Acc

epte

d A

rtic

le

1

Original Research Article Autophagy is Modulated in Human Neuroblastoma Cells Through Direct Exposition to Low Frequency Electromagnetic Fields† NICOLETTA MARCHESI,1 CECILIA OSERA,1 LORENZO FASSINA,2,3 MARIALAURA AMADIO, 1 FRANCESCA ANGELETTI,4 MARTINA MORINI, 4 GIOVANNI MAGENES,2,3 LETIZIA VENTURINI, 5 MARCO BIGGIOGERA,4 GIOVANNI RICEVUTI,5 STEFANO GOVONI,1 SALVATORE CAORSI,2,6 ALESSIA PASCALE,1 AND SERGIO COMINCINI4 1Department of Drug Sciences, Section of Pharmacology, University of Pavia, 27100 Pavia, Italy 2Department of Industrial and Information Engineering, University of Pavia, 27100 Pavia, Italy 3Centre for Tissue Engineering (C.I.T.), University of Pavia, 27100 Pavia, Italy 4Department of Biology and Biotechnology, University of Pavia, 27100 Pavia, Italy 5IDR “Santa Margherita”, Department of Internal Medicine and Therapeutics, Section of Geriatrics and Gerontology, University of Pavia, 27100 Pavia, Italy 6Research Unit ICEMB, University of Pavia, 27100 Pavia, Italy

Summary

In neurogenerative diseases, comprising Alzheimer’s (AD), functional alteration in autophagy is considered

one of the pathological hallmarks and a promising therapeutic target. Epidemiological investigations on the

possible causes undergoing these diseases have suggested that electromagnetic fields (EMF) exposition can

contribute to their etiology. On the other hand, EMF have therapeutic implications in reactivating neuronal

functionality. To partly clarify this dualism, the effect of low-frequency EMF (LF-EMF) on the modulation

of autophagy was investigated in human neuroblastoma SH-SY5Y cells, which were also subsequently

exposed to Aβ peptides, key players in AD. The results primarily point that LF-EMF induce a significant

reduction of microRNA 30a (miR-30a) expression with a concomitant increase of Beclin1 transcript

(BECN1) and its corresponding protein. Furthermore, LF-EMF counteract the induced miR-30a up-

regulation in the same cells transfected with miR-30a mimic precursor molecules and, on the other side,

rescue Beclin1 expression after BECN1 siRNA treatment. The expression of autophagy-related markers

(ATG7 and LC3B-II) as well as the dynamics of autophagosome formation were also visualized after LF-

EMF exposition. Finally, different protocols of repeated LF-EMF treatments were assayed to contrast the

effects of Aβ peptides in vitro administration.

Overall, this research demonstrates, for the first time, that specific LF-EMF treatments can modulate in vitro

the expression of a microRNA sequence, which in turn affects autophagy via Beclin1 expression. Taking

† This article has been accepted for publication and undergone full peer review but has not been through the

copyediting, typesetting, pagination and proofreading process, which may lead to differences between this

version and the Version of Record. Please cite this article as doi: [10.1002/jcp.24631]

Additional Supporting Information may be found in the online version of this article.

Received 03 March 2014; Revised 13 March 2014; Accepted 24 March 2014

Journal of Cellular Physiology

© 2014 Wiley Periodicals, Inc.

DOI: 10.1002/jcp.24631

Acc

epte

d A

rtic

le

2

into account the pivotal role of autophagy in the clearance of protein aggregates within the cells, our results

indicate a potential cytoprotective effect exerted by LF-EMF in neurodegenerative diseases such as AD.

Keywords: microRNA, Alzheimer’s Disease, Beclin1

Running title: Autophagy modulation by electromagnetic fields

Introduction

The scientific progress led to undoubted advantages in life style but, on the other hand, supported the

increasing exposure to chemical and physical pollutants. The massive presence of environmental risk factors

such as the electromagnetic fields (EMF), and among them especially the low frequency-type (LF-EMF), can

have consequences on human health that are not entirely clear. LF-EMF, ranging from 1 to 300 Hz,

characteristic of electric power, subways, common appliances such as washing machines and personal

computers are therefore globally widespread (Kheifets et al., 2010). Epidemiological and occupational

studies have shown a correlation between LF-EMF exposure and an increased risk to develop several

diseases, including tumors and neurodegenerative disorders (Davanipour et al., 2007). However, EMF can

also elicit positive effects on biological systems; certain types of EMF are indeed currently employed in

clinical practice to treat different dysfunctions. For instance, a pioneering field of research in Alzheimer’s

Disease (AD) is the deep brain stimulation via EMF, which seems to produce clinical benefits in AD patients

(Laxton et al., 2010). Increasing evidence report that EMF can induce epigenetic modifications; within this

context, microRNAs (miRNAs) are emerging as key epigenetic factors able to affect post-transcriptionally

gene expression, finally modulating multiple biological functions. miRNAs are endogenous 22-24

nucleotide-long noncoding RNA molecules, firstly described in C.elegans (Ambros et al., 2003), which

impair stability and translation of specific mRNAs, finally affecting protein synthesis. The mechanism of

action is double: miRNAs can bind to mRNA targets with exact complementarity and induce the RNAi

pathway, or they can bind to targets with imperfect complementarity and block translation (Vella et al.,

2004).

Of note, miRNAs are involved in the modulation of a wide range of biological processes including

programed cell death (apoptosis and autophagy) (Xu et al., 2012). Distinct from apoptosis, autophagy, from

the Greek “auto” (self) and “phagy” (to eat), refers to an evolutionarily conserved, multi-step lysosomal

degradation process able to maintain cellular homeostasis through the digestion of long-lived proteins and

damaged organelles (Dalby et al., 2010). The process of autophagy involves the formation of double

membrane vesicles (autophagosomes) that engulf organelles and cytoplasm, and finally fuse with the

lysosome to form the autolysosomes, where the contents are degraded and recycled for new proteins and

ATP synthesis. The autophagosome formation is mediated by different autophagy-promoting genes (ATGs)

that function at various stages of autophagy (Levine and Klionsky, 2004). Recently, miRNAs have been well

characterized to modulate some ATGs and their regulators at different autophagic stages such as induction,

Acc

epte

d A

rtic

le

3

vesicle nucleation, vesicle elongation and completion (Fu et al., 2010; Comincini et al., 2013).

In the present work, we focused on a particular miRNA sequence (miR-30a) involved in the

regulation of Beclin1, the mammalian homologue of the yeast Atg6, a key autophagy-promoting gene that

plays a critical role in the regulation of death and survival of various cell types (Kang et al., 2011). At

molecular level, it was reported that miR-30a can inhibit Beclin1 expression, thereby blocking vesicle

nucleation and resulting in an overall reduced autophagy activity (Zhu et al., 2009).

Recent studies have observed that the expression of Beclin1 is altered in some diseases including cancers and

neurodegenerative disorders such as AD (Jaeger et al., 2010). In particular, in AD brains Beclin1 has been

found to be reduced at both mRNA and protein levels (for a review, see Jaeger and Wyss-Coray, 2010).

Notably, proteins degradation, and in particular autophagy, are strongly impaired in AD, thus contributing to

determine the typical AD hallmarks represented by extracellular amyloid deposits and intracellular

neurofibrillary tangles (Son et al., 2012). To this regard, it was found that Beclin1–deficient transgenic mice

expressing human amyloid precursor protein (hAPP, a protein whose cleavage metabolites are the main

constituents of AD plaques) exhibited disturbances in their autophagosomal-lysosomal degradation system

and showed increased amyloid plaques load. Moreover, inhibition of autophagy in hAPP-expressing cells

leads to an accumulation of APP and its metabolites, while autophagy activation reduced the levels of APP

and its associated products (Pickford et al., 2008). In addition, APP over-expression, both in vitro and in

mouse models, does not affect Beclin1 expression, suggesting that the impairment of autophagy could be an

early event that proceeds APP-processing dysfunction in AD pathogenesis (Jaeger et al., 2010).

Overall these studies support the concept that autophagy stimulation might represent a potential therapeutic

approach to counteract the accumulation of misfolded proteins. In this context, we studied the effect of a

pulsed LF-EMF (75 Hz, 2 mT, 1.3 ms) exposure scheme on miR-30a expression and, downstream, on

Beclin1 mRNA and protein levels, to evaluate whether this specific LF-EMF treatment may have a

favourable effect on the activation of the autophagy process in human neuroblastoma cells.

Materials and Methods

Electromagnetic bioreactor

The pulse generator used was provided by Igea (Carpi, Italy) and powered the electromagnetic bioreactor

previously described (Fassina et al., 2006-2008-2009-2010; Osera et al., 2011). Briefly, the pulsed

electromagnetic field applied to the cells generated a LF-EMF with the following parameters: intensity of the

magnetic field (2±0.2 mT), amplitude of the induced electric tension (5±1 mV), signal frequency (75±2 Hz),

and pulse duration (1.3 ms). The electromagnetic bioreactor was placed into the cell culture incubator 2

hours before the beginning of experiments and the cells were exposed for 1, 3, 6, 12 or 24 hours. Most of the

experiments were performed with 1 hour LF-EMF duration and different recovery post-treatment (p.t.) times

were investigated, as described in the Results. Control cultures were placed into an identical incubator in the

absence of LF-EMF stimulation.

Acc

epte

d A

rtic

le

4

Cell cultures and chemicals

Human neuroblastoma SH-SY5Y, SK-N-SH and glioblastoma-derived cell lines U87-MG and T98G

(provided by ATCC, Teddington, UK) were grown in Eagle’s minimum essential medium supplemented

with 10% fetal calf serum, 1% penicillin-streptomycin, L-glutamine (2 mM), nonessential amino acids (1

mM), and sodium pyruvate (1 mM) at 37°C in an atmosphere of 5% CO2 and 95% humidity. The cultured

cells were subjected to LF-EMF by placing the appropriate multiwell plates or petri dishes within the

electromagnetic bioreactor and exposing the cells to the above described stimulus. For autophagy evaluations

in living cells, SH-SY5Y cells were incubated with Rapamycin (Sigma-Aldrich, St.Louis, MI) at 1 and 10

µM concentration, 12 hours before LF-EMF expositions: then, they were visualized by fluorescent inverted

microscope at 4 and 24 hours post exposition. Chloroquine diphosphate (Invitrogen, Life Technologies,

Grand Island, NY) was added at 10 µM concentration, 2 hours before the end of the 24 and 48 hours

scheduled treatments. Rapamycin and Chloroquine diphosphate were dissolved in dimethyl sulfoxide

(DMSO) and diluted in culture medium to the appropriate concentration.

To evaluate LF-EMF effects in counteracting Aβ1-40 and Aβ1-42 -mediated toxicity in short-term viability

(MTT assays), the peptides (Aβ1-40, 1 µM; Aβ1-42, 2 µM; Aβ1-40 + Aβ1-42, 1 µM each), provided by Sigma-

Aldrich, were added to SH-SY5Y cells before the LF-EMF treatments, as shown in Figure 6A.

Cell transfection

To modulate miR-30a expression, SH-SY5Y cells were transfected using NEON Transfection System

(Invitrogen), according to the manufacturer’s instructions. Specifically, 4.8×105 SH-SY5Y cells were

transfected with miR-30a precursor sequence, Pre-miR30a (hsa-miR30a-5p mirVana, Ambion, Life

Technologies) at the final concentrations of 1 and 10 nM, or with mock solution. To modulate BECN1

expression, 4.8×105 SH-SY5Y cells were transfected as above described, using pooled siBECN1 sequences

(BECN1 Silencer, Ambion, s16537 and s16538) at the final concentration of 4 µM or with mock solution

alone. Cells were maintained for 48 hours, subjected or not- to 1 hour LF-EMF stimulation and finally their

total RNA was extracted.

LC3B-GFP autophagosome analysis

For autophagosome detection, SH-SY5Y cells were seeded at 2x103 into 96-well plates; after 12 hours, they

were transduced with BacMam LC3B-GFP or BacMam LC3B(G120A)-GFP viral particles (MOI=30),

according to the Premo Autophagy Sensor Kit (Invitrogen, Life Technologies). Rapamycin (1-10 µM) was

added immediately after the transduction, while Chloroquine diphosphate (10 µM) was added only 2 h

before the end of the 24 hours scheduled LM-EMF treatment (each represented by 1 hour LF-EMF

exposure). After 4 and 24 hours p.t., LC3B-GFP and LC3B(G120A)-GFP signals were monitored using an

inverted fluorescence microscope (40X magnification, Eclipse Nikon TS100). DIC phase contrast and

fluorescent photographs (10X magnification) were also collected.

Acc

epte

d A

rtic

le

5

Electron microscopy analysis

SH-SY5Y cells (106) were grown as before specified at a 75% confluence, and subjected or not- to 1 hour

LF-EMF exposure. At 4-24-48 hours p.t., cells were harvested by centrifugation at 800 rpm for 3 minutes

and fixed with 2% glutaraldehyde in medium, maintained for 2 hours at room temperature. Cells were then

rinsed in PBS (pH 7.2) overnight and post-fixed in 1% aqueous OsO4 for 2 hours at room temperature. Cells

were pre-embedded in 2% agarose in water, dehydrated in acetone, and finally embedded in epoxy resin

(Electron Microscopy Sciences, EM-bed812). Ultrathin sections (50–60 nm) were collected on formvar-

carbon-coated nickel grids and stained with uranyl acetate and lead citrate. The specimens were finally

observed with a Zeiss EM900 electron microscope equipped with a 30 µm objective aperture and operating

at 80 kV.

MTT assay

Mitochondrial enzymatic activity was estimated by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide] assay (Sigma-Aldrich). A cell suspension of 2.5×103 cells/well in 100 µL

culture medium was seeded into 96-well plates. After each LF-EMF treatments, 10 µl of MTT (concentration

equal to 1 mg/ml) was added to each well. After incubation at 37°C for 4 hours, the formed purple formazan

crystals were solubilized in 100 µl of lysis buffer (20% sodium dodecyl sulfate in 50% dimethylformamide)

overnight at 37°C. Absorbance values were measured at 595 nm in a microplate reader (Bio-Rad

Laboratories, Hercules, CA) and the results expressed as absorbance.

Clonogenic survival assay

1.5×103 SH-SY5Y cells were plated into 6-well plates. The cells were either treated or not with LF-EMF.

After 2 weeks from the last LF-EMF treatment, cells were fixed with 4% paraformaldehyde (Sigma-Aldrich)

stained with 1 mg/ml of Brilliant Blue (Sigma-Aldrich) and then dissolved in methanol 50% and acetic acid

7.5%. Colonies that contained more than 50 cells were counted by using the Clono-counter software as we

described (Palumbo et al., 2012).

Real Time quantitative PCR expression analysis

For miRNA-30a and Beclin1 (BECN1) expression analysis, total RNA was extracted from cells homogenates

using the Trizol reagent (Invitrogen, Life Technologies), according to the manufacturer’s instructions. Two

µg of each RNAs were then reverse-transcribed for miRNA-30a, BECN1 and β-actin (BACT) expression

assays, as follows: for miRNA-30a, the specific TaqMan MicroRNA Reverse transcription kit (Ambion, Life

Technologies) was employed, according to the suggested protocol. For BECN1 and BACT, reactions were

performed using the cDNA Archive kit (Applied Biosystems, Life Technologie). Real-time quantitative PCR

reactions were performed as previously described (Barbieri et al., 2011), using for miR-30a the TaqMan

microRNA assay (ID: P00257479) and for BECN1 (forward: CCAGCCCCTGAAACTGGAC; reverse

TCCAGGAACTCACAGCTCCA; TaqMan MGB probe ATCCTGGACCGTGTCA). BACT was used as

Acc

epte

d A

rtic

le

6

housekeeping normalizer as discussed in Comincini et al. (2013). Relative quantifications were assessed

using the ∆∆Ct method (Livak and Schmittgen, 2001).

RIP assay

A RIP assay was employed to confirm miR-30a/BECN1 interaction using conditions previously described

(Comincini et al., 2013). Basically, the RIP-Assay kit for microRNA was employed following the

manufacturer’s specifications. Briefly, fresh cellular extracts from SH-SY5Y cells (106) were co-

immunoprecipitated overnight at 4°C with 20 µg of RIP-certified anti-EIF2C2/AGO2 mouse monoclonal

antibody (MBL), one of the RISC protein components, previously conjugated with Sepharose Protein A or G

beads (Amersham Biosciences, GE Healthcare). Rabbit IgG and input-alone (mock) were used as negative

controls. BECN1 and miR-30a expression levels were evaluated by Real-time PCR (as described in the

Methods of the current manuscript) after total RNA isolation from antibody-immobilized Protein A or G

agarose beads-RNP complexes. Data, reported below, resulting from 3 independent experiments, were

normalized to mock samples.

Immunoblotting analysis

Following LF-EMF treatments, SH-SY5Y cells were collected and homogenized in a buffer containing (20

mM Tris-HCl pH 7.4, 2 mM EDTA, 0.5 mM EGTA, 50 mM 2-mercaptoethanol, 0.32 mM sucrose), and

Complete Protease Inhibitor Cocktail (Sigma-Aldrich). The protein content was measured employing the

Bradford’s method using bovine serum albumin as standard. Proteins were diluted in SDS protein gel

loading solution 2×, boiled for 5 min, separated by 12% SDS-polyacrylamide gel electrophoresis. The anti-

Beclin1 (#3738, Cell Signaling Technology, Danvers, MA), the anti-ATG7 (#2631, Cell Signaling

Technology) and the anti-LC3B (#2775, Cell Signaling Technology) were all diluted at 1:2000, while the

anti-β-actin (#5125, Cell Signaling Technology) was diluted at 1:5000 and the mouse monoclonal anti-α-

tubulin (T9026, Sigma-Aldrich) at 1:1000. All the antibodies were diluted in TBST buffer [10mM Tris-HCl,

100 mM NaCl, 0.1% (v/v) Tween 20, pH 7.5] containing 6% (w/v) milk. Species-specific peroxidase-labeled

ECL secondary antibodies (Cell Signaling Technology, 1:4000 dilutions) were used. Protein signals were

revealed using the ECL Advance Western Blotting Detection Kit (GE Healthcare, Pittsburgh, PA). The

experiments were performed in duplicate for each different cell preparation using α-tubulin and β-actin to

normalize the data. The statistical analysis was performed on the densitometric values obtained using the

NIH Image software (http://rsb.info.nih.gov/nih-image) after image acquisition.

Data analysis

All statistical analyses were performed by using GraphPad InStat application (GraphPad software, La Jolla,

CA). All data were analyzed by using the Tukey–Kramer multiple comparisons test, as specifically indicated

in the text or in the Figure legends. Differences were considered statistically significant when p<0.005.

Acc

epte

d A

rtic

le

7

Results

SH-SY5Y human neuroblastoma undifferentiated cells were exposed for different time intervals to a pulsed

low frequency electromagnetic stimulation (75 Hz, 2 mT, 5 mV, 1.3 ms) by means of a specific apparatus

already described in (Fassina et al., 2006-2008-2009-2010: Osera et al., 2011). As controls, cells were grown

in identical standard culture conditions in the absence of electromagnetic stimulation. We therefore

investigated the effects of low frequency electromagnetic (LF-EMF) stimulation on cell viability and on the

expression of autophagy-related genes and proteins.

A continuous LF-EMF exposure modulates miR-30a expression

Initially, SH-SY5Y cells were exposed continuously to LF-EMF for different time intervals (1, 3, 6, 12 and

24 hours): after each scheduled treatment, cells were analyzed in their growing capabilities using a light

optical inverted microscope and in short-term viability by MTT assay. After these evaluations, the samples

were collected for gene and protein expression studies. We found that the different LF-EMF treatments did

not affect short-term viability rates (Fig. 1A). During this interval of treatment (1-24 hours), the endogenous

expression of miR-30a in SH-SY5Y cells was investigated by Real-time PCR. As reported in Figure 1B,

miR-30a exhibited a down-regulation, particularly pronounced in correspondence of the shorter exposure (1

hour) and to a lesser extent following 3-24 hours of LF-EMF treatment. Shorter LF-EMF exposures of 15

and 30 minutes were also assayed, however, no significant differences were observed in comparison to the

miR-30a expression level of the untreated control; conversely, after 48 hours of continuous LF-EMF

exposure, miR-30a expression was comparable to the basal levels of untreated samples (data not shown).

Effects of 1 hour LF-EMF treatment on miR-30a and BECN1 expression

Given the strong reduction of miR-30a after 1 hour LF-EMF treatment, we decided to expose SH-SY5Y

cells to this specific stimulus and to recover the cells at increasing p.t. interval times (i.e. 1, 6, 12, 24 and 48

hours). Notably, 1 hour LF-EMF treatment did not affect long term viability rates as revealed by clonogenic

assays [untreated cells: average colony forming units (CFU)=86±11; 1 hour LF-EMF cells: average

CFU=91±4; n=5]. We found that miR-30a was strongly down-regulated following 1-12 hours p.t. and that

neither 48 hours were sufficient to restore its expression levels compared to the untreated cells (Fig. 1C).

miR-30a was previously demonstrated to regulate Beclin1 (BECN1) gene expression in human glioblastoma

cells, by directly targeting the 3'-UTR of BECN1 to mediate a repressive effect on the protein expression

(Zhu et al., 2009). Furthermore, we also tested the association of miR-30a and BECN1 transcript in SH-

SY5Y cells by a RIP-Assay, followed by Real-time PCR detection as we previously described (Comincini et

al., 2013). Briefly, cellular EIF2C2/AGO2-associated RNA from cultured cells was isolated with a RIP-

Assay kit for microRNA coupled with a RIP-certified anti-EIF2C2/AGO2 monoclonal antibody. An equal

amount of IgG2a isotype control was used as a negative control. We reported a significant enrichment of

BECN1 and miR-30a expression, compared with input and isotype controls within the anti-EIF2C2/AGO2

Acc

epte

d A

rtic

le

8

immunoprecipitates, using either Protein A or G sepharose beads. These data suggested that miR-30a

interacts with BECN1 to finally mediate a repressive effect on its expression (data not shown).

We therefore evaluated if the pronounced miR-30a down-regulation induced by 1 hour LF-EMF exposure

affected BECN1 expression in SH-SY5Y cells. As expected, following this treatment, a parallel significant

up-regulation of BECN1 expression was detected, mostly scored by Real-time PCR at 24-48 hours p.t. (Fig.

1D).

Furthermore, the ability of the 1 hour LF-EMF treatment to modulate miR-30a expression was evaluated in

additional cell lines, such as the neuroblastoma SK-N-SH and the glioblastoma-derived U87-MG and T98G

cells. As reported in Figure. S1, this specific treatment induced a general and highly significant miR-30a

down-regulation in neuroblastoma cells, with a more prominent effect in SH-SY5Y, and in U87-MG

glioblastoma cells.

To further confirm the ability of 1 hour LF-EMF treatment to modulate miR-30a expression, we transfected

SH-SY5Y cells with a specific miR-30a mimic precursor sequence (Pre-miR30, at 1 and 10 nM, 48 hours

before LF-EMF exposure). Real-time PCR data showed that, again, the 1 hour LF-EMF challenge induced a

marked decrease in miR-30a expression and, most importantly, it was able to significantly counteract the

miR-30a over-expression induced by Pre-miR30 administration at both the employed concentrations (Fig.

2A). In addition, to further shed light on BECN1 modulation by LF-EMF, we partially knocked-down

BECN1 expression in SH-SY5Y cells using validated siRNA BECN1 pooled molecules, and then subjected

these cells, 48 hours after siRNA transfection, to a subsequent 1 hour LF-EMF exposure. Real-time PCR

data showed that following siRNA transfection there was a sensible decrease in BECN1 expression

compared to mock-transfected cells; of note, mock and siBECN1-treated cells exhibited a significant BECN1

over-expression produced by 1 hour LF-EMF exposure (Fig. 2B).

Effects of 1 hour LF-EMF treatment on the activation of the autophagy process in SH-SY5Y human

neuroblastoma cells

Since Beclin1, an experimentally validated target of miR-30a, is required for the initiation of autophagosome

formation in autophagy (Klionsky et al., 2012), we investigated if this process might be modulated by LF-

EMF exposure. To this purpose, SH-SY5Y cells were transduced with a Baculovirus LC3B-GFP expressing

vector, as we previously described (Fassina et al., 2012; Comincini et al., 2013) and exposed to LF-EMF (1

hour); living cells were then analyzed at different time intervals (4 and 24 hours p.t.) for LC3B-GFP

expression by inverted fluorescent microscope examinations. As a negative control, cells were transduced

with a mutant vector, BacMam LC3B(G120A)-GFP at the same multiplicity of infection (MOI). The

mutation on this control prevents LC3B cleavage and its subsequent lipidation during normal autophagy, and

protein localization remains cytosolic and diffuse. GFP expression was additionally analyzed in cells treated

with the autophagy inducer Rapamycin, at 1 and 10 µM concentration, while the block of the autophagy flux

was evaluated after Chloroquine diphosphate administration (10 µM), according to the current autophagy

guidelines (Klionsky et al., 2012). As reported in Figure 3A, light optical microscope examinations indicated

Acc

epte

d A

rtic

le

9

that transduction and LF-EMF treatment did not sensibly affect SH-SY5Y growing capabilities. LC3B-GFP

expression, likely LC3B-II on the outer membrane of the autophagosomes, was mainly scored as discrete

puncta after LF-EMF treatment (24 hours p.t.), similarly to Rapamycin-treated cells in the absence of LF-

EMF stimulation. As expected, the blockage of the autophagic flux by Chloroquine diphosphate induced a

further dotted-like increase of LC3B-GFP localized expression (Fig. 3B). Differently, and as expected,

before LF-EMF exposure, in cells transduced with LC3B(G120A)-GFP mutated vector and Rapamycin-

treated, LC3B-GFP exhibited a faint cytoplasmic diffuse pattern. In general, after 48 hours p.t. GFP signals

declined (data not shown).

Furthermore, electron microscope analysis on SH-SY5Y cells exposed to 1 hour LF-EMF treatment revealed

in general a marked increase in the number and size of autophagic-like vesicles, characterized by double

membrane and containing residual partially undigested material, compared to untreated cells (Fig.4). In

particular, at 4 hours p.t. cells exhibited mostly early autophagic vacuoles, while in extended p.t. intervals

(i.e. 24 and 48 hours p.t.) cells showed large late autophagic vacuoles with partially degraded, electron-dense

particles.

We therefore exposed SH-SY5Y cells to 1 hour LF-EMF to analyze the expression of key proteins involved

in the autophagy process at increasing p.t. intervals (i.e. 6, 12, 24 and 48 hours). As shown in Figure 5,

immunoblotting analysis, after LF-EMF exposure, showed an increasing trend of Beclin1 expression with a

maximum at 24-48 hours p.t. A significant increase of the expression of the autophagy marker LC3B-II was

also observed at 12, 24 and 48 hours p.t., after normalization with housekeeping proteins (α-tubulin and β-

actin), as recommended (Klionsky et al., 2012). Finally, the autophagy-related protein 7 (Atg7) showed a

marked increase of its expression at 6-48 hours p.t. (Fig. 5A,B).

LF-EMF effects on Aββββ toxicity in SH-SY5Y human neuroblastoma cells

To evaluate a preclinical potential application of the LF-EMF-mediated modulation of the autophagy

process, SH-SY5Y cells, which are widely employed in AD in vitro studies, were incubated with a defined

amount of Aβ1-40 peptide (1 µM), 12 hours before LF-EMF. Different LF-EMF protocols were employed (1

to 4 repeated exposures of 1 hour each, as schematized in Figure 6A) and the cells were analyzed in their

short-term viability by MTT assays. As reported in Figure 6B and C, at 48 hours p.t., partly with 2 (2E) but

mostly with 3 LF-EMF treatments (3E), the decrease in viability rates produced by Aβ1-40 administration

(34%) was significantly counteracted by the specific LF-EMF protocol; differently, the longest LF-EMF

protocol (4E) significantly affected cell viability, independently of Aβ1-40 administration. These results were

further confirmed in cell growing capabilities by light optical microscope examinations as reported in Figure

S2.

According to these results, SH-SY5Y cells were further incubated with Aβ1-42 (2 µM), or with the equimolar

combination of Aβ1-40 and Aβ1-42 peptides (1 µM each), and subjected to the LF-EMF protocol (3E) which

previously resulted the most effective in rescuing cell viability. A preliminary incubation of SH-SY5Y cells

with Aβ1-42 at 1 µM concentration did not highlight a significant reduction of cell viability (at 24-48-72-96

Acc

epte

d A

rtic

le

10

hours p.t., data not shown), in agreement with previous reports (Molina-Holgado et al., 2008). Differently,

Aβ1-42 at 2 µM concentration and the combination of Aβ1-40 and Aβ1-42 at 1 µM concentration each, reduced

cell viability to 45 and 51%, respectively, as revealed by MTT assay at t3 interval, as reported in Fig. S3

(panel A). Of note, at this time interval, LF-EMF 3E treatment (i.e. 48 hours) induced a significant rescue of

short term cell viability after the combined Aβ1-40 and Aβ1-42 treatment, while, on the contrary, 3E protocol

did not significantly counteract the induced toxicity of Aβ1-42 administration. The comparative results on the

effect of LF-EMF 3E protocol on SH-SY5Y cells following the administration of the different Aβ peptides,

including Aβ1-40 , were summarized in Fig. S3 (panel B).

Discussion

The main finding of this study is to show, for the first time to our knowledge, that a specific low frequency

pulsed EMF stimulation can modulate in vitro the autophagy process by directly tuning the expression of a

microRNA sequence.

It should be noted that, depending on the dose and on the length of treatment, the electromagnetic stimuli can

induce a cytoprotective cellular response, likely suggesting a possible application in medical therapy (Osera

et al., 2011). To this regard, several in vitro, pre-clinical and clinical researches studied the biologic effects

of pulsed electromagnetic stimulation, in particular in the effectiveness in different disorders including

palliative treatments for both post-operative and non-post-operative pain (Harden et al., 2007; Rohde et al.,

2010) and in arthritis (Ryang et al., 2010).

On the other hand, epidemiological studies seem to indicate possible associations between exposure to EMF

and an increased risk of tumors and neurodegenerative disorders, such as AD (Davanipour et al., 2007).

However, this association is not actually strictly proven and the underlying biological mechanisms are still

unknown (Kheifets et al., 2009). One of the main limits and concerns in comparing the biologic effects of

EMF is related to the lack of homogeneity, since the different scientific studies present a high variability in

terms of magnetic flux density (the component of the magnetic field passing through a surface), signal type,

frequency, duration, and the number of treatment sessions (de Girolamo et al., 2013). To this regard, within

this current scientific debate, in the present work, we used the same parameters of pulsed electromagnetic

field (2 mT, 75 Hz, 1.3 ms) that we employed in previous studies where we demonstrated that EMF induce a

cytoprotective action in SH-SY5Y cells over-expressing the amyloid precursor protein (APP) (Osera et al.,

2011) and a stimulation of bone cell proliferation (Fassina et al., 2008; Saino et al., 2011).

Very recently, a similar pulsed LF-EMF treatment (1.5 mT, 75 Hz, 1.3 ms) was employed by de Girolamo

and collaborators (2013) which demonstrated that it did not exert cytotoxic effects and it positively

influences, in a dose-dependent manner, cell proliferation, the expression of tendon-specific markers, and the

release of anti-inflammatory cytokines and angiogenic factors in a healthy human tendon cell culture model.

Within the context of AD, the pioneering studies of Arendash and coworkers (2010-2012a-2012b) primarily

showed that high frequency EMF protect against cognitive impairment, being able to reverse it in an AD

Acc

epte

d A

rtic

le

11

mice model. More recently, in vivo preclinical assays using transcranial electromagnetic treatment (TMS)

schemes, suggested that, besides AD, TMS’s mechanisms of action provide an effective therapeutic potential

against other neurologic disorders/injuries, such as Parkinson’s disease, traumatic brain injury, and stroke

(Arendash et al., 2012; Arendash, 2012). Of interest, at molecular level, it was reported that in AD patients,

the autophagic process, and in particular the maturation of autophagosomes, is impaired (Yu et al., 2005).

Defects in autophagosome formation and loss of basal autophagy may be implicated as a cause of

neurodegeneration (Hara et al., 2006, Wong and Cuervo, 2010), while an increased autophagic activity may

help to clear key aggregated proteins involved in neurodegenerative pathologies, such as mutant α-synuclein

and huntingtin proteins which contribute to Parkinson and Huntington diseases, respectively (Engelender,

2008; Sarkar et al., 2007). There is also mounting evidence that if the autophagosome-lysosomal degradation

is impaired, this could disturb the processing of APP and participate to the development of AD pathology.

Notably, Beclin1 is an important multifunctional protein that also plays a relevant role in the early stage of

autophagy. Indeed, Beclin1, via interaction with the Vps34 protein complex, is implicated in the autophagic

initial step involving the double-membrane vesicle formation. The protein is therefore a positive regulator of

the autophagy pathway and promotes its induction (Cao and Klionsky, 2007). It has been reported that the

deficiency of Beclin1 in cultured neurons and transgenic mice provokes the deposition of β−amyloid

peptides, whereas its over-expression reduces the accumulation of these peptides (reviewed in Salminen et

al., 2013). In addition, Pickford et al. (2008) reported that Beclin1 mRNA and protein levels are reduced in

the brains of individuals with mild cognitive impairment compared to the brains of control patients, and

Beclin1 further decreases in the brains of patients with severe AD. Therefore restoring Beclin1 expression

may have a clinical relevance in diseases which implicate a deficit in autophagy, such as AD.

To this aim, we developed an in vitro not invasive methodology to induce an increase of Beclin1

expression in SH-SY5Y human neuroblastoma cells, consisting of a specific LF-EMF exposure. It should be

stressed that we employed SH-SY5Y cells because of their extensive use in AD preclinical in vitro studies

(Amadio et al., 2009; Prasanthi et al., 2009) and because they exhibited a prominent LF-EMF-induced miR-

30a down-regulation threshold as we have documented.

Of note, miR-30a has been previously demonstrated to negatively target Beclin1 coding gene (BECN1), thus

resulting in decreased autophagic activity in human glioblastoma cells. In fact, the treatment of these tumor

cells with miR-30a mimic sequence decreases the expression of Beclin1 transcript and protein, while, on the

contrary, antagomir increases their expression (Zhu et al., 2009). Therefore, a down-regulation of this

specific microRNA sequence positively affects Beclin1 expression.

We initially focused our attention on the response of SH-SY5Y cells to a continuous LF-EMF stimulus for

different exposure times, by evaluating the changes in the expression of miR-30a. Our data clearly indicate

that 1 hour LF-EMF exposure strongly decreases miR-30a expression. Prolonged LF-EMF exposures lead to

a down-regulation of miR-30a as well, although to a less extent than 1 hour, suggesting that the inhibition of

miR-30a expression inversely correlates to time exposure. Based on these results, 1 hour LF-EMF

stimulation was adopted for the next experiments. We then evaluated the recovery time-kinetics of miR-30a

Acc

epte

d A

rtic

le

12

levels after 1 hour LF-EMF challenge, finding that miR-30a is maintained at significant low levels even after

48 hours p.t.. In parallel, and as a consequence, Beclin1 mRNA and the corresponding protein levels were

increased after 24 and 48 hours p.t.. Accordingly, our results showed that the specific LF-EMF treatment did

not affect short- and long-term viability. These data mechanistically demonstrate that the employed 1 hour

LF-EMF treatment directly affects miR-30a expression which, in turn, tunes BECN1 levels. The modulatory

effect exerted by LF-EMF on the miR-30a/Beclin1 cascade is also supported by experiments performed on

SH-SY5Y cells transiently over-expressing miR-30a and, as a counterpart, on siBECN1-treated cells. To this

last regard, it should be underlined that BECN1 was on purpose not extensively down-regulated to not

significantly alter the viability rates due to a possible Beclin1 perturbation within the autophagy process.

We additionally documented that our specific LF-EMF scheduled treatment modulates the autophagy

process in SH-SY5Y cells via LC3B-GFP autophagosome analysis. To this aim, we first visualized LC3B-

GFP expression following 1 hour LF-EMF challenge thus comparing it with the expression patterns

produced by Rapamycyn, a well-established autophagy-inducer, and finally we evaluated the block of the

autophagic flux in living cells induced by Chloroquine administration (Klionsky et al., 2012). As a

complementary approach, ultrastructural evaluation by transmission electron microscopy highlighted a

marked increase in autophagy-like vesicles after LF-EMF exposure: accordingly to LC3B-GFP expression

results, cells exposed to 1 hour LF-EMF with longer p.t. interval times displayed large vacuoles with partly

visible parallel membrane bilayers, containing undigested cytoplasmic residuals and surrounded by electron

dense organelles, likely lysosomes. All these ultrastructural features resembled a specific dynamic of

autophagic vesicles formation (Klionsky et al., 2012), ultimately induced by LF-EMF treatment. In addition,

immunoblotting results showed that the expression of the two autophagy-related markers, LC3B-II and Atg7,

were significantly up-regulated following LF-EMF exposure. Altogether, these results suggest that this

specific LF-EMF treatment, instead of directly modulating cell proliferation or activating programmed-cell

death pathways, induces a pro-survival autophagy process that might be cytoprotective by removing

damaged proteins and organelles. A different cytoprotective action has also been recently observed by us in

SH-SY5Y cells where the same 1 hour LF-EMF treatment was able to improve the resistance to induced

oxidative stress (Osera et al., submitted).

Subsequently, we subjected SH-SY5Y cells to single or repeated 1 hour LF-EMF protocols to evaluate their

possible benefits on cell viability against Aβ1-40 in vitro administration. Of note, in this pilot neurotoxicity

study we decided to employ undifferentiated SH-SY5Y cells because it was reported that protocols which

induce cell differentiation confer higher tolerance to Aβ peptides, potentially by up-regulating AKT survival

signaling pathways (Cheung et al., 2009). We preliminary exposed SH-SY5Y cells to a time-kinetic dose of

Aβ1-40, to assess conditions that did not induce extensive toxicity and to monitor cell proliferation effects.

The concentration of Aβ used in our study was also based on the assumption that low micromolar and

nanomolar concentrations of soluble oligomeric Aβ peptides cause toxicity at neuritic and synaptic levels.

The effects on neurite outgrowth in cell culture were clearly seen after the addition of 1 µM Aβ1-40, while

higher concentrations (10–100 µM), previously used in other cell culture experiments (Cheung et al., 2009),

Acc

epte

d A

rtic

le

13

cause a significant decrease in cell viability. In our experiments, Aβ1-40 administration at 1 µM concentration,

which did not compromise short-term viability, shows clear toxic effects on cell viability only after 72-96

hours post-administration (data not shown). Then, we performed Aβ1-40 administration in SH-SY5Y cells,

followed by 1 to 4 distinct treatments of 1 hour LF-EMF exposure each (i.e. 1E, 2E, 3E and 4E). As

expected, we found that this specific LF-EMF challenge administered within the first day (1E and 2E) did

not produce clear differences on cell viability. Differently, in the extended treatment (Day 2), Aβ1-40

influences cell viability to the extent that 3 LF-EMF exposure (3E) resulted in a significant rescue of this

parameter compared to the corresponding Aβ1-40 treated cells not subjected to LF-EMF exposure. The last

scheduled treatment, 4 cycles of LF-EMF exposure (4E), induced a comparable decrease in cell viability,

independently of Aβ1-40 presence. To this regard, we can suppose that while the scored beneficial effects of

3E protocol on cell viability may be ascribed to the LF-EMF treatment itself, a further LF-EMF exposure

may determine a marked decline of the cell growing capabilities. In agreement with this last result Jiang and

collaborators (Jiang et al., 2013), described that extensively prolonged EMF pulsed treatments (100-1000-

10000 pulses at 100 Hz and 50kV/m field strength) result in enhanced oxidative stress ascribable to

autophagy dysfunctions. Furthermore, the authors reported that these prolonged treatments caused long-term

impairment in cognition and memory in rats, resulting in AD-like symptoms. The 3 LF-EMF exposure (3E)

protocol, effective in counteracting Aβ1-40 toxicity, was also similarly assayed challenging SH-SY5Y cells

with Aβ1-42 and with a mixture of Aβ1-40 and Aβ1-42 peptides. Interestingly, the 3E protocol was able to

significantly rescue the cell viability impairment induced by the in vitro co-treatment with the peptides,

while it was not effective to reverse the Aβ1-42-mediated toxic effects. To this regard, it might be reasonable

to hypothesize that a different LF-EMF exposure protocol, varying time-kinetics as well as intrinsic physical

parameters (pulse duration, electromagnetic frequency), might result more effective in specifically

counteracting the effects of Aβ1-42 peptide, less abundant compared to Aβ1-40 but more neurotoxic and the

main component of senile AD plaques (work in progress).

In conclusion, our work points out that a specific LF-EMF treatment is able to modulate the

expression of one of the key genes (BECN1) involved in the fine tuning of the autophagy process.

Noteworthy, autophagy has been increasingly recognized as a pathway involved in the etiology, thus having

a therapeutic potential, of different physiological and pathological conditions, including age-dependent

neurodegenerative diseases. Despite these novel findings on LF-EMF induced autophagic effects in human

neuroblastoma cells, the exact mechanisms of action by which cells perceive physical stimuli and how this

information is quickly transduced into gene expression variations remains to be better established. However,

the present work provides new clues in the field thus demonstrating, for the first time, that EMF might

directly and effectively affect gene expression by modulating specific regulatory microRNA sequences.

Acknowledgements

Acc

epte

d A

rtic

le

14

The Authors are grateful to Dr. Ruggero Cadossi and Dr. Stefania Setti (Igea, Carpi, Italy) for providing

Biostim pulse generator.

Literature Cited:

Amadio M, Pascale A, Wang J, Ho L., Quattrone A, Gandy S, Haroutunian V, Racchi M, Pasinetti GM. 2009. nELAV Proteins Alteration in Alzheimer's Disease Brain: A Novel Putative Target for Amyloid-beta Reverberating on A beta PP Processing. J Alzheimers Dis 16:409-419.

Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D. 2003. MicroRNAs and other tiny endogenous RNAs in C-elegans. Curr Biol 13:807-818.

Arendash GW. 2012. Transcranial Electromagnetic Treatment Against Alzheimer's Disease: Why it has the Potential to Trump Alzheimer's Disease Drug Development. J Alzheimers Dis 32:243-266.

Arendash GW, Mori T, Dorsey M, Gonzalez R, Tajiri N, Borlongan C. 2012. Electromagnetic Treatment to Old Alzheimer's Mice Reverses beta-Amyloid Deposition, Modifies Cerebral Blood Flow, and Provides Selected Cognitive Benefit. Plos One 7 7:e35751.

Arendash GW, Sanchez-Ramos J, Mori T, Mamcarz M, Lin X, Runfeldt M, Wang L, Zhang G, Sava V, Tan J, Cao C. 2010. Electromagnetic Field Treatment Protects Against and Reverses Cognitive Impairment in Alzheimer's Disease Mice. J Alzheimers Disease 19:191-210.

Barbieri G, Palumbo S, Gabrusiewicz K, Azzalin A, Marchesi N, Spedito A, Biggiogera M, Sbalchiero E, Mazzini G, Miracco C. Pirtoli L, Kaminska B, Comincini S. 2011. Silencing of cellular prion protein (PrPC) expression by DNA-antisense oligonucleotides induces autophagy-dependent cell death in glioma cells. Autophagy 7:840-853.

Cao Y, Klionsky DJ. 2007. Physiological functions of Atg6/Beclin 1: a unique autophagy-related protein. Cell Res 17:839-849.

Cheung YT, Lau WKW, Yu MS, Lai CSW, Yeung SC, So KF, Chang RCC. 2009. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 30:127-135.

Comincini S, Allavena G, Palumbo S, Morini M, Durando F, Angeletti F, Pirtoli L, Miracco C. 2013. microRNA 17 regulates the expression of ATG7 and modulates the autophagy process, improving the sensitivity to temozolomide and low-dose ionizing radiation treatments in human glioblastoma cells. Cancer Biol Ther 14:574-586.

Dalby KN, Tekedereli I, Lopez-Berestein G, Ozpolat B. 2010. Targeting the prodeath and prosurvival functions of autophagy as novel therapeutic strategies in cancer. Autophagy 6:322-329.

Davanipour Z, Tseng CC, Lee PJ, Sobel E. 2007. A case-control study of occupational magnetic field exposure and Alzheimer's disease: results from the California Alzheimer's Disease Diagnosis and Treatment Centers. BMC Neurology 7:13.

de Girolamo L, Stanco D, Galliera E, Vigano M, Colombini A, Setti S, Vianello E, Corsi Romanelli MM, Sansone V. 2013. Low frequency pulsed electromagnetic field affects proliferation, tissue-specific gene expression, and cytokines release of human tendon cells. Cell Biochemistry and Biophysics 66:697-708.

Engelender S. 2008. Ubiquitination of alpha-synuclein and autophagy in Parkinson's disease. Autophagy 4:372-374.

Fassina L, Visai L, Benazzo F, Benedetti L, Calligaro A, De Angelis MGC, Farina A, Maliardi V, Magenes G. 2006. Effects of electromagnetic stimulation on calcified matrix production by SAOS-2 cells over a polyurethane porous scaffold. Tissue Engin 12:1985-1999.

Fassina L, Saino E, Visai L, Silvani G, De Angelis MGC, Mazzini G, Benazzo F, Magenes G. 2008. Electromagnetic enhancement of a culture of human SAOS-2 osteoblasts seeded onto titanium fiber-mesh scaffolds. J Biom Mat Res Part A 87A:750-759.

Fassina L, Saino E, Sbarra MS, Visai L, De Angelis MGC, Mazzini G, Benazzo F, Magenes G. 2009. Ultrasonic and Electromagnetic Enhancement of a Culture of Human SAOS-2 Osteoblasts Seeded onto a Titanium Plasma-Spray Surface. Tissue Engin Part C-Methods 15:233-242.

Fassina L, Saino E, Sbarra MS, Visai L, De Angelis MGC, Magenes G, Benazzo F. 2010. In vitro electromagnetically stimulated SAOS-2 osteoblasts inside porous hydroxyapatite. J Biomed Mat Res Part A 93A:1272-1279.

Acc

epte

d A

rtic

le

15

Fassina L, Magenes G, Inzaghi A, Palumbo S, Allavena G, Miracco C, Pirtoli L, Biggiogera M, Comincini S. 2012. AUTOCOUNTER, an ImageJ JavaScript to analyze LC3B-GFP expression dynamics in autophagy-induced astrocytoma cells. Eur J Histochem. 56:277-283.

Fu LL, Wen X, Bao JK, Liu B. 2012. MicroRNA-modulated autophagic signaling networks in cancer. Int J Biochem Cell Biol 44:733-736.

Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, Mizushima N. 2006. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441:885-889.

Harden RN, Remble TA. Houle TT, Long JF, Markov MS, Gallizzi MA. 2007. Prospective, randomized, single-blind, sham treatment-controlled study of the safety and efficacy of an electromagnetic field device for the treatment of chronic low back pain: a pilot study. Pain practice: the official Journal of World Institute of Pain 7:248-255.

Jaeger PA, Pickford F, Sun CH, Lucin KM, Masliah E, Wyss-Coray T. 2010. Regulation of Amyloid Precursor Protein Processing by the Beclin 1 Complex. Plos One 5:e11102.

Jaeger PA, Wyss-Coray T. 2010. Beclin 1 Complex in Autophagy and Alzheimer Disease. Arch Neurology 67:1181-1184.

Jiang DP, Li J, Zhang J, Xu SL, Kuang F, Lang HY, Wang YF, An GX, Li JH, Guo GZ. 2013. Electromagnetic Pulse Exposure Induces Overexpression of Beta Amyloid Protein in Rats. Arch Med Res 44:178-184.

Kang R, Zeh HJ, Lotze MT, Tang D. 2011. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ 18:571-580.

Kheifets L, Ahlbom A, Crespi CM, Draper G, Hagihara J, Lowenthal RM, Mezei G, Oksuzyan S, Schüz J, Swanson J, Tittarelli A, Vinceti M, Wunsch Filho V. 2010. Pooled analysis of recent studies on magnetic fields and childhood leukaemia. Br J Cancer 103:1128-1135.

Kheifets L, Bowman JD, Checkoway H, Feychting M, Harrington JM, Kavet R, Marsh G, Mezei G, Renew DC, van Wijngaarden E. 2009. Future needs of occupational epidemiology of extremely low frequency electric and magnetic fields: review and recommendations. Occup Envir Med 66: 72-80.

Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K, Agholme L, Agnello M, Agostinis P, Aguirre-Ghiso JA, et al. 2012. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 8:445-544.

Laxton AW, Tang-Wai DF, McAndrews MP, Zumsteg D, Wennberg R, Keren R, Wherrett J, Naglie G, Hamani C, Smith GS, Lozano AM. 2010. A Phase I Trial of Deep Brain Stimulation of Memory Circuits in Alzheimer's Disease. Ann Neurology 68:521-534.

Levine B, Klionsky DJ. 2004. Development by self-digestion: Molecular mechanisms and biological functions of autophagy. Devel Cell 6:463-477.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-408.

Molina-Holgado F, Gaeta A, Francis PT, Williams RJ, Hider RC. 2008. Neuroprotective actions of deferiprone in cultured cortical neurones and SHSY-5Y cells. J Neurochem. 105:2466-2476.

Osera C, Fassina L, Amadio M, Venturini L, Buoso E, Magenes G, Govoni S, Ricevuti G, Pascale A. 2011. Cytoprotective Response Induced by Electromagnetic Stimulation on SH-SY5Y Human Neuroblastoma Cell Line. Tissue Engin Part A 17:2573-2582.

Palumbo S, Pirtoli L, Tini P, Cevenini G, Calderaro F, Toscano M, Miracco C, Comincini S. 2012. Different Involvement of Autophagy in Human Malignant Glioma Cell Lines Undergoing Irradiation and Temozolomide Combined Treatments. J Cell Biochem 113:2308-2318.

Pickford F, Masliah E, Britschgi M, Lucin K, Narasimhan R, Jaeger PA, Small S, Spencer B, Rockenstein E, Levine B, Wyss-Coray T. 2008. The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid beta accumulation in mice. J Clin Investig 118:2190-2199.

Prasanthi JRP, Huls A, Thomasson S, Thompson A, Schommer E, Ghribi O. 2009. Differential effects of 24-hydroxycholesterol and 27-hydroxycholesterol on beta-amyloid precursor protein levels and processing in human neuroblastoma SH-SY5Y cells. Mol Neurodegeneration 4:1.

Rohde C, Chiang A, Adipoju O. Casper D, Pilla AA. 2010. Effects of Pulsed Electromagnetic Fields on Interleukin-1 beta and Postoperative Pain: A Double-Blind, Placebo-Controlled, Pilot Study in Breast Reduction Patients. Plastic Reconstr Surgery 125:1620-1629.

Acc

epte

d A

rtic

le

16

Ryang We S, Koog YH, Jeong KI, Wi H. 2013. Effects of pulsed electromagnetic field on knee osteoarthritis: a systematic review. Rheumatology 52:815-824.

Saino E, Fassina L, Van Vlierberghe S, Avanzini MA, Dubruel P, Magenes G, Visai L, Benazzo F. 2011. Effects of electromagnetic stimulation on osteogenic differentiation of human mesenchymal stromal cells seeded onto gelatin cryogel. Int J Immunopath Pharmacol 24:1-6.

Salminen A, Kaarniranta K, Kauppinen A, Ojala J, Haapasalo A, Soininen H, Hiltunem M. 2013. Impaired autophagy and APP processing in Alzheimer's disease: The potential role of Beclin 1 interactome. Prog Neurobiol 106-107:33-54.

Sarkar S, Perlstein EO, Imarisio S, Pineau S, Cordenier A, Maglathlin RL, Webster JA, Lewis TA, O'Kane CJ, Schreiber SL, Rubinsztein DC. 2007. Small molecules enhance autophagy and reduce toxicity in Huntington's disease models. Nature Chem Biol 3:331-338.

Son JH, Shim JH, Kim KH, Ha JY, Han JY. 2012. Neuronal autophagy and neurodegenerative diseases. Exper Mol Medicine 44:89-98.

Vella MC, Choi EY, Lin SY, Reinert K, Slack FJ. 2004. The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3'UTR. Genes Dev 18:132-137.

Wong E, Cuervo AM. 2010. Autophagy gone awry in neurodegenerative diseases. Nature Neurosc 13:805-811.

Xu J, Wang Y, Tan X, Jing H. 2012. MicroRNAs in autophagy and their emerging roles in crosstalk with apoptosis. Autophagy 8:873-882.

Yu WH, Cuervo AM, Kumar A, Peterhoff CM, Schmidt SD, Lee JH, Mohan PS, Mercken M, Farmery MR, Tjernberg LO, Jiang Y, Duff K, Uchiyama Y, Näslund J, Mathews PM, Cataldo AM, Nixon RA. 2005. Macroautophagy - a novel beta-amyloid peptide-generating pathway activated in Alzheimer's disease. J Cell Biol 171:87-98.

Zhu H, Wu H, Liu X, Li B, Chen Y, Ren X, Liu CG, Yang JM. 2009. Regulation of autophagy by a beclin 1-targeted microRNA, miR-30a, in cancer cells. Autophagy 5:816-823.

Figure Legends

Fig. 1. Short-term viability, miR-30a and BECN1 expression after LF-EMF exposure in SH-SY5Y human neuroblastoma cells. (A) Short-term viability by MTT assay in SH-SY5Y cells exposed (dotted line) or not- (continuous line) to LF-EMF treatment for different times (1, 3, 6, 12 and 24 hours). Absorbance values were expressed as mean. (B) Cells were exposed to the same intervals of LF-EMF treatment and assayed for miR-30a expression by Real-time PCR. Relative expressions were obtained normalizing miR-30a expression levels to the respective β-actin (BACT) values and using the average of the untreated sample for each interval as an internal calibrator (CTR). The values are expressed as mean ± S.E.M. and compared to CTR. p<0.001 (**); p<0.005 (*), Tukey–Kramer multiple comparisons test, n=3. (C) miR-30a and (D) BECN1 relative expression quantification was performed subjecting SH-SY5Y cells to 1 hour LF-EMF exposition and immediately collecting the samples from the indicated post-treatment (p.t.) interval times (1, 6, 12, 24 and 48 hours). Results were normalized using BACT values and referred to the average of the untreated sample for each interval as an internal calibrator (CTR). The values are expressed as mean ± S.E.M. and compared to CTR. p<0.001 (**); p<0.005 (*), Tukey–Kramer multiple comparisons test, n=3. Fig. 2. LF-EMF treatment directly affects miR-30a and BECN1 expression levels in SH-SH5Y human neuroblastoma cells. (A) Real-time PCR relative expression of miR-30a was performed in SH-SY5Y cells transfected (grey bars) or not- (white bars) with two different concentrations of miR-30a precursor molecules (Pre-miR30a, at 1 and 10 nM) 48 hours before 1 hour LF-EMF exposure. Results were obtained following normalization to BACT values and using the untreated sample (CTR) as internal calibrator. The values are expressed as mean ± S.E.M.. p<0.001 (**), Tukey–Kramer multiple comparisons test, n=3. (B) BECN1 relative expression by Real-time PCR was performed in SH-SY5Y cells subjected (grey bars) or not- to

Acc

epte

d A

rtic

le

17

siBECN1 transfection, 48 hours before LF-EMF exposition. Cells were then exposed to 1 hour LF-EMF treatment. Results were obtained following normalization to BACT values and using the untreated sample (CTR) as internal calibrator. The values are expressed as mean ± S.E.M.. p<0.005 (*), Tukey–Kramer multiple comparisons test, n=3. Fig. 3. LC3B-GFP expression in human neuroblastoma SH-SY5Y cells exposed to LF-EMF. (A) SH-SY5Y cells were transduced or not- with Baculovirus LC3B-GFP or with the mutated LC3B(G120A)-GFP (LC3B*-GFP) expressing vectors. Rapamycin (1-10 µM) was added immediately after the transduction, while Chloroquine diphosphate (10 µM) was added only 2 hours before the end of the 24 hours p.t. Rapamycin-treated cells were not subjected to LF-EMF exposition. After 4 and 24 hours p.t, LC3B-GFP and LC3B*-GFP signals were monitored using an inverted fluorescence microscope (40X magnification). DIC phase contrast photographs (10X magnification) were showed in upper panels. (B) LC3B-GFP expression in SH-SY5Y cells exposed to 1 hour LF-EMF, in absence or presence of Chloroquine diphosphate (10 µM), as above reported, observed at 24 hours p.t (100X magnification). Bar=10 µm. Fig.4. Ultrastructural analysis in human neuroblastoma SH-SY5Y cells exposed to LF-EMF. SH-SY5Y cells (106) were grown at a 75% confluence and subjected or not- to 1 hour LF-EMF exposure. Untreated cells (A) and exposed cells were harvested following different p.t intervals (4-24-48 hours, respectively panels B,C,D), fixed and stained for ultrastructural visualization. Specimens were then observed with a Zeiss EM900 electron microscope. Magnifications are 7000X (A,B,C,D) and 12000X (B1). Arrows indicate large intracellular vesicles, likely autophagosomes; *indicates a phagophore (isolation membrane) assembly site (B,B1). Fig. 5. Autophagy-markers expression in human neuroblastoma SH-SY5Y cells exposed to 1 hour LF-EMF. (A) Immunoblotting expression of the autophagy-related proteins Beclin1, LC3B-II and Atg7 in SH-SY5Y cells. Cells were subjected to the specific 1 hour LF-EMF treatment, and the samples were collected after different p.t. interval times (6, 12, 24 and 48 hours). Molecular weights are in kDa. (B) Relative proteins expression using densitometric analyses (NIH Image software). Beclin1, LC3B-II and Atg7 relative values, expressed as mean ± S.E.M, were obtained as ratios with housekeeping proteins (α-tubulin and β-actin) and compared to mean untreated samples (CTR, white bars). p<0.001 (**); p<0.005 (*), Tukey–Kramer multiple comparisons test, n=7. Fig. 6. Short-term viability effects of LF-EMF protocols after Aβ1-40 peptide administration in human SH-SY5Y neuroblastoma cells. (A) Experimental scheme of the different LF-EMF protocols. SH-SY5Y cells were incubated or not- with Aβ1-40 peptide (1 µM) at t0 and after 12 hours of incubation, subjected to 1 to 4 (1E, 2E, 3E and 4E) repeated LF-EMF specific treatments of 1 hour each. After each treatment, cells were assayed in short-term viability by MTT at 24 and 48 hours p.t. (B) Combined effects of different LF-EMF protocols and Aβ1-40 peptide (1 µM) in SH-SY5Y short-term cell viability by MTT assays, immediately after LF-EMF treatments (t1, t2, t3 and t4) and at 24/48 hours p.t. (C) Effect of 1 hour LF-EMF treatment in SH-SY5Y cells on short-term viability (48 hours p.t.), after incubation with Aβ1-40 peptide (1 µM). Viability (Absorbance values) was assayed by MTT; each LF-EMF protocol (black bars, 1E, 2E, 3E and 4E) was compared to the corresponding untreated samples (white bars, 1C, 2C, 3C and 4C). p<0.005 (*) Tukey–Kramer multiple comparisons test, n=3. Fig. S1. miR-30a expression in human neuroblastoma and glioblastoma established cells. miR-30a relative expression was comparatively evaluated in human neuroblastoma- (SH-SY5Y and SK-N-SH) and in glioblastoma-derived (U87-MG and T98G) cells subjected (black bars) or not (white bars) to the specific LF-EMF exposure of 1 hour. Results were obtained following normalization to BACT values and using the untreated samples as internal calibrators. The values are expressed as mean ± S.E.M. p<0.001 (**), Tukey–Kramer multiple comparisons test, n=3. Fig. S2. Combined effects of different LF-EMF protocols and Aβ1-40 peptide on human neuroblastoma SH-SY5Y growing capabilities. DIC phase contrast photographs (10X magnification) were reported for each specific LF-EMF protocol (1E, 2E, 3E and 4E,) and compared to untreated samples. Cells were all incubated with 1 µM of Aβ1-40 peptide and analyzed after 48 hours p.t.

Acc

epte

d A

rtic

le

18

Fig. S3. Short-term viability effects of 3E LF-EMF protocol after administration of Aβ1-42 or combined Aβ1-

40+Aβ1-42 peptides in human SH-SY5Y neuroblastoma cells. (A) Effects of different 3E LF-EMF protocol and Aβ1-42 (2 µM) or Aβ1-40/1-42 peptide (1 µM each) in SH-SY5Y short-term cell viability by MTT assays, immediately after LF-EMF treatments (at t3 interval) and at 24/48 hours p.t. (B) Cell viability percentages were assayed by MTT at 48 hours at t3 interval (see Fig.6A); each peptide treatment (Aβ1-40 see corresponding results in Fig.6 B,C; Aβ1-42, 2 µM; Aβ1-42+Aβ1-42, 1 µM each; black bars) subjected to LF-EMF 3E protocol was compared to the corresponding untreated samples, not subjected to the same LF-EMF exposure (white bars). p<0.005 (*) Tukey–Kramer multiple comparisons test, n=3.

Acc

epte

d A

rtic

le

19

Fig1 .

Acc

epte

d A

rtic

le

20

fig2 .

Acc

epte

d A

rtic

le

21

fig3 .

Acc

epte

d A

rtic

le

22

Fig 4tiff .

Acc

epte

d A

rtic

le

23

Fig5new .

Acc

epte

d A

rtic

le

24

Fig6new .