Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus...

Cytogenetic Characterization and AFLP-Based GeneticLinkage Mapping for the Butterfly Bicyclus anynana,Covering All 28 Karyotyped ChromosomesArjen E. Van’t Hof1¤, Frantisek Marec2, Ilik J. Saccheri3, Paul M. Brakefield1, Bas J. Zwaan1*

1 Department of Evolutionary Biology, Institute of Biology, Leiden University, Leiden, The Netherlands, 2 Faculty of Biological Sciences, University of South Bohemia, and

Biology Centre, ASCR, Institute of Entomology, Ceske Budejovice, Czech Republic, 3 School of Biological Sciences, University of Liverpool, Liverpool, United Kingdom

Abstract

Background: The chromosome characteristics of the butterfly Bicyclus anynana, have received little attention, despite thescientific importance of this species. This study presents the characterization of chromosomes in this species by means ofcytogenetic analysis and linkage mapping.

Methodology/Principal Findings: Physical genomic features in the butterfly B. anynana were examined by karyotypeanalysis and construction of a linkage map. Lepidoptera possess a female heterogametic W-Z sex chromosome system. TheWZ-bivalent in pachytene oocytes of B. anynana consists of an abnormally small, heterochromatic W-chromosome with theZ-chromosome wrapped around it. Accordingly, the W-body in interphase nuclei is much smaller than usual in Lepidoptera.This suggests an intermediate stage in the process of secondary loss of the W-chromosome to a ZZ/Z sex determinationsystem. Two nucleoli are present in the pachytene stage associated with an autosome and the WZ-bivalent respectively.Chromosome counts confirmed a haploid number of n = 28. Linkage mapping had to take account of absence of crossing-over in females, and of our use of a full-sib crossing design. We developed a new method to determine and exclude thenon-recombinant uninformative female inherited component in offspring. The linkage map was constructed using a novelapproach that uses exclusively JOINMAP-software for Lepidoptera linkage mapping. This approach simplifies the mappingprocedure, avoids over-estimation of mapping distance and increases the reliability of relative marker positions. A total of347 AFLP markers, 9 microsatellites and one single-copy nuclear gene covered all 28 chromosomes, with a mappingdistance of 1354 cM. Conserved synteny of Tpi on the Z-chromosome in Lepidoptera was confirmed for B. anynana. Theresults are discussed in relation to other mapping studies in Lepidoptera.

Conclusions/Significance: This study adds to the knowledge of chromosome structure and evolution of an intensivelystudied organism. On a broader scale it provides an insight in Lepidoptera sex chromosome evolution and it proposes asimpler and more reliable method of linkage mapping than used for Lepidoptera to date.

Citation: Van’t Hof AE, Marec F, Saccheri IJ, Brakefield PM, Zwaan BJ (2008) Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for theButterfly Bicyclus anynana, Covering All 28 Karyotyped Chromosomes. PLoS ONE 3(12): e3882. doi:10.1371/journal.pone.0003882

Editor: William J. Murphy, Texas A&M University, United States of America

Received September 18, 2008; Accepted November 13, 2008; Published December 8, 2008

Copyright: � 2008 Van’t Hof et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: The financing of the cytogenetic experiments was covered by grant 206/06/1860 of the Grant Agency of the Czech Republic (Prague) and from theEntomology Institute project Z50070508. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of themanuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

¤ Current address: School of Biological Sciences, University of Liverpool, The Biosciences Building, Liverpool, United Kingdom

Introduction

The butterfly Bicyclus anynana (Nymphalidae, Satyrinae) is

among the most extensively studied Lepidoptera species. It has

been established as an emerging model organism to address many

evolutionary questions with a particular focus on genetic and

environmental effects on wing pattern formation [1–3], and on life

history evolution and ageing [4–7]. Although this species has

received much scientific attention, the physical features of its

genome have yet to be described.

Lepidoptera chromosome numbers are usually between 28 to 32

pairs [8,9], but can vary widely probably as a result of their

holokinetic chromosome arrangement [10,11]. The most striking

examples at the genus level are found in Agrodiaetus, with haploid

chromosome numbers that vary between 10 and 134 [10].

However, geographical intra-specific variability is also commonly

observed in Lepidoptera [8,12]. Geographical subspecies of the

silk moth Samia cynthia show, besides different chromosome

numbers, a high polymorphism of sex chromosomes [13], which

may play a role in population and species divergence [14,15]. An

extraordinary variation in chromosome numbers, ranging from

n = 12 to n = 88, was reported between populations of a Philaethria

dido species complex, which is no longer regarded as single species,

since no evidence of hybrids between individuals of sympatric

populations with different chromosome numbers was found

[16,17]. The karyotype variation within the genus Bicyclus is less

PLoS ONE | www.plosone.org 1 December 2008 | Volume 3 | Issue 12 | e3882

spectacular (Supplement S1). With the exception of B. auricrudus

that has a reported haploid chromosome number of 14, all

karyotyped species have between 26 and 29 pairs, with n = 28 being

the predominant count [18–20]. However, geographical within-

species variation has been observed in B. funebris with n = 28 in

Uganda and n = 29 in Senegal [18,19]. A haploid chromosome

number of 28 was reported in B. anynana from Entebbe, Uganda

[18], but given the geographical variability in Lepidoptera there is

need for confirmation since the material used in the present study

originates from Nkhata Bay in Malawi, about 1300 km to the south.

Identification of individual chromosomes based on size and

banding patterns is difficult in Lepidoptera because of the large

number of small and equally sized chromosomes that are not

susceptible to banding techniques during mitosis. Much longer

meiotic chromosomes in the pachytene stage provide better

resolution, but their chromomere patterns are usually not fully

distinctive [11,21]. In addition, lepidopteran chromosomes are

holokinetic, i.e. they lack a distinct primary constriction (the

centromere) and spindle microtubules are attached to a large

kinetochore plate, which covers significant part of the chromo-

some surface [22]. Thus, the chromosomes cannot be distin-

guished or characterized by centromere position. The most useful

visual characteristics to distinguish lepidopteran chromosomes are

the presence of nucleolar organising regions (NORs) associated

with nucleoli and heterochromatin of the W chromosome in the

sex-chromosome (WZ) pachytene bivalents of females. However,

this accounts only for a small fraction of the chromosomes [23,24].

Despite the abundance of lepidopteran species and their

economical relevance, linkage maps are currently available for only

six species. One reason for this is that the generally large number of

chromosomes in this taxon requires a relatively large number of

markers to cover all chromosomes with sufficient density. Addition-

ally, a substantial part of the polymorphisms in the offspring cannot

be used for positional mapping since the maternally transmitted

markers are non-recombinant in Lepidoptera. The maternally

transmitted markers obscure a large part of the paternally

transmitted genotypes when using dominant markers, resulting in

an even greater loss of information [25,26]. The most detailed

linkage information in Lepidoptera comes from the domesticated

silkworm Bombyx mori, for which a number of linkage maps have been

constructed based on RAPD [27,28], RFLP [29], AFLP [30],

microsatellites [31], and BAC sequences [32–34]. In addition, all

genetic linkage groups (LGs) were successfully assigned to individual

chromosomes in this species [35]. The other lepidopteran linkage

maps have been constructed for Heliconius melpomene [25], H. erato

[26,36], Colias eurytheme-C. philodice hybrid [37], Ostrinia nubilalis [38]

and Plutella xylostella [39] based on RFLP, AFLP, microsatellites,

allozymes and single copy nuclear genes.

When using a cross with dominant markers such as AFLP’s, the

general approach in Lepidoptera mapping procedures is to divide

the offspring marker data into three groups based on the F1

marker genotypes. Markers that are heterozygous in both F1

parents segregate in the F2 with a 3:1 Mendelian ratio. Markers

that are recessive homozygous in the F1 male and heterozygous in

the F1 female have a 1:1 ratio in the F2 offspring. These markers

are used for LG assignment and for identification and exclusion of

the uninformative female-inherited component in the 3:1 markers.

The markers that are recessive homozygous in the F1 female and

heterozygous in the F1 male also have a 1:1 ratio in the offspring.

These markers, combined with the male-inherited component of

the 3:1 marker genotypes, are used for constructing the final

linkage map [25,26,36].

When using only the 3:1 markers, the outcome is a linkage map

with two LGs per chromosome (2n LGs). The two sets of

homologous LGs are incompatible and can only be combined with

anchoring markers. Male informative markers, allelic AFLPs and

microsatellites can act as such anchors and there are various

approaches to integrate the two sets of dominant markers. For

example, Lepidoptera specific software was designed to create a

linkage map for B. mori because it was argued that MAPMAKER

3.0 [40] is unsuitable for this purpose [29]. In other studies, the

final step is performed with MAPMAKER 3.0, allthough in some

cases the preceding steps were done in JOINMAP 3.0 [41] or

specifically designed programs [25,26,36,39]. Alternatively, the

LGs in repulsion were presented as two different sets [27,28], or

one integrated set that was based on the average distances of

anchoring markers [34].

Here we report on a novel approach for the final step in

Lepidoptera linkage maping by using the option in JOINMAP to

join maps, i.e. to present the two opposite phased homologous maps

as different mapping populations and use the software to integrate

them based on the anchoring markers. The advantages are that the

female-derived component can be removed instead of presented as

missing data, and the same software combines the two phases

automatically. To compare our mapping distance with that of other

species of butterfly, we also performed a MAPMAKER analysis

because Mapping distances generated by the two programs can

differ substantially [42,43]. In general, these differences are caused

by the different algorithms that are used. MAPMAKER determines

the mapping distance based on maximum likelihood multipoint

estimates, while JOINMAP uses linear regression of pairwise

distances. Additionally, when using dominant markers in species

with only one recombining sex, the manner in which the

uninformative part of the data are treated also has an effect on

mapping distance.

Methods

Cytogenetic proceduresSpread preparations of pachytene oocytes were obtained

following the protocol in [44] for pachytene mapping. Ovaries

of 5th instar larvae were dissected in physiological solution, then

fixed for 20 min in Carnoys fixative (6 : 3 : 1 ethanol-chloroform-

acetic acid), macerated in 60% acetic acid, spread on a slide at

45uC, dehydrated by three washes in increasing concentrations of

ethanol (70%, 80%, and 96%, 30s each), and dried at room

temperature, leaving the preparations suitable for different types of

staining. Some preparations were stained for 5 min and mounted

in 2.5% lactic acetic orcein. Others were stained with YOYO-1

fluorescent dye (Molecular Probes Inc., Eugene, OR, USA) under

the following conditions: the dry preparations were first soaked for

5 min in PBS (phosphate buffered saline), then stained with 50 ml

of 100 nM YOYO-1 in PBS for 20 min, briefly washed in tap

water, air-dried and mounted in 20 ml of antifade based on

DABCO (1,4-diazabicyclo(2.2.2)-octane; Sigma-Aldrich, St. Louis,

MO, USA) (for details, see [45]).

Male metaphase I and II chromosomes were obtained from

testes of the 5th instar larvae. The testes were dissected in

physiological solution, pretreated in hypotonic solution (0.075M

KCl) for 15 min, and then fixed in Carnoy’s fixative for

15 minutes. The testes were subsequently squashed in 20 ml of

50% acetic acid using a siliconised cover slip, followed by

dehydration in an alcohol series as described above. Staining

involved a 5 min incubation in PBS/1% Triton-X, followed by

15 min in PBS/1% Triton-X with 0.25 mg/ml DAPI (49,6-

diamino-2-phenylindole; Sigma-Aldrich). The slides were then

rinsed for 5 min in PBS/1% Triton-X with 1% Kodak PHOTO-

FLO, followed by 10s rinsing in H2O containing 1% Kodak

B. anynana Chromosomes


PHOTO-FLO. Finally, the preparations were mounted in 20 ml of

antifade.

To determine the sex chromatin status (see [46]), preparations

of polyploid nuclei were made from Malpighian tubules of 5th

instar larvae. The tubules were dissected in physiological solution,

fixed in Carnoy’s fixative for 2 min, and then stained with 1.5%

lactic acetic orcein for 4 min.

Linkage analysis and map constructionCross design. The linkage analysis was based on a cross

between individuals from divergent selection lines for eyespot size

on the ventral hindwing, designated High (H) and Low (L) for large

and small eyespots respectively [3,47]. An H-female was mated to

an L-male (P generation), and subsequently, 15 full-sib F1 crosses

were set up by combining random brothers and sisters to produce

segregating F2 offspring. The larvae were raised on maize plants

and the adults were fed with banana. They were reared at 23uC to

minimize the effect of temperature on eyespot size, since this

temperature is an intermediate between the temperature that

would produce small (20uC) and large (27uC) eyespots as a result of

phenotypic plasticity. The cross that produced the largest amount

of F2 adults was selected to produce the linkage map. All

procedures have been performed following our institutional

animal husbandry guidelines. From a total offspring of 71 males

and 113 females, 23 individuals from both ends of the phenotypic

extremes of the F2 generation were genotyped in each sex (i.e. 92 F2

individuals in total). DNA was extracted from half a thorax using

DNeasy tissue spin columns (Qiagen GmbH, Hilden, Germany).

AFLP. We followed a modified procedure of the AFLP

technique [48]. Digestion and ligation were performed simultane-

ously for two hours at 37uC in 25 ml 16T4 ligase buffer containing

1.2 units of both MseI and EcoRI (NEB, Ipswich, MA, USA),

0.612 mM Mse-adapter (59-GACGATGAGTCCTGAG-39+59-TA-

CTCAGGACTCAT-39), 0.068 mM Eco-adapter (59-CTCGTAG-

ACTGCGTACC-39+5-AATTGGTACGCAGTCTAC-39), 0.6

Weiss units T4 Ligase, 2.5 mg BSA and 5 ml DNA extract from

the 2nd Qiagen DNeasy tissue kit elution (corresponding to approxi-

mately 125 ng DNA).

Preamplification was performed in 15 ml 16AFLP Amplifica-

tion Core Mix Module (Applied Biosystems, Foster City, CA,

USA) supplied with 0.12 mM Eco+A primer (59-GACTGCG-

TACCAATTCA-39), 0.92 mM Mse+C primer (59-GAT-

GAGTCCTGAGTAAC-39), and 2 ml undiluted restriction-liga-

tion product as template. Preamplification PCR cycle was 120s

72uC, 120s 94uC, followed by 20 cycles of 10 s 94uC, 30 s 56uC,

120 s 72uC.

Selective amplifications with 33 different primer combinations

were processed in 10 ml 16Core Mix with 0.05 mM fluorescently

labeled Eco+ANN primer, 0.25 mM Mse+CNN primer and 1 ml

106diluted preamplified product as template. For sequence and

fluorescent labels of the primers see Table 1. Amplification was

performed with 60 s 94uC, then 9 cycles of 10 s 94uC, 30 s Ta

(annealing temperature), 120 s 72uC, with Ta decreasing 1uC per

cycle from 65uC down to 57uC. Then 25 cycles of 10 s 94uC, 30 s

56uC, 120 s 72uC, and a final extension of 30 min at 72uC. Twelve

of the combinations were genotyped on an ABI 377 automated

sequencer with 3 different dyes and ROX500 size standard, and an

additional 21 on an ABI 3100 with 4 dyes and LIZ500 size standard.

The ABI377 data output was analyzed with GENOGRAPHER

1.6.0 [49] and the ABI3100 generated data with GENOTYPER 3.6.

(Applied Biosystems). We use the term ‘‘peakpresent’’ to indicate an

AFLP amplicon that shows up as a peak on capillary fragment

analysis systems and which is either homozygous or heterozygous

and ‘‘peakabsent’’ for the recessive homozygote.

Microsatellites. The microsatellite markers available for this

species were processed under the conditions described in [50],

except in this case they were amplified with NED, PET, 6-FAM or

HEX modified fluorescent primers, run with LIZ-500 size

standard on an ABI 3700 fragment analysis instrument and

analysed with Genotyper 3.6 (primers, size standard, software and

ABI 3700 from Applied Biosystems).

Tpi genotyping. RNA was extracted from ground thorax

with TRIZOL (Invitrogen, Carlsbad, CA, USA) following the

methods suggested by the manufacturer. cDNA was synthesized

with SUPERSCRIPT III (Invitrogen) with 50 ng template and a

T17 primer under standard conditions. A section of the Tpi

(Triose-phosphate isomerase) gene was amplified with arthropod-

specific degenerate primers 197fin1F and 197fin2R [51]. PCR was

performed in 16Amplitaq PCR buffer I, 0.6 units Amplitaq Gold

polymerase (buffer and polymerase supplied by Applied

Table 1. AFLP primer combinations and fluorescent dyes.

MseI-based primer EcoRI-based primer blue EcoRI-based primer green EcoRI-based primer yellow EcoRI-based primer red Instrument

mCAA eACA 5-FAM eACC JOE eAAC NED not used ABI 377

mCAC eACA 5-FAM eACC JOE eAAC NED not used ABI 377

mCAT eACA 5-FAM eACC JOE eAAC NED not used ABI 377

mCGC eACA 5-FAM eACC JOE eAAC NED not used ABI 377

mCAG eACA 6-FAM eAAC VIC eACC NED not used ABI 3100

mCGA eACA 6-FAM eAAC VIC eACC NED not used ABI 3100

mCGG eACA 6-FAM eAAC VIC eACC NED eACG PET ABI 3100

mCGT eACA 6-FAM eAAC VIC not used eACG PET ABI 3100

mCTC eACA 6-FAM eAAC VIC eACC NED eACG PET ABI 3100

mCTG eACA 6-FAM eAAC VIC eACC NED eACG PET ABI 3100

The first column contains the different MseI-based primers used. The next four columns contain the fluorescently labeled EcoRI-based primers that were used incombination with the MseI-based primer within the same row. The primers are 19 bp in length and consist of a 16 bp core sequence and a 3 bp extension. ‘‘m’’ is shortfor a GATGAGTCCTGAGTAA core sequence and ‘‘e’’ stands for a GACTGCGTACCAATTC core sequence. ‘‘m’’ and ‘‘e’’ are followed by the three base extensions thatdifferentiate them. The colors of the fluorescent labels of the EcoRI-based primers are presented in the column headers, and the fluorescent 59 modifications in the cellsbelow them (5-FAM, 6-FAM, JOE, VIC, NED and PET). Individual AFLP markers in Fig. 2 & 3 are characterized by the eNNN-mNNN combinations shown in this table andthe PCR product size. The final column describes which fragment analysis instrument was used.doi:10.1371/journal.pone.0003882.t001



Biosystems) 0.4 mM of each primer, 0.2 mM dNTP and 1 ml of the

cDNA in a final volume of 20 ml. The PCR cycle was 9 min 94uC,

then 35 cycles of 30 s 94uC, 30 s 50uC, 45 s 72uC. The PCR product

was purified with EXOSAP-IT (Amersham plc, Little Chalfont,

UK), sequenced with the BigDye 3.1 kit (Applied Biosystems), and

analyzed on an ABI 3100 sequencer (Applied Biosystems). Gene-

specific primers Ba_TPI_207U (TTCGGCTGAGATGATAA-

AGG) and Ba_TPI_473L (AGTACCAATGGCCCACACTG)

were designed within the Tpi sequence to amplify an intronic

region, using the same genomic template as for the AFLP reactions.

PCR conditions were as described above, except for using Ta 52uCinstead of 50uC. The F1 parents were screened for SNPs (single

nucleotide polymorphisms) by means of sequencing the intron.

Genotyping the F2 offspring was based on PCR amplification (as

above), the amplicons were subsequently treated with 1 unit of AluI

restriction enzyme (NEB) for 2 h at 37uC, which either cuts a 230 bp

fragment into 30 bp and 200 bp or leaves it intact, depending on the

genotype. The restriction pattern was screened on a 3% agarose gel.

The Tpi partial cds and intron sequence are submitted to

GENBANK under accession numbers EU675861 and EU675862.

Data sorting into FI, MI, BI, and sex-linked markers. The

AFLP markers were divided into different groups, depending on the

F1 genotypes. Female informative (FI) markers are present in the F1

female and absent in the F1 male and segregate 1:1, male informative

(MI) markers are present in the F1 male and absent in the F1 female

and segregate 1:1 as well. BI (both informative) markers segregate

with a 3:1 ratio, resulting from F1 male and female that are both

heterozygous peakpresent. Z-linked markers were identified by a

peakpresent in all male offspring and a 1:1 ratio in the female

offspring (representing an F1 WZ+ (R)6Z+Z2 (=) F1 cross, with

‘‘+’’ = peakpresent allele and ‘‘–’’ = peakabsent allele). All F2 female

MI-markers were compared with this Z-specific 1:1 pattern in

JOINMAP to reveal the WZ26Z+Z2 crosses in which both male

and female offspring have a 1:1 ratio.

Identification of chromosome prints. Due to the absence

of meiotic recombination in females, syntenic FI-markers are

transmitted to the offspring in complete association, independent

of their relative position. Consequently, they cannot be positioned

within LGs. A cluster of syntenic FI-markers displays a

chromosome-specific pattern of F2 genotypes, which is identical

for all loci on the same chromosome and which displays the exact

opposite pattern in all markers in repulsion. This fixed set of

genotypes has been named the ‘‘chromosome print’’ [28]. The

number of chromosome prints per individual equals the haploid

autosomal chromosome number. Their identification in B. anynana

was carried out as described in [25], by grouping the FI-markers

together with JOINMAP under strict conditions (LOD .8),

allowing just a small number of genotyping errors. The linkage

phase describes on which parental (F1) chromosome the

peakpresent of a marker lies and from which grandparent (P-

generation) it came. If the marker is present in the grandmother

and absent in the grandfather, the linkage phase is ‘‘0’’, the reverse

gives linkage phase ‘‘1’’. When the marker is present in both

grandparents, the linkage phase is determined by the software

based on co-segregation in the F2 with markers for which linkage

phases are known. Linkage phases consist of a maternal and a

paternal component, indicating marker orientation (and P-origin)

in the F1 mother and the F1 father.

The chromosome prints were numbered based on the output

order of the software. It is important to reduce the number of

errors in chromosome prints to a minimum because they are

subsequently used for error detection and identification and

removal of uninformative markers. With multiple FI-markers

defining a chromosome print, inconsistencies were rescored and

when persistent, the chromosome print was based on the most

common genotype in the inconsistent individual.

Chromosome prints for chromosomes without FI-markers were

reconstructed based on BI and MI-markers as described in

Supplement S2. This was done after the LG assignment described

below. In addition, ten LGs with available (FI-based) chromosome

prints were also reconstructed in this way to validate the

reconstruction technique.

BI and microsatellite linkage group assignment. BI and

microsatellite markers were grouped by screening them against the

21 chromosome print patterns in JOINMAP with a LOD threshold

of 3. This mapping step also established the linkage phase of the

markers. Markers in the six LGs for which chromosome prints were

initially not available were assigned to LG22-LG27.

The markers were subsequently screened by a ‘‘forbidden

genotype’’ analysis to confirm or reject correct LG assignment and

to detect scoring errors [29,39]. This procedure is based on the

fact that certain marker combinations within an individual cannot

occur because it would involve recombination in females. This

screening procedure is explained in more detail in Supplement S3.

The threshold to exclude markers from further analysis was set to

three or more forbidden genotypes.

Identification of allelic (codominant) AFLPs. Part of the

observed variation in AFLP data is caused by indels (insertions or

deletions) between the two restriction sites at a single locus,

resulting in amplicons of different sizes. To determine whether two

BI loci are in fact different alleles of the same locus, we applied the

following criteria: (1) they must have the same primer

combination; (2) they must group together in the same LG when

presented as independent loci in the initial uncensored BI

screening; and (3) linkage phases of markers with 3:1 ratio must

be opposite for both the maternal and the paternal component.

Either one or both peaks present in an individual would be a

prerequisite for codominance in species with recombination in

both sexes, but with non-recombining females, that same

condition is already covered by forbidden genotype restrictions.

MI alleles were detected as well, but they do not provide more

analytical power when combined together into one codominant

marker as is the case in the BI-markers. Their opposite paternal

linkage phases produce fully complementary peak patterns that

hold the same mapping information.

Censoring of female-derived BI-markers in the F2. The

BI-markers (with a 3:1 ratio in the offspring) obtain half their

peakpresent alleles from the F1 mother and the other half from the

F1 father. A female derived peakpresent obscures the male-derived

allele in dominant markers, so that it is impossible to distinguish

between F2 homozygotes and heterozygotes. This is not an issue

when mapping species with recombination in both sexes, because

mapping software can treat these unknown allele combinations as

‘‘either heterozygous or homozygous’’. However, without

recombination in the females, genotype scores that have a

positive F1 female signal have to be excluded from analysis,

which means that part of the paternal information is also lost.

What remains are scores for those individuals that obtained a

peakabsent from the female and either a present or absent from

the male in a 1:1 ratio. The criteria for filtering out the female

component is straightforward because the female BI peakpresent is

always fully linked to either a positive or negative chromosome

print value, depending on their relative maternal linkage phases

(Supplement S4). Markers from individuals with a positive

chromosome print value must be removed when they have the

same maternal linkage phase as the chromosome print, and

markers in repulsion with the chromosome print must be removed

in the remainder of the individuals.



Assignment of linkage groups for MI-markers. The

censored BI genotypes are initially replaced with ‘‘missing data’’.

The BI and microsatellite markers with their LG designations are

then analyzed together with the MI and microsatellite markers in

JOINMAP to establish to which LGs they belong.

Final map construction. Microsatellites were translated to

their male informative component as described in Supplement S5,

resulting in MI-markers with a 1:1 ratio. These were then combined

with the MI- and censored BI-markers for each separate

chromosome. Each chromosome set was then divided in two

subsets, based on their chromosome print values (Supplement S4).

The BI markers in these two subsets are of opposite maternal linkage

phase as a result of the exclusion of the censored BI genotypes. All

the subsets were individually presented to JOINMAP for linkage

map construction. Subsequently, the sets of linkage maps

representing the same chromosomes with suitable anchoring

markers are combined with the ‘‘Combine groups for map

integration’’ command in JOINMAP. The remaining sets (without

anchoring markers) remain as separate LGs. The integration of the

two subsets is represented schematically in Supplement S4.

The Z chromosome markers were divided into male- and female

F2 offspring. The female F2 offspring have a 1:1 ratio for all markers,

while the F2 males have 100% peakpresent when the F1 female is

also peakpresent. These 100% male scores were excluded from

analysis and all the female markers and the remaining male markers

were separately mapped and then joined as described above.

Comparison between JOINMAP and MAPMAKER. Besides

the linkage map construction with JOINMAP, we followed the

procedures described in [26] for constructing a linkage map with

MAPMAKER 3.0.

All steps except the ‘‘Final map construction’’ were identical to the

procedures described above, since [26] used JOINMAP for that part

of the analysis. The main difference from the JOINMAP approach

in this final step is that the censored BI-markers were replaced by

‘‘missing data’’ rather than excluded, and that the markers belonging

to the same LGs were analysed together instead of in two separate

groups. For LGs without sufficient anchoring markers, the subgroups

with the largest mapping distance were compared.

Results

CytogeneticsChromosome number. The analysis of metaphase I

bivalents and male metaphase II chromosomes in male meiosis,

and pachytene bivalents in female meiotic prophase I showed a

haploid chromosome number of 28 for B. anynana in our stock

from Malawi (Fig. 1A–C). This is consistent with the findings of

[18] for B. anynana from Uganda and thus, there is no evidence for

geographical variation in chromosome numbers in this species.

Orcein staining of pachytene bivalents provided the characteristic

chromomere pattern that differentiated the chromosomes to a

certain level (Fig. 1C). However, we did not assign chromosome

numbers based on these patterns since it is not clear with which

linkage groups they correspond.

Sex chromosomes. Male pachytene spreads displayed 28

bivalents per nucleus that were aligned over their full length. Female

pachytene oocytes showed 27 fully-paired bivalents and a pair of sex

chromosomes, consisting of a small heterochromatic W chromosome

that has a circular arrangement and a Z chromosome that was

wrapped around it in the majority of nuclei (Fig 1D); in some nuclei,

the W chromosome was associated with a terminal segment of the Z

chromosome (Fig. 1C) or less often with a central part of the Z

chromosome (Fig. 1E) and formed a short thick rod or a body-like

structure. A comparison of the male and female chromosome

complements shows that B. anynana has a WZ/ZZ (female/male) sex

chromosome system, typical for the majority of advanced

Lepidoptera (reviewed in [11]).

Large, highly polyploid interphase nuclei of the Malpighian

tubules do not form lobes as is seen in some Lepidoptera (cf. [52]),

but have oval shapes. In females, each nucleus showed a small

heterochromatin W-body (i.e. sex chromatin) that was absent in

males (Fig. 1F,G). The small size of the W-body was consistent

with the tiny W chromosome observed in pachytene oocytes.

Nucleolar organising regions. Two distinct nucleoli were

regularly observed in YOYO-1-stained pachytene spreads. One was

associated with an autosome bivalent, the other with the WZ bivalent

(Fig. 1D,H,I). The association with the WZ bivalent is not apparent in

Fig. 1D and 1H since the nucleolus also borders autosomal bivalents,

but it was consistent in all examined nuclei. At the end of the

autosome bivalent, a pair of YOYO-1-positive dots was immersed

into the nucleolus mass. The dots probably composed of

heterochromatin were often separated from the main chromosome

bodies by a constriction, obviously representing the nucleolus

organizing region (NOR) (Fig 1H). In orcein-stained pachytenes,

two conspicuous chromomeres were seen at the end of this NOR-

bivalent (Fig 1I). These chromomeres most likely correspond with the

two heterochromatic dots highlighted with YOYO-1 (Fig. 1D,H).

Linkage mappingGenetic markers. A total number of 458 polymorphic

segregating markers was generated with AFLPs. The effective

number was smaller because the female informative markers do not

contribute to mapping, a small number of markers failed the

forbidden genotype screening, and 52 markers that behaved as

alleles were merged to form 26 single locus codominant markers.

This resulted in 347 AFLP loci that could be used for the

construction of the linkage map. The markers cover all

chromosomes except for the W chromosome, which cannot be

mapped even if markers were available because this chromosome

not involved in recombination. Additionally, there were seven

polymorphic microsatellites that could be positioned on the map and

another two that could only be assigned to specific LG’s by their

female informative component because they were homozygous in

the F1 male. This number is far lower than the number of

microsatellite loci available for B. anynana because many were not

informative in the P-generation to start with, and other loci inherited

an uninformative set of alleles from the P-generation to the F1 due to

the bottleneck conditions of the full-sib cross design. The AluI

digestion of the genomic Tpi amplicons gave a restriction pattern in

male F2 offspring of either a 230 bp fragment, a 200 bp (and a 30 bp)

fragment, or both of them within the same individual, thus

representing both homozygotes and the heterozygote. Female F2

offspring had either the 230 bp or the 200 bp fragment (but not both)

per individual, thereby showing a hemizygous (Z-linked) pattern.

Chromosome prints based on FI-markers were available for 21

of the 27 autosomes, another three were reconstructed from BI

and MI-markers (LGs 22, 25, 27) and the remaining three were

based on BI-markers alone (LGs 23, 24, 26), with random 1:1

designation for the unassigned values as described in Supplement

S2. The empirical verification of the BI+MI based reconstruction

for LGs with chromosome prints already available gave an exact

match between ‘‘chromosome print’’ and ‘‘reconstructed chromo-

some print’’ in eight out of 10 cases, one with a single error and

one with three, giving a total of only four inconsistent values out of

920. The verification of difference between the BI-only recon-

structed maps and the actual maps (performed on the same 10

control LGs) showed a deviation of 2 cM at most for the entire



mapping distance, and the markers always remained in the same

order.

The final linkage map is shown in Fig. 2 and 3. Twenty

chromosomes had sufficient anchoring markers to create integrat-

ed LGs following the procedures outlined in Supplement S4. Eight

chromosomes had either one or no anchoring markers (chromo-

somes 11, 12, 14, 17, 20, 22, 23, 24), which prevented integration.

These are represented in Fig. 2 and 3 as separate linkage groups

Figure 1. Preparations of meiotic cells and somatic interphase nuclei in Bicyclus anynana. (A) Squashed DAPI-stained male metaphase Ibivalents; (B) squashed DAPI-stained male metaphase II chromosomes; (C) spread orcein-stained female pachytene complement showingchromomere patterns; note the small heterochromatic W chromosome associated with the terminal segment of the Z chromosome (arrow); (D)spread YOYO-1-stained female postpachytene complement showing a curious WZ bivalent, in which the Z chromosome strand is wrapped aroundthe body-like W chromosome, and two nucleoli, one associated with an autosome bivalent (NA) and the other with the WZ bivalent (NWZ); note smallheterochromatin dots (arrow) highlighted with YOYO-1 at the end of each chromosome of the NOR-autosome bivalent; (E) orcein-stained femalepachytene spread, showing a WZ-bivalent where the W chromosome is associated with the central part of the Z chromosome; (F) a polyploid nucleusof the female Malpighian tubule cell showing a small sex-chromatin body (arrow), representing multiple copies of the tiny W chromosome; (G) apolyploid nucleus of the male Malpighian tubule cell without sex chromatin; (H) YOYO-1 stained female pachytene spread showing the NOR asstalked dots (arrow) in the nucleolus; (I) orcein-stained female pachytene spread with two conspicuous chromomeres (arrow) within the nucleolus.Scale bars indicate 10 mm in (A-D and H,I) and 50 mm in (F, G).doi:10.1371/journal.pone.0003882.g001



per chromosome with unknown position and orientation relative

to each other. These two subsets represent markers available from

the high and low eyespot selection lines respectively. The Z

chromosome contains 18 evenly dispersed markers and the Tpi

gene. The mapping lengths of the chromosomes range from 8 to

84 cM, but we assume that the smaller linkage groups have

insufficient coverage rather than representing chromosomes that

are relatively small. Therefore, the estimated map length does not

necessarily reflect the actual chromosome length.

Comparing mapping procedures; JOINMAP with

separate phase analysis vs. MAPMAKER with missing

data censoring. The mapping order in MAPMAKER was

similar to the JOINMAP output for most chromosomes. However,

in some LG’s with low proportions of anchoring markers vs. BI

markers, or unevenly distributed anchoring markers, large

rearrangements sometimes occurred. This is caused by the fact

that MAPMAKER compares small subsets of markers rather than

all representatives of an LG at the same time. MAPMAKER

initially uses a maximum of eight markers, and subsequently

positions additional markers within the initial (eight marker) map.

Finally, the mapping order is fine-tuned by using a sliding window

of five markers (ripple command). The use of a subset of markers

(i.e. eight initial markers or five ripple markers) that is made up of

BI markers of both maternal linkage phases and less than two

anchoring markers, results in an unreliable suggested marker

order. The reliability of the initial (eight marker) map can be

improved by including all available MI and codominant markers,

but with the ripple command the representative markers cannot be

hand-picked because their grouping depends on the provisional

marker order suggested by MAPMAKER. Similar to the ripple

command that is used to determine marker order, a sliding

window analysis also reveals the reliability of the marker order, by

comparing the likelihood of the most likely marker order with

alternative orders (flips test). This test is confronted with the same

bi-phasic incompatibility problems and cannot be used on a

censored data set with missing data. The consequences of

comparing only subsets of markers within a linkage group (i.e.

sliding window) are illustrated with an example based on LG21,

which is characterized by codominant anchoring markers close to

both ends and ten dominant markers of both phases in between

them (Supplement S6). JOINMAP also performs a ripple test,

which is based on a sliding window of only three markers. With

Figure 2. Linkage map of LG1-12. Vertical bars represent chromosomes and show the mapping distance in centimorgan (cM) on the left and thecorresponding markers on the right. Microsatellites are displayed in bold and start with ‘‘BA’’, the two microsatellites with only FI polymorphism areplaced underneath the LG’s they belong to. AFLPs are named according to their selective primer extension and amplicon size. The ‘‘e’’ stands for thefluorescent EcoRI-based primer and the ‘‘m’’ stands for the non-fluorescent MseI-based primer. AFLPs with two amplicon sizes per primercombination (e.g. eACCmCAA212-221 in LG03) are codominant. A vertical line indicates that markers are less than 1 cM apart (e.g. eACAmCGA119and eAACmCAT370 in LG09).doi:10.1371/journal.pone.0003882.g002



‘‘missing data’’ input, this results in even more problems than in

MAPMAKER because the chance that two anchoring markers are

included in a subset of just three markers is far smaller than in a

subset of five. This is presumably the reason why for the final

mapping step in some butterfly linkage maps JOINMAP has been

replaced by MAPMAKER.

The marker order suggested by JOINMAP (following the

procedures used for the present linkage map) is far more reliable

than the MAPMAKER approach because it does not attempt to

map incompatible BI markers relative to each other directly. The

ripple test, which can cause serious problems with missing data

analysis, strongly increases the reliability of the marker order when

Figure 3. Linkage map of LG13-27 and Z.doi:10.1371/journal.pone.0003882.g003



analyzing markers of each maternal linkage phase separately in

JOINMAP. Instead of reporting a flips test value, JOINMAP

simply excludes markers that do not meet the criteria for reliable

neighboring markers (recombination frequency smaller than 0.4

and LOD larger than 1.0). MAPMAKER on the other hand

always suggests a mapping order and will always produce a linkage

map that includes all presented markers.

The mapping distances given by MAPMAKER were larger

than those produced by JOINMAP under all circumstances. The

mapping distances decreased substantially with error detection

activated in MAPMAKER, but were on average still 38% larger

than in JOINMAP, ranging from 1.02 to 2.14 times in size for the

different LGs (Supplement S7). The total mapping distances are

1873 vs. 1354 cM for MAPMAKER and JOINMAP respectively.

The data are presented in different ways to each program, with the

censored BI-markers as missing data in MAPMAKER and

excluded in JOINMAP. Since JOINMAP has difficulties with

high proportions of non-overlapping missing data, a comparison

with identical data input was not possible for the MI-markers

combined with censored BI-markers. Therefore, the software was

also compared based only on MI-markers, thus avoiding censoring

of markers. Fourteen LGs had sufficient MI-markers to construct

linkage maps with MAPMAKER again giving higher values than

JOINMAP, but now with only 17% difference. The genome size

of B. anynana is 0.49 pg [53], which corresponds with approxi-

mately 480 Mb [54]. This means that the JOINMAP based

linkage map is 355 Kb/cM and the MAPMAKER based map 256

Mb/cM.

Discussion

CytogeneticsThe cytogenetic characteristics combined with the inheritance

patterns of genetic markers of B. anynana correspond to those

generally found in Lepidoptera. Female heterogamety is con-

firmed by the presence of a WZ bivalent in pachytene oocytes and

the presence of a heterochromatic W-body in female somatic

interphase nuclei, which are absent in males. The chromosomes

are indistinguishable in different stages of both mitotic and meiotic

divisions, except for orcein stained pachytene, where different

bivalents can be differentiated to a certain degree. We regularly

identified two distinctive bivalents that were associated with two

different nucleoli in female pachytene spreads. One of these

nucleoli is associated with the WZ bivalent and the other with an

autosome bivalent. The autosome bivalent carried a terminally

located NOR that was associated with small but clear hetero-

chromatin. The presence of heterochromatin at the NORs is

common in animals (e.g. [55,56]) but in Lepidoptera has been

reported only in the silkworm B. mori [57].

It remained unclear whether the sex-linked NOR of B. anynana

was located on the W- or on the Z chromosome or on both sex

chromosomes since we did not examine pachytene spermatocytes

for a comparison. Due to the circular form of the WZ bivalent it

was not possible to determine whether the sex-linked NOR is

terminal or interstitial. Nevertheless, we favor location of the sex-

linked NOR on the Z chromosome as the W chromosome appears

composed entirely of heterochromatin, which would inhibit a high

transcriptional activity of the active NOR.

The pachytene WZ bivalent of B. anynana is exceptional due to

the tiny W chromosome. The W chromosome of the oriental

tussock moth, Artaxa subflava is about half the size of the Z

chromosome [58] and in the other lepidopteran species examined

so far, the W chromosome was either only slightly smaller or

comparable in size to the Z chromosome (e.g. [23,59,60].

Compatible lengths in the pachytene stage of such relatively

similar sized W and Z chromosomes undoubtedly facilitate their

complete pairing. A regular synaptonemal complex can be formed

in spite of their obvious non-homology by means of twisting and

synaptic adjustment [52,61]. However, the size difference of W

and Z is too large in B. anynana to form a regular bivalent. Instead,

the much longer Z chromosome often forms a circle or horseshoe

structure with the W chromosome closed inside. This arrangement

could be considered an extreme case of synaptic adjustment as it

allows the sex chromosomes to pair along their entire length. A

similar mode of pairing was observed in mutants of the flour moth

(Ephestia kuehniella), in which the W chromosome was shortened by

irradiation [62], and also in A. subflava, in which the W

chromosome comprises about half of the Z chromosome but

shows still a conspicuous heterochromatic mass (see Fig. 3 in [58]).

On the other hand, we cannot exclude that the W and Z

chromosomes pair by means of some sequence homology, for

example, in telomeric regions or via rDNA in the case of shared

NORs. The B. anynana W chromosome is composed of constitutive

heterochromatin as in many other Lepidoptera. This observation,

combined with recent findings on the composition of W

chromosomes in B. mori, C. pomonella, and several pyralids

[57,60,63,64], suggests that the B. anynana W chromosome is

probably gene-poor and rich in interspersed repetitive sequences,

such as transposable elements, which are known to be abundant in

B. anynana in general [65]. The small size of the W chromosome is

also reflected by a small heterochromatin body in Malpighian

tubule nuclei of females. The size could indicate an intermediate

stage in the process of secondary loss of the W chromosome as is

the case in Lepidoptera that have adopted a ZZ/Z sex

determination system after loss of the W chromosome [11].

Linkage mapHow to get the most out of an F2 design. The full-sib F2

cross design was chosen for the purpose of mapping QTL for

ventral eyespot size. It generates a maximum phenotypic range in

the offspring while keeping random genetic variation to a

minimum. As a downside, this design is not ideally suited for

linkage mapping with dominant markers.

One effect of having just one set of grandparents is that BI

markers carry information in only one of both paternal linkage

phases for most LGs (Supplement S8). Another effect is that it

creates a strong bottleneck, that results in a lower proportion of FI

and MI markers relative to BI markers than in an outbred cross

(Supplement S8). This is most striking when the F1 male and

female inherit the same set of P chromosomes, where 1:1

segregating markers can only arise as a result of recombination

in the P-male. This unfavorable F1 gamete combination occurs in

25% of the chromosomes, and is reflected by the complete absence

of FI-markers in six LGs. Without recombination in the P-male for

such LGs, generating more AFLP markers will not produce FI-

markers because they do not exist for these linkage groups.

Therefore, the chromosome prints for these six FI-devoid

autosomes had to be obtained from BI and MI-markers instead.

This reconstruction is based on the forbidden genotype restric-

tions, and the assumptions that either the unassigned individuals

received a MI-marker that was fully associated with a non-

recombinant BI-marker region (BI+MI reconstruction), or that the

female BI component segregation is 1:1 (BI only reconstruction).

Empirical tests based on LGs with available chromosome prints

showed that this approach creates chromosome prints that are

identical or nearly identical to the available ones, and linkage

maps that are very similar to those based on conventionally

censored datasets. The stochastic deviations from the 1:1



segregation have a negligible effect on the mapping distance and

no effect on the mapping order. This validates the BI censoring

approach for LGs without FI-markers.

The selective genotyping approach was chosen to avoid

genotyping intermediate eyespot phenotypes in the offspring, since

they provide hardly any additional information in QTL mapping

compared to that of the extreme phenotypes [66]. As a result of this,

the linkage map itself is based on a non-random set of offspring. The

effect of this on the reliability of the linkage map is negligible because

it does not affect the three main characteristics in linkage mapping:

namely, marker grouping, marker order and marker distance. There

could, however be an effect of selection on the ratios of segregating

markers, since dominance promotes extreme phenotypes in recessive

homozygotes and additive alleles produce extreme phenotypes in

both types of homozygotes. Markers that are linked to genes which

are involved with eyespot formation may therefore deviate from 3:1

or 1:1 ratios due to hitch-hiking.

Effects of data censoring. Using MAPMAKER with

censored BI-markers as missing data resulted in a map that was

38% larger in size than the one produced from two subsets per

chromosome with JOINMAP. This size difference is caused by

two factors. Firstly, there is a software effect (i.e. algorithms used)

that is revealed by analyzing only the (uncensored) MI-markers,

that accounts for 17% of the difference in this study. The rest of

the difference is caused by the treatment of the incompatible bi-

phasic censored BI-markers. The main purpose of the

MAPMAKER analysis was to allow comparison of mapping

distance in B. anynana with other Lepidoptera linkage maps, since

this is the first species in this taxon for which the final mapping

step was performed in JOINMAP. This software has not been used

before for Lepidoptera linkage maps, presumably because it is less

able to deal with a substantial portion of non-overlapping

genotypes than MAPMAKER. Our approach avoided this

problem by adapting that of [34] which involves splitting up the

dataset based on chromosome print value and omitting female-

derived information rather than treating it as missing data. This

results in two linkage maps per chromosome that are then

juxtaposed and integrated based on common MI and codominant

markers and their average distances. Rather than just using the

average distance between the anchoring markers to combine the

two phases, JOINMAP also takes the number of individuals

representing both subsets into account [67].

Linkage groups and chromosome number. The number

of LGs matches the karyotype, thus markers are available for all 27

autosomes and the Z chromosome. There are no markers

available for the W chromosome, probably due to its small size.

The marker densities and distances vary substantially between the

different chromosomes, but given the uniform lengths of the

pachytene bivalents, we interpret this as incomplete marker

coverage rather than a difference in chromosome size. We aimed

to present an integrated linkage map, with relative marker

positions and distances based on both sets of incompatible BI-

markers linked together with MI, codominant AFLP and

microsatellite markers. We succeeded for 20 LGs, and mapped

the remaining eight separately because they lacked sufficient

anchoring markers. The presence of the Tpi gene of B. anynana is

consistent with all (distantly related) Lepidoptera species for which

this gene has been mapped to date (summarized in [11]). This

strengthens the hypothesis of taxon-wide conserved synteny for at

least part of the Lepidoptera Z chromosome.

Linkage and physical maps in Lepidoptera. The present

linkage map provides the basis for the assignment of the number,

position, effect and interactions of QTLs involved with the

development of wingspot size. We will further anchor the map

using SNP markers [68], with a main focus on genes that are

involved in eyespot formation in B. anynana and eyespot and wing

pattern formation in Lepidoptera in general. Additionally, physical

anchoring of linkage groups to specific chromosomes by means of

BAC-FISH, as has been performed in B. mori [35], will provide a

solid framework for future mapping studies.

The MAPMAKER mapping distance of 1873 cM in B. anynana

is within the 1430–2542 cM range reported for other butterfly

species [25,26,37]. The accuracy of these mapping distances may

however be limited, since mapping distances of both 1430 cM and

2400 cM were reported in Heliconius erato [26,36] and distances

ranging from 1305 cM to 6512 cM in Bombyx mori [30,32] when

using MAPMAKER software. One mapping software package

that does support sex-specific map construction is CRI-MAP [69],

which has been used to build many mammalian genetic maps. To

our knowledge, CRI-MAP has never been used to compute a

Lepidoptera map based on dominant markers. CRI-MAP shares

some of its origins with MAPMAKER and suffers from the same

deficiencies of MAPMAKER we have explained above. Notably,

CRI-MAP includes (1) no robust method to choose an initial order

of markers and (2) no systematic method to decide whether a

marker should be excluded from the map because it cannot be

reliably ordered. Our proposed mapping strategy avoids Lepidop-

tera specific issues that have an effect on mapping distance and

order, but it still requires a large number of analysis steps.

Therefore, we would welcome the implementation of sex-specific

recombination in the analysis parameters of JOINMAP. This

would not just be an asset to linkage mapping in Lepidoptera, but

for all organisms in which sex-specific recombination rates have

been reported.

Supporting Information

Supplement S1 Haploid chromosome numbers of different

Bicyclus species and their geographical origin.

Found at: doi:10.1371/journal.pone.0003882.s001 (0.04 MB

DOC)

Supplement S2 Reconstruction of the chromosome print


DOC)

Supplement S3 Forbidden genotype screening


DOC)

Supplement S4 Censoring of BI markers and map integration

with anchoring markers


DOC)

Supplement S5 Microsatellite censoring


DOC)

Supplement S6 Implications of sliding window analysis of a

‘‘missing data’’-censored dataset based on an example.


DOC)

Supplement S7 Linkage group sizes of Bicyclus anynana

produced with MAPMAKER and with JOINMAP


DOC)

Supplement S8 Implications of a full-sib design


DOC)



Acknowledgments

We thank Dr Durrell Kapan and Dr. Ir. Johan W. van Ooijen for valuable

comments on linkage mapping in Lepidoptera and its implications for

JOINMAP software.

Author Contributions

Conceived and designed the experiments: AEVH FM IS PMB BJZ.

Performed the experiments: AEVH FM IS. Analyzed the data: AEVH FM

IS BJZ. Contributed reagents/materials/analysis tools: FM IS PMB BJZ.

Wrote the paper: AEVH.

References

1. Beldade P, Brakefield PM (2002) The genetics and evo-devo of butterfly wing

patterns. Nature Reviews Genetics 3: 442–452.

2. Beldade P, Brakefield PM, Long AD (2005) Generating phenotypic variation:

prospects from ‘‘evo-devo’’ research on Bicyclus anynana wing patterns. Evol Dev7: 101–107.

3. Wijngaarden PJ, Brakefield PM (2000) The genetic basis of eyespot size in the

butterfly Bicyclus anynana: an analysis of line crosses. Heredity 85: 471–479.

4. Marcus JM, Ramos DM, Monteiro A (2004) Germline transformation of the

butterfly Bicyclus anynana. Proc R Soc Lond B Biol Sci 271 Suppl 5: S263–5.

5. Fischer K, Eenhoorn E, Bot ANM, Brakefield PM, Zwaan BJ (2003) Coolerbutterflies lay larger eggs: developmental plasticity versus acclimation.

Proc R Soc B 270: 2051–2056.

6. Pijpe J, Brakefield PM, Zwaan BJ (2008) Increased life span in a polyphenic

butterfly artificially selected for starvation resistance. Am Nat 171: 81–90.

7. Zijlstra WG, Steigenga MJ, Brakefield PM, Zwaan BJ (2003) Simultaneousselection on two fitness-related traits in the butterfly Bicyclus anynana. Evolution

57: 1852–1862.

8. Robinson R (1971) Lepidoptera Genetics. Oxford, UK: Pergamon Press.

9. Suomalainen E (1969) Chromosome evolution in the Lepidoptera. Chromo-

somes Today 2: 132–138.

10. Kandul NP, Lukhtanov VA, Pierce NE (2007) Karyotypic diversity and

speciation in Agrodiaetus butterflies. Evolution 61: 546–559.

11. Traut W, Sahara K, Marec F (2008) Sex Chromosomes and Sex Determinationin Lepidoptera. Sex Dev 1: 332–346.

12. White MJD (1973) The chromosomes. London: Chapman & Hall.

13. Yoshido A, Marec F, Sahara K (2005) Resolution of sex chromosome

constitution by GISH and telomere-FISH in some species of Lepidoptera.

Chromosoma 114: 193–202.

14. Charlesworth B, Coyne JA, Barton NH (1987) The relative rates of evolution of

sex chromosomes and autosomes. Am Nat 130: 113–146.

15. Prowell DP (1998) Sex linkage and speciation in Lepidoptera. In: Howard DJ,

Berlocher SH, eds. Endless forms: species and speciation. New York: Oxford

University Press. pp 309–319.

16. Brown KS, Emmel T, Eliazar PJ, Suomalainen E (1992) Evolutionary patterns

in chromosome numbers in neotropical Lepidoptera. I. Chromosomes of the

Heliconiini (family Nymphalidae: subfamily Nymphalinae). Hereditas 117:109–125.

17. Suomalainen E, Brown KS Jr (1984) Chromosome number variation withinPhilaethria butterflies (Lepidoptera: Nymphalidae, Heliconiini). Chromosoma 90:

170–176.

18. De Lesse H (1968) Formules chromosomiques de Lepidopteres Rhopaloceresd’Uganda et du Kenya. Ann Soc Ent Fr (NS) 4: 581–599.

19. De Lesse H, Condamin M (1962) Formules chromosomiques de quelques

Lepidopteres Rhopaloceres du Senegal. Bulletin de l’IFAN 24: 464–473.

20. De Lesse H, Condamin M (1965) Formules chromosomiques de quelques

Lepidopteres Rhopaloceres du Senegal et de Cote d’Ivoire. Bulletin de l’IFAN27: 1089–1094.

21. Tanaka N, Yokoyama T, Abe H, Tsuchida K, Ninagi O, et al. (2000)

Cytogenetic analysis shows that the unusually large chromosome in the sex-limited pB silkworm (Bombyx mori) strain consists of three chromosomes.

Hereditas 133: 95–103.

22. Wolf KW (1996) The structure of condensed chromosomes in mitosis and

meiosis of insects. Int J Insect Morphol Embryol 25: 37–62.

23. Fukova I, Nguyen P, Marec F (2005) Codling moth cytogenetics: karyotype,chromosomal location of rDNA, and molecular differentiation of sex

chromosomes. Genome 48: 1083–1092.

24. Marec F, Tothova A, Sahara K, Traut W (2001) Meiotic pairing of sexchromosome, fragments and its relation to atypical transmission of a sex-linked

marker in Ephestia kuehniella (Insecta : Lepidoptera). Heredity 87: 659–671.

25. Jiggins CD, Mavarez J, Beltran M, McMillan WO, Johnston S, et al. (2005) A

genetic linkage map of the mimetic butterfly Heliconius melpomene. Genetics 171:

557–570.

26. Kapan DD, Flanagan NS, Tobler A, Papa R, Reed RD, et al. (2006)

Localization of Mullerian mimicry genes on a dense linkage map of Heliconius

erato. Genetics 173: 735–757.

27. Promboon A, Shimada T, Fujiwara H, Kobayashi M (1995) Linkage map of

Random Amplified Polymorphic DNAs (RAPDs) in the silkworm, Bombyx mori.Genet Res 66: 1–7.

28. Yasukochi Y (1998) A dense genetic map of the silkworm, Bombyx mori, covering

all chromosomes based on 1018 molecular markers. Genetics 150: 1513–1525.

29. Shi J, Heckel DG, Goldsmith MR (1995) A genetic linkage map for the

domesticated silkworm, Bombyx mori, based on restriction fragment lengthpolymorphisms. Genetical Research 66: 109–126.

30. Tan YD, Wan C, Zhu Y, Lu C, Xiang Z, et al. (2001) An amplified fragment

length polymorphism map of the silkworm. Genetics 157: 1277–1284.

31. Miao X-X, Xub S-J, Li M-H, Li M-W, Huang J-H, et al. (2005) Simple

sequence repeat-based consensus linkage map of Bombyx mori. Proc Natl Acad Sci

USA 102: 16303–16308.

32. Yamamoto K, Narukawa J, Kadono-Okuda K, Nohata J, Sasanuma M, et al.

(2006) Construction of a single nucleotide polymorphism linkage map for the

silkworm, Bombyx mori, based on bacterial artificial chromosome end sequences.

Genetics 173: 151–161.

33. Yamamoto K, Nohata J, Kadono-Okuda K, Narukawa J, Sasanuma M, et al.

(2008) A BAC-based integrated linkage map of the silkworm, Bombyx mori.

Genome Biol 9: R21.

34. Yasukochi Y, Ashakumary LA, Baba K, Yoshido A, Sahara K (2006) A second-

generation integrated map of the silkworm reveals synteny and conserved gene

order between lepidopteran insects. Genetics 173: 1319–1328.

35. Yoshido A, Bando H, Yasukochi Y, Sahara K (2005) The Bombyx mori karyotype

and the assignment of linkage groups. Genetics 170: 675–685.

36. Tobler A, Kapan D, Flanagan N, Gonzalez C, Peterson E, et al. (2005) First-

generation linkage map of the warningly colored butterfly Heliconius erato.

Heredity 94: 408–417.

37. Wang B, Porter AH (2004) An AFLP-based interspecific linkage map of

sympatric, hybridizing Colias butterflies. Genetics 168: 215–225.

38. Dopman EB, Bogdanowicz SM, Harrison RG (2004) Genetic mapping of sexual

isolation between E and Z pheromone strains of the European corn borer

(Ostrinia nubilalis). Genetics 167: 301–309.

39. Heckel DG, Gahan LJ, Liu Y-B, Tabashnik BE (1999) Genetic mapping of

resistance to Bacillus thuringiensis toxins in diamondback moth using biphasic

linkage analysis. Proc Natl Acad Sci USA 96: 8373–8377.

40. Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, et al. (1987)

MAPMAKER: an interactive computer package for constructing primary

genetic linkage maps of experimental and natural populations. Genomics 1:

174–181.

41. Van Ooijen JW, Voorrips RE (2001) JoinMap 3.0: software for the calculation of

genetic linkage maps. Wageningen: Plant Research International.

42. Gawłowska M, Swiecicki W, Wolko B (2005) Comparison of genetic maps for

two pea populations (Pisum sativum L.). Pisum Genetics 37: 19–23.

43. Sewell MM, Sherman BK, Neale DB (1999) A consensus map for loblolly pine

(Pinus taeda L.). I. Construction and integration of individual linkage maps from

two outbred three-generation pedigrees. Genetics 151: 321–330.

44. Traut W (1976) Pachytene mapping in the female silkworm, Bombyx mori L.

(Lepidoptera). Chromosoma 58: 275–284.

45. Mediouni J, Fukova I, Frydrychova R, Dhouibi MH, Marec F (2004) Karyotype,

sex chromatin and sex chromosome differentiation in the carob moth, Ectomyelois

ceratoniae (Lepidoptera: Pyralidae). Caryologia 57: 184–194.

46. Traut W, Marec F (1996) Sex chromatin in Lepidoptera. Q Rev Biol 71:

239–256.

47. Brakefield PM, Gates J, Keys D, Kesbeke F, Wijngaarden PJ, et al. (1996)

Development, plasticity and evolution of butterfly eyespot patterns. Nature 384:

236–242.

48. Vos P, Hogers R, Bleeker M, Reijans M, Lee Tvd, et al. (1995) AFLP: a new

technique for DNA fingerprinting. Nucleic Acids Research 23: 4407–4414.

49. Benham J, Jeung J-U, Jasieniuk M, Kanazin V, Blake T (1999) Genographer: A

graphical tool for automated AFLP and microsatellite analysis. J Agric Genomics

4.

50. Van’t Hof AE, Zwaan BJ, Saccheri IJ, Daly D, Bot ANM, et al. (2005)

Characterization of 28 microsatellite loci for the butterfly Bicyclus anynana. Mol

Ecol Notes 5: 169–172.

51. Regier JC (2005) Protocols, Concepts, and Reagents for preparing DNA

sequencing templates. Version 3/14/06. www.umbi.umd.edu/users/jcrlab/

PCR_primers.pdf.

52. Marec F, Traut W (1994) Sex chromosome pairing and sex chromatin bodies in

W-Z translocation strains of Ephestia kuehniella (Lepidoptera). Genome 37:426–435.

53. Gregory TR, Hebert PDN (2003) Genome size variation in lepidopteran insects.

Can J of Zool 81: 1399–1405.

54. Dolezel J, Bartos J, Voglmayr H, Greilhuber J (2003) Nuclear DNA content and

genome size of trout and human. Cytometry 51A: 127–128.

55. Hirai H, Yamamoto MT, Ogura K, Satta Y, Yamada M, et al. (1994)

Multiplication of 28S rDNA and NOR activity in chromosome evolution among

ants of the Myrmecia pilosula species complex. Chromosoma 103: 171–178.

56. King M, Contreras N, Honeycutt RL (1990) Variation within and between

nucleolar organizer regions in Australian hylid frogs (Anura) shown by 18S+28Sin-situ hybridization. Genet Res 80: 17–29.



57. Sahara K, Yoshido A, Kawamura N, Ohnuma A, Abe H, et al. (2003) W-

derived BAC probes as a new tool for identification of the W chromosome and

its aberrations in Bombyx mori. Chromosoma 112: 48–55.

58. Yoshido A, Yamada Y, Sahara K (2006) The W chromosome detection in

several Lepidopteran species by genomic in situ hybridization (GISH). J Insect

Biotechnol Sericol 75: 147–151.

59. Traut W, Sahara K, Otto TD, Marec F (1999) Molecular differentiation of sex

chromosomes probed by comparative genomic hybridization. Chromosoma

108: 173–180.

60. Vıtkova M, Fukova I, Kubıckova S, Marec F (2007) Molecular divergence of the

W chromosomes in pyralid moths (Lepidoptera). Chromosome Res 15:

917–930.

61. Weith A, Traut W (1986) Synaptic adjustment, non-homologous pairing, and

non-pairing of homologous segments in sex chromosome mutants of Ephestia

kuehniella (Insecta, Lepidoptera). Chromosoma 94: 125–131.

62. Traut W, Weith A, Traut G (1986) Structural mutants of the W chromosome in

Ephestia (Insecta, Lepidoptera). Genetica 70: 69–79.

63. Abe H, Mita K, Yasukochi Y, Oshiki T, Shimada T (2005) Retrotransposable

elements on the W chromosome of the silkworm, Bombyx mori. CytogenetGenome Res 110: 144–151.

64. Fukova I, Traut W, Vıtkova M, Nguyen P, Kubıckova S, et al. (2007) Probing

the W chromosome of the codling moth, Cydia pomonella, with sequences frommicrodissected sex chromatin. Chromosoma 116: 135–145.

65. Van’t Hof AE, Brakefield PM, Saccheri IJ, Zwaan BJ (2007) Evolutionarydynamics of multilocus microsatellite arrangements in the genome of the butterfly

Bicyclus anynana, with implications for other Lepidoptera. Heredity 98: 320–328.

66. Muranty H, Goffinet B, Santi F (1997) Multitrait and multipopulation QTLsearch using selective genotyping. Genet Res 70: 259–265.

67. Stam P (1993) Construction of integrated genetic linkage maps by means of anew computer package: JoinMap. Plant J 3: 739–744.

68. Beldade P, Rudd S, Gruber JD, Long AD (2006) A wing expressed sequence tagresource for Bicyclus anynana butterflies, an evo-devo model. BMC Genomics 7:

130.

69. Lander ES, Green P (1987) Construction of multilocus genetic linkage maps inhumans. Proc. Natl. Acad. Sci. USA 84: 2363–2367.



Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus...

Documents

Transcript of Cytogenetic Characterization and AFLP-Based Genetic Linkage Mapping for the Butterfly Bicyclus...