PLEASE SCROLL DOWN FOR ARTICLE

This article was downloaded by: [B-on Consortium - 2007]On: 20 October 2008Access details: Access Details: [subscription number 778384750]Publisher Informa HealthcareInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Mitochondrial DNAPublication details, including instructions for authors and subscription information:http://www.informaworld.com/smpp/title~content=t713640135

Characterisation of the 11 Kb DNA region adjacent to the gene encodingDesulfovibrio gigas flavoredoxinManuela Broco a; Ana Marques a; Solange Oliveira ab; Claudina Rodrigues-Pousada a

a Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Oeiras, Portugal b Departamentode Biologia, Universidade de Évora, Évora, Portugal

Online Publication Date: 01 June 2005

To cite this Article Broco, Manuela, Marques, Ana, Oliveira, Solange and Rodrigues-Pousada, Claudina(2005)'Characterisation of the11 Kb DNA region adjacent to the gene encoding Desulfovibrio gigas flavoredoxin',Mitochondrial DNA,16:3,207 — 216

To link to this Article: DOI: 10.1080/10425170500088296

URL: http://dx.doi.org/10.1080/10425170500088296

Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf

This article may be used for research, teaching and private study purposes. Any substantial orsystematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply ordistribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae and drug dosesshould be independently verified with primary sources. The publisher shall not be liable for any loss,actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directlyor indirectly in connection with or arising out of the use of this material.

FULL LENGTH RESEARCH PAPER

Characterisation of the 11 Kb DNA region adjacent to the gene encodingDesulfovibrio gigas flavoredoxin

MANUELA BROCO1, ANA MARQUES1, SOLANGE OLIVEIRA1,2, &

CLAUDINA RODRIGUES-POUSADA1

1Instituto de Tecnologia Quımica e Biologica, Universidade Nova de Lisboa, Avenida Republica (EAN), Oeiras 2784-505,

Portugal, and 2Departamento de Biologia, Universidade de Evora, Apartado 94, Evora 7002-554, Portugal

(Received 3 December 2004)

AbstractFlavoredoxin is an FMN binding protein that functions as an electron carrier in the sulphate metabolism of Desulfovibrio gigas.The neighbouring DNA regions of the gene encoding flavoredoxin were sequenced and characterised. Transcript analysis ofthe flavoredoxin gene resulted in a positive band corresponding to the size of the coding region, suggesting that flavoredoxin isencoded by a monocystronic unit, as previously suggested by sequence analysis.

Analysis of the adjacent DNA regions revealed several interesting genes. The sequenced DNA regions contain nine openreading frames (ORFs) organised in two polycystronic and two monocystronic units. These genes encode proteins involved indifferent metabolic pathways, namely in DNA methylation, tRNA and rRNA modification, mRNA metabolism, cell division,CoA synthesis and lipoprotein transport across the membrane.

Keywords: Desulfovibrio gigas, flavoredoxin, monocystronic, flanking regions

Genebank accession No. AY702971

Introduction

Sulphate reducing bacteria (SRB) are anaerobicbacteria that have as common feature the ability touse sulphate as terminal electron acceptor (Postgate1984). These bacteria are widespread in terrestrialand aquatic environments, but they can also be foundin animal and human gastrointestinal tract (Barton1995). They have particular metabolic properties,which allow them to be involved in the sulphur cycle,via their ability to reduce sulphate (Postgate 1984); inthe nitrogen cycle, due to their capacity to perform thenon symbiotic fixation of nitrogen (Kent et al. 1989);and in the carbon cycle, associated with the importantrole they play in the mineralisation process of organicmatter (Peck 1984). SRB are involved in importantenvironmental processes like biocorrosion, due to the

high amounts of H2S produced during respiration.

Nevertheless, they can also be very important in

anaerobic biotransformation of environmental con-

taminants (Barton 1995), making these bacteria very

interesting ones from a biotechnological point of view.

Among the SRB, the Desulfovibrio genus is by far the

best known. Desulfovibrio has been considered a major

problem for industry and for the environment and some

of its proteins can be used for technological applications

(Barton 1995).These bacteria are metabolicallydiverse,

being able to use a wide range of electron donors and

acceptors to conserve energy. They are rich in redox-

proteins with a great variety of prosthetic groups and

many novel metal centres have been described in the last

years (Barton 1995). Several biochemical studies have

been made in order to characterise the proteins involved

ISSN 1042-5179 print/ISSN 1029-2365 online q 2005 Taylor & Francis Group Ltd

DOI: 10.1080/10425170500088296

Correspondence: C. Rodrigues-Pousada, Instituto de Tecnologia Quımica e Biologica, 2780 Oeiras, Portugal. Tel: 351 1 4469879.Fax: 351 1 4428766. E-mail: claudina@itqb.unl.pt

DNA Sequence, June 2005; 16(3): 207–216

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

in the energy conservation. However, the metabolism of

these bacteria is still poorly understood. Genomic

characterisation of these bacteria will largely contribute

to a better understanding of their complex metabolism,

namely by comparative analysis of the amino acid

sequence of redox proteins, which may allow the

identification of the prosthetic groups binding sites of

these proteins. The knowledge of the gene organisation

into operons will help to understand the biochemical

function of the proteins from the identified genes.

Several genes encoding important proteins have already

been isolated and characterised.

Flavoredoxin (flr) is a flavoprotein from the Flavin

reductase family (Agostinho et al. 2000), which was

initially proposed to be involved in the sulphite

reduction as the direct electron donor to desulfoviridin

(Chen et al. 1993). However, recent in vivo studies have

suggested that this redox protein is in fact involved in the

thiosulphate reduction (Broco et al. submitted).

The present report presents the characterisation of the

DNAregions fromtheDesulfovibriogigasgenomeadjacent

to the gene encoding flavoredoxin (flr). These DNA

fragments contain several ORFs (open reading frames)

organised in monocystronic and polycystronic units,

encoding hypothetical proteins involved in different

metabolic pathways. The flr transcript characterisation

and that of the polycystronic units are also shown.

Materials and methods

Bacterial strains and growth conditions

D. gigas (ATCC 19364) was grown anaerobically as

previously described by Gomes et al. (1997).

Escherichia coli strains P2 392 and LE 392 were used

to screen a D. gigas genomic library (constructed in the

vector l-Dash II-Stratagene, La Jolla, CA, USA) and

in the purification of the recombinant positive phage.

E. coli strain XL1-blue (Stratagene) carrying the

plasmid pZErO-1e (Invitrogen, San Diego, CA,

USA) and pZErO-1e-derived vectors was grown as

described by the manufacturer. E. coli competent cells

were prepared according to standard protocols

(Sambrook et al. 1989).

DNA preparation

Genomic D. gigas DNA was purified as previously

described by Gomes et al. (1997). Phage DNA was

isolated using the Qiagen Lambda Maxi Kit (Qiagen,

Hilden, Germany). Plasmid DNA was prepared using

the Plasmid Purification kit (Sigma-Aldrich, St Louis,

USA).

Cloning and sequence analysis

The 11,000 bp genomic DNA fragment containing

the flr gene was isolated and cloned as described in

Agostinho et al. (2000). Sequencing of these DNA

fragment in both strands was performed using the

DYEnamic ET Terminator Cycle Sequencing Kit

(Amersham Biosciences, CPR, USA). Sequencing

reactions were analysed and organised with Gene-

Skipper software. The oligonucleotides necessary to

fill the gaps on the DNA sequence were purchased

(MWG Biotech, Ebersberg, Germany). Protein

identification and amino acid sequence analysis was

performed with BLAST 2.0 (Altschul et al. 1997) and

ExPASy server analysis tools (Gasteiger et al. 2003).

Hydropathy profiles were determined using the Kyte-

Doolittle method (Kyte & Doolittle 1982) and

TMpred (Hofmann & Stoffel 1993). The presence

of signal-peptide was analysed with SignalP V1.1

(Bendtsen et al. 2004). Amino acid sequence

alignments were performed with Clustal W (Higgins

et al. 1994) and BioEdit (http://www.mbio.ncsu.edu/

BioEdit/bioedit.html). Molecular Evolution Genetics

Analysis (MEGA version 2.1) (Kumar et al. 2001) was

used to obtain molecular phylogeny using the

Neighbour-Joining method (Saitou & Nei 1987).

Neighbour genes in other genomes were found using

Search Tool for the Retrieval of Interacting Genes/

Proteins (STRING) (Snel et al. 2000, von Mering

et al. 2003).

RNA isolation, northern blot and RT-PCR analysis

Total RNA was isolated from mid-log phase D. gigas

cells grown anaerobically in lactate/sulphate medium

(Malki et al. 1997) according to Ausubel et al. (1995).

RNA was separated on a 1.2% (wt/vol) agarose gel in

1X MOPS buffer and 6% (vol/vol) formaldehyde,

using the 0.24–9.5 Kb RNA Ladder (Invitrogen) as a

size marker. Northern blotting and membrane

hybridisation with a a32P-labelled probe for D. gigas

flr gene were performed as described by Ausubel et al.

(1995).

RT-PCR was carried out with Superscript First-

Strand Synthesis System Kit (Invitrogen). A negative

control was performed in which the RNA sample

was used as a template for PCR. Four oligonucleo-

tides were designed to perform RT-PCR, FlrPEch

(50CGCCCTGCCGCCGCCAC 30)/FlrP17 (50

CGGGAAGTCGCATACACCTG 30) and FlrP20

(50 GTCCAGGATCTCCGAGGCCT)/FlrP6 (50

CTCAGTCAGGGCAAGGCGTC 30) to amplify

the regions related to ORF1/ORF2 and ORF8/ORF9,

respectively.

Results and discussion

Flavoredoxin gene and its amino acid sequence were

already analysed by Agostinho et al. (2000). This

FMN binding protein contains 194 amino acid

residues and shows homology with proteins from the

flavin reductase family (Agostinho et al. 2000)

M. Broco et al.208

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

(Table I). Interestingly, the phylogenetic analysis

(see Figure 1A) of D. gigas flavoredoxin and

homologous proteins from other proteobacteria from

the d-subdivision shows that these proteins are more

closely related to members of Archaea than to proteins

from other bacteria, suggesting that a gene transfer

might have occurred.

Northern blot analysis revealed that flr gene is

highly expressed in exponentially growing D. gigas

cells (Figure 2). The mRNA has about 670 bp,

showing that flavoredoxin is indeed encoded by a

monocystronic unit as predicted previously from the

nucleotide sequence analysis (Agostinho et al. 2000).

Sequence analysis reveals the presence of four ORFs

upstream and five ORFs downstream of flr. The first

region is organised as a polycystronic unit whereas the

second region is organised in two monocystronic and

one polycystronic units (Figure 3). ORF10 is

incomplete in the 50 region and except for ORFs 5

and 7, all ORFs are transcribed in the same direction.

ORF1–4 are organised in an operon

The predicted polypeptide encoded by ORF1 is a

35,023 Da protein with 315 amino acid residues and

revealed homologies with tRNA delta (2)-isopente-

nylpyrophosphate transferase from several prokar-

yotes (Table I). ORF1 seems to be the last of an

operon coding for ORF1–4 (see Figure 3) since a

hypothetical terminator was identified downstream of

this ORF. This terminator includes a hairpin that

probably also belongs to the terminator of the operon

encoding the membrane bound Ech [NiFe] hydro-

genase in opposite direction (Rodrigues et al. 2003).

The tRNA delta(2)-isopentenylpyrophosphate

transferase catalyses the first step in the biosynthesis

of 2-methylthio-N(6)-(delta(2)-isopentenyl)-adeno-

sine (ms2i6A), adjacent to the anticodon of tRNAs

whose codons start by uridine (Bartz et al. 1970).

Changes in the degree of tRNA modifications were

suggested to be involved in a regulatory mechanism

associated with environmental stress responses (Con-

nolly & Winkler 1989) and in the expression of

virulence genes (Gray et al. 1992, Durand et al. 1997,

Durand et al. 2000). The amino acid sequence of

ORF1 has a putative ATP binding site (VGPT-

GVGKT) in the N-terminus whose consensus

sequence is [AG]-x(4)-G-K-[ST]. Since this protein

is involved in the modification of an adenine residue

from a tRNA molecule, probably this motif is the

substrate recognition sequence.

The polypeptide chain of 19,950 Da encoded by

ORF2 shows high homologies with prokaryotic proteins

involved in the coenzyme-A metabolism, the phospho-

pantetheine adenylyltransferase (Table I). In bacteria,

phosphopantetheine adenylyltransferase was described

as a homohexamer (Geerlof et al. 1999) that catalyses

the penultimate step in coenzyme A (CoA) biosynthesis,

the reversible adenylation of 40phosphopantetheine

yielding 30dephospho-Coa (dPCoA) and pyropho-

sphate. In the amino acid sequence of ORF2, we could

identify the motif TXGH, proposed to make contact

with the adenylate group of dephospho-CoA and the

conserved amino acid residues, which create a positive

region proposed to bind b-phosphate (K51 and K142)

and g-phosphate (S137 and S138) of ATP (Izard &

Geerlof 1999).

The predicted 209 amino acid sequence encoded by

ORF3 revealed homologies with N6-adenine-specific

methylase from several prokaryotes (Table I). This

enzyme catalyses specifically the methylation of the

amino group of the C-6 position of adenines in DNA and

is usually associated with restriction-modification sys-

temsandDNAmismatch repair (Bickle&Kruger1993).

In the amino acid sequence predicted from ORF3,

eight from the nine motifs previously described in

DNA methylases (Malone et al. 1995) were identified

(see Figure 4). Motif VII was not found, but this

region was described as a low conserved motif

(Malone et al. 1995). Motifs I–III and X are

responsible for the binding of the methyl donor S-

adenosyl-L-methionine. Motifs IV–VIII form the

catalytic region of the protein (Malone et al. 1995).

Recent site-directed mutagenesis studies indicated

that the conserved aspartate residue from the DPPY

motif is involved in DNA binding (Szegedi &

Gumport 2000). According to the classification

suggested by Malone et al. (1995), D. gigas ORF3

seems to encode an N6-adenine-specific methylase

from class a.

The deduced polypeptide of 546 amino acid

residues encoded by ORF4 shows homologies with

proteins with the b-lactamase fold involved in the

mRNA metabolism (Table I). A separate family of

enzymes with the metallo-b-lactamase fold, named

the b-CASP family, includes proteins acting on

nucleic acids, mainly involved in DNA repair and

RNA processing. These proteins can be found in the

three primary kingdoms (Eukarya, Bacteria and

Archaea), but the involvement of the bacterial proteins

in mRNA processing remains to be investigated

(Callebaut et al. 2002). Motifs I–III and V (Aravind

1999) belonging to the proteins with the b-lactamase

fold were identified (see Figure 5) using the

comparison of ORF4 predicted amino acid sequence

with its orthologues. This investigator has described

by in silico analysis that in the b-lactamase fold, the

Zn2þ ion is held in the active site coordinated by the

first two histidines from Motif II, the histidine from

Motif III and the negatively charged substrate, which

is stabilised by the histidine residue from Motif

V. Motif IV (f-f-f-D/E-T/S-T) (f is a hydrophobic

residue) and VI (a histidine residue between a

b-strand and an a-helix) are present only in proteins

that have nucleic acids as substrates. From the analysis

of Motif VI, it was possible to deduce that the ORF4 is

Characterisation of the flr flanking regions 209

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

Table I. Predicted polypeptides encoded by the ORFs present in an 11,000 bp DNA fragment from D. gigas and homologous proteins.

ORFs

Polypeptide molecular mass

(Da) Orthologous proteins Source Function

Similarity/Identity

(%)

ORF1 35,023 IPP transferase D. desulfuricans G20 tRNA modification 58.7/50.2

IPP transferase G. sulfurreducens 47.2/34.4

IPP transferase B. halodurans 44.3/30.5

IPP transferase C. hutchinsonii 47.6/28.6

ORF2 19,950 Phophopantetheine adenylyltransferase D. desulfuricans G20 Catalyses the rate limiting step in CoA biosynthesis 67.8/54.2

Phophopantetheine adenylyltransferase E. coli 55.7/43.2

Phophopantetheine adenylyltransferase T. tengcongensis 64.2/43.8

Phophopantetheine adenylyltransferase L. interrogans 61.4/40.3

ORF3 22,504 N6-adenine-specific methylase D. desulfuricans G20 DNA replication, recombination and repair 55/45

Putative methylase C. tepidum TLS 48.3/34.4

Conserved hypothetical protein S. pneumoniae R6 49.3/30.1

Putative methylase yhhF E. coli 42.7/28.6

ORF4 61,097 Predicted exonuclease of the b-lactamase fold D. desulfuricans Involved in RNA processing 73.8/61.2

Predicted exonuclease of the b-lactamase fold G. metallireducens 39.2/24.8

Putative mRNA 30-end processing factor A. fulgidus 26.5/18.2

Cleavage and polyadenylation specificity factor M. acetivorans 25/16.9

Cleavage and polyadenylation specificity factor 3 M. musculus 26.1/15.3

ORF5 21,053 Flavoredoxin homolog D. desulfuricans Flavoproteins involved in several biological processes 61.3/46.4

Flavoredoxin homolog M. barkeri 67.5/55.2

Actinorhodin polyketide dimerase ACTVB homologue S. roseofulvus 53.0/26.5

NADH-dependent FMN oxidoreductase R. erythropolis 44.2/19.0

Nitrilotriacetate monooxygenase component B C. heintzii 52.5/24.6

ORF6 22,142 MJ0455 M. jannaschii – 64.5/49.2

Uncharacterized metal-binding protein C. thermocellum 51.4/38.2

Uncharacterized metal-binding protein G. metallireducens 46.9/35

ORF7 27,765 16S rRNA uridine-516 pseudouridylate synthase D. desulfuricans rRNA uridine isomeration 57.1/44.9

16S rRNA uridine-516 pseudouridylate synthase T. tengcongensis 45.1/34

Ribosomal large subunit pseudouridine synthase B B. cererus 44.9/32.3

Ribosomal large subunit pseudouridine synthase B F. nucleatum 40.3/27.9

ORF8 24,929 Outer membrane lipoprotein-sorting protein D. desulfuricans Periplasmic lipoprotein carrier 48.1/34.3

Periplasmic chaperone LolA P. aeruginosa 37.1/21

Outer-membrane lipoproteins carrier protein LolA X. campestris 33/18.8

E. coli 29/16.1

ORF9 106,479 DNA segregation ATPase FtsK/SpoIIIE D. desulfuricans Cell division 43.5/35.1

DNA segregation ATPase FtsK/SpoIIIE G. metallireducens 34.2/26.1

DNA translocase ftsK C. perfringens 33.6/24.4

Cell division protein E. coli 31.9/23.5

ORF10 – – – – –

M.

Broco

etal.

210

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

Figure 1. Phylogenetic analysis. (A) D. gigas flavoredoxin was compared with homologue proteins from the Archae M. acetivorans, M. barkeri str. fusaro C2A and M. mazei str. Goe1 and from the bacteria

G. metallireducens str. GS-15, T. denticola str. ATCC 35405, C. thermocellum ATCC 27405, B. thetaiotaomicron str. VPI-5482, D. vulgaris subsp. vulgaris str. Hildenborough and D. desulfuricans G20. (B) D.

gigas putative lipoprotein carrier lolA was compared with homologue proteins from the Archae M. mazei str. Goe1 and from the Bacteria X. fastidiosa Ann-1, X. campestris pv. campestris str. ATCC 33913,

N. europaea ATCC 19718, P. aeruginosa PA01, E. coli K12, D. vulgaris subsp. vulgaris str. Hildenborough and D. desulfuricans G20. Members of Archaea are black boxed. The trees were obtained with

molecular evolutionary genetic analysis (MEGA) software (v. 2.1), using the Neighbour-Joining method with bootstrap support.

Characterisation

ofth

efl

rfl

ankin

gregion

s211

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

specific to RNA molecules rather than to DNA, since

it contains a histidine residue and not a hydrophobic

residue (Callebaut et al. 2002).

RT-PCR was performed in order to amplify a region

between ORF1 and 2. A product with the expected

length was obtained (Figure 2B), indicating that these

two coding regions are co-transcribed.

A putative promoter region, 210 and 235

consensus sequence AATGAT and TGGAGA,

respectively was identified upstream of ORF4. The

presence of a putative promoter upstream ORF1 and a

terminator downstream ORF4, respectively, together

with the results obtained by RT_PCR (see Figure 2)

and the short distance between ORFs (,6 bp),

suggest that ORF1–4 are organised in a polycystronic

unit. The open reading frames coding for hypothe-

ticals N6-adenine specific methylase (ORF3) and

phosphopantetheine adenylyltransferase (ORF2) are

frequently found in neighbouring regions in other

bacterial genomes (Snel et al. 2000, von Mering et al.

2003). Similarly, the gene coding for tRNA delta(2)-

isopentenylpyrophosphate (ORF1) is frequently

found near genes encoding DNA mismatch repair

proteins, which are usually from the b-lactamase fold

family as the predicted exonuclease encoded by ORF4

(Snel et al. 2000, von Mering et al. 2003). Despite the

proximity of these open reading frames in several

bacterial genomes, no functional relationship was

found between the proteins encoded by ORF1 and 4.

Other studies have described the presence of the gene

coding for tRNA delta (2)-isopentenylpyrophosphate

transferase in large operons encoding proteins that

seem to be functionally unrelated (Connolly &

Winkler 1989). The organisation of these genes in

complex operons was suggested to be related with

coregulation, ensuring coordination of cellular meta-

bolism (Bjork 1985).

ORF6 encoded polypeptide

A probable open reading frame designated ORF6 was

identified. It codes for 196 amino acid residues protein

with homologies around 50% of identity and 60% of

similarity (Table I) with uncharacterised metal-binding

proteins with unknown function. Interestingly, in the

sequenced genomes of D. desulfuricans and D. vulgaris

Figure 3. Genomic organisation of an 11 Kb DNA fragment from the D. gigas genome. Horizontal arrows represent the open reading frames

direction and relative size. Bent and vertical arrows indicate putative promoters and terminators, respectively. Eco R I restriction sites are

indicated. ORFs 1–4, operon coding for tRNA delta(2)-isopentenylpyrophosphate transferase, Phosphopantetheine adenylyltransferase, N6-

adenine-specific methylase and exonuclease/cleavage and polyadenylation factor, respectively. ORF5 encodes flavoredoxin. ORF6 encodes a

hypothetical protein. ORF7 codes for an rRNA pseudouridine synthase B. ORFs 8–10 are organised as a polycystronic unit coding for

lipoprotein carrier (lolA), a cell division protein (ftsK) and translation elongation factor P (EF-P), respectively. ORF10, a putative translation

elongation factor P, is incomplete.

Figure 2. Transcription analysis. (A) Transcriptional analysis of the flr gene. Northern blot analysis of total RNA from D. gigas grown

anaerobically, hybridised with flr probe. The arrow indicate the determined size of the flr mRNA. M, molecular mass standards. (B) RT-PCR

of total RNAs with internal primers amplifying a region ranging ORF1–2 (lane 1–548 bp) and ORF8–9 (lane 3–579 bp). Lane 2 and 4

correspond to the negative controls of ORF1–2 and ORF8–9, respectively. M, molecular weigh marker 1 Kp plus DNA laddere (Invitrogen).

M. Broco et al.212

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

the gene encoding this metal binding protein was not

found, suggesting diversity among the Desulfovibrio

genus.

ORF7 encodes a putative rRNA pseudouridine synthase B

The predicted 253 amino acid sequence codified by

ORF7 shows homologies with the rRNA pseudo-

uridine synthase B from several prokaryotes (Table I).

The amino acid predicted sequence presents two

domains, Rsu (14 residues) and S4 (59 residues). The

Rsu domain is very conserved, and its presence in

D. gigas suggests that this protein is involved in rRNA

small subunit isomeration like the Rsu protein in E. coli

(Conrad et al. 1999). In the Rsu domain there is a

conserved motif, GRLD, whose aspartate residue is

essential for the catalytic activity of the protein. The

S4 domain is not as conserved as the Rsu domain and

is involved in the RNA binding (Aravind & Koonin

1999). A hypothetical promoter and terminator were

found upstream and downstream ORF7, respectively,

suggesting that a monocystronic unit encodes this

protein in D. gigas. Pseudouridine synthases are a

family of enzymes that catalyse the synthesis of

pseudouridine, the C5-C10 isomer of uridine, in a

variety of RNAs.

ORF8–10 are organised as a polycystronic unit

ORF8 encodes a predicted 224 amino acid residues

sequence with homologies with the outer membrane

lipoprotein carrier lolA from several gram-negative

bacteria (Table I). LolA is involved in a mechanism

responsible for the sorting and localization of mature

lipoproteins in either the inner or in outer-membrane.

In fact, a 27 amino acid residues signal peptide was

found in the N-terminus of the predicted polypeptide

chain. The presence of a signal peptide suggests that

Figure 4. Amino acid sequences alignment containing part of D. gigas ORF3 and its homologous proteins from several prokaryotes, namely

D. desulfuricans G20, C. tepidum TLS, A. gambiae str. PEST, E. coli K12, G. sulfurreducens str. PCA. Motifs I–III and X are involved in the

binding of S-adenosyl-L-methionine molecule. Motifs IV–VIII constitute the catalytic region (Malone et al. 1995).

Figure 5. Amino acid sequences alignment of D. gigas ORF4 and homologous proteins from several bacteria, namely D. desulfuricans G20,

T. tengcongensis str. MB4, D. radiodurans str., C. hutchinsonii str. ATCC 33406 and G. metallireducens G5-15; from the Archae A. fulgidus str.

DSM 4304 and M. acetivorans C2A; and from the Eukarya D. melanogaster and M. musculus. Sequence comparison of Motifs I–VI of the

ORF4 encoded polypeptide with homologous proteins. E and H represent b-strand and a-helix, respectively. Consensus sequences of

the motifs are indicated above the motif line.

Characterisation of the flr flanking regions 213

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

this protein, after being synthesized is exported to the

periplasmic space. No conserved domains were

identified in this protein. From the phylogenetic

analysis (Figure 1B) we can see that the proteins from

D. gigas and D. desulfuricans are more closely related to

protein from the Archaea Methanosarcina than to the

proteins from their bacteria group. This suggests the

occurrence of gene transfer, such as it might have

happened for flavoredoxin and for the D. gigas Ech

operon (Rodrigues et al. 2003).

Upstream ORF8 is ORF9, which encodes a large

protein with 991 amino acid residues with homologies

with the membrane protein involved in the cell

division, ftsK. Similarly to what was already described

for E. coli ftsK (Begg et al. 1995), the deduced amino

acid sequence of putative ORF9 revealed a high

conserved C-terminus, a less conserved N-terminus

and a domain with repeats between these two regions.

The N-terminus is highly hydrophobic and contains

five membrane-spanning a-helices, indicating that as

in E. coli ftsK, the N-terminus of the predicted

polypeptide is integrated in the membrane. In the N-

terminus of E. coli ftsK it was described the presence

of the conserved motif HEXXH, characteristic of zinc

metalloproteases, important for the enzyme activity in

cell division (Dorazi & Dewar 2000). In D. gigas and

D. desulfuricans this motif is not complete, since the

second histidine residue is missing. The C-terminus of

the predicted amino acid sequence is hydrophilic

similarly to E. coli ftsK and contains the ATPases

Associated several cellular Activities (AAA) domain

with a conserved ATP/GTP binding site (GAT-

GAGKS). The domain between the N- and C-

terminal region has different characteristics among the

proteins homologous to ORF9. In E. coli, it is well

described the presence of the PQ rich region (Begg

et al. 1995), proposed to be responsible for the dif

recombination activity of the enzyme (Boyle et al.

2000). However, this repeated region is not conserved

among ftsK proteins and it has been suggested that

this region might have some specific and additional

function (Boyle et al. 2000). In D. gigas amino acid

sequence, the PQ rich region is not present as

described in E. coli but there are a proline and

proline/valine/alanine rich regions, containing seven

PVA repeats. Interestingly, a similar amino acid repeat

region is not observed in D. desulfuricans.

The predicted 34 amino acid sequence encoded by

the incomplete ORF10 shows homologies with the

C-terminus of the translation elongation factor P

(EF-P). According to the alignment with its ortho-

logues, the predicted amino acid sequence represents

about 19% of the complete sequence, but it contains

the EF-P elongation factor P signature (KPATLET-

GLQVQVPLFVNLG). The EF-P is a prokaryotic

protein required for efficient peptide bond biosyn-

thesis on 70S ribosomes from fMet-tRNAfMet (Aoki

et al. 1997). EF-P reveals homologies with eIF5A

from Archaea/Eukarya, indicating that the machinery

of translation initiation would be present in the

universal ancestor (Kent et al. 1989).

Despite the apparently non-related functions of the

predicted proteins, some features suggest that these

ORFsareorganised asa polycystronicunit. Firstly, these

ORFs are separated by only few nucleotides. Secondly,

the analysis of genomes from other bacteria show that

the genes coding for putative lolA and ftsK are

frequently found in adjacent positions (Snel et al.

2000, von Mering et al. 2003), which suggests that these

proteins could be functionally related. Thirdly, RT-PCR

using oligonucleotides to amplify a region containing

parts of both ORF8 and 9 (Figure 2), resulted in a

product with the expected length, indicating that these

genes are co-transcribed in D. gigas.

It was found in the ORF9 (ftsK) N-terminus a lipid-

binding domain (MLGLGCLLLAC) usually present

in lipoproteins, not typical of ftsK. The presence of

this domain could suggest that the predicted ftsK

might have a different function in D. gigas somehow

related with the predicted lolA. However, the

D. desulfuricans homologous protein coding region

also seems to be co-transcribed with the lolA gene,

although the amino acid sequence does not contain

this lipoprotein lipid attachment site.

Conclusions

In the present report, it is shown that flavoredoxin is

transcribed by a monocystronic unit as previously

predicted from the DNA sequence analysis (Agostinho

et al. 2000). Additionally, it was also shown that the

genes identified in the adjacent regions of flr, encode

several hypothetical proteins whose function are not

related with the metabolic pathway in which flavo-

redoxin was recently proposed to be involved (Broco

et al. submitted). Concerning the recently published

D. vulgaris genome (Heidelberg et al. 2004) and the

sequenced DNA regions of the D. desulfuricans genome,

flr seems to be encoded also by a monocystronic unit in

these Desulfovibrio species. Comparing the genes present

in the DNA regions around flr in these species of

Desulfovibrio with the D. gigas genomic organisation

described in the present paper, apart from an ABC

transporter operon present only in D. vulgaris and

D. desulfuricans, there is no common genes around flr

among these species. This suggests that the genetic

organisation around flr does not give any additional

information on the metabolic pathway on which

flavoredoxin might be involved. Interestingly, six from

the nine ORFs present in these regions encode

hypothetical proteins involved in the nucleic acids

metabolism, mainly in pathways involving RNA

molecules. It would be interesting to complete the

sequence of the operon containing ORF8–10. This

operon can contain additional genes frequently found

adjacent to lolA and fts K genes, such as the gene

M. Broco et al.214

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

encoding an ATPase from the AAA family, related to the

helicase subunit of the Holliday junction resolvase.

Additionally, it would be also interesting to investigate if

the N-terminus lipid-binding domain found in the

amino acid sequence of D. gigas ftsK is recognized by the

lipoprotein carrier lolA.

Acknowledgements

We are gratefull to STAB-Vida for having determined

the nucleotide sequence fluorograms. We thank

Fundacao para a Ciencia e a Tecnologia (FCT) for

the fellowship PRAXIS XXI/BD/21527/99 to

Manuela Broco, for the financial support POC-

TI/BME/37480/2001 to Claudina Rodrigues-Pousada.

References

Agostinho M, Oliveira S, Broco M, Liu MY, LeGall J, Rodrigues-

Pousada C. 2000. Molecular cloning of the gene encoding

flavoredoxin, a flavoprotein from Desulfovibrio gigas. Biochem

Biophys Res Commun 272:653–656.

Altschul F, Stephen TL, Madden AA, Schaffer J, Zhang Z, Zhang W,

Miller DJ, Lipman. 1997. Gapped BLAST and PSI-BLAST:

A new generation of protein database search programs. Nucleic

Acids Res 25:3389–3402.

Aoki H, Adams SL, Turner MA, Ganoza MC. 1997. Molecular

characterization of the prokaryotic efp gene product involved in a

peptidyltransferase reaction. Biochimie 79:7–11.

Aravind L. 1999. An evolutionary classification of the metallo-beta-

lactamase fold proteins. In Silico Biol 1:69–91.

Aravind L, Koonin EV. 1999. Novel predicted RNA-binding

domains associated with the translation machinery. J Mol Evol

48:291–302.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith

JA, Struhl K. 1995. Current protocols in molecular biology.

New York: Greene Publishing Associates and Wiley-Interscience.

Barton LL. 1995. Sulfate-reducing bacteria. Vol. 8. New York

London: Plenum Press.

Bartz JK, Kline LK, Soll D. 1970. N6-(Delta 2-isopentenyl)adeno-

sine: Biosynthesis in vitro in transfer RNA by an enzyme purified

from Escherichia coli. Biochem Biophys Res Commun

40:1481–1487.

Begg KJ, Dewar SJ, Donachie WD. 1995. A new Escherichia coli cell

division gene, fts K. J Bacteriol 177:6211–6222.

Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improved

prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795.

Bickle TA, Kruger DH. 1993. Biology of DNA restriction.

Microbiol Rev 57:434–450.

Bjork GR. 1985. E. coli ribosomal protein operons: The case of the

misplaced genes. Cell 42:7–8.

Boyle DS, Grant D, Draper GC, Donachie WD. 2000. All major

regions of FtsK are required for resolution of chromosome

dimers. J Bacteriol 182:4124–4127.

Callebaut I, Moshous D, Mornon JP, de Villartay JP. 2002.

Metallo-beta-lactamase fold within nucleic acids processing

enzymes: The beta-CASP family. Nucleic Acids Res 30:

3592–3601.

Chen L, Liu MY, LeGall J. 1993. Isolation and characterization of

flavoredoxin, a new flavoprotein that permits in vitro reconstitu-

tion of an electron transfer chain from molecular hydrogen to

sulfite reduction in the bacterium Desulfovibrio gigas. Arch

Biochem Biophys 303:44–50.

Connolly DM, Winkler ME. 1989. Genetic and physiological

relationships among the miaA gene, 2-methylthio-N6-(delta 2-

isopentenyl)-adenosine tRNA modification, and spontaneous

mutagenesis in Escherichia coli K-12. J Bacteriol 171:3233–3246.

Conrad J, Niu L, Rudd K, Lane BG, Ofengand J. 1999. 16S

ribosomal RNA pseudouridine synthase RsuA of Escherichia coli:

Deletion, mutation of the conserved Asp102 residue, and

sequence comparison among all other pseudouridine synthases.

RNA 5:751–763.

Dorazi R, Dewar SJ. 2000. Membrane topology of the N-terminus

of the Escherichia coli FtsK division protein. FEBS Lett 478:

13–18.

Durand JM, Bjork GR, Kuwae A, Yoshikawa M, Sasakawa C. 1997.

The modified nucleoside 2-methylthio-N6-isopentenyladeno-

sine in tRNA of Shigella flexneri is required for expression of

virulence genes. J Bacteriol 179:5777–5782.

Durand JM, Dagberg B, Uhlin BE, Bjork GR. 2000. Transfer RNA

modification, temperature and DNA superhelicity have a

common target in the regulatory network of the virulence of

Shigella flexneri: The expression of the vir F gene. Mol Microbiol

35:924–935.

Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch

A. 2003. ExPASy: The proteomics server for in-depth protein

knowledge and analysis. Nucleic Acids Res 31:3784–3788.

Geerlof A, Lewendon A, Shaw WV. 1999. Purification and

characterization of phosphopantetheine adenylyltransferase

from Escherichia coli. J Biol Chem 274:27105–27111.

Gomes CM, Silva G, Oliveira S, LeGall J, Liu MY, Xavier AV,

Rodrigues-Pousada C, Teixeira M. 1997. Studies on the redox

centers of the terminal oxidase from Desulfovibrio gigas and

evidence for its interaction with rubredoxin. J Biol Chem

272:22502–22508.

Gray J, Wang J, Gelvin SB. 1992. Mutation of the miaA gene of

Agrobacterium tumefaciens results in reduced vir gene expression.

J Bacteriol 174:1086–1098.

Heidelberg JF, Seshadri R, Haveman SA, Hemme CL, Paulsen IT,

Kolonay JF, Eisen JA, Ward N, Methe B, Brinkac LM, et al.

2004. The genome sequence of the anaerobic, sulfate-reducing

bacterium Desulfovibrio vulgaris Hildenborough. Nat Biotechnol

22:554–559.

Hofmann K, Stoffel W. 1993. TMbase—A database of membrane

spanning proteins segments. Biol Chem Hoppe-Seyler 374:166.

Izard T, Geerlof A. 1999. The crystal structure of a novel bacterial

adenylyltransferase reveals half of sites reactivity. EMBO J

18:2021–2030.

Kent HM, Buck M, Evans DJ. 1989. Cloning and sequencing of the

nifH gene of Desulfovibrio gigas. FEMS Microbiol Lett 61:73–78.

Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2:

Molecular evolutionary genetics analysis software. Bioinfor-

matics 17:1244–1245.

Kyte J, Doolittle RF. 1982. A simple method for displaying the

hydropathic character of a protein. J Mol Biol 157:105–132.

Malki S, De Luca G, Fardeau ML, Rousset M, Belaich JP,

Dermoun Z. 1997. Physiological characteristics and growth

behavior of single and double hydrogenase mutants of

Desulfovibrio fructosovorans. Arch Microbiol 167:38–45.

Malone T, Blumenthal RM, Cheng X. 1995. Structure-guided

analysis reveals nine sequence motifs conserved among DNA

amino-methyltransferases, and suggests a catalytic mechanism

for these enzymes. J Mol Biol 253:618–632.

von Mering C, Huynen M, Jaeggi D, Schmidt S, Bork P, Snel B.

2003. STRING: A database of predicted functional associations

between proteins. Nucleic Acids Res 31:258–261.

Peck HD. 1984. Physiological diversity of sulfate-reducing bacteria.

In: Tuovinen EOH, editor. Microbial chemoautothrophy.

Colombus: Ohio State University Press. p 309–335.

Postgate JR. 1984. The sulphate-reducing bacteria. 2nd ed.

Cambridge, England: Cambridge University Press.

Rodrigues R, Valente FM, Pereira IA, Oliveira S, Rodrigues-

Pousada C. 2003. A novel membrane-bound Ech [NiFe]

Characterisation of the flr flanking regions 215

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008

hydrogenase in Desulfovibrio gigas. Biochem Biophys Res

Commun 306:366–375.

Saitou M, Nei M. 1987. The neighbor-joining methods:A new method

for constructing phylogenetic trees. Mol Biol Evol 4:406–425.

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning,

a laboratory manual. New York: Cold Spring Harbor.

Snel B, Lehmann G, Bork P, Huynen MA. 2000. STRING: A

web-server to retrieve and display the repeatedly occurring

neighbourhood of a gene. Nucleic Acids Res 28:3442–3444.

Szegedi SS, Gumport RI. 2000. DNA binding properties in vivo

and target recognition domain sequence alignment analyses of

wild-type and mutant Rsr I [N6-adenine] DNA methyltransfer-

ases. Nucleic Acids Res 28:3972–3981.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W:

Improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res

22:4673–4680.

M. Broco et al.216

Downloaded By: [B-on Consortium - 2007] At: 19:14 20 October 2008