at SciVerse ScienceDirect

Physiological and Molecular Plant Pathology 77 (2012) 10e16

Contents lists available

Physiological and Molecular Plant Pathology

journal homepage: www.elsevier .com/locate/pmpp

Defence-related gene expression in bark and sapwood of Norway spruce inresponse to Heterobasidion parviporum and methyl jasmonate

Nadeem Yaqoob a,b, Igor A. Yakovlev a, Paal Krokene a, Harald Kvaalen a, Halvor Solheim a,Carl Gunnar Fossdal a,*aNorwegian Forest and Landscape Institute, Forest Biology and Ecology, Høgskoleveien 8, NO-1431 Ås, NorwaybDepartment of Ecology and Natural Resource Management, Norwegian University of Life Sciences, Høgskoleveien 12, NO-1432 Ås, Norway

a r t i c l e i n f o

Article history:Accepted 2 November 2011

Keywords:qRTePCRGene expressionResistanceInduced resistanceHeterobasidion parviporumMethyl jasmonateNecrotrophNorway spruce

Abbreviations: qRT-PCR, Quantitative reverse tranreaction; H. parviporum, Heterobasidion parviporuhydroxylase; PaHCT1, Hydroxycinnamoyl:CoA shikimatransferase; PaPAL, Phenylalanine ammonia-lyase; MeJ,aminocyclopropane-1-carboxylate oxidases; PaACcarboxylic acid syntheses; PaChi4, Chitinase class IV.* Corresponding author. Tel.: þ47 649490905; fax:

E-mail addresses: carl.fossdal@skogoglandskap(C.G. Fossdal).

0885-5765/$ e see front matter � 2011 Elsevier Ltd.doi:10.1016/j.pmpp.2011.11.001

a b s t r a c t

We compared gene expression in Norway spruce secondary phloem (bark) and developing xylem(sapwood) in response to the necrotrophic pathogen Heterobasidion parviporum, wounding and methyljasmonate (MeJ). The pathogen induced systemic and local up-regulation of PaPX3, PaPX2 and PaChi4 inboth bark and sapwood that returned to constitutive levels as the plants recovered from the infection,whereas the local responses to MeJ were similar in both tissues but was longer lasting for PaPX3 andPaChi4. Genes involved in lignin biosynthesis (PaPAL1, PaPAL2, PaC4H3/5 and PaHCT1) were up-regulatedlocally in the bark in response to pathogen and wounding whereas MeJ induced a similar but strongerlocal response. The ethylene biosynthesis related transcripts PaACO and PaACS did not increase inresponse to MeJ treatment or the pathogen, however it increased both locally and systemically asa response to wounding in the sapwood. These results demonstrate that the local and systemic hostresponses to pathogen infection and wounding largely correspond and reveal striking similaritiesbetween the local response to a necrotroph, wounding and MeJ treatment in both bark and living wood.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Conifers dominate many temperate regions and Norway spruce(Picea abies) is one of the most economically and ecologicallyimportant tree species in the northern hemisphere. Trees and otherplants are continuously exposed to a variety of abiotic and bioticstresses and have evolved numerous mechanisms to defendthemselves. Trees face special challenges in defence due to theiroften very long lifespan and the fact that most of their biomass isallocated to wood that also must be protected from pathogen attackand decay. Several local and systemic defence responses are initi-ated in plants upon pathogen recognition. The level of host resis-tance is determined by how efficiently the plant can coordinate its

scription - polymerase chainm; PaC4H3/5, Cinnamate-4-te/quinate hydroxycinnamoylMethyl jasmonate; PaACO, 1-S, 1-aminocyclopropane-1-

þ47 64948001..no, foc@skogoglandskap.no

All rights reserved.

defences and how quickly the responses can be launched [1e4].Many plant hormones, such as abscisic acid, salicylic acid, jasmonicacid and ethylene, are involved in plant defence signalling cascadesthat lead to reinforcement of cell walls and production of hydrolyticenzymes [5]. Conifers have evolved both constitutive and inducibledefence systems in the bark that deter, expel or kill invadingpathogens [6,7], but much less is known about the defence reac-tions in the wood at the molecular level.

Heterobasidion annosum Fr. sensu lato (H. annosum), the causalagent of root and butt rot of various conifers, is a well-knownnecrotroph that is responsible for annual losses of w800 millionV in Europe. The main cause of root and butt rot in Norway spruceis Heterobasidion parviporum (H. parviporum) which colonizes treesthrough bark wounds in the stem or enters fresh stumps andspread to healthy plants through root contact [8]. In response toinfection Norway spruce elicits defence responses in the living barkand sapwood, including changes in size and phenolic content of thepolyphenolic parenchyma cells [9,10], and formation of a woundperiderm [9,11]. The anatomical, physiological and chemicalaspects of Norway spruce defences in the bark have been examinedin recent studies [12e14]. Less is known about defences in thewood, but H. annosum spreads further inwood than in bark of Sitkaspruce seedlings, indicating that resistance responses areweaker in

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e16 11

the wood [15]. Gene expression profiling in the bark has been doneto understand the resistance mechanisms in Norway spruce toH. parviporum [2,4], but there have been no attempts to comparethe expression profile of putative defence genes in bark andsapwood after H. parviporum infection.

Regulation of defence-related genes is a key element in allinducible defence mechanisms in plants [16]. Norway spruceupregulates several pathogen related proteins in response topathogen attack. Chitinases from the host tree hydrolyse chitin,a major component in the cell walls of all true fungi, and chitinasesseem to play important defence roles in many fungus-plantpathosystems, including the release of elicitors [17]. The chitinasePaChi4 is upregulated in stressed and dying Norway spruce tissuesand is a useful marker for local and systemic host response [2].Lignin, the most abundant polymer in trees after cellulose, alsoplays important roles in plant defence. Peroxidases that are up-regulated after pathogen invasion in Norway spruce and otherconifers are involved in lignification and suberization of hosttissues, as well as in production of reactive oxygen species [18e20].The lignin related peroxidases PaPX2 and PaPX3 have a generalstress-induced function and are upregulated in Norway spruce barkin response to H. parviporum infection [21]. Phenylalanineammonia-lyase (PaPAL1 and PaPAL2) has a key role in ligninformation, along with cinnamate 4-hydroxylase (PaC4H) andhydroxyl cinnamoyl CoA (PaHCT) [21e23]. In Norway sprucePaPAL2 seems to be involved in the formation of defence-relatedlignin and be responsible for the increased flux of phenylalanineinto lignin biosynthesis in stressed trees [21]. The ethylene sig-nalling pathway is another important regulator of plant defenceresponse. Ethylene formation in spruce and other plants is regu-lated by two key enzymes; 1-aminocyclopropane-1-carboxylateoxidases (ACO) and 1-aminocyclopropane-1-carboxylic acidsyntheses (ACS) [24]. The ethylene and MeJ signalling pathwaysmay interact with each other and are involved in both plantdevelopment and defence [25]. MeJ-induced ethylene production isresponsible for conifer bark defence responses [26].

Here we document differential expression of nine defencerelated genes in Norway spruce bark and sapwood over a spatialand temporal gradient using qRT-PCR. Because MeJ enhances theresistance of Norway spruce to fungal pathogens [13] it is of interestto compare the expression profiles induced by MeJ treatment andfungal infection. Expression profiling of these key genes willenhance our understanding of their role in local and systemicresistance responses in Norway spruce, and reveal if the systemicdefence responses documented in the bark also are detectable inthe outer sapwood.

2. Material and methods

2.1. Plant material and sampling

Two-year-old Norway spruce saplings generated by somaticembryogenesis from a single clone (AL15886-B10 derived froma single seed from a full-sib family of Picea abies (L.) Karst [Cross \#2650 X _ #2707] produced at Biri Nursery and Seed ImprovementCenter, Norway) were selected for this study [27]. This clone isconsidered highly resistant to fungal infection, as it shows veryshort lesion length and recovers quickly from inoculation withH. parviporum as well as from wounding alone. Forty geneticallyidentical saplings were kept in growth chambers under optimaltemperature (20e22 �C) at ambient day length with200e250 mmol m�2 s�1 light conditions.

Saplings were inoculated with H. parviporum, wounded orpainted with methyl jasmonate (MeJ) on the stem. Plants treatedwith MeJ were kept in a separate chamber under identical

conditions, to avoid effects of volatile MeJ on the other plants. Theheterokaryotic H. parviporum strain 87-257/1 was inoculated intothe stem at 5 cm height from the ground by cutting aw5 mm smallbark flap using a scalpel. A small amount of malt agar (1% malt and1.5% agar) containing actively growing mycelium was placedunderneath the bark flap, pressed firmly against the stem, andsealed with parafilm. Unwounded control plants were wrappedwith parafilm at the corresponding position of the stem. MeJ wasapplied by painting a 1 cm section of the stemwith 100 mMMeJ inwater with the surfactant Tween 20 (0.1%). Water with 0.1% ofTween 20 served as a control for the MeJ treatment. Samples ofbark and sapwood were harvested 1, 3, 6 and 13 days after inocu-lation. Two ramets were harvested at each time point. Sampleswere quick-frozen in liquid nitrogen and stored at �80 C untilanalysis. To study local and systemic gene expression in response tofungal inoculation, three sections of bark and sapwood were ana-lysed separately. The first section was 1 cm long and included theinoculation site and ca 0.5 cm above the upper margin of theinoculation wound. The second and third sections were taken3e5 cm and 6e8 cm above the inoculation site, respectively. Thesections were named B1, B2 and B3 for bark andW1,W2 andW3 forsapwood, with position 1 being closest to the inoculation wound.MeJ treated samples were analysed for local responses in thetreated 1 cm section of the stem only. The unwounded and tweenpainted controls were analysed at the corresponding position, andat each sampling position bark and sapwood tissues were analysedseparately.

2.2. Total RNA extraction and cDNA synthesis

Tissue samples (100e150 mg) were ground first in liquidnitrogen using a mortar and a pestle and then transferred to 2 mleppendorf tubes for fine grinding in a Retsch 300 Mill (RetschGmbh, Haan, Germany) for 1.5 min. The equipment and tissuesamples were kept chilled with N2 throughout the grindingprocess. Isolation of RNA from bark and shoot tissues was doneusing the RNAqueous-Midi� kit (Ambion #1911, Austin, TX, USA)according to the manufacturer’s protocol. RNA from sapwood wasextracted using the RiboPure� kit (Ambion, #1924, Austin, TX,USA) according to the manufacturer’s guidelines. Isolated RNA waspurified from genomic DNA traces by the DNA-Free� kit (Ambion#1906) following the manufacturer’s protocol. Quantification ofobtained RNA was done by spectrophotometer using theRiboGreen� RNA Quantification Kit (R-11490) according to user’smanual. Samples were quantified at standard fluorescence wave-lengths (excitation w480 nm, emission w520 nm). In order tomake cDNA, 300 ng RNA was reverse transcribed using TaqmanReverse Transcription Reagents (Applied Biosystems, Foster City,CA) following instructions prescribed by the manufacturer. Reac-tion mixture was prepared in 50 ml volume and incubated in thethermal cycler at 25 �C for 10 min, then at 48 �C for 30 min, andfinally at 95 �C for 5 min.

2.3. Transcript quantification by real-time qRTePCR

Transcript expression levels were determined by qRT-PCR. qRT-PCR reactions were carried out in a 25 ml volume containing 250 nMof each primer, 2 ml cDNA and 1 � SYBR�Green PCR master mix(Applied Biosystems, #4309155). The 7500 Real-Time PCR System(Applied Biosystems, #4351106) was used for quantification ina 96-well reaction plate using the parameters recommended by themanufacturer (2 min at 50 �C, 10 min at 95 �C and 40 cycles at 95 �Cfor 15 s and 60 �C for 1 min). Samples from two ramets (plants) ofthe clone were used to generate each data point giving two bio-logical replicates. Each cDNA resulting from total RNA extracted

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e1612

from every sample was run twice by qRT-PCR giving two technicalreplicates and the average of these two for each biological samplewere then used in the further data analysis. Before performing qRT-PCR the resulting amplicon of each primer pair was tested onagarose gels and they all corresponded to their expected sizes. Wetested that all the primer pairs gave PCR efficiencies within theacceptable range of 110e90% efficiency from their standard curves.We thereafter verified the specificity of the amplifications.at theend of each PCR-run using the 7500-system SDS dissociation curveanalysis software. Description of PCR primers is given in Table 1.Acquisition and analysis of data were done using the 7500-systemSDS software for absolute quantification and MS Excel for finalcalculations, as described by [28]. Relative transcript amounts werecalculated from raw data obtained from real-time PCR in the formof critical threshold cycle values (dCt). The difference betweenendogenous a-Tubulin and corresponding threshold cycles for thetranscript to be quantified (TARGET) were calculated as X ¼ a-Tubulin � TARGET for all genes measured. To obtain better presen-tation of up- and down-regulation of transcripts, the raw data Xwere further transformed by subtracting the value for the corre-sponding healthy control giving values that are symmetric aroundthe value 0 dCt. Positive values then represent higher and negativevalues lower transcription than average for control plants, and theunit is number of PCR cycles (Figs. 1,2). Since several qRT-PCR basedobservations were made on the same plant for all the plants in thedataset, the transformed values were subjected to repeatedmeasures analysis of variance by use of the GLM and Mixedprocedures in SAS Software (SAS Institute Inc.,Cary, NC, USA)system. Planed comparisons between treatment means were per-formed by use of the pdiff option in the lsmeans statement in theseprocedures.

3. Results

3.1. Peroxidases

Transcripts of the class III peroxidases PaPX2 and PaPX3increased significantly in both bark (p < 0.05) and sapwood(p < 0.02) following inoculation with the necrotrophic pathogenH. parviporum both locally and systemically (Fig. 1). Transcriptlevels were high the first 6 days following inoculation, followed bya dramatic drop to or below constitutive levels by day 13 as the

Table 1Candidate defence genes in Norway spruce analysed by real-time qRT-PCR.

Name GenBankAccession No.

Predicted gene

PaPX3 AM170663,AJ566203

P.abies Peroxidase (PaPX3 gene)

PaPX2 AJ566201 P.abies mRNA for peroxidase (PaPX2 gen

PaChi4 AY450924 P.abies class IV chitinase (PaChi4)

PgACS EF179152 P.glauca PaACC synthase (PaACS4)

PgACO BT112327 P.glauca PaACO-like gene

PaHCT1 AM173211 Hydroxycinnamoyl:CoA shikimate/quinahydroxycinnamoyl transferase (PaHCT1)

PaC4H3/5 AM176009,AM173043

P.abies Cinnamate-4-hydroxylase

PaPAL1 AY952468 P.abies phenylalanine ammonia lyase-likprotein (PaPAL1)

PaPAL2 AM293549 P.abies Phenylalanine ammonia-lyase-likprotein (PaPAL2)

PaaTub X57980S94427

P.abies alpha-tubulin

plants recovered from the infections. The greatest systemic increasein response to the pathogen was seen in the sapwood that peakedat day six at both 3-5 and 6e8 cm above the inoculation site (Fig. 1).Wounding alone also caused a significant (p ¼ <0.02) local andsystemic up regulation of PaPX2 and PaPX3 in bark and sapwood(Fig. 1, S3). PaPX3 dropped back to constitutive levels locally afterwounding in the bark (p ¼ 0.0121) but remained elevated thesapwood until day 13. MeJ induced a significant (p < 0.01) localincrease in PaPX3 in both bark and sapwood, while PaPX2 tran-siently increased only in bark at day 1. In the bark the effect of MeJtreatment on PaPX3was long lasting and stronger than the effect ofpathogen inoculation.

3.2. PaChi4 induction

PaChi4 was the most highly induced gene in response to thepathogen in this study (Fig. 1). PaChi4 was up-regulated locally(p < 0.005) as well as systemically in both bark and sapwood.Transcript levels were elevated from day 1 in the sapwood andincreased until 6 days after fungal infection. Transcript levels in thebark followed the same trend but were lower than in the sapwoodboth locally and systemically. Transcript levels of PaChi4 decreasedtoward constitutive levels in both bark and wood by day 13 as theplants recovered from the infections. Wounding caused a similarlocal and systemic increase in the expression of PaChi4 in the barkand the sapwood, but it was smaller than that caused by fungalinfection (Fig. 1, S3). MeJ induced similar local responses in PaChi4as pathogen inoculation, with increased transcript levels in bothbark and sapwood (p < 0.05) by day 3 and 6, indicating similaritiesin the regulation of PaChi4 by the three treatments, but a return toits constitutive level by day 13 was not seen following MeJ treat-ment (Fig. 1).

3.3. Ethylene signalling

One of the two genes in the ethylene signalling pathway, PaACS,was rapidly and significantly (p< 0.004) up regulated in sapwood butnot in the bark to wounding (Fig. S3). In pathogen infected plants thePaACS expression level tended to be similar to that in the control(Fig. 2).PaACS levelswerenot significantly increasedbyMeJ treatment(Fig. 2). For PaACO there were no significant responses to neitherwounding nor MeJ or the pathogen inoculation. (data not shown).

Froward/reverse primers used in qRT-PCR References

ATGGTGGCGCTGTCAATTC/TGCTGTAGAACGTCCAAGAAAGAC

[21]

e) CGCCCAACTTATCGCTGAGA/TCCACCCGGCTCTTGATG

[21]

GCGAGGGCAAGGGATTCTAC/GTGGTGCCAAATCCAGAAA

[2]

CAAGCAGAATCCCTATGATGCCGAAA/TCTGGATGAGACTTGAGCCAACCTTC

[46]

TGGAACATCGGGCAGTAACAAACG/GACGGAGCCACCTCTGCATCC

[46]

te TGCGAGTGTAATCCATGAAGCTT/GGCTGCAATCCCAAATAGTCTAAA

[21]

CGCCCCGAGCGATTCT/GGCTGCAATCCCAAATAGTCTAAA

[21]

e CAGCCCTCTGCCCAACAG/AGCTGGGTTCTCACGAATTCA

[18]

e TTGCTCGTAGGCACCAATAGC/GCCTTGCCTTCGTTGATAGC

[21]

GGCATACCGGCAGCTCTTC/AAGTTGTTGGCGGCGTCTT

[2]

PaChi4-MeJ

B 1 W 1

PaPX2-H.p.

-4

-2

0

2

4

6

8

10

Rel

ativ

e C

t val

ue

-4

-2

0

2

4

6

8

10PaPX3-MeJPaPX3-H.p.

PaPX2-MeJ

Day1 Day3 Day6 Day13

Plant partsB 1 B 2 B 3 W 1 W 2 W 3

-2

0

2

4

6

8

10

12

14PaChi4-H.p.

Fig. 1. Expression profiles of the peroxidases PaPX2, PaPX3 and PaChi4 in the bark (B) and sapwood (W) of Norway spruce 1e13 days after inoculation with Heterobasidion par-viporum (a, c) or external application of methyl jasmonate (MeJ) (b, d). Numbers following B and W indicate different sampling positions above the treatment site (1 ¼ at treatmentsite; 2 ¼ 3e5 cm above; 3 ¼ 6e8 cm above). One unit of relative Ct value corresponds to a two-fold difference in transcript level (see materials and method for relative Ct valuecalculations). Error bars denote SD.

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e16 13

3.4. Lignin related genes

PaPAL1, PaPAL2, PaC4H3/5 and PaHCT1 were significantly up-regulated locally in the bark (p < 0.05) but not in sapwood bypathogen inoculation (Fig. S1,S2). PaPAL1, PaPAL2 and PaHCT1 weresimilarly regulated in bark after wounding alone, in contrastPaC4H3/5 showed a stochastic pattern of expression (Fig. S3). The

local response in bark to MeJ treatment resulted in higher expres-sion levels than fungal inoculation and wounding alone (Fig. 1,S1,S2,S3) and even after MeJ treatment both PaPAL1 and PaPAL2returned to constitutive levels by day 13 similar to that in responseto the pathogen. There was no statistically significant PaPAL1,PaPAL2, PaC4H3/5 and PaHCT1 increase in the sapwood afterpathogen inoculation (data not shown), wounding nor MeJ

PaACS-H.p.

B 1 B 2 B 3-3

-2

-1

0

1

2

3

Plant parts

PaACS-MeJ

B 1 W 1

Day1 Day3 Day6 Day13

Rel

ativ

e C

t val

ue

Fig. 2. Transcript increase profiles of PaACS in the bark (B) and sapwood (W) of Nor-way spruce after inoculation with Heterobasidion parviporum or treatment with methyljasmonate (MeJ). Numbers following B and W indicate different sampling positionsabove the treatment site (1 ¼ at treatment site; 2 ¼ 3e5 cm above; 3 ¼ 6e8 cm above).One unit of relative Ct value corresponds approximately to a two-fold increase intranscript level (see materials and method for relative Ct value calculations). Error barsdenote SD.

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e1614

treatments for these gene products. These responses suggestsimilarities between the effect of MeJ, pathogen and woundingalone on these lignin related genes.

4. Discussion

This is the first study to compare transcript levels of defence-related genes in bark and sapwood of Norway spruce. We fol-lowed spatiotemporal changes in genes of the lignin/phenyl-propanoid pathway, the chitinase PaChi4, the peroxidases PaPX3and PaPX3, as well as two ethylene related genes in 2-year-oldclonal plants after inoculation with the necrotroph H. parviporum,wounding alone andMeJ treatment. These results demonstrate thatthe local and systemic host responses to pathogen infection andwounding largely correspond and reveal striking similaritiesbetween the local response to a necrotroph, wounding and MeJtreatment in both bark and living wood.

A thorough understanding of the regulation of defence-relatedgenes in Norway spruce is important to understand the mecha-nisms of tree resistance against H. parviporum and how MeJ can beused to prime tree resistance. The systemic expression of peroxi-dases and chitinases suggests the presence of systemic signallingcascades in Norway spruce [2,18,29]. Previous studies have estab-lished that some Norway spruce trees that are resistant toH. parviporum have been found to have very high transcripts levelsof defence related genes (e.g. peroxidases, class IV chitinase andothers) [2,30], and they also appear to respond quicker to pathogenattack than susceptible genotypes.

In conifers and other plants induced defence responses toinvading organisms are associated with cell wall modificationthrough lignification and suberization [31]. We found the ligninrelated peroxidases PaPX3 and PaPX2 were induced after bothinoculation and wounding, supporting the suggestion that theyhave general stress-induced and host defence functions [21].Transcript levels of PaPX2 were higher in the bark, while PaPX3transcripts were more abundant in the sapwood, contributing toan elevated systemic peroxidase response in both tissues. Thisexpression pattern has also been observed by Adomas et al. [32] inPinus sylvestris roots inoculated with H. annosum. It confirmsa very active participation of peroxidases in host defence in manytissue types. The quick and strong expression of peroxidases

systemically agrees with previous studies in very young Norwayspruce seedlings and tissue cultures, where strong upregulationwas observed 12e48 h after inoculation [30,33,34]. Kärkönen andco-workers [34] observed peak levels of peroxidases in cell cultureof Norway spruce as quickly as 30 min after inoculation withH. annosum. Rapid induction of peroxidases can be used asa possible future molecular marker to identify resistant genotypesof Norway spruce.

Chitinases in the tree degrade the chitin in fungal cell walls bybreaking the glycosidic bonds, and the resulting oligomers frag-ments act as elicitors that stimulate plant defence responses[35e37]. Chitinases are upregulated in plant parts where fungalgrowth is then inhibited by resultant swelling and lysis of fungalhyphal tips [38]. Most previous studies of chitinases in conifershave focused on gene expression in bark tissue, and in Norwayspruce differential expression of chitinases has been reported bothin barks of mature trees and in callus cultures [2,30]. We found thatearly local and systemic increase in transcript levels of the chitinasePaChi4 were even greater in the sapwood than in the bark toH. parviporum, suggesting significant defence response also in thesapwood of these 2-year-old saplings. We may speculate that thehigher chitinase level in the sapwood is due to defence signallingfrom the bark through the rays that run radially trough the barkinto the sapwood. Additionally, the faster systemic expression ofPaChi4 in the living wood than in the bark suggests that the hostdefence signal may travel in the xylem, but this remains to beverified. Pathogen infection, wounding and MeJ applicationinduced very similar local expression of PaChi4, and parallel simi-larities have been observed in an anatomical study of Norwayspruce [13]. It is generally believed that exogenous application ofMeJ induces typical defence responses in Norway spruce [6,26].However, the exact mechanisms responsible for enhanced treeresistance after MeJ treatment remain unclear, but MeJ might beinvolved in the recovery from wounding and efficient defenseagainst necrotrophic pathogens both locally and systemically.

Reinforcement of cell walls by lignin deposition is a commonresponse to pathogen infection in plants. The first step in ligninbiosynthesis is deamination of phenylalanine by the enzymephenyl alanine ammonia-lyase (PAL) [30,39,40], and it is welldocumented that PAL activity is related to lignification [41,42]. It isthus of interest to study changes in expression of PaPAL1, PaPAL2,and other genes involved in lignin synthesis, such as PaC4H3/5 andPaHCT1, in response to H. parviporum infection. Norway spruceclones that are relatively resistant to H. parviporum have beenfound to have higher transcript levels of PaPAL than more suscep-tible clones [30]. Our data show that PaPAL transcript levels in thebark rapidly decreased to normal levels after reaching theirmaximum by six days after induction, and this coincides with theinfection being defeated and recovery from wounding in theseplants. These results are in line with Likar & Regvar [43],who foundthat PaPAL transcript levels peaked in Norway spruce shoots fivedays after inoculation with H. annosum, and with Koutaniemi et al.[21] who found significantly up-regulation of PaPAL2 in Norwayspruce bark after H. annosum infection. Increased PAL activity afterpathogen infection, together with upregulation of peroxidases,suggests a role in cell wall strengthening by increased lignificationin Norway spruce.

The second step in the lignin biosynthetic pathway is catalysedby cinnamate 4-hydroxylase (C4H), which converts trans-coumaricacid to para-coumaric acid [1]. We observed upregulation ofPaC4H3/5 transcript levels locally in the bark after pathogeninfection but no significant response to wounding alone, reminis-cent of Koutaniemi et al. [21] that found increased transcript levelsin the bark of 32-year-old Norway spruce tree 14 days afterH. annosum inoculation.

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e16 15

The third gene in the lignin pathway that we studied wasPaHCT1. We observed a 3-fold increase locally in the bark after MeJtreatment, and suppression to below constitutive levels in theliving wood, was also saw an increase after pathogen infection butno significant response to wounding alone. Previous work hasshown PaHCT1 to be up-regulated 4-fold in the bark of 32-year-oldNorway spruce 14 days after H. parviporum inoculation [21]. Thesedata indicate that MeJ treatment and pathogen infection inducessimilar defence responses in the bark.

Interaction or cross-talk between the ethylene and MeJ signaltransduction pathways is important in the defence responses ofmany plants [25], including Arabidopsis thaliana [44] and coniferssuch as Douglas fir [24]. Similarities between angiosperms andgymnosperm plants, separated by 300 million years of evolution,suggest that these signal transduction pathways have very ancientroots. In conifers ethylene and MeJ seem to induce similar defenceresponses as wounding, insect attack or fungal infection [26,45].We studied two genes in the ethylene pathway, PaACO and PaACS,but our data do not allow us to draw any firm conclusions about thesimilarity in the ethylene response of Norway spruce to pathogeninfection and MeJ treatment. PaACO catalyses the final step in theethylene biosynthesis pathway and is represented by a single genein the Pinaceae family [24]. We found no effect of MeJ treatment onPaACO expression, whereas fungal inoculation seemed to inducea delayed, systemic up regulation of PaACO in the sapwood but notin bark, but this trend was not statistically significant (data notshown). Delayed increase of ACO was found by Ralph et al. [46],who studied PsACO expression in Sitka spruce after wounding andinsect herbivory. PaACS on the other hand was insignificantlyupregulated in response to MeJ treatment, but remained close toconstitutive levels after fungal inoculation, while statisticallysignificant increase were only seen in the sapwood both locally andsystemically in response to wounding alone. The non-responsiveness of PaACS to fungal inoculation, wounding and MeJin the bark agrees with Ralph et al. [46], where PaACS remainedclose to constitutive levels in Sitka spruce bark after wounding andinsect herbivory. Previously, MeJ has been found to induce highlevels of ethylene in Douglas fir [26], where MeJ treated stems had77-fold higher ethylene production than wounded stems. Weobserved a much more modest induction of PaACS in response towounding, with four-fold higher transcripts locally in the sapwood.

Data from Sitka spruce seedlings suggest that resistanceresponses toHeterobasidion infection aremuch weaker in the livingwood than in the bark [15]. However, our results indicate thatseveral local and systemic defence responses are upregulated in thesapwood of Norway spruce saplings resistant to H. parviporum, andsome transcripts were even upregulated more strongly and fora longer time after infection in the sapwood than in the bark. Thisagrees with the observation that 2-year-old Sitka spruce cloneswith high resistance to H. annosum are able to limit the growth ofthis pathogen not only in the bark but also in the living wood [15].

Among the nine genes examined in this study PaPX2, PaPX3 andPaChi4 were highly expressed in both bark and sapwood afterwounding and pathogen inoculation and appeared to play themostimportant role in defence response both locally and systemically.Genes involved in lignin biosynthesis were more responsive to MeJtreatment than to inoculation with H. parviporum or woundingalone. In general, MeJ treatment induced s higher and longer lastingtranscript levels than fungal inoculation in the bark. However, evenif the fungal inoculation tended to induced higher levels of PaChi4,PaPX2 and PaPX3 in the living wood than MeJ the similaritiesbetween the host response to the necrotroph, wounding and MeJtreatment are more striking than the differences. In addition toincreasing our knowledge of local and systemic defence responsesin Norway spruce secondary phloem and xylem to MeJ, wounding

and pathogen infection this study may contribute to resistancebreeding by providing breeders with possible tools to determinetree resistance at an early age by quantifying gene expressionpatterns in the bark and sapwood.

Acknowledgements

We thank Lars Dalen for help and support during samplecollection, Inger Heldal for help with sample preparation andguidance in the lab. The project was supported by the ResearchCouncil of Norway (Grant No 136001).

Appendix. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.pmpp.2011.11.001.

References

[1] Kombrink E, Somssich IE, Callow JA, Andrews JH, Inez CT. Defense responses ofplants to pathogens. advances in botanical research. Academic Press; 1995. pp.1e34.

[2] Hietala AM, Kvaalen H, Schmidt A, Johnk N, Solheim H, Fossdal CG. Temporaland spatial profiles of chitinase expression by Norway spruce in response tobark colonization by Heterobasidion annosum. Applied and EnvironmentalMicrobiology 2004;70:3948e53.

[3] Lorenzo O, Solano R. Molecular players regulating the jasmonate signallingnetwork. Current Opinion in Plant Biology 2005;8:532e40.

[4] Fossdal CG, Hietala AM, Kvaalen H, Solheim H. Changes in host chitinaseisoforms in relation to wounding and colonization by Heterobasidion anno-sum: early and strong defense response in 33-year-old resistant Norwayspruce clone. Tree Physiology 2006;26:169e77.

[5] Bowles DJ. Defense-related proteins in higher plants. Annual Review ofBiochemistry 1990;59:873e907.

[6] Franceschi VR, Krokene P, Christiansen E, Krekling T. Anatomical and chemicaldefenses of conifer bark against bark beetles and other pests. New Phytologist2005;167:353e75.

[7] Bonello P, Gordon TR, Herms DA, Wood DL, Erbilgin N. Nature and ecologicalimplications of pathogen-induced systemic resistance in conifers: a novelhypothesis. Physiological and Molecular Plant Pathology 2006;68:95e104.

[8] Asiegbu FO, Adomas A, Stenlid J. Conifer root and butt rot caused by Hetero-basidion annosum (Fr.) Bref. s.l. Molecular Plant Pathology 2005;6:395e409.

[9] Franceschi VR, Krokene P, Krekling T, Christiansen E. Phloem parenchymacells are involved in local and distant defense responses to fungal inoculationor bark-beetle attack in Norway spruce (Pinaceae). American Journal ofBotany 2000;87:314e26.

[10] Krokene P, Solheim H, Krekling T, Christiansen E. Inducible anatomicaldefense responses in Norway spruce stems and their possible role in inducedresistance. Tree Physiology 2003;23:191e7.

[11] Nagy NE, Franceschi VR, Solheim H, Krekling T, Christiansen E. Wound-induced traumatic resin duct development in stems of Norway spruce(Pinaceae): anatomy and cytochemical traits. American Journal of Botany2000;87:302e13.

[12] Erbilgin N, Krokene P, Christiansen E, Zeneli G, Gershenzon J. Exogenousapplication of methyl jasmonate elicits defenses in Norway spruce (Piceaabies) and reduces host colonization by the bark beetle Ips typographus.Oecologia 2006;148:426e36.

[13] Krokene P, Nagy NE, Solheim H. Methyl jasmonate and oxalic acid treatmentof Norway spruce: anatomically based defense responses and increasedresistance against fungal infection. Tree Physiology 2008;28:29e35.

[14] Zhao T, Krokene P, Bjorklund N, Langstrom B, Solheim H, Christiansen E, et al.The influence of Ceratocystis polonica inoculation and methyl jasmonateapplication on terpene chemistry of Norway spruce, Picea abies. Phytochem-istry 2010;71:1332e41.

[15] Bodles WJA, Fossdal CG, Woodward S. Multiplex real-time PCR detection ofpathogen colonization in the bark and wood of Picea sitchensis clones differingin resistance to Heterobasidion annosum. Tree Physiology 2006;26:775e82.

[16] Edreva A. Pathogenesis-related proteins: research progress in the last 15years. General and Applied Plant Physiology 2005;31:20.

[17] Davis JM, Wu HG, Cooke JEK, Reed JM, Luce KS, Michler CH. Pathogen chal-lenge, salicylic acid, and jasmonic acid regulate expression of chitinase genehomologs in pine. Molecular Plant-Microbe Interactions 2002;15:380e7.

[18] Fossdal CG, Sharma P, Lonneborg A. Isolation of the first putative peroxidasecDNA from a conifer and the local and systemic accumulation of relatedproteins upon pathogen infection. Plant Molecular Biology 2001;47:423e35.

[19] Yoshida K, Kaothien P, Matsui T, Kawaoka A, Shinmyo A. Molecular biologyand application of plant peroxidase genes. Applied Microbiology andBiotechnology 2003;60:665e70.

N. Yaqoob et al. / Physiological and Molecular Plant Pathology 77 (2012) 10e1616

[20] Passardi F, Cosio C, Penel C, Dunand C. Peroxidases have more functions thana Swiss army knife. Plant Cell Reports 2005;24:255e65.

[21] Koutaniemi S, Warinowski T, Kärkönen A, Alatalo E, Fossdal CG, Saranpaa P,et al. Expression profiling of the lignin biosynthetic pathway in Norwayspruce using EST sequencing and real-time RT-PCR. Plant Molecular Biology2007;65:311e28.

[22] Wagner A, Ralph J, Akiyama T, Flint H, Phillips L, Torr K, et al. Exploringlignification in conifers by silencing hydroxycinnamoyl-CoA: shikimatehydroxycinnamoyl transferase in Pinus radiata. Proceedings of theNational Academy of Sciences of the United States of America 2007;104:11856e61.

[23] Vanholme R, Morreel K, Ralph J, Boerjan W. Lignin engineering. CurrentOpinion in Plant Biology 2008;11:278e85.

[24] Hudgins JW, Ralph SG, Franceschi VR, Bohlmann J. Ethylene in induced coniferdefense: cDNA cloning, protein expression, and cellular and subcellularlocalization of 1-aminocyclopropane-1-carboxylate oxidase in resin duct andphenolic parenchyma cells. Planta 2006;224:865e77.

[25] Almagro L, Gómez Ros LV, Belchi-Navarro S, Bru R, Ros Barceló A, Pedreño MA.Class III peroxidases in plant defence reactions. Journal of ExperimentalBotany 2009;60:377e90.

[26] Hudgins JW, Franceschi VR. Methyl jasmonate-induced ethylene production isresponsible for conifer phloem defense responses and reprogramming of stemcambial zone for traumatic resin duct formation. Plant Physiology 2004;135:2134e49.

[27] Kvaalen H, Johnsen O. Timing of bud set in Picea abies is regulated bya memory of temperature during zygotic and somatic embryogenesis. NewPhytologist 2008;177:49e59.

[28] Johnsen O, Daehlen OG, Ostreng G, Skroppa T. Daylength and temperatureduring seed production interactively affect adaptive performance of Piceaabies progenies. New Phytologist 2005;168:589e96.

[29] Nagy NE, Fossdal CG, Dalen LS, Lonneborg A, Heldal I, Johnsen O. Effects ofRhizoctonia infection and drought on peroxidase and chitinase activity inNorway spruce (Picea abies). Physiologia Plantarum 2004;120:465e73.

[30] Karlsson M, Hietala AM, Kvaalen H, Solheim H, Olson A, Stenlid J, et al.Quantification of host and pathogen DNA and RNA transcripts in the inter-action of Norway spruce with Heterobasidion parviporum. Physiological andMolecular Plant Pathology 2007;70:99e109.

[31] Lagrimini LM, Joly RJ, Dunlap JR, Liu TTY. The consequence of peroxidaseoverexpression in transgenic plants on root growth and development. PlantMolecular Biology 1997;33:887e95.

[32] Adomas A, Heller G, Li G, Olson Å, Chu T-M, Osborne J, et al. Transcriptprofiling of a conifer pathosystem: response of Pinus sylvestris root tissues topathogen (Heterobasidion annosum) invasion. Tree Physiology 2007;27:1441e58.

[33] Fossdal CG, Nagy NE, Johnsen O, Dalen LS. Local and systemic stress responsesin Norway spruce: similarities in gene expression between a compatiblepathogen interaction and drought stress. Physiological and Molecular PlantPathology 2007;70:161e73.

[34] Kärkönen A, Warinowski T, Teeri T, Simola L, Fry S. On the mechanism ofapoplastic H2O2 production during lignin formation and elicitation in culturedspruce cellsdperoxidases after elicitation. Planta 2009;230:553e67.

[35] Brunner F, Stintzi A, Fritig B, Legrand M. Substrate specificities of tobaccochitinases. Plant Journal 1998;14:225e34.

[36] Salzman RA, Brady JA, Finlayson SA, Buchanan CD, Summer EJ, Sun F, et al.Transcriptional profiling of sorghum induced by methyl jasmonate, salicylicacid, and aminocyclopropane carboxylic acid reveals cooperative regulationand novel gene responses. Plant Physiology 2005;138:352e68.

[37] Frettinger P, Herrmann S, Lapeyrie F, Oelmuller R, Buscot F. Differentialexpression of two class III chitinases in two types of roots of Quercus roburduring pre-mycorrhizal interactions with Piloderma croceum. Mycorrhiza2006;16:219e23.

[38] Kasprzewska A. Plant chitinaseseregulation and function. Cellular andMolecular Biology Letters 2003;8:16.

[39] Elkind Y, Edwards R, Mavandad M, Hedrick SA, Ribak O, Dixon RA, et al.Abnormal plant development and down-regulation of phenylpropanoidbiosynthesis in transgenic tobacco containing a heterologous phenylalanineammonia-lyase gene. Proceedings of the National Academy of Sciences of theUnited States of America 1990;87:9057e61.

[40] Bate NJ, Orr J, Ni W, Meromi A, Nadler-Hassar T, Doerner PW, et al. Quanti-tative relationship between phenylalanine ammonia-lyase levels and phe-nylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis. Proceedings of the NationalAcademy of Sciences of the United States of America 1994;91:7608e12.

[41] Zhang XH, Chiang VL. Molecular cloning of 4-coumarate:coenzyme A ligase inloblolly pine and the roles of this enzyme in the biosynthesis of lignin incompression wood. Plant Physiology 1997;113:65e74.

[42] Whetten R, Sun YH, Zhang Y, Sederoff R. Functional genomics and cell wallbiosynthesis in loblolly pine. Plant Molecular Biology 2001;47:275e91.

[43] Likar M, Regvar M. Early defence reactions in Norway spruce seedlingsinoculated with the mycorrhizal fungus Pisolithus tinctorius (Persoon) Coker &Couch and the pathogen Heterobasidion annosum (Fr.) Bref. Trees-Structureand Function 2008;22:861e8.

[44] Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, et al.Coordinated plant defense responses in Arabidopsis revealed by microarrayanalysis. Proceedings of the National Academy of Sciences of the United Statesof America 2000;97:11655e60.

[45] Martin D, Tholl D, Gershenzon J, Bohlmann J. Methyl jasmonate inducestraumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumu-lation in developing xylem of Norway spruce stems. Plant Physiology 2002;129:1003e18.

[46] Ralph SG, Hudgins JW, Jancsik S, Franceschi VR, Bohlmann J. Amino-cyclopropane carboxylic acid synthase is a regulated step in ethylene-dependent induced conifer defense. full-length cDNA cloning of a multigenefamily, differential constitutive, and wound- and insect-induced expression,and cellular and subcellular localization in spruce and Douglas fir. PlantPhysiology 2007;143:410e24.