Article

Reference

Antibiotic resistant bacteria/genes dissemination in lacustrine

sediments highly increased following cultural eutrophication of Lake

Geneva (Switzerland)

THEVENON, Florian, et al.

Abstract

This study investigates faecal indicator bacteria (FIB), multiple antibiotic resistant (MAR), and

antibiotic resistance genes (ARGs), of sediment profiles from different parts of Lake Geneva

(Switzerland) over the last decades. MARs consist to expose culturable Escherichia coli (EC)

and Enterococcus (ENT) to mixed five antibiotics including Ampicillin, Tetracycline,

Amoxicillin, Chloramphenicol and Erythromycin. Cultureindependent is performed to assess

the distribution of ARGs responsible for, b-lactams (blaTEM; Amoxicillin/Ampicillin),

Streptomycin/Spectinomycin (aadA), Tetracycline (tet) Chloramphenicol (cmlA) and

Vancomycin (van). Bacterial cultures reveal that in the sediments deposited following

eutrophication of Lake Geneva in the 1970s, the percentage of MARs to five antibiotics varied

from 0.12% to 4.6% and 0.016% to 11.6% of total culturable EC and ENT, respectively. In

these organic-rich bacteria-contaminated sediments, the blaTEM resistant of FIB varied from

22% to 48% and 16% to 37% for EC and ENT respectively, whereas the positive PCR assays

responsible for tested ARGs were observed for EC, ENT, and total [...]

THEVENON, Florian, et al. Antibiotic resistant bacteria/genes dissemination in lacustrine

sediments highly increased following cultural eutrophication of Lake Geneva (Switzerland).

Chemosphere, 2012, vol. 86, no. 5, p. 468-476

DOI : 10.1016/j.chemosphere.2011.09.048

Available at:

http://archive-ouverte.unige.ch/unige:18100

Disclaimer: layout of this document may differ from the published version.

1 / 1

Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highlyincreased following cultural eutrophication of Lake Geneva (Switzerland)

Florian Thevenon a, Thierry Adatte b, Walter Wildi a, John Poté a,⇑a Institute F.-A. Forel, University of Geneva, Versoix, Switzerlandb Institute of Geology and Palaeontology, University of Lausanne, Lausanne, Switzerland

a r t i c l e i n f o

Article history:Received 20 June 2011Received in revised form 6 September 2011Accepted 13 September 2011Available online xxxx

Keywords:Lake GenevaSedimentsEutrophicationFaecal indicator bacteriaAntibiotic resistanceAntibiotic resistance genes

a b s t r a c t

This study investigates faecal indicator bacteria (FIB), multiple antibiotic resistant (MAR), and antibioticresistance genes (ARGs), of sediment profiles from different parts of Lake Geneva (Switzerland) over thelast decades. MARs consist to expose culturable Escherichia coli (EC) and Enterococcus (ENT) to mixed fiveantibiotics including Ampicillin, Tetracycline, Amoxicillin, Chloramphenicol and Erythromycin. Culture-independent is performed to assess the distribution of ARGs responsible for, b-lactams (blaTEM;Amoxicillin/Ampicillin), Streptomycin/Spectinomycin (aadA), Tetracycline (tet) Chloramphenicol (cmlA)and Vancomycin (van). Bacterial cultures reveal that in the sediments deposited following eutrophicationof Lake Geneva in the 1970s, the percentage of MARs to five antibiotics varied from 0.12% to 4.6% and0.016% to 11.6% of total culturable EC and ENT, respectively. In these organic-rich bacteria-contaminatedsediments, the blaTEM resistant of FIB varied from 22% to 48% and 16% to 37% for EC and ENT respectively,whereas the positive PCR assays responsible for tested ARGs were observed for EC, ENT, and total DNAfrom all samples. The aadA resistance gene was amplified for all the sediment samples, including thosenot influenced by WWTP effluent water. Our results demonstrate that bacteria MARs and ARGs highlyincreased in the sediments contaminated with WWTP effluent following the cultural eutrophication ofLake Geneva. Hence, the human-induced changing limnological conditions highly enhanced the sedimentmicrobial activity, and therein the spreading of antibiotic resistant bacteria and genes in this aquaticenvironment used to supply drinking water in a highly populated area. Furthermore, the presence ofthe antibiotic resistance gene aadA in all the studied samples points out a regional dissemination of thisemerging contaminant in freshwater sediments since at least the late nineteenth century.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

The spreading of anthropogenic pollutants in freshwaterecosystems is essentially due to the input of untreated or partlytreated wastewaters including industrial, agricultural and domesticeffluents. The increasing contamination of sediments by inorganicand organic micro-pollutants including antibiotics, heavy metals,hydrophobic organic compounds such as polycyclic aromatichydrocarbons (PAHs), polychlorinated biphenyls (PCBs), andorganochlorine pesticides, is a big concern for modern aquaticecosystems (Förstner and Wittmann, 1979; Pardos et al., 2004;Schwarzenbach et al., 2006; Martinez, 2008). According to thebiotic and abiotic sediment parameters, these contaminants canaccumulate or be remobilized from sediments into the water col-umn, causing potential irreversible adverse effects to ecosystemsand human health. The remobilization of these contaminants andtheir return to the hydrosphere and food chain occur either by

sediment re-suspension, microbial metabolism, or by infiltrationinto the groundwater. In this context, contaminated sedimentscan constitute a secondary source of pollution, so that the accumu-lation and re-suspension of contaminants should be examinedextensively (Wildi et al., 2004).

The extensive use of a wide variety of antibiotics in largeamounts, including non-biodegradable antibiotics useful in humanmedicine, contaminates aquatic environments and exerts a selec-tive pressure for long periods of time (Cabello, 2006). The high con-centration of antibiotics found in water, sediments, and soils, canbe the consequence of human-induced shifts in the original func-tions of antimicrobial resistance elements used in hospitals andfarms for their shield roles (Martinez, 2008). The residual antibiot-ics therein release into the environment can potentially exert aselection pressure on microorganisms (Pruden et al., 2006). Sincethe antibiotics can challenge microbial populations, they must beconsidered as important and hazardous pollutants into the envi-ronment (Martinez, 2009). Many studies discussed the origin andthe consequences of the presence of the bacteria (including FIB)antibiotic-resistant in aquatic environment (Vilanova et al., 2004;

0045-6535/$ - see front matter � 2011 Elsevier Ltd. All rights reserved.doi:10.1016/j.chemosphere.2011.09.048

⇑ Corresponding author. Tel.: +41 22 379 03 21; fax: +41 22 379 03 29.E-mail address: john.pote@unige.ch (J. Poté).

Chemosphere xxx (2011) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Chemosphere

journal homepage: www.elsevier .com/locate /chemosphere

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

Kümmerer, 2009). It has been demonstrated that the Bacteriaantibiotic resistant in aquatic environment can be the results ofcontamination by anthropogenic sources including runoff fromagricultural areas and untreated or partly treated urban WWTPeffluent water (Wright, 2010). Bacteria can survive longer insediments than in the water column since sediments providefavourable nutrient conditions (Haller et al., 2009a). Consequently,the presence of FIB and antibiotic-resistant bacteria in watercolumn and sediment may affect water quality and contribute tohorizontal gene transfer (HGT) between bacteria as well as wide-spread dissemination of antibiotic-resistant genes. Although thespreading of antibiotics in the environment is well documented,numerous questions remain about: (i) the role that natural envi-ronments play in the maintenance and dispersion of antibioticresistance genes, (ii) the frequency with which these genes areexchanged among indigenous bacteria, and (iii) whether antibioticresistance genes can spread from these commensal strains toclinical isolates.

Lake Geneva is the largest freshwater reservoir in WesternEurope, with a volume of 89 km3 and a maximum depth of309 m. The lake was considered eutrophic in the 1970s and has be-come mesotrophic in the 1980s after a drastic reduction of phos-phorus inputs (Dorioz et al., 1998). Approximately 700000people are supplied with water from Lake Geneva. The city of Lau-sanne, located on the northern shore, discharges the largest vol-ume of treated wastewater into the nearby Bay of Vidy (Fig. 1).The municipal wastewater treatment plant (WWTP) was built in1964 for 220000 eq.-inhabitants. Although the WWTP was ex-panded in 1976, its effluents were still being discharged at a dis-tance of about 300 m from the lakeshore (at 15 m water depth).The outlet pipe was eventually extended in 2001 to a distance of700 m from the shore, at 35 m water depth (Fig. 1). Meanwhile,the Vidy Bay is the most contaminated area of Lake Geneva.

Previous data document the accumulation of contaminants insediments close to a recreational area on the bay’s shoreline, aswell as significant related ecological impacts and health risks(Loizeau et al., 2004; Pardos et al., 2004; Wildi et al., 2004). Severalstudies have already focused on the physicochemical characteris-tics of surface sediments of Vidy Bay, and on the spatial distribu-tion of OM, faecal indicator bacteria, heavy metals, andhydrophobic organic compounds (Poté et al., 2008; Haller et al.,2009a). In analogy to marine sediments, recent investigations infreshwater lakes have established sampling procedures for assess-ing in situ microbial activity (Vuillemin et al., 2010; Thevenon et al.,2011). Vuillemin et al., 2010) successfully applied this approach toidentify living microbes in lake sediments as deep as 50 m. Recentstudies also investigated the occurrence and fate of micro-pollutants (e.g., hormones) in the Vidy Bay (Morasch et al., 2010;Perazzolo et al., 2010; Margot et al., 2011; Bonvin et al., 2011).These studies demonstrated the presence of a large abundance ofpharmaceuticals and antibiotics in different concentration inWWTP effluent and water column in the bay. However, there isstill a lack of crucial information about the impacts of chemicalpollutants (such as heavy metals and antibiotics) on bacterialcommunities, and the impact of (past) wastewater emissions.

The aims of this study are (i) to evaluate the isolated FIB includ-ing E. coli and Enterococcus multiple antibiotic resistant (MAR), and(ii) to test the presence and distribution of antibiotic resistancegenes (ARGs) in contaminated and unpolluted sediment profilesof Lake Geneva. This research is based on a combination of cul-ture-dependent and -independent approaches in order to deter-mine the actual state of dissemination of antibiotic-genes in FIBand total bacteria in sediment records from the most contaminatedarea of Lake Geneva. Studying these sediments allow to address thepotential impact of emergence of bacteria-resistant strains fromWWTP to freshwater sediment microbes.

Fig. 1. Map of Lake Geneva (centre) with a zoom on the two sample sites: The Bay of Vidy (bottom left insert) with the position of cores V4 and V7 (filled circles) close to the1964 and 2001 outlet pipes (open circles) of the wastewater treatment plant discharge (WWTP), and the Creux de Genthod region (bottom right insert) with the position ofcore G1. The position of core C2 retrieved from the deepest part of the lake (about 300 m depth).

2 F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

2. Materials and methods

2.1. Study sites and sampling procedure

The boat ‘‘La Licorne’’ of the Institute F.-A. Forel was used forretrieving sediment cores (Fig. 1): (i) in the Bay of Vidy, near thepresent WWTP outlet pipe discharge: core V4 (60 m water-depth,62 cm-length, Swiss coordinates X: 534682, Y = 151410, distanceto coast �715 m); and in between the two outlet pipes: core V7(35 m water-depth, 38 cm-length, Swiss coordinates X: 534670,Y = 151570, distance to coast �570 m); (ii) in the Creux de Gen-thod region at 50 m water-depth (core G1, 60 cm-length, Swisscoordinates X: 502613, Y: 122938, distance to coast �1000).Although the Creux-de-Genthod region of Lake Geneva is a coastalarea, the level of (in)organic pollution is almost equivalent to theone recovered in the deepest (�300 m depth) and remote part ofLake Geneva (see position of core C2 on Fig. 1; Thevenon et al.,2011), so that the Creux de Genthod site is considered WWTP pol-lution free.

After their collection, the cores were brought to the Institute F.-A. Forel, opened, and sliced into 2 cm thick sections. For microbio-logical analysis, the sediment samples were placed in sterile plasticcontainers (stored in an icebox) and treated in the laboratory with-in 24 h. For chemical analysis, the sediment samples were frozen,freeze-dried and ground into a fine powder.

2.2. Sediment physicochemical analysis and sediment core chronology

2.2.1. Physicochemical analyses2.2.1.1. Total phosphorus (P). Total phosphorus analyses were per-formed on ca. 100 mg of dry powdered sediment, mixed with1 mL of MgNO3 and left to dry in an oven at 45 �C for 2 h. The sam-ples were then heated in a furnace at 550 �C during 2 h. After cool-ing, 10 mL of 1 N HCl were added and placed under constantshaking for 14 h. The solutions were filtered with a 63-lm filter,diluted 10 times, and analysed using the ascorbic acid method.For this process, the solution was mixed with ammonium molyb-date and potassium antimonyl tartrate to form phosphomolybdicacid. The intensity of the blue colour of this acid measured (threetimes with a precision better than 5%) with a photospectrometer(Perkin Elmer UV/Vis Photospectrometer Lambda 10) was finallyconverted to the concentration of PO4 in mg L�1.

2.2.1.2. Total nitrogen (N). Total nitrogen concentration (%N) wasanalysed using an elemental analyser (Carlo Erba Flash EA 1112CHNS/MAS200) on about 10 mg of dry powdered sediment. Thecarbon/nitrogen (C/N) ratio was calculated as the weight ratio ofthe organic carbon measured by the Rock Eval pyrolysis (see be-low) and the N content analysed by elemental gaschromatography.

2.2.1.3. Total organic (Corg) and mineral (Cmin) carbon analyses. Totalorganic (Corg) and mineral (Cmin) carbon contents were determinedusing Rock–Eval pyrolysis (Espitalié et al., 1985; Lafargue et al.,1996) with a Model 6 device (Vinci Technologies) and the standardIFP 160000. The analyses were carried out on 50–100 mg of pow-dered dry sediment under standard conditions. During Rock–Evalpyrolysis ca. 150–100 mg of ground and homogenized sample issubject to a pyrolysis step followed by the complete oxidation ofthe residual sample. A FID detector measures the hydrocarbon re-leased during pyrolysis, while CO2 and CO are detected by infraredabsorbance. Pyrolysis starts isothermally at 300 �C for 3 min, afterwhich the sample is heated to 650 �C. The oxidation step starts iso-thermally at 400 �C (3 min) and then heats up to 850 �C. Peaks of CO2

released during pyrolysis and oxidation of samples are used to calcu-

late the amount of total organic carbon (Corg) and the amount of min-eral carbon (Cmin). Mean error measurements are about 5%.

2.2.1.4. Laser granulometry. The particle grain size was measuredwith a laser Coulter� LS-100 diffractometer (Beckman Coulter, Ful-lerton, CA, USA), after removing the labile organic fraction of ca.0.5 g of dried non-crushed sediment with hydrogen peroxide(33% H2O2) for ultrasonic dispersion during 5 min. The grain sizeanalysis provides a size distribution by volume of equivalentspheres, and the grain size analysis results are reported as themean over the volume distribution for representing the grain sizedistribution.

2.2.1.5. Advanced mercury analysis (AMA). Total mercury (Hg) wasdetermined by cold vapour atomic absorption spectrometry afterthermal decomposition of the sample using an automatic solidanalyser (Altec�, model Advanced Mercury Analyser; AMA-254, Al-tec s.r.l., Czech Rep.). The detection limit (3 SD blank) was0.005 mg g�1 and the reproducibility better than 5%. The accuracyof the determination for Hg concentrations was estimated usingBEST-1 (National research Council Canada); the repeated analysesnever exceeded the published concentration ranges(0.092 ± 0.009 mg g�1).

2.2.2. ChronostratigraphyThe chronostratigraphy of core V4 is based on a continuous

high-resolution (every cm) sedimentary record of cesium (137Cs)obtained from a former core taken at the same location than V4(core Vs 14 in Glass-Haller, 2010). Fig. 2 presents this Cs profilewhich evidences the maximum atmospheric radionuclide falloutof 1963/1964 (coinciding with the WWTP operating) at 44 cm coredepth. One radiocarbon (14C) date (sample number, ETH-41999)performed on a small piece of wood founded at 60 cm in core V4(62 cm core long) yields a radiocarbon age of 175 ± 40 y BP (beforepresent = 1950). Calibration using OxCal v3.10 program (Bronk-Ramsey, 2001) gives a calendar age of 1765 ± 45, so that the lower-most sediments of core V4 deposited before the impact of theindustrial revolution of the late 19th century. Similarly, the Cs pro-file of the core from the Creux de Genthod (core G1) locates themaximum radionuclide fallout from atmospheric nuclear tests(1963/1964) about 18 cm core depth (Thevenon et al., 2011), so thatthe lowermost sediments investigated here (44 cm core depth)deposited before the excessive industrial pollution of the late19th century. Anthropogenic Cs was not measured on the 38 cmlong core taken in the Vidy Bay (core V7), because this sequencedoes not recover the pre-WWTP sediments deposited before 1964.

2.3. Faecal Indicator bacteria (FIB) isolation and multiple antibioticresistant (MAR) tests

The FIB including EC and ENT were isolate from sediment sam-ples using the method previously describe by Balkwill and Ghiorse(1985) and modified by Haller et al. (2009b). Briefly, the sedimentswere resuspended by adding 100 g (wet weight) of sediment to500 mL of 0.2% Na6(PO3)6 (E. Lotti S.A, Switzerland) in 1 L sterileplastic bottles, and mixed for 30 min using an agitator rotary print-ing press Watson–Marlow 601 controller (Skan, Switzerland). Themixture was centrifuged at 4000 rpm for 15 min at 15 �C. The sus-pension was used for EC and ENT antibiotic susceptibility tests. Toenumerate EC and ENT multiple antibiotic resistant (MAR), appro-priate dilutions of sediment suspension were spread into appropri-ate mediums alone and supplemented with various antibioticsolutions. The concentration of antibiotics (greater than minimuminhibitory concentration) and MAR percentage were estimated asdescribed in the literature (Andrews, 2001; Choi et al., 2003; Sáenzet al., 2004; Demanèche et al., 2008). To summarise, 50 mL of each

F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx 3

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

sediment suspension was filtered through a 0.45 lm membrane(47 mm diameter, Millipores, Bedford, USA), which was placed ondifferent FIB culture media, supplemented with the anti-fungalcompound Nystatin (Sigma–Aldrich, Gmbh, Germany) at final con-centration of 100 lg mL�1 (Haller et al., 2009b). The membraneswere positioned on the corresponding culture medium either freeof antibiotics or containing the mixture of the following antibiot-ics: Ampicillin, Tetracycline, Amoxicillin, Chloramphenicol andErythromycin (Sigma, USA); with each antibiotic at the final con-centration of 20 lg mL�1 and 2 lg mL�1 for EC and ENT MAR testrespectively. For EC and ENT only b-lactame resistant analysis,the concentration of mixture for both Amoxicillin and Ampicillinwas 100 lg mL�1.

The incubation conditions were as follows (all medium fromBiolife, Italiana): (i) for EC, TSA (tryptone soy agar medium) incu-bated 4 h at 30 �C and transferred on TBX (tryptone bile x-glucuro-nide medium) for 24 h at 44 �C, (ii) for ENT, SBA (Slanetz Bartleyagar medium) incubated for 48 h at 44 �C, and transferred onBAA (Bile Aesculin agar medium) for 4 h at 44 �C. The results areexpressed as colony forming units (CFU) per 100 g of dry sediments(CFU 100 g�1). The reproducibility of the whole analytical proce-dure was tested by triplicates of selected sediment samples whichrevealed a mean variation coefficient of 13% for EC and 8% for ENT.

2.4. DNA extraction and PCR assays for detection of resistance genes

Total DNA from sediment samples was extracted using Ultra-clean soil DNA Kit (Mo Bio Labs, Solana Beach, CA 92075) according

to the manufacturer’s recommendations. The procedure consistson several steps including a bead-beating, cell lyses, and DNA puri-fication. The purification and measurement of concentration of ex-tracted DNA were performed as described by Poté et al. (2003)Garcia-Bravo et al. (2010). The isolated DNA was used as a tem-plate for qualitative PCR assays to assess the presence of resistancegenes responsible for Vancomycin (van), b-lactames gene (blaTEM;Amoxicillin/Ampicillin), Streptomycin/Spectinomycin (aadA), Tet-racycline (tet) and Chloramphenicol (cmlA), according to the PCRconditions developed by the studies referred to Table 1.

For FIB, the qualitative PCR assays for the detection of the resis-tance genes were performed directly in the isolated colonies fromthe medium free of antibiotics. Before PCR amplification, the colo-nies were resuspended in 20 lL of sterile water. The primer de-signs, references and sizes of amplified fragments are listed inTable 1.

3. Results

3.1. Physicochemical parameters

The geochemical parameters and the grain size distribution ofcores V4 and V7 are reported on Fig. 2 as a function of sedimentcore depth. The mean grain size of core V4, ranging from 6 to22 lm, shows a clear increase above 40 cm due to the WWTPimplementation in 1964 (1963/1964 peak of 137Cs at 44 cm) anda maximum value at 28 cm depth.

60

50

40

30

20

10

0

0 40 80 120 160

0 4 8 12

0 0.5 1 1.5

5 10 15 20 25 0.1 1 10

4 6 8 10 122 2.4 2.8 3.2 3.6

10 15 20 25 30

Dep

th (c

m)

137Cs (Bq kg-1)

% Corg

% N

P (mg g-1)

C/N

WWTP: 1964

Hg (µg g-1)

14C: 1765 ± 45

Coring: 2010

% Cmin

Eutrophicationin the 1970-80s

Mean grain size (µm)

V7V4

Fig. 2. 137Cs profile from core Vs 14 (data from Glass-Haller, 2010) and the physicochemial parameters results of core V4 (and of core V7 in dashed lines): mean grain size,mineral (% Cmin) and organic (% Corg) carbon contents, nitrogen concentration (% N), phosphorus content (P), C/N ratio, and mercury concentration (Hg), expressed as afunction of depth in cm.

Table 1Primer for resistance genes in Esherichia Coli, Enterococcus and total DNA extracted from sediment samples used in this study.

Primers Target Size (bp) of PCRproduct

Sequence (50–30) Annealing T�(�C)

Reference

vanAF vanAR Vancomycin/Teicoplanin generesistant

732 GGGAAAACGACAATTGCGTACAATGCGGCCGTTA

54 Dutka-Malen et al.(1995)

vanBF vanBR Vancomycin gene resistant 635 ATGGGAAGCCGATAGTCGATTTCGTTCCTCGACC

54 Dutka-Malen et al.(1995)

Bla TEM-F TEM-R Amoxicillin/Ampicillin/b-lactamesgene resistant

1150 ATTCTTGAAGACGAAAGGGCACGCTCAGTGGAACGAAAAC

60 Belaaouaj et al.(1994)

aadA-F aadA-R Streptomycin/Spectinomycin generesistant

282 GCAGCGCAATGACATTCTTGATCCTTCGGCGCGATTTTG

60 Madsen et al.(2000)

tetA-F tetA-R Tetracyclin gene resistant 937 GTAATTCTGAGCACTGTCGCCTGCCTGGACAACATTGCTT

62 Guardabassi et al.(2000)

cmlA-F cmlA-R Chloramphenicol gene resistant 455 TGTCATTTACGGCATACTCGATCAGGCATCCCATTCCCAT

55 Sáenz et al. (2004)

4 F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

The organic compounds (Corg, N, and P) show a similar patternof variation, with (i) the lowest concentrations for the lowermostsediments (preindustrial period), (ii) increasing values after thebeginning of the STP discharges (in 1964), and (iii) values that dou-bled between 24 and 18 cm (during the 1970s; see below).

Preindustrial sediments deposited at 60 cm core depth in theVidy Bay (core V4, Fig. 2) exhibit C/N ratio of 4, indicating that phy-toplankton, which is the major source of autochtonous OM in lakes,dominates before the waste sediment discharge in the Vidy Bay. Bycontrast, increasing C/N ratio (>6) above 52 cm likely indicates ahigher contribution of terrestrial input; whereas the abrupt raise(C/N ratio > 8) above 42 cm certainly indicates a change of OMsource following the release of treated wastewater into the bayafter 1964 (Fig. 2).

The Cmin record of core V4 (Fig. 2) suggests that the WWTPeffluent did not significantly modified the inorganic carbon deposi-tion and preservation in the Vidy Bay. By contrast, a major drop oc-curs above 24 cm, with minimum values between 22 and 14 cm(about 2%).

The Hg profile of core V4 shows a sustained increase from 62 to44 cm, with values ranging from about 0.1 to 1.7 lg g�1. This pat-tern is typical of the long-term industrial pollution signal regis-tered in the deepwater sites of Lake Geneva during the late-19th

century (cores C2 and G1, Fig. 1; Thevenon et al., 2011). However,by opposition to the remote and deepwater sites, the Hg pollutionin the Vidy Bay did not drop following the WWTPs implementationin the late 1960s, pointing out the local pollution of the bay due tothe Vidy WWTP emissions. Moreover the inferred sedimentationrate after the STP implementation in the Vidy Bay (�1 cm y�1) ismuch higher than the former sedimentation rate at the slope ofthe study area (�0.1 cm y�1), pointing out the high accumulationof anthropogenic heavy metal into the Vidy Bay. In fact, the con-centration of organic and inorganic pollutants deposited into theVidy Bay is inversely related to the distance from the WWTP outletpipe discharge location (V7 > V4), as demonstrated by the maxi-mum Hg (�10 lg g�1) and P (�20 mg g�1) concentrations recov-ered close to the outlet pipe (core V4, Fig. 2).

3.2. Isolated strains and prevalence of multi antibiotic resistant faecalindicator bacteria

The distribution of MAR in culturable EC and ENT of core V4 isreported in Table 2 and in Fig. 3 as a function of sediment-depth.The highest values of isolated strain of EC and ENT are observedafter ca. 1970 (ca. 24 cm) in the sediments deposited at about500 m from the outlet pipe of the WWTP (core V4, Fig. 1). The max-

Table 2Distribution of Escherichia coli and Enterococcus isolated strains and percentage of multiple antibiotic and b-lactames resistant tests in sediment from V4⁄.

Depth(cm)

EC isolate strains (CFU � 106)100 g�1

EC MAR(%)

b-lactames EC resistant(%)

ENT isolate strains (CFU � 105)100 g�1

ENT MAR(%)

b-lactames ENT resistant(%)

2 24.1 2.32 24.62 89.8 0 21.834 17.3 1.65 28.74 63.4 0.016 26.746 21.2 2.41 48.22 77.7 0.04 36.828 28.4 3.03 41.71 59.2 0.13 33.61

10 12.8 0.14 21.94 46.8 0 15.9212 22.2 1.24 ⁄⁄ 69.4 0.017 ⁄⁄

14 14.7 3.93 ⁄⁄ 37.7 0 ⁄⁄

16 18.2 0.82 ⁄⁄ 89.8 0 ⁄⁄

18 15.2 3.26 ⁄⁄ 42.9 0 ⁄⁄

20 35.2 0.12 ⁄⁄ 43.5 0 ⁄⁄

22 0.24 0 ⁄⁄ 0.45 0 ⁄⁄

24 1.6 0.36 ⁄⁄ 0.97 11.9 ⁄⁄

40 0.001 0 ⁄⁄ 0.0032 0 ⁄⁄

50 0.0002 0 ⁄⁄ 0.011 0 ⁄⁄

⁄The reproducibility of the whole analytical procedure was tested by triplicates of selected sediment samples which revealed a mean variation coefficient of 13% for EC and 8%for ENT.⁄⁄Analysis not performed.

60

50

40

30

20

10

00.0 2.0x107 4.0x107 0 1 2 3 4 0 4 8 122 2.4 2.8 3.2 0.0 8.0x106

0.0 4.0x105 8.0x105 0 80000 4 8 120 20 40 60 80100

Dep

th (c

m)

EC Strains % MRA EC ENT strains % MRA ENT

Resistant ENTResistant ECP (mg g-1)

% Cmin

WWTP: 1964

14C: 1765 ± 45

Coring: 2010

Eutrophicationin the 1970s

% grain size classes(<4 , <32, >32 µm)

Fig. 3. Grain size classes, mineral carbon (% Cmin), and phosphorus (P) concentrations, isolated Escherichia Coli and enterococcus strains (CFU g�1 dry sediments), EscherichiaColi and enterococcus multiple resistant antibiotic (% MRA) expressed as a function of depth in cm of core V4.

F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx 5

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

imum values of recovered strains are 35.2 � 106 and 9.0 �106 CFU 100 g�1 dry sediment respectively for EC and ENT. Beforeca. 1970, the FIB values vary between 0–8.9 � 103 and 0–4.2 � 102 CFU 100 g�1 dry sediment for EC and ENT, respectively.The percentage of MAR bacteria significantly varies with time(P < 0.05). The percentage of EC MAR varies from 0.12% to 4.6%after ca. 1970. The maximum value of ENT MAR (11.9%) occurs at24 cm depth (eutrophication of the lake, see the discussion part).It is meaningful to note that no MAR is observed for both EC andENT before 1970, while sewage sediment accumulates in the baysince 1964. Moreover, the first peak of resistance for both EC andENT observed at 24 cm sediment core depth is synchronous withthe abrupt rise in nutrient content (P on Fig. 3). In this specific hori-zon, the percentage of resistant FIB to b-lactame (Amoxicillin/Ampicillin) is higher than % MARs and varies from 22% to 48%and 16% to 37% for EC and ENT respectively.

3.3. PCR assays for detection of resistance genes

The qualitative PCR assays were used to assess the presence ofresistance genes including blaTEM, aadA, tet, cmlA and van resis-tance genes in both isolated colonies (EC and ENT) and in totalDNA extracted from sediment samples. The results are summarisedin Table 3. Positive PCR indicates the presence of resistance genesresponsible for blaTEM, aadA, tetA and cmlA in the isolated coloniesof EC and ENT and total DNA in all sediment samples from core V4.Concerning core V7, the positive PCR was more remarkable in theupper sediment samples (the upper 20 cm core depth). The vanresistance gene was observed in total DNA and ENT isolates fromV4 and V7. The aadA resistance gene is present in total DNA ex-tracted from all sediment samples including preindustrial samples(bottom of cores V4 and G1).

4. Discussion

4.1. (In)organic pollution

Major changes can be inferred from the physicochemical studyof core V4, located in the Bay of Vidy at ca. 500 m from the muni-

cipal WWTP outlet. Indeed, this well-dated 62-cm long-core notonly registered the regional heavy metal pollution related to theindustrial revolution during the late 19th century (steady increaseof Hg on Fig. 2), but also the local (in)organic pollution linked to theWWTP implementation in 1964. The grain size distribution (Fig. 2and 3) indicates that larger mineral particles deposited within thewastewater arising from the Vidy WWTP. Although the Cmin con-tent seems to be the only proxy not being affected by the wastewa-ter discharge after 1964, this parameter shows an abrupt dropsynchronous to the high increase of the organic parameters around24 cm (Fig. 2). At the same time, C/N ratio only slightly variesaround 9, identifying sediments enriched by sewage-derived OM(Andrews et al., 1998; Ruiz-Fernandez et al., 2003) but ruling outa significant change in OM source at that time. Therefore, the greatincrease in the nutrient content that is simultaneous to the drop inthe Cmin preservation (Fig. 3) likely indicates changing limnologicalconditions in response to cultural eutrophication in the 1970s (an-oxic conditions and carbonates dissolution). Cultural eutrophica-tion that affected Lake Geneva in the 1970s due to increasednutrient supply and poor mixing of the hypolimnion highly in-creased the bacterial activity in the deepwater and coastal sites(Thevenon et al., 2011).

4.2. Multi antibiotic resistant FIB in sediment

The influence of multiple antibiotic resistances on bacterialpopulation can be observed in sediments influenced by WWTPeffluent water, because of the accumulation of several antibioticsand antibiotic resistance genes in sediments (Kümmerer, 2004;Akiyama and Savin, 2010). The traditional approach for determina-tion of EC and ENT antibiotics resistant in sediments consists toisolate and expose the bacteria to mixture of antibiotic solutions.In this study, the levels of EC and ENT MAR in sediments weredetermined by exposing the culturable bacteria to the platesamended with five antibiotics (including Ampicillin, Tetracycline,Amoxicillin, Chloramphenicol and Erythromycin) and to the b-lac-tame family, in order to test the influence of multiple antibioticconcentrations on the grown of FIB. The maximum values of ECMAR exposed to five antibiotics and b-lactame family are 4.6%

Table 3PCR presence/absence assays of various antibiotic resistance genes for Escherichia Coli, Enterococcus and total DNA from sediment samples.

Sampling sites Depth (cm) blaTEM aadA tetA cmlA vacA

EC ENT Total DNA EC ENT Total DNA Total DNA Total DNA ENT Total DNA

V4 2 + + + + + + + + + +4 + + + + + + + + + +8 + � + + + + + + + +

10 + + + + + + + + + +20 + + + + + + + + + +22 + + + + + + + + + +24 + + + + + + + + + +40 + + + + + + + + + +50 + + + + + + + + + +

V7 2 ⁄ ⁄ + + ⁄ + + + + +8 ⁄ ⁄ + + ⁄ + + + + +

12 ⁄ ⁄ + + ⁄ + + + + +16 ⁄ ⁄ � + ⁄ + � � + +20 ⁄ ⁄ � + ⁄ + � � + +26 ⁄ ⁄ � + ⁄ + � + + +32 ⁄ ⁄ � + ⁄ + � + � �38 ⁄ ⁄ � + ⁄ + � + � �

G1 2 ⁄ ⁄ � ⁄ ⁄ + � ⁄ � �6 ⁄ ⁄ � ⁄ ⁄ + � ⁄ � �

20 ⁄ ⁄ � ⁄ ⁄ + � ⁄ � �30 ⁄ ⁄ � ⁄ ⁄ + � ⁄ � �44 ⁄ ⁄ � ⁄ ⁄ + � ⁄ � �

+: positive PCR, �: negative PCR, ⁄: analysis no performed.

6 F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

and 48.2%, respectively. For ENT, the maximum values exposed tofive antibiotics and b-lactame family are 11.9% and 36.8%, respec-tively. In both cases, the results show the variations in levels ofEC and ENT MAR through the sediment profile of core V4 (Table2, Fig. 3): the FIB MAR and antibiotic resistant bacteria increasedramatically in sediment deposited after 1970 in the Vidy Bay. Sur-prisingly, it seems that the vertical distribution of EC and ENT in V4record (Fig. 3) does not evidence the WWTP influence after 1964,but rather the impact of the cultural eutrophication that affectedLake Geneva in the 1970s and early 1980s.

The FIB, including EC and ENT, are commonly used as indicatorsof pathogens in aquatic environment, and as model organisms fordetecting the occurrence of antibiotics in both human and domes-tic animal populations (Radimersky et al., 2010). Although the ENTcan persist more than EC in aquatic environment, these bacteriapreferentially accumulate in sediment than in water column(Poté et al., 2009; Haller et al., 2009a). In addition, many studieshave been performed to monitor the source of faecal pollutionusing antibiotic resistance analysis of FIB isolated strains (Burnes,2003; Choi et al., 2003). It has been showed that antibiotic resis-tance pattern methods of EC and ENT are relatively simple andinexpensive methods that are valuable to determine the sourcesof faecal contamination and to improve the freshwater quality.Interestingly, our study shows that the sediments deposited after1970 in the Vidy Bay present the higher levels of FIB MAR, withmaximum values of 8.6 � 105 and 11.6 � 103 CFU 100 g�1 for ECand ENT, respectively. Such data, which contrast with the oldersamples from V4 and G1 (before the effect of WWTP effluentwater), prove that the municipal WWTP and the trophic state ofthe lake have considerable effects on FIB abundance and on the dis-semination of multi-antibiotic resistant genes in freshwater sedi-ments. Moreover, the contaminated sediments of the Bay of Vidyconstitute a reserve of FIB and FIB MAR which persist in certainareas of the bay. The possible resuspension of FIB and FIB MARcan therefore affect the water quality and can increase health risksto leaving organisms and populations during recreationalactivities.

4.3. Antibiotic resistance genes

Because the cultivable bacteria represent less than 5% of totalbacteria in the sediment of Lake Geneva (Poté et al., 2010; Theve-non et al., 2011), the presence of genes in the bacterial communitywas further investigated by a culture-dependent (for EC and ENTisolated strains) and -independent strategy. The PCR presence/ab-sence assay was conducted on the isolated strains and totalmetagenomic DNA. The presence of many tested resistance geneswas observed in many sediments samples (Table 3), indicating thatsediment bacteria community acquired some resistance genes thatare probably mainly due to human activities as well as throughhorizontal gene transfer (HGT) between bacteria. It has been dem-onstrated that HGT is a major mechanism for sharing ARGs be-tween bacteria, occurring between nonpathogens, pathogens, andeven distantly related organisms such as Gram-positive andGram-negative bacteria (Pruden et al., 2006). However, severalfundamental questions remain about whether HGT occurs beforethe dissemination (e.g. in hospitals) or in the environment, andabout the role of commensal bacteria, including those from soils/sediments as donors or recipients of DNA (Demanèche et al.,2008). Therefore, additional studies are needed to evaluate thepossible impact that ARGs could have as templates for further geneevolution in sediments.

It has been indicated that the ARGs and MAR bacteria (such asEC, P. aerunosa, Acinetobacter, Pseudomonas, Enterobacteriaceae),and phylogenically distant bacteria (such as member of alpha andBetaproteobacteria are present in the municipal WWTP effluent

waters (Kümmerer, 2009). These bacteria can accumulate in fresh-water sediments. Our recent phylogenetic analysis of the bacterialcommunity composition from the surface sediments of the VidyBay revealed a dominance of Betaproteobacteria. A large proportionof Betaproteobacteria clones in Vidy sediments were related toDechloromonas sp, a dechlorinating bacteria. Deltaproteobacteria,including clones related to sulphate-reducing bacteria and Fe(III)-reducing bacteria (Geobacter sp.), were abundant in the sedimentscontaminated by the WWTP effluent (Haller et al., 2011). Accord-ing to the results of the present study, our observation frommetagenomic approach supposes that these phylogenetic commu-nities present both ARGs and MAR that are essentially due to theinfluence of WWTP effluent input and to the lake trophic state.In addition, the presence of aadA (streptomycin and spectinomy-cin) resistance gene found in the sediments deposited before theinfluence of WWTP effluent water (Table 3), indicates that prein-dustrial sediments can be a reservoir of antibiotic resistant-genes.However, in contrary with soil for which several reports confirmedthat antibiotics are produced at sufficiently high concentrations toinhibit bacterial growth in the vicinity of the producers (Li andAlexander, 1990; Demanèche et al., 2008), the production of anti-biotics in sediments and the emergence of ARGs are a highly com-plex process which is not yet fully understand (Kümmerer, 2009).Nonetheless, several studies demonstrated that antibiotic and anti-biotic-resistance genes can be recovered from aquatic environmentas a result of the contamination by anthropogenic sources such asWWTP input, runoff from agricultural areas, or from the extensiveuse of antibiotics in aquaculture (Wright, 2010). Numerous studiesfurther suggest that the prevalence of antibiotic resistance may in-crease in bacterial populations via indirect or coselection fromheavy metal contamination (Tuckfield and McArthur, 2008). Inter-estingly, the results of our study show that the sediments from theBay of Vidy, which are highly contaminated by heavy metals,constitute a important reserve of bacteria MARs and ARGs.Moreover, the comparison with the physicochemical parametersdemonstrates that the increase of bacteria MARs and ARGs in sed-iments is not only related to the pollution source (WWTP of Vidy),but rather to the response of the lake ecosystem which is stronglyinfluenced by the lake’s trophic state. Finally, the presence of aadA(streptomycin and spectinomycin) resistant-gene in sedimentsdeposited during the late nineteen century indicates the eventualregional dissemination of resistant-gene in Lake Geneva’s waterdue to the extensive use of antibiotic in human medicine, inagriculture, and in aquaculture, for more than one century.

5. Conclusion

The main objective of this study was to investigate the accumu-lation of pathogenic bacteria multiple antibiotic resistant (MARs)and antibiotic resistance genes (ARGs) in sediment profiles fromdifferent parts of Lake Geneva (Switzerland) over the last decades.This research demonstrates the combined effect of the WWTPeffluent water and the changes in lake trophic state on the distri-bution of pathogens indicators bacteria MARs and ARGs. Our pres-ent findings further confirm the hypothesis that naturalenvironments represent reservoirs of antibiotic resistance genes,so that changes in theses ecosystems might be relevant for theemergence of previously unknown resistance determinants in bac-terial pathogens (Martinez, 2008, 2009). Additionally, one of themain findings of this study is that aadA gene resistant was foundedin the sediments deposited before the twentieth century and theWWTP impacts, suggesting that the ARGs can be considered asan emerging contaminant in freshwater sediments (Pruden et al.,2006; Kümmerer, 2009; Wright, 2010) since more than onecentury.

F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx 7

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

The results of this study will serve as a reference point for futureresearch in polluted aquatic environments affected by wastewaterinputs and lake trophic changes, resulting from anthropogenicnutrient release and/or warmer climate impact on oxygen deple-tion of lake’s bottom waters. However, given the long history ofpollution in the Bay of Vidy, additional researches are needed forbetter understanding the production, the quantification, and theemergence of antibiotics and bacteria/antibiotic-resistance genesin freshwater sediments since the last decades to century. Wepresent here the first study regarding the time distribution of FIBMARs and ARGs in the contaminated and uncontaminated sedi-ments of the Bay of Vidy, highlighting that future studies shouldinclude the quantification and the behaviours of the tested antibi-otic genes in microbial diversities from freshwater ecosystems.

Acknowledgements

This research is a part of Swiss National Science Foundation(Prodoc Project Leman 21, module 4 (PDFMP2-123048, Project C).The work was funded by the Ernst and Lucie Schmidheiny Founda-tion and Société académique de Genève (Geneva, Switzerland), andby a grant from the Swiss National Science Foundation (SNSFAmbizione fellowship).

The authors would particularly like to thank Drs Patrick Mavin-gui and Van Tran-Van Microbial Ecology, Lyon-1, for their precioushelp in providing access to laboratory for various analyses and, Phi-lippe Arpagaus, Christine Guido-Bruno, Benoît Droz and TiffanyMonnier for their valuable help with sediment sampling and labo-ratory analyses.

References

Akiyama, T., Savin, M.C., 2010. Population of antibiotic-resistant coliform bacteriachange rapidly in a wastewater effluent dominated stream. Sci. Total. Environ.408, 6192–6201.

Andrews, J.M., 2001. Determination of minimum inhibitor concentrations. J.Antimicrob. Chem. 48 (suppl. SI), 5–16.

Andrews, J.E., Greenaway, A.M., Dennis, P.F., 1998. Combined carbon isotope and C/N ratios as indicators of sources and fate of organic matter in a poorly flushed,tropical estuary: Hunts Bay, Kingston Harbour, Jamaica. Estuarine, Coastal ShelfSci. 46, 743–756.

Balkwill, D.L., Ghiorse, W.C., 1985. Characterization of subsurface bacteriaassociated with two shallow aquifers in Oklahoma. Appl. Environ. Microbiol.50, 580–588.

Belaaouaj, A., Lapoumeroulie, C., Caniça, M.M., Vedel, G., Névot, P., Krishnamoorthy,R., Paul, G., 1994. Nucleotide sequences of the genes coding for the TEM-like b-lactamases IRT-1 and IRT-2 (formerly called TRI-1 and TRI-2). FEMS Microbiol.Lett. 120, 75–80.

Bonvin, F., Rutler, R., Chevre, N., Halder, J., Kohn, T., 2011. Spatial and TemporalPresence of a Wastewater-Derived Micropollutant Plume in Lake Geneva.Environ. Sci. Technol. 45, 4702–4709.

Bronk-Ramsey, C., 2001. Development of the radiocarbon program OxCal.Radiocarbon 43, 355–363.

Burnes, B., 2003. Antibiotic resistance analysis of fecal coliform to determine fecalpollution sources in a mixed-use watershed. Environ. Monit. Ass. 85, 87–98.

Cabello, F.C., 2006. Heavy use of prophylactic antibiotics in aquaculture: a growingproblem for human and animal health and for the environment. Environ.Microbiol 8 (7), 1137–1144.

Choi, S., Chu, W., Brown, J., Becker, S.J., Harwood, V.J., Jiang, S.C., 2003. Application ofenterococci antibiotic resistance patterns for contamination sourceidentification at Huntington Beach, California. Mar. Pollut. Bull. 46, 748–755.

Demanèche, S., Sanguin, H., Poté, J., Navarro, E., Bernillon, D., Mavingui, P., Wildi, W.,Vogel, T.-M., Simonet, P., 2008. Antibiotic-resistant soil bacteria in transgenicplant fields. Proc. Natl. Acad. Sci. 105, 3957–3962.

Dorioz, J.M., Pelletier, J.P., Benoit, P., 1998. Physico-chemical properties andbioavailability of particulate phosphorus of various origin in a watershed ofLake Geneva (France). Water Res. 32 (2), 275–286.

Dutka-Malen, S., Evers, S., Courvalin, P., 1995. Detection of glycopeptide resistancegenotypes and identification to the species level of clinically relevantenterococci by PCR. Clin. Microbiol. 33, 24–27. Erratum in: J. Clin. Microbiol.33,1434.

Espitalié, J., Deroo, G., Marquis, F., 1985. La pyrolyse Rock Eval et ses applications.2de partie. Rev Inst Fr Pet 40, 755–784.

Förstner, U., Wittmann, G.T.W., 1979. Metal pollution in the aquatic environment.Metal pollution in the aquatic environment, xvi+486 pp.

Garcia-Bravo, A., Wildi, W., Poté, J., 2010. Kinetics of plant material mass loss andDNA release in freshwater column. Ecotoxicol. Environ. Saf. 73, 1548–1552.

Glass-Haller, L., 2010. Microbial and geochemical characterization of acontaminated freshwater ecosystem (the case of Vidy Bay, Lake Geneva,Switzerland). Terre et environnement, vol. 95, 186 pages. ISBN 2-940153-94-9.

Guardabassi, L., Dijkshoorn, L., Collard, J.-M., Olsen, J.E., Dalsgaard, A., 2000.Distribution and in-vitro transfer of tetracycline resistance determinants inclinical and aquatic Acinetobacter strains. J. Med. Microbiol. 49, 929–936.

Haller, L., Poté, J., Loizeau, J.-L., Wildi, W., 2009a. Distribution and survival of faecalindicator bacteria in the sediments of the Bay of Vidy, Lake Geneva, Switzerland.Ecol. Indicators 9, 540–547.

Haller, L., Amedegnato, E., Poté, J., Wildi, W., 2009b. Influence of freshwatersediment characteristics on persistence of fecal indicator bacteria. Water, Air,Soil Pollut. 203, 217–227.

Haller, L., Tonolla, M., Zopfi, J., Peduzzi, R., Wildi, W., Poté, J., 2011. Composition ofbacterial and archaeal communities in freshwater sediments with differentcontamination levels (Lake Geneva, Switzerland). Water Res. 45, 1213–1228.

Kümmerer, K., 2004. Resistance in the environment. J. Antimicrob. Chemother. 54,311–320.

Kümmerer, K., 2009. Antibiotics in aquatic environmentv – a review – part II.Chemosphere 75, 435–441.

Lafargue, E., Espitalié, J., Marquis, F., Pillot, D., 1996. Rocal-Eval 6, applications inhydrocarbon exploration, production and soil contamination studies. VinciTechnologies, Rock-Eval user manual.

Li, D.M., Alexander, M., 1990. Factors affecting co-inoculation with antibiotic-producing bacteria to enhance rhizobial colonization and nodulation. Plant Soil129, 195–201.

Loizeau, J.L., Pardos, M., Monna, F., Peytremann, P., Haller, L., Dominik, J., 2004. Theimpact of a sewage treatment plant’s effluent on sediment quality in a small bayin Lake Geneva (Switzerland–France). Part 2: temporal evolution of heavymetals. Lakes Reservoirs: Res. Manage. 9, 53–63.

Madsen, L., Aarestrup, F.M., Olsen, J.E., 2000. Characterization of streptomycinresistance determinants in Danish isolates of Salmonella typhimurium. Vet.Microbiol. 75, 73–82.

Margot, J., Magnet, A., Thonney, D., Chevre, N., de Alencastro, F., Rossi, L., 2011.Traitement des micropolluants dans les eaux usées – Rapport final sur les essaispilotes à la STEP de Vidy (Lausanne). Ed. Ville de Lausanne.

Martinez, J.L., 2008. Antibiotics and antibiotic resistance genes in naturalenvironments. Science 321, 365–367.

Martinez, J.L., 2009. Environmental pollution by antibiotics and by antibioticresistance determinants. Environ. Pollut. 157, 2893–2902.

Morasch, B., Bonvin, F., Reiser, H., Grandjean, D., de Alencastro, L.F., Perazzolo, C.,Chèvre, N., Kohn, T., 2010. Prioritization, occurrence and fate of pharmaceuticalsand other micropollutants in the Vidy bay (Lake Geneva): Part II:micropollutant removal in the wastewater treatment plant and duringsubsequent passage through the bay into raw drinking water. Environ.Toxicol. Chem. 29, 1658–1668.

Pardos, M., Benninghoff, C., Alencastro, L.P., Wildi, W., 2004. The impact of a sewagetreatment plant’s effluent on sediment quality in a small bay in Lake Geneva(Switzerland-France). Part 1: spatial distribution of contaminants and thepotential for biological impacts. Lakes Reservoirs: Research and Management 9,41–52.

Perazzolo, C., Morasch, B., Kohn, T., Magnet, A., Thonney, D., Chevre, N., 2010.Occurrence and fate of micropollutants in the Vidy Bay of Lake Geneva,Switzerland. Part I: priority list for environmental risk assessment ofpharmaceuticals. Environ. Toxicol. Chem. 29 (8), 1649–1657.

Poté, J., Ceccherini, M.T., Tran Van, V., Rosselli, W., Wildi, W., Simonet, P., Vogel, T.M.,2003. Fate and Transport of Antibiotic Resistance Genes in Saturated SoilColumns. Eur. J. Soil Biol. 39, 65–71.

Poté, J., Haller, L., Loizeau, J.-L., Garcia Bravo, A., Sastre, V., Wildi, W., 2008. Effects ofa sewage treatment plant outlet pipe extension on the distribution ofcontaminants in the sediments of the Bay of Vidy, Lake Geneva, Switzerland.Bioresour. Technol. 99, 7122–7131.

Poté, J., Haller, L., Kottelat, R., Sastre, V., Arpagaus, P., Wildi, W., 2009. Persistenceand growth of faecal culturable bacterial indicators in water column andsediments of Vidy Bay, Lake Geneva, Switzerland. J. Environ. Sci. 21, 62–69.

Poté, J., Bravo, A.G., Mavingui, P., Ariztegui, D., Wildi, W., 2010. Evaluation ofquantitative recovery of bacterial cells and DNA from different lake sedimentsby Nycodenz density gradient centrifugation. Ecol. Indicators 10, 234–240.

Pruden, A., Pei, R., Storteboom, H., Carlson, K., 2006. Antibiotic resistance genes asemerging contaminants: studies in Northern Colorado. Environ. Sci. Technol. 40,7445–7450.

Radimersky, T., Frolkova, P., Janoszowska, D., et al., 2010. Antibiotic resistant infaecal bacteria (Esherichia coli, Enteroccoccus spp) in feral pigeons. Appl.Microbiol. 109, 1687–1695.

Ruiz-Fernandez, A.C., Hillaire-Marcel, C., Páez-Osuna, F., Ghaleb, B., Soto-Jiménez,M., 2003. Historical trends of metal pollution recorded in the sediments of theCuliacan River Estuary, Northwestern Mexico. Appl. Geochem. 18, 577–588.

Sáenz, Y., Briñas, L., Domínguez, E., Ruiz, J., Zarazaga, M., Vila, J., Torres, C., 2004.Mechanisms of resistance in multiple-antibiotic-resistant Escherichia colistrains of human, animal and food origin. Antimicrob Agents Chemother. 48,3996–4001.

Schwarzenbach, R.P., Escher, B.I., Fenner, K., Hofstetter, T.B., Johnson, C.A., vonGunten, U., Wehrli, B., 2006. The challenge of micropollutants in aquaticsystems. Science 313, 1072–1077.

8 F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048

Thevenon, F., Graham, N. D., Hebez, A., Wildi, W., Poté, J., 2011. Spatio-temporaldistribution of organic and inorganic pollutants from Lake Geneva (Switzerland)reveals strong interacting effects of sewage treatment plant and eutrophicationon microbial abundance. Chemosphere, doi:10.1016/j.chemosphere.2011.03.051.

Tuckfield, R.C., McArthur, J.V., 2008. Spatial analysis of antibiotic resistance alongmetal contamination. Microb. Ecol. 55, 595–607.

Vilanova, X., Manero, A., Cerda-Cuéllar, M., Blanch, A.A., 2004. The composition andpersistence of faecal coliform and enterococcal populations in sewagetreatment plants. J. Appl. Microbiol. 96, 279–288.

Vuillemin, A., Ariztegui, D., Vasconcelos, C., the PASADO Scientific Drilling Party,2010. Establishing sampling procedures in lake cores for subsurface biospherestudies: assessing in situ microbial activity. Sci. Drilling 10, 35–39. doi:10.2204/iodp.sd. 10.04.2010.

Wildi, W., Dominik, J., Loizeau, J.L., Thomas, R.L., Favarger, P.Y., Haller, L., Perroud, A.,Peytremann, C., 2004. River, reservoir and lake sediment contamination byheavy metals downstream from urban areas of Switzerland. Lakes Reservoirs:Res. Manage. 9, 75–87.

Wright, G., 2010. Antibiotic resistance in the environment: a link to clinic? Curr.Opin. Microbiol. 13, 589–594.

F. Thevenon et al. / Chemosphere xxx (2011) xxx–xxx 9

Please cite this article in press as: Thevenon, F., et al. Antibiotic resistant bacteria/genes dissemination in lacustrine sediments highly increased followingcultural eutrophication of Lake Geneva (Switzerland). Chemosphere (2011), doi:10.1016/j.chemosphere.2011.09.048