane 10, Helicobacter bizzozeronii

R1051 (10 ng); lane 11, Helicobacter cynogastricus JKM4 (10 ng); lane 12, Helicobacter mustelae NCTC 12032 (10 ng); lane 13, Helicobacter salo-

monis R1053 (10 ng); lane 14, Helicobacter pylori SS1 (10 ng); lane 15, H. pylori TN2GF4 (10 ng); lane 16, H. pylori NCTC 11637 (10 ng); lane 17,

H. pylori ATCC 43579 (10 ng); and lane 18, H. pylori RC-1 (10 ng). (B) Lane M shows a 100-bp DNA ladder, and lanes 1–16 show the PCR products

made from the template DNA, as follows; lane 1, H. suis TKY-infected mouse gastric mucosa (100 ng); lane 2, H. pylori SS1 (10 ng); lanes 3–8,

age-matched uninfected mouse gastric mucosa (100 ng); and lanes 9–16, H. suis SNTW101-infected mouse gastric mucosa (100 ng), 20 months

post-inoculation. Arrows indicate the amplified DNA bands using the primer pairs VAC3624F/VAC4041R (418 bp, vacA gene of H. pylori), HH-F5/

HH-R4 (348 bp, noncoding region of H. suis), and carR2F/carR2R (220 bp, carR gene of H. suis).

Figure 4 Comparison of Helicobacter suis-specific arrangements of the carR gene. The results of parallel DNA sequencing of the carR gene

among H. suis TKY, H. suis SNTW101, H. suis SH8, H. suis SH10, H. suis HS1 (EMBL/GenBank/DDBJ accession no. ADGY01000086.1, contig00086),

and H. suis HS5 (EMBL/GenBank/DDBJ accession no. ADHO010000186.1, contig00186) are shown. The DNA sequences of H. suis TKY, SNTW101,

SH8, and SH10 were determined after the PCR amplification using the primer pair carRUP/carRDW (Table 1). For the diagnostic PCR, the primer

pair carR2F/carR2R was enclosed and indicated.

Figure 6 PCR detection of Helicobacter suis in gastric biopsy specimens. Diagnostic PCR detection of Helicobacter in gastric biopsy specimens of

patients with nodular gastritis was carried out using the specific primer pairs Vac3624F/Vac4041R and carR2F/carR2R. Lane M shows a 100-bp

DNA ladder, and lanes 1–16 show the PCR products made from the template DNA, as follows: lane 1, Helicobacter pylori SS1 (10 ng); lane 2,

H. suis TKY-infected mouse gastric mucosa (100 ng); and lanes 3–16, prepared from gastric biopsy samples (100 ng). Arrows indicate the DNA

bands amplified using the primer pairs VAC3624F/VAC4041R (418 bp) and carR2F/carR2R (220 bp).



specimens using H. suis-specific primer pairs targeting

genes other than 16S rRNA and urease genes. Compar-

ative genomics of the four available H. suis genome

sequences revealed that H. suis TKY, SNTW101, HS1,

and HS5 had two promising target DNA sequences for

the detection of H. suis by PCR amplification which the

H. pylori strains did not carry (Figs 3 and 4). One was

the conserved region of the H. heilmannii s.l. genome

located within the H. suis HS1 contig00090 and HS5

contig00292. Therefore, we designed the H. suis-specific

primer pairs (HH-F5/HH-R4). The other was a putative

carR gene (carotenogenesis protein), and the most

homologous gene was carR of Azospirillum brasilense,

which codes for a positive regulator of a novel two-

component regulatory system for the global expression

of carbohydrate catabolic pathways [48]. Using the HH-

F5/HH-R4 and carR2F/carR2R primer pairs, the target-

ing DNA fragments of H. suis strains were specifically

amplified by PCR (Fig. 5A). Consequently, we also suc-

ceeded in detecting the H. suis infection in mouse stom-

achs by PCR using these primer pairs (Fig. 5B). Finally,

we succeeded in specifically detecting the H. pylori and

H. suis infections in gastric biopsy specimens by PCR

using the VAC3624F/VAC4041R and carR2F/carR2R

primer pairs, respectively (Fig. 6).

In the present study, there was a strong association

between the gastric colonization of H. suis SNTW101

isolated from a patient suffering from nodular gastritis

and the formation of gastric lymphoid follicles in the

long-term evaluation of the mouse infection model

(Fig. 1), whereas in the previous reports, the inocula-

tion with gastric mucosal homogenates containing

H. suis TKY induced gastric MALT lymphoma in a rela-

tively short-term evaluation of a mouse model [25–28].In addition, the infection with H. suis strains isolated

from pigs caused gastric disorders in mice [49,50] and

Mongolian gerbils [50]. To determine the difference in

virulence among H. suis strains, further comparative

genome analyses in addition to infection experiments

will be needed.

Nucleotide Sequence Accession Numbers

The nucleotide sequences of the noncoding regions

(about 590 bp) are available from the EMBL/GenBank/

DDBJ database under accession nos. AB849018 (H. suis

TKY), AB849019 (H. suis SNTW101), AB849020 (H. suis

SH8), and AB849021 (H. suis SH10), and the nucleotide

sequences of the carR genes (about 550 bp) are also

available from the EMBL/GenBank/DDBJ database

under accession nos. AB849014 (H. suis TKY), AB849015

(H. suis SNTW101), AB849016 (H. suis SH8), and

AB849017 (H. suis SH10).

Acknowledgements and Disclosures

This study was financially supported in part by Grants-in-Aid

for Scientific Research (C) (nos. 21590491 and 25460935) andfor Young Scientists (B) (no. 25860099) from the Japan Soci-

ety for the Promotion of Science (JSPS). This study was also

supported by the Adaptable and Seamless Technology TransferProgram (A-STEP; no. 241FT0225) from the Japan Science and

Technology Agency (JST). This study was carried out under

the NIBB Cooperative Research Program (Next-generation

DNA Sequencing Initiative: nos. 10-703, 11-707, and 12-711).Competing interests: The authors have no competing

interests.

References

1 Suerbaum S, Josenhans C. Helicobacter pylori evolution and phe-

notypic diversification in a changing host. Nat Rev 2007;5:441–52.2 Baele M, Pasmans F, Flahou B, Chiers K, Ducatelle R, Hae-

sebrouck F. Non-Helicobacter pylori helicobacters detected in the

stomach of humans comprise several naturally occurring Heli-

cobacter species in animals. FEMS Immunol Med Microbiol

2009;55:306–13.3 Matsui H, Sekiya Y, Aikawa C, Murayama SY, Takahashi T,

Yoshida H, Takahashi T, Tsuchimoto K, Nakamura M. “Candida-

tus Helicobacter heilmannii” infection in the course of gastric

mucosa-associated lymphoid tissue (MALT) lymphoma in

human beings and mouse models. Curr Trends Microbiol

2010;6:27–34.4 Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M,

Meyns T, Decostere A, Ducatelle R. Gastric helicobacters in

domestic animals and nonhuman primates and their signifi-

cance for human health. Clin Microbiol Rev 2009;22:202–23.5 Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A,

Mast J, Chiers K, Ducatelle R, Haesebrouck F. Isolation and

characterization of Helicobacter suis sp. nov. from pig stomachs.

Int J Syst Evol Microbiol 2008;58:1350–8.6 Haesebrouck F, Pasmans F, Flahou B, Smet A, Vandamme P,

Ducatelle R. Non-Helicobacter pylori Helicobacter species in the

human gastric mucosa: a proposal to introduce the terms

H. heilmannii sensu lato and sensu stricto. Helicobacter

2011;16:339–40.7 Chen Y, Zhou D, Wang J. Biological diagnostic and therapeutic

study on the infection of Helicobacter heilmannii. Zhonghua Yi

Xue Za Zhi 1998;78:490–3.8 Iwanczak B, Biernat M, Iwanczak F, Grabinska J, Matusiewicz

K. The clinical aspects of Helicobacter heilmannii infection in chil-

dren with dyspeptic symptoms. J Physiol Pharmacol

2012;63:133–6.9 Okiyama Y, Matsuzawa K, Hidaka E, Sano K, Akamatsu T, Ota

H. Helicobacter heilmannii infection: clinical, endoscopic and his-

topathological features in Japanese patients. Pathol Int

2005;55:398–404.10 Nel W. Gastritis and gastropathy: more than meets the eye.

Contin Med Educ 2012;30:61–2, 64–6.11 Fox JG. The non-H pylori helicobacters: their expanding role in

gastrointestinal and systemic diseases. Gut 2002;50:273–83.12 Stolte M, Bayerdorffer E, Morgner A, Alpen B, Wundisch T,

Thiede C, Neubauer A. Helicobacter and gastric MALT lym-

phoma. Gut 2002;50(Suppl 3):iii19–24.13 Chisholm SA, Owen RJ. Development and application of a

novel screening PCR assay for direct detection of ‘Helicobacter



heilmannii’-like organisms in human gastric biopsies in South-

east England. Diagn Microbiol Infect Dis 2003;46:1–7.14 Boyanova L, Lazarova E, Jelev C, Gergova G, Mitov I. Helicob-

acter pylori and Helicobacter heilmannii in untreated Bulgarian

children over a period of 10 years. J Med Microbiol

2007;56:1081–5.15 Trebesius K, Adler K, Vieth M, Stolte M, Haas R. Specific detec-

tion and prevalence of Helicobacter heilmannii-like organisms in

the human gastric mucosa by fluorescent in situ hybridization

and partial 16S ribosomal DNA sequencing. J Clin Microbiol

2001;39:1510–6.16 Boyanova L, Koumanova R, Lazarova E, Jelev C. Helicobacter

pylori and Helicobacter heilmannii in children. A Bulgarian study.

Diagn Microbiol Infect Dis 2003;46:249–52.17 Ierardi E, Monno RA, Gentile A, Francavilla R, Burattini O,

Marangi S, Pollice L, Francavilla A. Helicobacter heilmannii gas-

tritis: a histological and immunohistochemical trait. J Clin

Pathol 2001;54:774–7.18 Debongnie JC, Donnay M, Mairesse J. Gastrospirillum hominis

(“Helicobacter heilmanii”): a cause of gastritis, sometimes tran-

sient, better diagnosed by touch cytology? Am J Gastroenterol

1995;90:411–6.19 Heilmann KL, Borchard F. Gastritis due to spiral shaped bacte-

ria other than Helicobacter pylori: clinical, histological, and ultra-

structural findings. Gut 1991;32:137–40.20 Yakoob J, Abbas Z, Khan R, Naz S, Ahmad Z, Islam M, Awan S,

Jafri F, Jafri W. Prevalence of non Helicobacter pylori species in

patients presenting with dyspepsia. BMC Gastroenterol 2012;12:3.

21 De Groote D, Van Doorn LJ, Van den Bulck K, Vandamme P,

Vieth M, Stolte M, Debongnie JC, Burette A, Haesebrouck F,

Ducatelle R. Detection of non-pylori Helicobacter species in “He-

licobacter heilmannii”-infected humans. Helicobacter 2005;10:398–406.

22 Van den Bulck K, Decostere A, Baele M, Driessen A, Debong-

nie JC, Burette A, Stolte M, Ducatelle R, Haesebrouck F. Iden-

tification of non-Helicobacter pylori spiral organisms in gastric

samples from humans, dogs, and cats. J Clin Microbiol

2005;43:2256–60.23 Morgner A, Lehn N, Andersen LP, Thiede C, Bennedsen M,

Trebesius K, Neubauer B, Neubauer A, Stolte M, Bayerdorffer

E. Helicobacter heilmannii-associated primary gastric low-grade

MALT lymphoma: complete remission after curing the infec-

tion. Gastroenterology 2000;118:821–8.24 Fritz EL, Slavik T, Delport W, Olivier B, van der Merwe SW.

Helicobacter heilmannii-associated primary gastric low-grade

MALT lymphoma: complete remission after curing the infec-

tion. Gastroenterology 2006;118:821–8.25 Nakamura M, Matsui H, Murayama SY, Matsumoto T, Yamada

H, Takahashi S, Tsuchimoto K. Interaction of VEGF to gastric

low grade MALT lymphoma by Helicobacter heilmannii infection

in C57BL/6 mice. Inflammopharmacology 2007;15:115–8.26 Nakamura M, Murayama SY, Serizawa H, et al. “Candidatus He-

licobacter heilmannii” from a cynomolgus monkey induces gas-

tric mucosa-associated lymphoid tissue lymphoma in C57BL/6

mice. Infect Immun 2007;75:1214–22.27 Nakamura M, Takahashi S, Matsui H, Murayama SY, Aikawa

C, Sekiya Y, Nishikawa K, Matsumoto T, Yamada H, Tsuchim-

oto K. Microcirculatory alteration in low-grade gastric mucosa-

associated lymphoma by Helicobacter heilmannii infection: its

relation to vascular endothelial growth factor and cyclooxygen-

ase-2. J Gastroenterol Hepatol 2008;23(Suppl 2):S157–60.28 Nishikawa K, Nakamura M, Takahashi S, Matsui H, Murayama

SY, Matsumoto T, Yamada H, Tsuchimoto K. Increased apoptosis

and angiogenesis in gastric low-grade mucosa-associated lym-

phoid tissue-type lymphoma by Helicobacter heilmannii infection

in C57/BL6 mice. FEMS Immunol Med Microbiol 2007;50:268–72.29 Yonezawa H, Osaki T, Kurata S, Fukuda M, Kawakami H,

Ochiai K, Hanawa T, Kamiya S. Outer membrane vesicles of

Helicobacter pylori TK1402 are involved in biofilm formation.

BMC Microbiol 2009;9:197.

30 Yonezawa H, Osaki T, Kurata S, Zaman C, Hanawa T, Kamiya

S. Assessment of in vitro biofilm formation by Helicobacter

pylori. J Gastroenterol Hepatol 2010;25(Suppl 1):S90–4.31 Yonezawa H, Osaki T, Hanawa T, Kurata S, Zaman C, Woo TD,

Takahashi M, Matsubara S, Kawakami H, Ochiai K, Kamiya S.

Destructive effects of butyrate on the cell envelope of Helicob-

acter pylori. J Med Microbiol 2012;61:582–9.32 Yonezawa H, Osaki T, Woo T, Kurata S, Zaman C, Hojo F,

Hanawa T, Kato S, Kamiya S. Analysis of outer membrane

vesicle protein involved in biofilm formation of Helicobacter

pylori. Anaerobe 2011;17:388–90.33 Vermoote M, Vandekerckhove TT, Flahou B, Pasmans F, Smet

A, De Groote D, Van Criekinge W, Ducatelle R, Haesebrouck F.

Genome sequence of Helicobacter suis supports its role in gastric

pathology. Vet Res 2011;42:51.

34 Joosten M, Blaecher C, Flahou B, Ducatelle R, Haesebrouck F,

Smet A. Diversity in bacterium-host interactions within the

species Helicobacter heilmannii sensu stricto. Vet Res 2013;44:65.

35 Baele M, Decostere A, Vandamme P, Van den Bulck K, Gruntar

I, Mehle J, Mast J, Ducatelle R, Haesebrouck F. Helicobacter ba-

culiformis sp. nov., isolated from feline stomach mucosa. Int J

Syst Evol Microbiol 2008;58:357–64.36 Baele M, Van den Bulck K, Decostere A, Vandamme P, Hanni-

nen ML, Ducatelle R, Haesebrouck F. Multiplex PCR assay for

differentiation of Helicobacter felis, H. bizzozeronii, and H. salomo-

nis. J Clin Microbiol 2004;42:1115–22.37 Van den Bulck K, Decostere A, Baele M, Vandamme P, Mast J,

Ducatelle R, Haesebrouck F. Helicobacter cynogastricus sp. nov.,

isolated from the canine gastric mucosa. Int J Syst Evol Microbiol

2006;56:1559–64.38 Matsui H, Aikawa C, Sekiya Y, Takahashi S, Murayama SY,

Nakamura M. Evaluation of antibiotic therapy for eradication

of “Candidatus Helicobatcer heilmannii”. Antimicrob Agents Chemo-

ther 2008;52:2988–9.39 Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex

microbial populations by denaturing gradient gel electrophore-

sis analysis of polymerase chain reaction-amplified genes cod-

ing for 16S rRNA. Appl Environ Microbiol 1993;59:695–700.40 Hu JK, McGlinn E, Harfe BD, Kardon G, Tabin CJ. Autono-

mous and nonautonomous roles of Hedgehog signaling in regu-

lating limb muscle formation. Genes Dev 2012;26:2088–102.41 Matsui H, Sekiya Y, Nakamura M, et al. CD46 transgenic

mouse model of necrotizing fasciitis caused by Streptococcus pyog-

enes infection. Infect Immun 2009;77:4806–14.42 Nakamura M, Matsui H, Takahashi T, Ogawa S, Tamura R,

Murayama SY, Takahashi S, Tsuchimoto K. Suppression of

lymphangiogenesis induced by Flt-4 antibody in gastric low-

grade mucosa-associated lymphoid tissue lymphoma by Helicob-

acter heilmannii infection. J Gastroenterol Hepatol 2010;25(Suppl

1):S1–6.43 Nobutani K, Yoshida M, Nishiumi S, et al. Helicobacter heilman-

nii can induce gastric lymphoid follicles in mice via a Peyer’s

patch-independent pathway. FEMS Immunol Med Microbiol

2010;60:156–64.44 Pena JA, Li SY, Wilson PH, Thibodeau SA, Szary AJ, Versalovic

J. Genotypic and phenotypic studies of murine intestinal lacto-



bacilli: species differences in mice with and without colitis. Appl

Environ Microbiol 2004;70:558–68.45 Hoshino A, Ohnishi N, Yasuhara M, Yamamoto K, Kondo A.

Separation of murine neutrophils and macrophages by thermo-

responsive magnetic nanoparticles. Biotechnol Prog 2007;23:

1513–6.46 O’Rourke JL, Solnick JV, Neilan BA, Seidel K, Hayter R, Han-

sen LM, Lee A. Description of ‘Candidatus Helicobacter heilmannii’

based on DNA sequence analysis of 16S rRNA and urease

genes. Int J Syst Evol Microbiol 2004;54:2203–11.47 Blaecher C, Smet A, Flahou B, et al. Significantly higher fre-

quency of Helicobacter suis in patients with idiopathic parkinson-

ism than in control patients. Aliment Pharmacol Ther

2013;38:1347–53.

48 Chattopadhyay S, Mukherjee A, Ghosh S. Molecular cloning

and sequencing of an operon, carRS of Azospirillum brasilense,

that codes for a novel two-component regulatory system: dem-

onstration of a positive regulatory role of carR for global con-

trol of carbohydrate catabolism. J Bacteriol 1994;176:7484–90.49 Park JH, Seok SH, Baek MW, Lee HY, Kim DJ. Gastric lesions

and immune responses caused by long-term infection with He-

licobacter heilmannii in C57BL/6 mice. J Comp Pathol

2008;139:208–17.50 Flahou B, Haesebrouck F, Pasmans F, D’Herde K, Driessen A,

Van Deun K, Smet A, Duchateau L, Chiers K, Ducatelle R.

Helicobacter suis causes severe gastric pathology in mouse and

Mongolian gerbil models of human gastric disease. PLoS ONE

2010;5:e14083.



Development of New PCR Primers by Comparative Genomics for the Detection of Helicobacter suis in...

Documents

Transcript of Development of New PCR Primers by Comparative Genomics for the Detection of Helicobacter suis in...