Decreased levels of cGMP in CSF are associated with cognitive decline and amyloid pathology in...

This article is protected by copyright. All rights reserved.

Decreased levels of cGMP in CSF are associated with cognitive decline and amyloid

pathology in Alzheimer’s disease1

Authors: Ana Ugarte1a

, Francisco Gil-Bea2a

, Carolina García-Barroso2, Ángel Cedazo-

Minguez3, M. Javier Ramírez

4, Rafael Franco

5, Ana García-Osta

2,b, Julen Oyarzabal

1,b* &

Mar Cuadrado-Tejedor2,6,b*

Author affiliations

1 Small Molecule Discovery Platform, Molecular Therapeutics Program. Center for Applied

Medical Research CIMA, University of Navarra, Pamplona, Spain

2 Neurobiology of Alzheimer´s disease, Neurosciences Division, Center for Applied

Medical Research, CIMA, University of Navarra, Pamplona, Spain.

3 KI-Alzheimer's Disease Research Center, Department of Neurobiology, Care Sciences

and Society, Karolinska Institutet, 14186 Huddinge, Sweden

4 Department of Pharmacology, University of Navarra, Pamplona, Spain.

5 Present address: Dept. Biochemistry and Molecular Biology. Universitat de Barcelona.

Barcelona. Spain

6 Department of Anatomy, University of Navarra, Pamplona, Spain

a Both authors contributed equally to this work

b Equal contribution

This article has been accepted for publication and undergone full peer review but has not been through the

copyediting, typesetting, pagination and proofreading process, which may lead to differences between this

version and the Version of Record. Please cite this article as doi: 10.1111/nan.12203 Acc

epte

d A

rticl

e


*Corresponding authors: Mar Cuadrado-Tejedor, Division of Neurosciences and Julen

Oyarzabal, Small Molecule Discovery Platform, CIMA, University of Navarra, Av. Pio XII

55, 31008 Pamplona, Spain.

Email: [email protected] and [email protected]

Phone number: 011 34 948 19 47 00 (2023/2044); Fax number: 011 34 948 19 47 15.

Abstract

Aims: Levels or the cyclic nucleotides cGMP or cAMP that play important roles in

memory processes are not characterized in Alzheimer´s disease (AD). The aim of this study

was to analyze the levels of these nucleotides in cerebrospinal fluid (CSF) samples from

patients diagnosed with clinical and prodromal stages of AD and study the expression level

of the enzymes that hydrolized them (phosphodiesterases: PDEs) in the brain of AD

patients vs controls.

Methods: For cGMP and cAMP CSF analysis the cohort (n=79) included cognitively

normal participants (SCI), individuals with mild cognitive impairment stable or AD

converters (sMCI and cMCI) and mild AD patients. A high throughput liquid

chromatography–mass spectrometry method (LC-MS/MS) was used. Interactions between

CSF cGMP or cAMP with MMSE score, CSF Aβ(1-42), and CSF p-tau were analyzed. For

PDE4, 5, 9 and 10 expression analysis, brains of AD patients vs controls (n=7 and n=8)

were used. Acc

epte

d A

rticl

e


Results: cGMP, and not cAMP levels, were significantly lower in the CSF of patients

diagnosed with mild-AD when compared to non-demented controls. CSF levels of cGMP

showed a significant association with MMSE-diagnosed clinical dementia and with CSF

biomarker Aβ42 in AD patients. Significant increase in PDE5 expression was detected in

temporal cortex of AD patients compared to that of age-matched healthy control subjects.

No changes in the expression of others PDEs were detected.

Conclusions: These results support the potential involvement of cGMP in the pathological

and clinical development of AD. The cGMP reduction in early stages of AD might

participate in the aggravation of amyloid pathology and cognitive decline.

Keywords: cGMP, phosphodiesterase, cerebrospinal fluid, memory function

Introduction

Cyclic nucleotides adenosine 3', 5'-monophosphate (cAMP) and guanosine 3', 5'-

monophosphate (cGMP) are second messengers that are required for the proper

development and function of the brain. Modulation of cAMP and cGMP concentration

occurs by the enzymes involved in their synthesis (adenylate and guanylate cyclase) and

those involved in their degradation (phosphodiesterases, PDEs) [1,2]. These cyclic

nucleotides play an important role in different phases of memory formation processes (for

review in [3,4]). In this sense, the ability of different inhibitors of PDEs to improve long-

term memory consolidation in rodents [5] and to reverse the memory deficits in Acc

epte

d A

rticl

e


Alzheimer´s disease (AD) mouse models has been demonstrated (review in [4]), by raising

the concentrations of cAMP and/or cGMP nucleotides. An imbalance in the cyclic

nucleotides’ signaling caused by an inadequate control by these enzymes may contribute to

the synaptic deficits occurring in neurodegenerative disorders associated with dementia.

Thus, PDE inhibitors could offer novel therapeutic strategies for restoring memory function

in patients with dementia. It has been shown that cGMP levels are decreased in the

hippocampus, but not in the cerebellum, of aged rats [6]. Nevertheless, levels of cGMP or

cAMP and the expression of PDEs in AD brains are not well characterized.

Despite the fact that cyclic nucleotides are intracellular second messengers, considerable

amounts have been found in body fluids as urine, blood and cerebrospinal fluid (CSF). In

the CSF compartment, whose composition closely mirrors that of the brain, reflecting

metabolic and biochemical changes within the central nervous system, cyclic nucleotides

have been found to be in a dynamic equilibrium [7]. The assessment of cGMP and cAMP

concentrations in CSF of patients with neurodegenerative disorders might add important

knowledge on the role of these cyclic nucleotides in the disease and might also have

clinical diagnostic purpose.

To date, there is one study that has identified decreased CSF levels of cAMP and cGMP in

Creutzfeldt-Jakob disease but not in Parkinson´s disease and amyotrophic lateral sclerosis

[8]. However, levels of these cyclic nucleotides in CSF of AD patients and their implication

in the disease progression have not been studied in detail; so far, one study with small

number of subjects showed an increase in cAMP but no changes in cGMP levels in the CSF Acc

epte

d A

rticl

e


of AD patients [9]. In the present study we used CSF samples from patients diagnosed with

clinical and prodromal stages of AD in order to assess the levels of cAMP and cGMP and

characterize the association of these cyclic nucleotides with the clinical and pathological

progression of AD. We have developed and implemented a high throughput LC-MS/MS

method that offers a very sensitive, robust and highly selective analysis of cAMP and

cGMP in CSF samples. Further, the expression level of PDE type 4, 5, 9 and 10 was also

studied in the temporal cortex of AD patients.

Methods

Assessment of cGMP and cAMP in CSF of AD patients

Participants

The 79 participants included in this study were from the Memory Clinic at the Karolinska

University Hospital in Huddinge, Sweden. As shown in Table 1, 27 patients with subjective

cognitive impairment (SCI) were grouped as controls since they had cognitive complaints

without impairment on objective cognitive tasks; 24 individuals suffered from mild

cognitive impairment (MCI) but did not convert to AD after a follow-up of 2 years (stable

MCI or sMCI); 11 patients with MCI that converted to AD after follow-up (cMCI); and 17

patients had mild AD. These patients were all living independently in the community. They

were evaluated according to a standard comprehensive assessment protocol including

clinical examination, brain imaging, electroencephalography, analyses of blood (serum Acc

epte

d A

rticl

e


albumin, glucose) and CSF (including albumin, total tau (T-Tau), phospho-tau (P-Tau181),

and Aβ42 and a detailed neuropsychological evaluation. Dementia and AD were diagnosed

according to DSM-IV and NINCDS-ADRDA criteria. Inclusion criteria for the AD group

were MMSE score between 20 and 26, CDR scale score of 0.5 or 1 and NINCDS/ADRDA

criteria for probable AD. For inclusion in the MCI groups, criteria were a MMSE score

between 24 and 30, CDR score of 0.5, absence of significant levels of impairment in other

cognitive domains, preservation of activities of daily life and absence of dementia.

Inclusion criteria for the SCI group were MMSE score between 24 and 30, CDR score of 0,

and absence dementia. Women under hormonal replacement therapy, as well as patients

with psychiatric disorders (i.e. depression, alcohol abuse) or other conditions (i.e. diabetes,

brain tumors, normal pressure hydrocephalus) were not included. The study was conducted

under the guidelines of the Declaration of Helsinki and approved by the ethics committee of

the Karolinska Institutet.

CSF collection

CSF was collected for diagnostic purpose by lumbar puncture as previously described [10].

CSF extraction is routinely performed at the Karolinska University Hospital Memory clinic

in Huddinge (Sweden) as part of the medical examination. The extractions were performed

in the mornings in fasting patients. CSF samples were obtained from L3/L4 or L4/L5

interspaces after local anaesthetic infiltration in the skin. After disposal of the first mL, the

following 10 mL were collected in polypropylene tubes. No sample containing more than

500 erythrocytes/μL CSF was used. Samples were gently mixed to avoid gradient effects Acc

epte

d A

rticl

e


and centrifuged at 2000×g at 4ºC for 10 min to eliminate cells and insoluble material.

Supernatants were aliquoted, immediately frozen and stored at -80 °C pending biochemical

analyses. Tau was determined using a sandwich enzyme-linked immunoabsorbent assay

(ELISA) [11]. P-Tau181 (P-Thr181) was determined using a sandwich ELISA, with

monoclonal antibody HT7 (recognizing all forms of Tau) used as capturing antibody, and

AT270 (specific to P-Tau181) used as a detection antibody [12]. Aβ42 was determined

using a sandwich ELISA as previously described [13]. All kits were purchased from

Innogenetics NV, Ghent, Belgium.

LC-MS/MS analysis of cAMP and cGMP

The use of stable isotope analogs in combination with LC-MS/MS provides the highest

possible analytical specificity for quantitative determinations of the small amounts of

cAMP and cGMP in CSF.

Several techniques have been employed to determine cAMP and/or cGMP in biological

samples. Currently ELISA is the most applied method to quantify cAMP and cGMP [14-

17]. Although ELISA assays have adequate sensitivity, they only allow the determination

of one compound at time and may lead to cross-reactivity issues (selectivity over GMP,

AMP, cUMP and other nucleoside analogues); therefore, methods with no specificity

questions are desired. Liquid chromatography (LC) with photo diode array (DAD) [18] or

fluorescence detection [19] has also been used for the analysis of these cyclic nucleotides.

DAD methods have low sensitivity, and fluorescent detection implies time-consuming and Acc

epte

d A

rticl

e


troublesome procedures. LC-MS/MS is sensitive and selective, enabling simultaneous

analysis of several analytes. Mass spectrometric quantitation can be further improved by

the use of stable isotope-labeled analogs of the analytes as internal standards, which

compensate for variability in sample preparation and instrumental analysis as well as

matrix-induced ion suppression (particularly useful for the analysis of endogenous analytes,

such as cyclic nucleotides). To the best of our knowledge, there are only 2 LC-MS/MS

methods published that quantify both cAMP and cGMP in biological samples; both

methods have been developed by pharmaceutical companies, Boehringer-Ingelheim [20]

and Pfizer [21].

Chemicals and reagents. HPLC grade acetonitrile was purchased from Merck (Darmstadt,

Germany) and LC-MS grade methanol from Scharlau Chemie (Barcelona, Spain). LC-MS

grade formic acid and acetic acid were provided by Sigma-Aldrich (St. Louis, USA). 3’,5’-

cGMP and 3’,5’-cAMP were obtained from Carbosynth (Berkshire, UK). The stable

isotope-labeled 13

C,15

N2-cGMP and 13

C5-cAMP, used as internal standards, were supplied

by Toronto Research Chemicals (Toronto, Canada). Ultrapure water (18MΩcm) was

generated using a Milli-Q system (Millipore, Bedford, MA, USA). The chemical structures

of analytes and internal standards are shown in Figure 1.

Stock solutions. Stock solutions of analytes and isotopically labeled internal standards were

prepared at a concentration of 1 mM in 50 % methanol in water and stored at – 80 °C. The

stock solutions were thawed and diluted immediately before use. Acc

epte

d A

rticl

e


Calibration and quality control samples. Fresh calibration standards were prepared on the

day of analysis from stock solutions. Calibration samples were prepared in human CSF or

water at concentrations ranging from approximately 0.15 nM to 15 nM for cGMP and from

0.26 nM to 70 nM for cAMP. Quality control (QC) samples at four concentrations were

prepared by spiking the human CSF with the appropriate amounts of cyclic nucleotide

standard solutions. As physiological concentrations of cAMP are higher than those of

cGMP, calibration ranges were different for both analytes, and QC levels were also

adjusted to this fact.

Sample preparation. Ostro 96-well plates from Waters (Manchester, UK) were used for

sample preparation, which selectively remove phospholipids from protein-precipitated

samples and require minimal method development. The CSF samples (25 µL) were pipetted

into the wells, followed by the addition of 100 µL of 2% formic acid in acetonitrile (4:1

solvent/sample) for in-well protein precipitation. This protein precipitation solvent

contained 10 nM of 13

C5-cAMP and 5 nM of 13

C,15

N2-cGMP, the internal standards. The

mixture was then mixed by pipetting several times (3-4) and samples were filtered using a

vacuum manifold (15 in.). Samples, collected in the 96-well collection plate, were then

evaporated at 37 °C under a stream of nitrogen and reconstituted in 35 µL of a mixture of

0.05% acetic acid in water and methanol (95:5, v:v). A 10 µL aliquot of the resulting

solution was injected onto the LC-MS/MS system for analysis. CSF samples, QC samples

and calibration standards were subjected to the same sample preparation procedure.

Acc

epte

d A

rticl

e


LC-MS/MS analysis. LC–MS analysis was performed with an ACQUITY ultra performance

liquid chromatographic system coupled to a Xevo TQ MS triple quadrupole mass

spectrometer equipped with an electrospray ionization interface (both from Waters). For

details regarding chromatographic and mass spectrometric conditions, and mass

spectrometric settings for the measured transitions see Supplementary Material. Under

selected conditions cAMP and cGMP have retention times of 2.26 min and 1.66 min,

respectively (Fig. 2).

PDE expression in AD brains

Patients, clinical and neuropathological data

Brain tissues were obtained from the Oxford Project to Investigate Memory and Ageing

(OPTIMA)/Thomas Willis Oxford Brain Collection, part of the Brains for Dementia

Research network. Subjects had been assessed annually for cognitive status using the Mini-

Mental State Examination [22]. At death, informed consent had been obtained from the

patients’ next-of-kin before collection of brains. All subjects fulfilled CERAD criteria for

the neuropathological diagnosis of AD and were staged at Braak V / VI. Controls did not

have dementia or other neurological diseases, did not meet CERAD criteria for AD

diagnosis, and were staged at Braak 0-II. Temporal (Brodmann Area, BA20) cortex were

dissected free of meninges. All tissue used had a brain pH>6.1, condition used as an

indication of tissue quality in post-mortem research [23].

RNA extraction and RT-PCR Acc

epte

d A

rticl

e


Total RNA was isolated using the Trizol reagent (Invitrogen Life Technologies, Carlsbad,

CA, USA) from the human brain (temporal cortex) samples. The RNA was treated with

DNase (µg/µL) at 37 °C for 30 min and reverse-transcribed into cDNA. Real-time

quantitative PCR assays were performed in triplicate in the presence of SYBRgreen to

detect the amplification products. Samples were analyzed simultaneously for 36B4 as

internal control using an ABI Prism 7300 sequence detector (Applied Biosystems, Foster

City, CA, USA) using Power SYBR™ Green PCR Master Mix (Applied Biosystems) and

specific primers. For human PDE4D (forward primer 5′-

ACGGACCGGATAATGGAGGAG; reverse primer 5′- ATTTTTCCACGGAAG

CATTGTG) human PDE5 (forward primer 5′-CCTTGCAGAACAGCAGGAGAAG-3′;

reverse primer 5′- GGCATATTGCAGAACACACCATC-3′; forward primer 5′-

ATCAGGAAACGGTGGGACATTTAC-3´; reverse primer 5′- CTTGTTCTCC

AGCAGTGAAGTCTC-3´), human PDE9 (forward primer 5′-CCACGACA

ACTACAGAAACAACC, reverse primer 5′- CAGATGGCCGCTGTCATTAGG) human

PDE10 (forward primer 5′- ATGGAGCAGCACCACTTCTC; reverse primer 5′-

GCAATGATGGCTTTGCGGAT) and for the normalizing control 36B4 (forward: 5´

AACATCTCCCCCTTCTCCTT 3´ and reverse: 5´ GAAGGCCTTGACCTTTTCAG 3´).

Data were analyzed using Sequence Detection software v. 3.0. (Applied Biosystems).

Data analysis

Normal distribution was checked by Shapiro-Wilks. Levels of CSF cGMP, cAMP, Total

tau and P-tau were log transformed since they were not normally distributed. Differences Acc

epte

d A

rticl

e


between groups for AD markers and levels of CSF cGMP and cAMP were analysed by

one-way ANOVA followed by DMS post-hoc test. Two-way ANOVA was used to assess

whether there was interaction between groups and ApoE genotype for levels of cGMP or

cAMP. Linear regression analysis were performed to study the association of levels of CSF

cGMP and cAMP (independent variables) with AD markers (dependent variables) after

adjusting for age, sex (co-variables) and ApoE genotype (category). Standardized or Beta

coefficients with their associated probability were presented. Differences between

expressions of PDEs in brains were checked by Student´s t test. Correlation between

variables was investigated by Pearson’s or Spearman´s correlation coefficients, depending

upon the normality of variables. All analyses were performed using the software

STATA/IC v12.1 for Windows (College Station, TX, USA).

Results

LC-MS/MS method validation

The recovery of the sample preparation method was determined by comparing the signal

(peak area) of the internal standards in CSF samples spiked with ISs prior to the extraction

with those obtained in plasma samples spiked with the ISs after the extraction (n = 5). ISs

were used as reference because cGMP and cAMP endogenous concentrations in the CSF

samples are unknown. Recovery values of 96.6 % (RSD 9.8%) and 101.5 % (RSD 5.6%)

Acc

epte

d A

rticl

e


for cAMP and cGMP respectively demonstrated the effectiveness of the sample preparation

method.

In the validated calibration range from 0.15 nM to 15 nM for cGMP and from 0.26 nM to

70 nM for cAMP a linear weighed (1/x) least square function could be applied. Linearity of

the assay was confirmed with correlation coefficients (R2) of 0.999 for both analytes.

Slopes in calibration functions obtained for standards prepared in water and in CSF were

compared, and differences of -2.1% for cGMP and 2.6% for cAMP were found. These

differences are negligible and demonstrated that calibration prepared in water could be used

to quantify the cyclic nucleotides in unknown CSF samples. This matrix independence of

the method illustrates the advantages of using isotope-labeled internal standards to

compensate for matrix effects.

The lower limit of quantification (LOQ) was set according to internationally well accepted

criteria (the lowest concentration of the calibration range with precision and accuracy

<20%) and was 0.15 nM for cGMP and 0.26 nM for cAMP. These LOQ values are lower

than those published for similar methods [20,21] and allow the analysis of samples with

very low concentrations of the analytes. Taking into account cAMP and cGMP basal levels

in healthy people, in the range of 8–14 nM (cAMP) and 2–5 nM (cGMP) [8], any

improvement in LOQ values is a remarkable achievement for the aim of this project.

Intra- and inter-assay precision and accuracy were examined by the analysis of a CSF

sample spiked with different concentrations of the cyclic nucleotides (Table S2). As cAMP Acc

epte

d A

rticl

e


physiological levels are higher than cGMP levels, spiked compound concentrations were

different for cAMP and cGMP. To determine intra-assay precision and accuracy, QC

samples were prepared with six replicates at four concentration levels. For inter-assay

validation, the samples were analysed in three separate runs, each including its own

standard curve. The very low relative standard deviations of mean (below 8% in all cases)

and good accuracies (between 93.8% and 101.3%) clearly demonstrated that our LC-

MS/MS method is robust and reproducible. Results from Table S2, also reflected the

advantages of utilization of an isotope labelled IS and are satisfying the requirements for

bioanalytical method validation.

cGMP and cAMP levels in CSF of AD patients

Characteristics of patients are shown in Table 1. Both patients diagnosed with AD and MCI

with AD progression presented lower levels of CSF Aβ42 when compared to subjective

cognitive impairment or stable MCI patients (F(3,75) = 20.61, p<0.01). Stable MCI patients

also had little but significant lower levels of CSF Aβ42 when compared to SCI group

(p<0.01). Patients with MCI that converted to AD did not show any significant change in

CSF levels of total Tau and P-Tau181 when compared to SCI group. However, these CSF

biomarkers were higher in AD than in both SCI and stable MCI patients (F(3,75) = 4.81,

p<0.01 for P-Tau181, p<0.05 for total tau). AD patients showed the lowest MMSE scores

when compared to the rest of the groups (F(3,75) = 51.87, p<0.01 vs SCI and stable MCI

patients, p<0.05 vs MCI converters). Females and participants carrying ApoE ε4 were more Acc

epte

d A

rticl

e


common in AD and cMCI groups. AD patients were also significantly older than both SCI

and stable MCI patients (F(3,75) = 7.37, p<0.01).

Our sensitive LC-MS/MS-based assay for cyclic nucleotides revealed that CSF levels of

cGMP were lower in patients with AD than in SCI (1.95 ± 0.23 vs 2.67 ± 0.25 nM, F(3,75) =

2.82, p<0.05, Fig. 3A). Although levels of cGMP appear to be slightly higher in both MCI

groups when compared to AD group, no statistical differences were found. In contrast, CSF

cAMP did not experiment the same extent of reduction as cGMP did in AD patients.

Indeed, no significant changes in levels of CSF cAMP were found among the four groups

(F(3,75) = 2.19, p=0.10, Fig. 3B).

Levels of CSF cGMP showed different trends among ApoE carriers. While similar levels

were found in AD and SCI ε3 carriers (2.31 ± 0.28 vs 2.38 ± 0.1 nM), ε4-carrying AD

patients presented much lower levels than SCI participants carrying ε4 (1.82 ± 0.30 vs 3.06

± 0.45 nM, F(3,37) = 2.53, p<0.05, Fig. S1A). Similar trend was found in cAMP levels. No

differences were found in ε3 carriers (10.46 ± 1.68 vs 11.78±0.91 nM), but ε4-carrying

patients of AD showed reduced levels of cAMP when compared to SCI ε4-carriers (11.07 ±

1.19 vs 14.89 ± 1.47 nM, F(3,34) = 2.60, p<0.05, Fig. S1B). Levels of cGMP also showed a

strong and negative association to age in both patients of AD and MCI converters (R2=

0.379, p<0.01), but this association was lost in both SCI and stable MCI patients (R2=

0.023, p= 0.302). Yet, no association of cAMP with age was found in any of the groups.

Acc

epte

d A

rticl

e


In order to study the particular relationship of cGMP and cAMP with AD markers, we

performed a series of multiple linear regressions, with MMSE score and CSF biomarkers

(Aβ42, total Tau and P-Tau181) as dependent variables after adjusting for age, sex and

ApoE genotype (Table 2). These analyses were performed in two separate group of

participants; one including patients with diagnose of AD (both AD and MCI converters)

and other with no diagnose of AD (both SCI and stable MCI groups) after the follow-up, to

estimate the effect size per diseased group. CSF levels of cGMP showed the strongest and

significant association to MMSE score (Beta= 0.855, p<0.01) and the CSF biomarker Aβ42

(Beta= 0.583, p<0.05) in the AD-diagnosed patients. This association was lost in

participants with no AD diagnosis.

PDE expression in AD brains

The total number of cases analyzed was 8 controls (4 males/4 females) and 7 AD (2

males/5 females). There was a severe memory deficit in AD, and MMSE at death was 5±1.

Age at death was 79 ± 3 years for controls and 81±2 for AD cases. There were no

significant differences between controls and AD regarding post-mortem delay (39 ± 5 h in

controls vs. 49 ± 6 h in AD) or brain pH, (6.3 ± 0.2 in controls vs. 6.4 ± 0.10 in AD). There

were no significant correlations between age, postmortem delay, or brain pH in either

controls or AD.

PDEs are the enzymes that hydrolize cAMP and cGMP. To determine if the decrease in

cGMP levels in the CSF of AD patients could be due to an increased degradation, we Acc

epte

d A

rticl

e


measured the expression levels of different PDEs in the temporal cortex of AD patients and

control subjects. We measured the expression of the two cGMP-specific PDEs, PDE5 and

PDE9 (PDE6 is also cGMP-specific but its expression is restricted to the retina and pineal

gland). The expression of PDE4, as a cAMP-specific and PDE10 as a non-specific PDE

were also measured. As depicted in Figure 4, a significant increase in the expression of

PDE5 was detected in the cortex of AD patients compared to that of age-matched healthy

control subjects (p < 0.05). The expression levels of the cGMP specific PDE9 also showed

a tendency to increase however, no changes in the expression level of PDE4 or PDE10

mRNA were observed in AD cortex compared to control subjects. These results suggest

that an increase in the expression of cGMP-specific PDEs could contribute to the decrease

in cGMP observed in the CSF of AD patients.

Discussion

Here we demonstrated that cGMP but not cAMP levels, are significantly lower in the CSF

of patients diagnosed with mild AD when compared to non-demented controls. The basal

concentrations for cAMP and cGMP in the control groups are in agreement with previous

reports showing concentrations in the range of 8–14 nM (cAMP) and 2–5 nM (cGMP)

[8,24]. The reduction of cGMP in the CSF compartment showed an age-dependent trend

and a strong association with both MMSE-diagnosed clinical dementia and the CSF

biomarker Aβ42 in AD patients. Acc

epte

d A

rticl

e


In contrast to our findings, one previous work reported no changes of cGMP in CSF from

AD patients [9]. In addition, this earlier work also found increased levels of cAMP that

were positively correlated with the amount of total tau in CSF from AD, which

contradictsour data that shows no changes in cAMP levels. An important distinguishing

feature between these studies is the disease stage when measurements were carried out.

While previous data were obtained from a variable cohort of mildly to moderately

demented patients (MMSE= 17.5 ± 7.4) our analyses were performed in a highly-invariable

cohort of very mildly demented patients (MMSE= 22.3 ± 0.7). Perhaps, as pathology

spreads and the number of neurodegenerative neurons rises, additional levels of cyclic

nucleotides might be released to the extracellular milieu and therefore, increase their

concentrations in the CSF compartment. This would in part explained why Martinez et al.

found a positive correlation of cAMP with total levels of tau in CSF, which is considered a

marker for neurodegeneration in AD [25]. Moreover, unlike the enzyme immunoassay used

by Martinez et al., 1999 [9], the implemented method based on LC-MS/MS technology

used in the present study provides a more robust, reproducible, specific and sensitive

(LOQs being 0.15 nM and 0.26 nM for cGMP and cAMP respectively) approach with a

precise quantification of cAMP and cGMP in one-shot from a minimal sample amount (25

uL of CSF). In this scenario, achieved sensitivity plays a key role enabling a reliable

assessment.

In other types of dementia, there are no other consistent data of alterations of the cyclic

nucleotide concentrations in CSF. However, Oeckl et al. have recently reported that Acc

epte

d A

rticl

e


Creutzfeldt-Jakob disease (CJD) patients show significantly lower levels of CSF cAMP and

cGMP by using LC MS/MS [8]. In the same study, no differences were observed in

Parkinson´s disease, in PD dementia (PDD) or in amyotrophic lateral sclerosis (ALS)

patients. In the case of PD, where cAMP and cGMP in CSF has been also studied by other

authors, two studies reported reduced cyclic nucleotide concentrations in the CSF of PD

patients [26,27], but several others have not observed any differences [8,24,28-30]. In the

case of CJD patients, the authors suggested that since there is a substantial degeneration of

the whole brain in prion diseases, the decrease of cAMP and cGMP may be due to a

decreased synthesis of the nucleotides [8]. In our case, the decreased levels of cGMP

showed in AD patients might be a consequence of increased activities of cGMP-specific

PDEs since an increase in PDE5 expression levels and a tendency to increase in PDE9 was

observed in the temporal cortex of AD patients. In contrast, both PDE4D and PDE10A

(cGMP non-specific PDEs) showed no changes in AD patients when compared to non-

demented individuals. The fact that the expression of cGMP-specific PDEs has been found

to be increased in AD brains further supports the potential involvement of cGMP in the

pathological and clinical development of AD.

For the moment, there are few studies reporting the expression of PDEs in the brain in

relation to the neuropathological process in AD and most of them have been achieved using

in situ hybridization. While region-specific alterations in two cAMP-specific PDEs (PDE7

and PDE8) have been observed [31], in relation to cGMP-specific PDEs Reyes-Irisarri et

al., showed no PDE5 mRNA expression in the human brain and no changes in the case of Acc

epte

d A

rticl

e


PDE9 [32]. The differences could be attributable to the radioactive in situ hybridization

used by Reyes-Irisarri et al., which is not as accurate for quantifying RNA expression as

real time PCR. In any case, further studies are required to determine whether the changes

found in PDE expression are a cause or a consequence of AD.

Together our findings support the hypothesis that cGMP-specific PDEs inhibitors

may affect memory-related processes by promoting increases of cGMP. In fact, selective

inhibitors of cGMP-specific PDEs have recently emerged as new therapeutic agents for the

treatment of AD [review in 4,33,34]. In particular, PDE5 and PDE9 inhibitors have

provided excellent results in animal models of AD [35-38]. Although the next decade will

be crucial to determine the efficacy of these drugs for cognitive enhancement and/or for

cognitive deficits associated with dementia, the proven safety of some of the PDE inhibitors

that are already used in human therapy (even in prolonged treatments) brings good

expectations [36]. For the moment, only PDE9 inhibitors have entered into clinical trials; in

fact, PF-04447943 started Phase 2 in 2009 and final data collection for primary outcome

measure was done by September 2010 (Ref. clinical trial: NCT00930059). No

improvement was observed in cognition or behaviour in AD patients compared to placebo

after 3-month treatment [39], however, a recent report regarding PF-04447943, shows that

further optimization around this clinical candidate to improve brain penetration and reduce

microsomal clearance is in progress [40]. Thus, according to this data, PDE9 inhibition is

still an attractive target for AD but identification of an optimal clinical candidate for CNS

indications is a challenge. Importantly, we would like to highlight that cGMP measurement, Acc

epte

d A

rticl

e


through the LC-MS/MS technology used in this study, might also be utilized as a

complementary marker to follow up efficacy of therapeutic agents in clinical trials.

Lastly, our findings in CSF samples from patients with prodromal MCI and mild AD

dementia suggest that homeostasis of cGMP is particularly affected in early stages of AD

and also that these reduced levels of cGMP might participate in the aggravation of amyloid

pathology and cognitive decline. Their determination could be a potential future biomarker

for early diagnosis of AD and for the development of novel drugs aimed at targeting these

second messenger systems. However, taking into account that the identification of

endogenous molecules (such as second messengers) as potential CSF biomarkers for

neurological disorders is challenging, extended studies that further characterize the

diagnostic benefit of cGMP in AD should be conducted.

Acknowledgments

This study was supported by FIMA (Spain), the FIS project (11/02861) and a Torres

Quevedo grant (Ana Ugarte) from MINECO (PTQ-12-05641). It has also been financed by

the following foundations: The regional agreement on medical training and clinical

research (ALF) between Stockholm County Council and Karolinska Institutet, Swedish

Brain Power, Margaretha af Ugglas stiftelsen, and the Swedish Alzheimer foundation.

Acc

epte

d A

rticl

e


Author Contribution: MCT, AGO and JO conceptualized and supervised the study. AU

performed the experiments and FGB and CGB performed the statistical analysis. All

authors participated in analyzing and interpreting the data. ACM and MJR provided CSF

and brain samples of AD and control subjects. MCT, AGO, JO, AU and FGB wrote the

manuscript.

Acc

epte

d A

rticl

e


References

1 Beavo, J. A. and L. L. Brunton Cyclic nucleotide research -- still expanding after half a

century Nat Rev Mol Cell Biol 2002;3:710-8

2 Conti, M. and J. Beavo Biochemistry and physiology of cyclic nucleotide

phosphodiesterases: essential components in cyclic nucleotide signaling 2007; 76: 481-511

3 Kleppisch, T. and R. Feil cGMP signalling in the mammalian brain: role in synaptic

plasticity and behaviour Handb Exp Pharmacol 2009;549-79

4 Garcia-Osta, A., M. Cuadrado-Tejedor, C. Garcia-Barroso, J. Oyarzabal and R. Franco

Phosphodiesterases as therapeutic targets for Alzheimer's disease ACS Chem Neurosci

2013;3:832-44

5 Reneerkens, O. A., K. Rutten, H. W. Steinbusch, A. Blokland and J. Prickaerts Selective

phosphodiesterase inhibitors: a promising target for cognition enhancement

Psychopharmacology (Berl) 2009;202:419-43

6 Chalimoniuk, M. and J. B. Strosznajder Aging modulates nitric oxide synthesis and

cGMP levels in hippocampus and cerebellum. Effects of amyloid beta peptide Mol Chem

Neuropathol 1998; 35: 77-95

7 Cramer, H. Cyclic 3', 5'-nucleotides in extracellular fluids of neural systems J Neurosci

Res 1977; 3: 241-6

8 Oeckl, P., P. Steinacker, S. Lehnert, S. Jesse, H. A. Kretzschmar, A. C. Ludolph, M. Otto

and B. Ferger CSF concentrations of cAMP and cGMP are lower in patients with

Creutzfeldt-Jakob disease but not Parkinson's disease and amyotrophic lateral sclerosis

PLoS One 2012; 7:

9 Martinez, M., E. Fernandez, A. Frank, C. Guaza, M. de la Fuente and A. Hernanz

Increased cerebrospinal fluid cAMP levels in Alzheimer's disease Brain Res 1999; 846:

265-7

10 Hansson, O., H. Zetterberg, P. Buchhave, E. Londos, K. Blennow and L. Minthon

Association between CSF biomarkers and incipient Alzheimer's disease in patients with

mild cognitive impairment: a follow-up study Lancet Neurol 2006; 5: 228-34 Acc

epte

d A

rticl

e


11 Blennow, K., A. Wallin, H. Agren, C. Spenger, J. Siegfried and E. Vanmechelen Tau

protein in cerebrospinal fluid: a biochemical marker for axonal degeneration in Alzheimer

disease? Mol Chem Neuropathol 1995; 26: 231-45

12 Vanmechelen, E., H. Vanderstichele, P. Davidsson, E. Van Kerschaver, B. Van Der

Perre, M. Sjogren, N. Andreasen and K. Blennow Quantification of tau phosphorylated at

threonine 181 in human cerebrospinal fluid: a sandwich ELISA with a synthetic

phosphopeptide for standardization Neurosci Lett 2000; 285: 49-52

13 Andreasen, N., C. Hesse, P. Davidsson, L. Minthon, A. Wallin, B. Winblad, H.

Vanderstichele, E. Vanmechelen and K. Blennow Cerebrospinal fluid beta-amyloid(1-42)

in Alzheimer disease: differences between early- and late-onset Alzheimer disease and

stability during the course of disease Arch Neurol 1999; 56: 673-80

14 Giorgi, M., V. D'Angelo, Z. Esposito, V. Nuccetelli, R. Sorge, A. Martorana, A. Stefani,

G. Bernardi and G. Sancesario Lowered cAMP and cGMP signalling in the brain during

levodopa-induced dyskinesias in hemiparkinsonian rats: new aspects in the pathogenetic

mechanisms Eur J Neurosci 2008; 28: 941-50

15 Pradelles, P., J. Grassi, D. Chabardes and N. Guiso Enzyme immunoassays of adenosine

cyclic 3',5'-monophosphate and guanosine cyclic 3',5'-monophosphate using

acetylcholinesterase Anal Chem 1989; 61: 447-53

16 Torremans, A., A. Van Hemelrijck, R. Straetemans, G. Vanhoof, G. Van Den Kieboom

and W. H. Drinkenburg Selective D1 agonism but not D2 antagonism is reflected in cAMP

and cGMP levels in rat CSF Brain Res Bull 2010; 81: 549-51

17 Marte, A., O. Pepicelli, A. Cavallero, M. Raiteri and E. Fedele In vivo effects of

phosphodiesterase inhibition on basal cyclic guanosine monophosphate levels in the

prefrontal cortex, hippocampus and cerebellum of freely moving rats J Neurosci Res 2008;

86: 3338-47

18 Diaz Enrich, M. J., J. A. Villamarin, J. I. Ramos Martinez and I. Ibarguren Measurement

of adenosine 3',5'-cyclic monophosphate and guanosine 3', 5'-cyclic monophosphate in

mussel (Mytilus galloprovincialis lmk.) by high-performance liquid chromatography with

diode array detection Anal Biochem 2000; 285: 105-12

19 Sato, M., N. Hida, T. Ozawa and Y. Umezawa Fluorescent indicators for cyclic GMP

based on cyclic GMP-dependent protein kinase Ialpha and green fluorescent proteins Anal

Chem 2000; 72: 5918-24 Acc

epte

d A

rticl

e


20 Oeckl, P. and B. Ferger Simultaneous LC-MS/MS analysis of the biomarkers cAMP and

cGMP in plasma, CSF and brain tissue J Neurosci Methods 2012; 203: 338-43

21 Van Damme, T., Y. Zhang, F. Lynen and P. Sandra Determination of cyclic guanosine-

and cyclic adenosine monophosphate (cGMP and cAMP) in human plasma and animal

tissues by solid phase extraction on silica and liquid chromatography-triple quadrupole

mass spectrometry J Chromatogr B Analyt Technol Biomed Life Sci 2012; 909: 14-21

22 Folstein, M. F., S. E. Folstein and P. R. McHugh "Mini-mental state". A practical

method for grading the cognitive state of patients for the clinician J Psychiatr Res 1975; 12:

189-98

23 Lewis, D. A. The human brain revisited: opportunities and challenges in postmortem

studies of psychiatric disorders Neuropsychopharmacology 2002; 26: 143-54

24 Ikeda, M., I. Sato, T. Yuasa, T. Miyatake and S. Murota Nitrite, nitrate and cGMP in the

cerebrospinal fluid in degenerative neurologic diseases J Neural Transm Gen Sect 1995;

100: 263-7

25 Tumani, H., C. Teunissen, S. Sussmuth, M. Otto, A. C. Ludolph and J. Brettschneider

Cerebrospinal fluid biomarkers of neurodegeneration in chronic neurological diseases

Expert Rev Mol Diagn 2008; 8: 479-94

26 Volicer L, Beal MF, Direnfeld LK, Marquis JK, Albert ML. CSF cyclic nucleotides and

somatostatin in Parkinson's disease. Neurology. 1986 Jan;36(1):89-92.

27 Belmaker RH, Ebstein RP, Biederman J, Stern R, Berman M, van Praag HM. The effect

of L-dopa and propranolol on human CSF cyclic nucleotides. Psychopharmacology (Berl).

1978 Jul 19;58(3):307-10.

28 Covicković-Sternić N, Kostić VS, Djuricić BM, Bumbasirević-Beslać L, Nikolić M,

Mrsulja BB. Cyclic nucleotides in cerebrospinal fluid of drug-free Parkinson patients. Eur

Neurol. 1987;27(1):24-8.

29 Cramer H, Warter JM, Renaud B. Analysis of neurotransmitter metabolites and

adenosine 3',5'-monophosphate in the CSF of patients with extrapyramidal motor disorders.

Adv Neurol. 1984;40:431-5.

30 Navarro JA, Jiménez-Jiménez FJ, Molina JA, Benito-León J, Cisneros E, Gasalla T,

Ortí-Pareja M, Tallón-Barranco A, de Bustos F, Arenas J. Cerebrospinal fluid cyclic Acc

epte

d A

rticl

e


guanosine 3'5' monophosphate levels in Parkinson's disease. J Neurol Sci. 1998 Feb

18;155(1):92-4.

31 Pérez-Torres S, Cortés R, Tolnay M, Probst A, Palacios JM, Mengod G. Alterations on

phosphodiesterase type 7 and 8 isozyme mRNA expression in Alzheimer's disease brains

examined by in situ hybridization. Exp Neurol. 2003 Aug;182(2):322-34.

32 Reyes-Irisarri, E., M. Markerink-Van Ittersum, G. Mengod and J. de Vente Expression

of the cGMP-specific phosphodiesterases 2 and 9 in normal and Alzheimer's disease human

brains Eur J Neurosci 2007; 25: 3332-8

33 Domek-Lopacinska, K. U. and J. B. Strosznajder Cyclic GMP and nitric oxide synthase

in aging and Alzheimer's disease Mol Neurobiol 2010 41: 129-37

34 Zhihui, Q. Modulating nitric oxide signaling in the CNS for Alzheimer's disease therapy

Future Med Chem 2013; 5: 1451-68

35 Cuadrado-Tejedor, M., I. Hervias, A. Ricobaraza, E. Puerta, J. M. Perez-Roldan, C.

Garcia-Barroso, R. Franco, N. Aguirre and A. Garcia-Osta Sildenafil restores cognitive

function without affecting beta-amyloid burden in a mouse model of Alzheimer's disease

Br J Pharmacol 2011; 164: 2029-41

36 Garcia-Barroso, C., A. Ricobaraza, M. Pascual-Lucas, N. Unceta, A. J. Rico, M. A.

Goicolea, J. Salles, J. L. Lanciego, J. Oyarzabal, R. Franco, M. Cuadrado-Tejedor and A.

Garcia-Osta Tadalafil crosses the blood-brain barrier and reverses cognitive dysfunction in

a mouse model of AD Neuropharmacology 2013; 64: 114-23

37 Puzzo, D., A. Staniszewski, S. X. Deng, L. Privitera, E. Leznik, S. Liu, H. Zhang, Y.

Feng, A. Palmeri, D. W. Landry and O. Arancio Phosphodiesterase 5 inhibition improves

synaptic function, memory, and amyloid-beta load in an Alzheimer's disease mouse model

J Neurosci 2009; 29: 8075-86

38 Kroker, K. S., C. Mathis, A. Marti, J. C. Cassel, H. Rosenbrock and C. Dorner-Ciossek

PDE9A inhibition rescues amyloid beta-induced deficits in synaptic plasticity and

cognition Neurobiol Aging 2014; 35: 2072-8

39 Schwam, E. M., T. Nicholas, R. Chew, C. B. Billing, W. Davidson, D. Ambrose and L.

D. Altstiel A Multicenter, Double-Blind, Placebo-Controlled Trial of the PDE9A Inhibitor,

PF-04447943, in Alzheimer's Disease Curr Alzheimer Res 2014; 11: 413-21 Acc

epte

d A

rticl

e


40 Claffey MM, Helal CJ, Verhoest PR, Kang Z, Fors KS, Jung S, Zhong J, Bundesmann

MW, Hou X, Lui S, Kleiman RJ, Vanase-Frawley M, Schmidt AW, Menniti F, Schmidt CJ,

Hoffman WE, Hajos M, McDowell L, O'Connor RE, Macdougall-Murphy M, Fonseca KR,

Becker SL, Nelson FR, Liras S. Application of structure-based drug design and parallel

chemistry to identify selective, brain penetrant, in vivo active phosphodiesterase 9A

inhibitors. J Med Chem. 2012 Nov 8;55(21):9055-68.

Figure. 1. Chemical structures of analytes and internal standards: (a) Cyclic

guanosine-13

C,15

N2 3’,5’-monophosphate (13

C,15

N2-cGMP); (b) 3’,5’-cGMP; (c) Cyclic

adenosine-13

C5-monophosphate (13

C5-cAMP); (d) 3’,5’-cAMP.

Figure. 2. Representative chromatograms Representative MRM chromatogram of a

standard solution containing 12 nM of 13

C,15

N2-cGMP (b); 0.15 nM of cGMP (c); 24 nM of

13C5-cAMP (d) and 0.72 nM of cAMP (e). (a) Depicts the sum of all acquired MRM

channels; (b), (c).

Figure 3. Levels of CSF cGMP and cAMP in AD and MCI patients (A) CSF levels of

cGMP in patients diagnosed with mild AD were found significantly lower when compared

to those of non-demented controls (F(3,75) = 2.82, p<0.05; one-way ANOVA after DMS

post-hoc test). (B) No significant changes were found in CSF levels of cAMP among

different groups, despite of MCI patients with AD progression showing a lowering trend

(F(3,75)= 2.19, p=0.10; one-way ANOVA after DMS post-hoc test). SCI, control participants Acc

epte

d A

rticl

e


with subjective cognitive impairment; sMCI, stable MCI patients with no conversion to

AD; cMCI, MCI patients with conversion to AD; CSF, cerebrospinal fluid. Data expressed

as mean ± standard error of mean. *p<0.05 vs SCI.

Figure. 4. Differential expression levels of various types of PDEs in the temporal

cortex from AD patients. RT-PCR analyses in post-mortem tissue from the BA20 part of

temporal cortex showed that expression of cGMP-specific PDE5A was significant

increased in AD patients (t(13) = -1.9, p < 0.05) and that PDE9 showed a clear tendency to

increase but the difference was not significant (t(14) = -1.7, p = 0.08). Expression levels of

cAMP-specific PDE4D and PDE10 were found unchanged in AD (PDE4D: t(7) = 2.2, p =

0.1. PDE10: t(14) = 0.9, p = 0.4). Data expressed as mean ± standard error of mean. *p <0.05

vs Control.

Acc

epte

d A

rticl

e


NAN_12203_F1

Acc

epte

d A

rticl

e


NAN_12203_F2

Acc

epte

d A

rticl

e


NAN_12203_F3

Acc

epte

d A

rticl

e


NAN_12203_F4

Acc

epte

d A

rticl

e

Table 1. Demographic and clinical data for all participants in this study.

Characteristics SCI sMCI cMCI Mild AD

n 27 24 11 17

male/female 11/16 16/8 4/7 5/12

Age (years) 56.8 ± 1.2 61.4 ± 2.2 63.0 ± 2.5 69.8 ± 2.5a, b

Education (years) 14.3 ± 0.7 12.4 ± 0.8 14.2 ± 1.1 9.2 ± 0.6a, b, c

ApoE ε4 carriers (%) 38.5 45.5 81.8 70.6

MMSE score 28.9 ± 0.2 28.2 ± 0.3 27.5 ± 0.3 22.3 ± 0.7a, b, c

CSF Aβ42 levels (ng/L) 852.4 ±31.6 676.4 ± 49.1a 424.0 ± 36.3

a, b’ 477.3 ± 30.8

a, b’

CSF T-tau (ng/L) 275.5 ± 23.9 409.5 ± 120.5 466.5 ± 74.9 733.0 ± 100.5a, b

CSF P-tau181 (ng/L) 51.6 ± 4.0 56.2 ± 8.6 71.4 ± 15.4 98.7 ± 11.6a, b’

Numeric values are presented as number of patients, percentage or mean (SD) ± SEM.

SCI,control participants with subjective cognitive impairment; sMCI, stable mild cognitive impairment with no conversion to AD after follow-

up; cMCI, mild cognitive impairment with conversion to AD after follow-up; AD, Alzheimer´s disease; MMSE, Mini-Mental State Examination;

CSF, cerebrospinal fluid. aP<0.01 vs SCI.

bP<0.05 vs sMCI.

b’P<0.01 vs sMCI.

cP<0.01 vs cMC.I

Acc

epte

d A

rticl

e

Table 2. Effects of CSF cGMP and cAMP on clinical and pathological markers of AD.

AD Group (n= 28) Non-AD group (n= 51)

Dependent Independent Standardized Standardized

Variable Variable Coefficient P Coefficient P

MMSE CSF cGMP 0.855 0.009 -0.097 0.731

CSF cAMP -0.444 0.106 0.021 0.911

CSF Aβ42 CSF cGMP 0.583 0.042 -0.154 0.424

CSF cAMP -0.238 0.372 0.058 0.757

CSF Tau CSF cGMP -0.083 0.824 0.024 0.885

CSF cAMP 0.249 0.446 0.099 0.550

CSF P-Tau181 CSF cGMP -0.257 0.506 -0.116 0.543

CSF cAMP 0.449 0.197 0.196 0.286

Multiple regression analyses were performed to study the association of cGMP and cAMP (as independent variables) with MMSE-diagnosed

dementia and biomarkers of AD pathology in CSF (as dependent variables) adjusted for age, sex (co-variables), and ApoE genotype (as category

or dummy variable).

Standardized coefficients (Beta) generated in this multivariate model can be used for analyzing which CSF measure (cGMP or cAMP) has

strongest effect on clinical and pathological markers of AD.

AD group includes patients with mild AD and MCI patients that were diagnosed with AD during the period of follow-up. Non-AD group

includes control non-demented patients and those MCI patients that were not diagnosed with AD during the period of follow-up.

AD, Alzheimer’s disease; CSF, cerebrospinal fluid.

Acc

epte

d A

rticl

e

Decreased levels of cGMP in CSF are associated with cognitive decline and amyloid pathology in...

Documents

Transcript of Decreased levels of cGMP in CSF are associated with cognitive decline and amyloid pathology in...