Altered immunoregulatory profile during anti-tumour necrosis factor treatment of patients with...

Altered immunoregulatory profile during anti-tumour necrosis factortreatment of patients with inflammatory bowel disease

J. Grundström,* L. Linton,†

S. Thunberg,* H. Forsslund,*

I. Janczewska,‡ R. Befrits,§

M. van Hage,* G. Gafvelin1* andM. Eberhardson1§¶

*Department of Medicine, Clinical Immunology

and Allergy Unit, Karolinska Institutet and

University Hospital, †Department of Medicine,

Translational Immunology Unit, Karolinska

Institutet, ‡Department of Clinical Sciences,

Karolinska Institutet, Danderyd Hospital,§Department of Gastroenterology and Hepatology,

Karolinska University Hospital Solna, and¶Department of Clinical Research and Education,

Karolinska Institutet, Södersjukhuset, Stockholm,

Sweden

Summary

Inflammatory bowel disease (IBD) can be treated effectively by anti-tumournecrosis factor (TNF) therapy. We set out to investigate the unclear immuno-regulatory mechanisms of the treatment. Thirty-four patients with IBDtreated with anti-TNF were included. Lymphocytes from peripheral bloodand intestinal biopsies were analysed by flow cytometry. Regulation ofantigen-stimulated proliferation was analysed by blocking of interleukin(IL)-10, transforming growth factor (TGF)-b or depletion of CD25+ cellsin peripheral blood mononuclear cell cultures. No changes in CD4+CD25+,CD25+TNF-RII+ or CD4+CD25+forkhead box protein 3 (FoxP3+) T cells couldbe observed in peripheral blood after, in comparison to before, 6 weeks oftreatment. The suppressive ability of CD4+CD25+ cells did not change. Therewas an initial decrease of CD4+CD25+ cells in intestinal mucosa after 2 weeksof treatment, followed by an increase of these cells from weeks 2 to 6 oftreatment (P < 0·05). This was accompanied by an increased percentage ofCD69+ cells among these cells after 6 weeks of treatment compared to beforetreatment (P < 0·01). There was also an increase of mucosal T helper type1cells from weeks 2 to 6 (P < 0·05). In addition, CD25+TNF-RII+ cells in themucosa were decreased after 6 weeks of treatment compared to before treat-ment (P < 0·05). Before treatment, peripheral blood mononuclear cell base-line proliferation was increased when IL-10 was blocked (P < 0·01), but notafter. In CD25+ cell-depleted cultures proliferation increased after treatment(P < 0·05). Our data indicate that anti-TNF treatment leads to an inductionof effector T cells. Anti-TNF therapy has no significant impact on regulatoryT cells in IBD, although the composition of regulatory T cell subsets maychange during treatment.

Keywords: Crohn’s disease, inflammatory bowel disease, regulatory T cell,TNF-RII, ulcerative colitis

Accepted for publication 12 April 2012

Correspondence: G. Gafvelin, Karolinska

Institutet, Department of Medicine, Clinical

Immunology and Allergy Unit, Karolinska

University Hospital L2:04, 17176 Stockholm,

Sweden.

E-mail: [email protected]

1Shared last authorship.

Introduction

In western societies, inflammatory bowel disease (IBD) hasincreased over the last decade, reaching an average preva-lence of almost 1% of the population. The two major sub-groups of IBD, ulcerative colitis (UC) and Crohn’s disease(CD), are equally common chronic, relapsing diseases of theintestine [1–4]. The clinical manifestations of IBD often startduring adolescence, with a peak age of onset ranging fromthe second to fourth decades of life [2,5].

Although the mechanisms of disease are not understoodfully, a widespread concept is that IBD results from a dis-rupted balance between the mucosal immune system and the

commensal gut flora. After provocation by pathogens orother unknown factors, the immune system remains chroni-cally activated with a persistently inflamed mucosa. Theinflammation is characterized by high expression of proin-flammatory cytokines such as tumour necrosis factor (TNF),interferon (IFN)-g, interleukin (IL)-6 and IL-1b [4]. Naive Thelper (Th) cells are attracted to the site of inflammation andundergo differentiation under the influence of factorsreleased by antigen-presenting cells (APC) and other stromalelements. These activated T cells take part in the tissuedamage and barrier disruption seen in IBD [6].

A variety of T cell deficiencies have been observed in IBDmodels, such as decreased regulatory function, excess of

bs_bs_banner

Clinical and Experimental Immunology ORIGINAL ARTICLE doi:10.1111/j.1365-2249.2012.04600.x

137© 2012 The AuthorsClinical and Experimental Immunology © 2012 British Society for Immunology, Clinical and Experimental Immunology, 169: 137–147

Th1-/Th2-/Th17-type responses and defects in T cell apop-tosis [3,7,8]. Patients with IBD have been found to haveincreased amounts of regulatory T cells (Tregs) in theinflamed intestinal mucosa that seem unable to control theinflammation [9–11]. Furthermore, it has been assumed thatthe T cell responses of CD and UC differ, as CD has beenassociated with a Th1 profile [12,13] and UC with a Th2profile [13]. This paradigm has been challenged with theidentification of the Th17 cells and recognition of theirimportance in autoimmunity and chronic inflammatorydisorders. Evidence has been presented for a role of Th17cells in both CD and UC [14].

During the past decade, treatment of IBD has beenimproved greatly by the introduction of anti-TNF therapy,including infliximab and adalimumab. Patients with activeIBD may go into clinical remission, often within weeks afterstarting therapy [15,16]. However, data reported on theeffects on the immune system by blocking TNF signalling inIBD are somewhat conflicting [17–21]. Recently, Li et al. [17]reported increased expression of forkhead box protein 3(FoxP3) in peripheral blood of anti-TNF therapy respondingpatients, while FoxP3 and CD25 expression in intestinalmucosa decreased during treatment, indicating that induc-tion of Tregs may be one of the mechanisms of action inanti-TNF therapy. In contrast, Hvas et al. [18] could notdetect any changes in circulating Tregs during the first 6 weeksof anti-TNF therapy. These studies were focusing on thephenotype of T cells in peripheral blood and intestinalmucosa, but not the functionality of these cells. Boschettiet al. [20] presented a study of functional in-vitro analysis ofTregs from four IBD patients before and after 2 weeks ofanti-TNF therapy, which showed that the Treg suppressivecapacity was enhanced during treatment. In concordancewith Li et al., they also found an increase of Tregs in peripheralblood.

In the present study, we set out to investigate differentsubsets of Th and Treg cells phenotypically and functionallyduring the first 6 weeks of anti-TNF treatment. We hypoth-esized that response to treatment is due to alterations withinthese subsets, correcting an imbalance present beforetreatment. In addition, different mechanisms of regulationof basal and antigen-specific T cell activation in peripheralblood mononuclear cell (PBMC) cultures were studied,which allowed us to examine how inflammation influencesregulation of antigen-specific immune responses.

Materials and methods

Patients

Thirty-four patients with CD or UC treated with the anti-TNF antibodies, infliximab or adalimumab (Remicade® orHumira®, respectively), were included consecutively in thestudy, without randomization. The choice of treatment forthe individual patient was based on clinical evaluation

without any intervention by the study. Patient demographyis outlined in Table 1. Anti-TNF-treatment was adminis-tered either as infusions of 5 mg/kg infliximab at weeks 0, 2and 6 or subcutaneous injections of 80 mg adalimumab atweek 0 followed by 40 mg every other week. Blood sampleswere obtained at the start of therapy (w0), after 2 (w2) and6 (w6) weeks [blood samples were only obtained at w0and w6 for patients 30–34 (Table 1), and these samples wereused specifically only for analysis of suppressive capacity].Mucosal biopsies (from rectum and sigmoideum) wereobtained from 12 patients at w0, w2 and w6 (as indicated inTable 2). Patients were assessed using the UC disease activityindex (UC-DAI, UC) and Harvey–Bradshaw Index (HBI,CD). At week 6, a patient was regarded as a responder if theclinical index activity decreased by �3 points, if a patientreached 1 or 0 in clinical activity index, if there was a sus-tained clinical benefit in terms of reduced corticosteroiddosage or at the discretion of the treating physician. Threehealthy donors were included for evaluation of Th subsetcharacterization. The study was approved by the local ethicscommittee and all participants gave their informed consentfor participation.

For the antigen-specific analyses, patients were groupedinto cat-allergic, pollen-allergic or non-allergic. The allergicpatients had immunoglobulin (Ig)E to their respectiveallergen >0·35 kU/l (ImmunoCAP; Phadia AB, Uppsala,Sweden), while the non-allergic controls were negative(�0·35 kU/l) to a mix of common inhalant allergens (Phadi-atop; Phadia AB).

In-vitro culture of peripheral blood mononuclear cells

PBMCs were separated from whole blood by Ficoll-Paque™PLUS (GE Healthcare, Uppsala, Sweden) centrifugation andcultured as described previously [22]. Briefly, PBMCs werestimulated with either a pollen allergen mix including1100 U/ml timothy grass pollen extract and 3400 U/mlbirch pollen extract (Phleum pratense pollen and Betula ver-rucosa pollen, respectively; Aquagen SQ, ALK, Hørsholm,Denmark), 10 mg/ml recombinant (r) Fel d 1 (the major catallergen, in-house production [23]) or Flue antigen (influ-enza vaccine, Vaxigrip®; Sanofi Pasteur MSD, Lyon, France)diluted ¥720 in phosphate-buffered saline (PBS). Analysisof Treg mechanisms was performed in antigen-stimulatedPBMC cultures from patients, as indicated in Table 2, byeither blocking IL-10 with 5 mg/ml anti-IL-10 antibody(Mabtech, Nacka, Sweden), TGF-b with 300 ng/ml solubleTGF-bRII-Fc chimera (R&D Systems, Minneapolis, MN,USA) or by depletion of CD25+ cells using CD25 micro-beads II kit (Miltenyi Biotec, Bergisch Gladbach, Germany).The cells were cultured for 6 days at 37°C, 5% CO2, and inorder to measure antigen-specific proliferation the cellswere cultured in the presence of 1 mCi of [3H]-thymidine(PerkinElmer, Waltham, MA, USA) during the last 18 h ofculture.

J. Grundström et al.

138 © 2012 The AuthorsClinical and Experimental Immunology © 2012 British Society for Immunology, Clinical and Experimental Immunology, 169: 137–147

Suppression assay

Five of the patients were recruited specifically for performingtests of the suppressive capacity of CD4+CD25+ Tregs. Periph-eral blood mononuclear cells from before and after sampleswere frozen at -80°C in 45% RPMI and 45% bovine growthserum with 10% dimethylsulphoxide (DMSO) directly afterisolation and stored in -150°C until use. After thawing,the PBMCs were separated into CD4–, CD4+CD25- andCD4+CD25+ cells using the CD4+CD25+ regulatory T cellisolation kit (Miltenyi Biotec). This led to a median enrich-ment of CD4+CD25+ cells of 45% (range 28–55%) (%CD25+

cells of CD3+CD4+ cells). The CD4+CD25+ cells wereco-cultured with CD4+CD25– cells from both visits with irra-diated CD4– cells as APCs at a ratio of 4:1 of CD25– : CD25+.The cells were cultured for 4 days in U-bottomed 96-wellplates coated with an excess of anti-CD3 (OKT-3, in-house

production) before adding 1 mCi of [3H]-thymidine for thelast 18 h of culture.

Flow cytometry

Patient samples, either whole blood or isolated PBMCs, wereanalysed by flow cytometry as indicated in Table 2. Lysis ofred blood cells (RBCs) was performed by lysis of wholeblood samples in hypotonic buffer [160 mM NH4Cl (Merck,Nottingham, UK), 8 mM Tris-HCl (Sigma-Aldrich, StLouis, MO, USA), pH 7·5] after fixating the cells in 3·2 mMC6H5Na3O7*2H2O (Merck), 0·4% paraformaldehyde (PFA)(Apoteket AB, Stockholm, Sweden), pH 7·5.

Cell surface markers were stained for flow cytometryusing mouse antibodies against CCR6 (clone 53103) andTNF-RII (CD120b, clone 22235) conjugated to phycoeryth-rin (PE), both from R&D Systems, CD4 conjugated to

Table 1. Patient demography.

ID Gender† Disease‡ Medication§ Index¶ w0 Index¶ w6 Prednisolone w0 Prednisolone w6 Response†† Allergy

1 M CD R 9 2 35 mg 15 mg R –

2 M CD R 3 1 – – R –

3 M UC H 6 2 30 mg 5 mg R Pollen

4 M CD H 5 6 Predclysma Predclysma NR –

5 F CD H 9 0 15 mg – R –

6 M CD R 11 2 15 mg – R –

7 F CD R 8 4 10 mg 10 mg R –

8 M CD R 5 5 – – NR –

9 M CD H 6 10 30 mg 7·5 mg NR –

10 M CD R 3 8 15 mg – NR –

11 F CD R 15 2 – – R –

12 M UC R 4 3 20 mg – (relapse) NR –

13 M CD R 12 2 – – R –

14 F CD R 2 2 7·5 mg – R –

15 M UC R 8 0 5 mg – R –

16 M CD R 0 1 22·5 mg 7·5 mg R –

17 M CD R 4 3 20 mg – R Pollen

18‡‡ M UC R 7 4 – – R Pollen/cat

19 F CD R 5·5 5 – – NR –

20 M CD R 13 4 15 mg – R Pollen

21 F CD R 3 1 – – R –

22 M UC R 1 1 20 mg – R –

23 M CD H 11 6 10 mg – R Pollen/cat

24 F CD R 13 3 – – R Pollen

25 M CD R 7 5 30 mg 5 mg R –

26 F CD H 8 2 – – R Pollen

27 M CD R 6 3 Entocort – R –

28 M CD R 10 2 15 mg 5 mg R –

29 F UC R 7 3 – – R –

30 M CD R 12 13 – – R –

31 F CD R 13 0 – – R –

32 F CD H 11 n.a. Entocort – (relapse) NR –

33 F UC R n.a. n.a. 10 mg – R –

34 F UC R n.a. n.a. – – R –

†M: male; F: female. ‡CD: Crohn’s disease; UC: ulcerative colitis. §R: Remicade®; H: Humira®. ¶Harvey–Bradshaw Index (HBI) for CD patients and

UC disease activity index (UC-DAI) for UC patients. ††R: responder; NR: non-responder. ‡‡Index was calculated by HBI (n.a.: not applicable).

Anti-TNF treatment-induced immunoregulation


PE-Texas Red (clone SFCI12T4D11) from Beckman Coulter,Brea, CA, USA, CD25 conjugated to PE-cyanin5 (cloneBC96) and CD69 conjugated to AlexaFluor 700/allophycocyanin-cyanin7 (clone FN50) from BioLegend(San Diego, CA, USA), CD25 conjugated to fluoresceinisothiocyanate (FITC) (clone M-A251), CXCR3 conjugatedto PE-cyanin5 (clone IC6/CXCR3), CCR4 conjugated toPE-cyanin7 (clone 1G1), CD4 conjugated to AlexaFluor 700/allophycocyanin-cyanin7 (clone RPA-T4) and CD3 conju-gated to Pacific Blue (clone SP34-2), from BD Biosciences(San Diego, CA, USA). Intracellular staining for FoxP3 withrat anti-FoxP3 conjugated to PE (clone PCH101; eBio-science, San Diego, CA, USA) was performed according tothe manufacturer’s instructions on PBMCs from 10 patients(Table 2).

For analysis of Th subset expression of lineage-associatedtranscription factors, PBMCs were stained intracellularly forT-bet with mouse anti-T-bet and GATA-3 with rat anti-GATA-3, both conjugated to eFluor 660 (clone 4B10 andTWAJ, respectively), and from eBioscience. Data were col-lected using a BD FACSAria instrument (BD Biosciences)

and analysed using FlowJo 7·6 software (Tree Star, Ashland,OR, USA).

Intestinal biopsies

Biopsies for flow cytometry staining were suspended in PBScontaining 2% bovine growth serum (BGS; HyClone,Thermo Fischer Scientific, Waltham, MA, USA), mashedusing a glass homogenizer and filtered through a 40-mm cellstrainer. After filtering, the cells were washed in PBS contain-ing 2% BGS. Subsequently, surface markers were stained forflow cytometric analysis using the fluorophore-conjugatedantibodies: TNF-RII PE, CCR6 PE, CXCR3 PE-cyanin5,CCR4 PE-cyanin7, CD25 FITC/PE-cyanin5, CD4 PE-TexasRed, CD69 AlexaFluor 700 and CD3 Pacific Blue.

Analysis of mRNA in peripheral bloodmononuclear cells

Samples from nine patients were included in the analysis ofmRNA expression according to Table 2. Cultures of 3 ¥ 106

Table 2. Inclusion of patients in the different analyses of the study.

ID Flow cytometry† Gut biopsies‡ IL-10 blocking§ CD25 depletion§ TGF-b blocking§ mRNA analysis

1 X, PBMCs – X – – X

2 X, PBMCs – X – – X

3 – – – X X –

4 – – – X X –

5 – – – X X –

6 X (not Th), PBMCs – X – – X




10 X, PBMCs – X – – X

11 X, PBMCs – X – – X

12 X, PBMCs – X – – X

13 X, PBMCs – X X – –

14 – – – X X –

15 X (not FoxP3), lysis X X X X –



18 X (not FoxP3), lysis – – – – –

19 X (not FoxP3), lysis – – – – –


21 X (not FoxP3), lysis X – – – –





26 X (not FoxP3), lysis X – – – –

27 X (not FoxP3), lysis – X X X –



Included patients are marked by X. †Analysis of surface markers by flow cytometry was performed on isolated peripheral blood mononuclear cells

(PBMCs) or whole blood with lysed red blood cells (RBCs) (‘lysis’). ‡Analysis of surface markers by flow cytometry on gut mucosal cells. §In-vitro

stimulation in PBMC cultures with blocking of interleukin (IL)-10 or transforming growth factor (TGF), or by depletion of CD25+ cells. FoxP3:

forkhead box protein 3; Th: T helper.



PBMCs were stimulated with aCD3/aCD28 or left unstimu-lated for 48 h in AIM-V medium (Gibco, InvitrogenCorpo-ration, Paisley, UK) and subjected to RNA expressionanalysis, as described previously [22], using primersfor EF-1, GATA-3, T-bet, FoxP3 [24] and RORc [25],(CyberGene AB, Stockholm, Sweden). Moreover, primersfor IFN-g, TNF-a, IL-6, TGF-b and IL-10 were used:IFN-g forward 5′-(AACTAGGCAGCCAACCTAAG)-3′,IFN-g reverse 5′-(ACCGGCAGTAACTGGATAGT)-3′,TNF-a forward 5′-(CAATAGGCTGTTCCCATGTA)-3′, TNF-a reverse 5′-(GTCACCAAATCAGCATTGTT)-3′,IL-6 forward 5′-(GAAAACAACCTGAACCTTCC)-3′,IL-6 reverse 5′-(CTCCAAAAGACCAGTGATGA)-3′, TGF-bforward 5′-(CTGCTGAGGCTCAAGTTAAA)-3′, TGF-breverse 5′-(CCGGTGACATCAAAAGATAA)-3′, IL-10 for-ward 5′-(ATCCAGTTTTACCTGGAGGA)-3′ and IL-10reverse 5′-(CCTTGCTCTTGTTTTCACAG)-3′ (CyberGeneAB). Data were normalized to the arithmetic mean expres-sion of EF-1 and relative quantification was calculatedby 2-DDCt.

Statistical analysis

Data are presented as median � interquartile range. Wilcox-on’s signed-rank test was used for matched comparison ofdata within groups at different time-points. For analysis ofunmatched data, the Mann–Whitney U-test was used. Analy-ses were performed using GraphPad Prism 5 software(GraphPad Software Inc., San Diego, CA, USA); P < 0·05 wasconsidered significant.

Results

Changes among T helper cell subsets duringanti-TNF therapy

Different subsets of Th cells were identified by means offlow cytometry adapted from Acosta-Rodriguez et al. [26],who found that Th1 cells express CXCR3, Th2 expressCCR4 and Th17 cells express CCR6 and CCR4. Gating ofCXCR3+, CCR4+CCR6– and CCR4+CCR6+ cells from CD4+

cells is depicted in Fig. 1a. At least 100 detected events inthe final gates were required for analysis. The gated cellpopulations will be referred to hereafter as Th1 (CXCR3+),Th2 (CCR4+CCR6–) and Th17 (CCR4+CCR6+). This gatingstrategy has been shown previously to define Th subsetsthat express the lineage-associated transcription factors[27]. Intracellular staining of transcription factors inPBMCs revealed that the Th2 subset expresses the highestlevel of GATA-3 and the Th1 subset expresses the highestlevel of T-bet (Fig. 1b). There was generally a low numberof cells detected in the Th17 gate and this subset displayeda high degree of GATA-3-positive cells. Thus the Th17population defined by our gating strategy was contami-nated by Th2 cells, while Th1 and Th2 cells were enriched

in their respective gated populations. No changes withinthe different subsets were observed over time in peripheralblood (Fig. 2a,b). There were significantly more Th1 cells inthe mucosa compared to peripheral blood (P < 0·001,Fig. 2a), whereas neither Th2 nor Th17 cells could bedetected in the gut mucosa under these experimental con-ditions. There was also a significant increase of Th1 cells inthe mucosa between w2 and w6 (P < 0·05, Fig. 2a). No dif-ferences in the amounts of circulating Th1 and Th2 cells orTh1/Th2 ratio were detected between UC and CD patients(data not shown), nor could any differences be detectedbetween treatment responding and non-respondingpatients.

% o

f Th

subs

et

% o

f Th

subs

et

0

2

4

6

8

10(b)

(a)

Th2

Th2Th1

Th17

Th17Th2

GATA-3

CCR4

CX

CR

3

CCR4+

CCR6

Th1

Tbet

Th1

Th170

5

10

15

Fig. 1. Gating strategy for T helper (Th) cell subsets. Among

CD3+CD4+ T cells, CXCR3+ (Th1), CCR4+CCR6– (Th2) and

CCR4+CCR6+ (Th17) cells were gated (a) and the expression of

GATA-3 and T-bet in the different subsets was analysed (b).

%C

CR

4+C

CR

6+/–

of C

D4+

0 2Week

6 0 2Week

602468

10

%C

XC

R3+

of C

D4+

0

20

40

60

80

(a) (b)Th1 in gutTh1 in blood

Th2Th17

*** *** ***

*

Fig. 2. T helper (Th) cell subsets in peripheral blood and intestinal

mucosa. (a) Th1 cells, open circles represent peripheral blood (n = 18)

and filled squares represent intestinal mucosa (n = 11); (b) Th2 cells

and Th17 cells in peripheral blood. Open triangles represent Th2

(n = 18) and filled diamonds represent Th17 (n = 10). Wilcoxon’s

signed-rank test was used for comparisons within the groups and the

Mann–Whitney U-test for comparisons between the groups. *P < 0·05;

***P < 0·001.



Treatment effect on CD4+CD25+, CD4+CD25+FoxP3+

and CD4+TNF-RII+ cells in peripheral blood andintestinal mucosa

Combinations of markers for flow cytometry were used toanalyse different Th cell subsets. First, the percentages ofCD25+ cells among CD4+ cells were analysed. Before treat-ment, similar proportions of CD25+ cells were found inperipheral blood and intestinal mucosa (Fig. 3a). Two weeksafter initiation of treatment, the percentage of these cells haddecreased significantly in the mucosa (Fig. 3a, P < 0·05),while their circulating counterparts remained unchanged.After 6 weeks of treatment, the percentage of CD25+ cells inintestinal mucosa had increased significantly compared tow2, to a level similar to w0. Similarly, the proportion ofcirculating CD25+ T cells after treatment (w6) showed a par-allel increase compared to before treatment (w0), althoughnot significant (Fig. 3a, P = 0·07). There was no detectableexpression of CD69, a marker that is expressed on recentlyactivated T cells, on CD4+CD25+ cells in peripheral blood,whereas CD69 expression increased significantly on theCD4+CD25+ cells in intestinal mucosa after 6 weeks of treat-ment (P < 0·01, Fig. 3b).

Because CD4+CD25+ T cells may contain both Tregs

and activated T cells, we next investigated the expressionof FoxP3 and CD25 on CD4+ cells. There was no change inthe percentage of CD4+CD25+FoxP3+ cells throughout the

treatment period (Fig. 3c). Intracellular staining of FoxP3was not performed on intestinal biopsies.

Tregs constitutively express TNF-RII, and TNF-RII hasbeen suggested as a marker for functional Tregs [28]. Weanalysed the co-expression of CD25 and TNF-RII in bothperipheral blood and intestinal mucosa. There was an initialsignificant decrease in the percentage of CD25+TNF-RII+

cells among CD4+ cells in peripheral blood (P < 0·05), butnot during the following course of treatment. In intestinalmucosa, a parallel significant decrease from w0 to w2(P < 0·001) was observed. Moreover, cells co-expressingthese markers in the mucosa were decreased significantly atw6 compared to w0 (P < 0·05). There were consistently sig-nificantly higher percentages of CD25+TNF-RII+ cells in theintestinal mucosa than in peripheral blood [P < 0·001 (w0)and P < 0·01 (w2 and 6), Fig. 3d].

Comparisons of CD with UC and responding with non-responding patients did not reveal any differences betweenthe groups for the surface marker expression analyses (datanot shown).

mRNA expression in polyclonally stimulated PBMCs

No significant changes in aCD3/aCD28-induced mRNAexpression were found, but there was a trend that the foldchange by stimulation was lower after than before treatment(data not shown). For FoxP3 [5·4 (4·4–18·9) before, 2·0 (1·2–6·9) after), GATA-3 (1·4 (1·2–2·0) before, 0·7 (1·4–1·4) after]and RORc2 [2·0 (1·4–3·2) before, (1·3 (1·0–1·5) after] thedecrease was close to significant P = 0·05 (FoxP3) andP = 0·07 (GATA-3 and RORc).

Effect of anti-TNF treatment on CD4+CD25+T cellregulatory activity

No difference in the suppressive activity of CD4+CD25+ cellscould be detected between cells collected from five IBDpatients before and after anti-TNF treatment (Fig. 4). Cul-tures with a 4:1 CD4+CD25– : CD4+CD25+ ratio exhibitedsimilar proliferation to CD4+CD25– cell cultures, irrespectiveof whether the CD4+CD25+ Treg-enriched fraction was col-lected before or after the treatment. There was, however, atendency to a decreased proliferation of CD4+CD25– Tresponder cells collected after treatment when co-culturedwith CD4+CD25+ cells obtained either before or after treat-ment (P = 0·06). Proliferation in cultures with CD4+CD25+

cells alone was severely compromised (median 16%, range4–32% of CD4+CD25– cells alone, data not shown).

Shift of regulatory mechanisms inantigen-stimulated PBMCs

Proliferation was measured in unstimulated (baseline prolif-eration) and antigen-stimulated PBMC cultures after inter-ference with different regulatory pathways. Before treatment,

00 2

Week

%C

D25

+F

oxP

3+

of C

D4+

%C

D25

+ o

f CD

4+

%C

D25

+T

NF

RII+

of C

D4+

%C

D69

+ o

fC

D4+

CD

25+

6 0 2Week

6

0 2Week

6 0 2Week

6

2

4

6

8

(c) (d)

(a) (b)

0 *

*

* *

**

**

**

*****5

10

15

05

10152025

020406080

100Blood Gut

Fig. 3. Expression of regulatory markers on T helper (Th) cells in

peripheral blood and intestinal mucosa during anti-tumour necrosis

factor (TNF) treatment. T cell subsets were identified by flow

cytometry. (a) CD25+ cells of CD4+ cells [n = 25 (blood), n = 12

(mucosa)]. (b) CD69 expression on CD4+CD25+ cells [n = 19 (blood),

n = 12 (mucosa)]. (c) Forkhead box protein 3 (FoxP3+)CD25+ cells of

CD4+ T cells in peripheral blood (n = 10). (d) CD25+TNF-RII+ cells of

CD4+ T cells [n = 25 (blood), n = 12 (mucosa)]. Open circles represent

peripheral blood and filled squares represent intestinal mucosa.

Wilcoxon’s signed-rank test for comparisons within the groups, the

Mann–Whitney U-test for comparisons between the groups.

*P < 0·05; **P < 0·01; ***P < 0·001.



blocking of IL-10 in unstimulated cultures led to signifi-cantly increased proliferation (w0, P < 0·01, Fig. 5a) com-pared to non-blocked cells. After treatment, this inhibitionresulted in a non-significant increase in proliferation (w6,P = 0·06, Fig. 5a). Pollen-stimulated proliferation was notaffected by IL-10 blocking either before or after treatment(Fig. 5b), whereas blocking of IL-10 led to significantlyincreased proliferation in rFel d 1- and Flue antigen-stimulated cultures before and after anti-TNF treatment [w0P < 0·001 (rFel d 1), P < 0·01 (Flue antigen) and w6, P < 0·05,Fig. 5c,d, respectively].

When CD25-expressing cells were removed from thePBMCs, no significant change in unstimulated and rFel d1-stimulated proliferation before treatment was detected(w0, Fig. 5a,c, respectively), in contrast to significantlyincreased proliferation post-treatment [w6, P < 0·05(baseline), P < 0·01 (rFel d 1), Fig. 5a,c, respectively]. Inpollen- and Flue antigen-stimulated CD25-depleted PBMCs,proliferation was not changed after compared to beforeanti-TNF treatment (Fig. 5b,d, respectively).

Neutralization of TGF-b did not alter proliferationin unstimulated, pollen-stimulated or rFel d 1-stimulatedcultures either before or after treatment (Fig. 5a–c). Only inFlue antigen-stimulated cultures did blocking of TGF-blead to significantly increased proliferation both beforeand after treatment (Fig. 5d, P < 0·01 and P < 0·05,respectively).

The proliferation results from pollen- and rFel d1-stimulated cultures were also analysed separately forpollen-allergic [n = 4 (IL-10), n = 5 (CD25, TGF-b)], cat-allergic (n = 1, not subjected to comparative analysis) andnon-allergic [n = 15 (IL-10), n = 11 (CD25) and n = 10(TGF-b)] subjects (Tables 1 and 2). For the non-allergicgroup, there was a significant increase in proliferation to rFeld 1 when IL-10 was blocked, both before and after treatment(P < 0·01 w0 and P < 0·05 w6), and when CD25+ cells wereremoved after treatment (w6, P < 0·01). The differentiationof the results with respect to allergic status did not reveal anyother significant differences or alterations in any culturecondition. No further differences were revealed by compar-ing CD with UC and responding with non-respondingpatients.

Discussion

In mice, Tregs have been shown to play a role in experimentalcolitis [29–32]. Moreover, anti-TNF treatment can induceremission and prevent inflammation in these models[33,34]. It has been suggested that the down-regulating effectof anti-TNF treatment on intestinal inflammation in IBDpatients is due to induction of FoxP3-expressing Treg cells[17,20], similar to the effects observed in patients with rheu-matoid arthritis (RA) [35,36]. Contrasting data showing noeffect on the frequency of Treg cells in peripheral bloodduring the course of treatment have also been presented[18,21]. In accordance with the latter reports, we could notdetect any significant changes in the amount of CD4+CD25+

cells, CD4+CD25+FoxP3+ cells or CD25+TNF-RII+ cells inperipheral blood after 6 weeks of anti-TNF treatment, norwas there any alteration in the expression of FoxP3 mRNAin polyclonally stimulated PBMCs. The low expression ofCD69 on the CD4+CD25+ cells suggests that these cells arenot activated effector cells, but rather Treg cells. An enrichedfraction of peripheral blood CD4+CD25+ cells isolated eitherbefore or after anti-TNF treatment did not suppress poly-clonally stimulated proliferation significantly at a 4:1 Tresponder : Treg cell ratio. Even though the suppression waslow in the cultures, treatment did not alter the suppressiveactivity. There was, however, a tendency to a slightlyincreased susceptibility to suppression among CD4+CD25– Tresponder cells collected after compared to before treatment.Taken together, these results speak against an effect of anti-TNF treatment on the amount as well as on the function ofperipheral blood Treg cells.

There is evidence for increased numbers of Treg cells in theintestinal mucosa of patients with IBD [9–11], supportingthe idea that although the number of regulatory cells isincreased, they are not sufficiently efficient to inhibit localinflammation. The reason may be either dysfunctional regu-latory activity or overwhelming amounts of effector T cells[10]. In this study, we analysed CD4+CD25+ cells in intestinalmucosa, although this population may contain both Treg andactivated T cells. The percentage of CD4+CD25+ cells inperipheral blood did not change during treatment, while inthe intestinal mucosa these cells decreased initially (after 2

Fig. 4. Suppressive activity of CD4+CD25+ T

cells before and after anti-tumour necrosis

factor (TNF) treatment. CD4+CD25+ cells were

co-cultured with CD4+CD25– cells at a 4:1 ratio

(CD25– : CD25+) for comparison of the

suppressive function of CD4+CD25+ cells from

before and after anti-TNF treatment. Assays

with polyclonally stimulated CD4+CD25– cells

from both (a) before and (b) after treatment

were used. Wilcoxon’s signed-rank test.

200 000

(a)

150 000

100 000

CP

M

50 000

Teff before +––

++–

+–+

Treg beforeTreg after

200 000P =0·06

P =0·06

(b)

150 000

100 000

CP

M

50 000

Teff after +––

++–

+–+

Treg beforeTreg after



weeks), followed by a significant increase of the CD4+CD25+

cells after 6 weeks of treatment. An increased percentage ofCD69 expression on these cells throughout the observedtreatment period indicates that they may correspond to acti-

vated effector T cells in the mucosa despite the improvementof the patients’ conditions.

We observed a significant decrease of CD25+TNF-RII+

cells in the mucosa during the course of treatment. This

0100200300400500500

100015002000250030003500

(a)

(b)

(c)

(d)

IL-10block

CP

M

0

0

5 000

10 000

15 000

20 000

25 000

30 000

35 000

0

5 000

10 000

15 000

20 000

25 000

30 000

35 000

0200400600800

10001000200030004000500060007000

0200400600800

10001000200030004000500060007000

100200300400500500

10001500200025003000

CP

M

0100200300400500500

10001500200025003000

CP

M

CP

M

CP

M

CP

M

CP

M

– + – + – +

**

0100200300400500500

100015002000250030003500

CP

M

– + – + – +

*

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

– + – + – +

CD25depletion

TGFβRblock

IL-10block

CD25depletion

TGFβRblock

Uns

timul

ated

Pol

len

rFel

d 1

Flu

e an

tigen

**

*

**

***

***

Before After

Fig. 5. Effect of blocking regulatory mechanisms on peripheral blood mononuclear cell (PBMC) proliferation. Unstimulated proliferation (a) and

proliferation in pollen-, rFel d 1- and Flue-stimulated cultures (b, c and d, respectively) before and after 6 weeks of anti-tumour necrosis factor

(TNF) treatment. Dark grey bars represent interleukin (IL)-10-blocking (n = 21), light grey bars represent CD25 depletion (n = 16) and white bars

represent transforming growth factor (TGF)-b-blocking (n = 15). Wilcoxon’s signed-rank test. *P < 0·05; **P < 0·01; ***P < 0·001.



decrease probably results from down-regulation of thereceptor in the absence of its ligand and may reflect a reduc-tion of inflammation. Although the co-expression of CD25and TNF-RII has been used to identify functional Tregs

among CD4+FoxP3+ cells [28], TNF signalling through TNF-RII on Treg cells may also abrogate their suppressive function[37]. Moreover, different Treg populations may displaydissimilar functional dependence on TNF-RII signalling.Recently a study in mice showed that natural Tregs requiredTNF-a signalling for in-vivo function while inducible Tregs

did not [38]. In patients with RA, Treg function has beensuggested to be compromised during active disease, and anti-TNF treatment is able to restore the suppressive function[35]. Tregs isolated from patients with RA expressed higherlevels of TNF-RII before compared to after anti-TNF treat-ment [36]. Thus, the observed decrease of TNF-RII onCD25+ cells in the intestinal mucosa during anti-TNF treat-ment does not necessarily reflect a decrease of functional Treg

cells. Interestingly, in a recent report, CD4+ cells in laminapropria from IBD patients were shown to express higherlevels of TNF-RII compared to healthy controls [39]. Fur-thermore, addition of anti-TNF to cell cultures induced apo-ptosis of peripheral blood CD14+ cells from IBD patients,and of peripheral blood CD4+ cells in co-culture with CD14+

cells from UC patients. TNF-RII-dependent apoptosis maythus be one mechanism of anti-TNF treatment and an alter-native explanation for the reduction of CD25+TNF-RII+ cellsfound in the present study.

Different regulatory mechanisms may play a role intreatment-induced resolution of inflammation. Therefore,we analysed baseline and antigen-stimulated T cell activationin PBMC cultures where either the regulatory cytokinesIL-10 or TGF-b were neutralized, or CD4+CD25+ cells(including most CD4+CD25+FoxP3+ Treg cells [22]) weredepleted. For both baseline and Fel d 1-stimulated prolifera-tion, IL-10-dependent regulatory mechanisms seem to bemore active before than after 6 weeks of anti-TNF therapy. Incontrast, regulation by CD4+CD25+ cells seems to play amore important role after 6 weeks of treatment than before.Thus, even though the overall treatment effect on peripheralblood Treg cells is limited, the anti-TNF treatment mayinduce a shift in Treg subsets.

To analyse regulation of antigen-stimulated immuneresponses we employed antigens to which most individualsare naturally exposed: an influenza antigen and twocommon environmental allergens. It has been reported thathealthy individuals have a functional response while allergicpatients have a dysfunctional Treg response to allergens[40–42]. However, our data did not support any differencein the regulation of allergen-stimulated proliferation inPBMCs, depending on the allergic status of the patients.

To identify Th subsets, we applied a gating strategy basedon chemokine receptor expression [26]. Using this strategy,populations enriched for Th1 cells expressing the lineage-associated transcription factor T-bet and Th2 cells express-

ing GATA-3 could be identified. Our analysis of subsets of Thcells in peripheral blood could not reveal any difference inthe amounts of Th1 or Th2 between CD and UC patients.There were significantly more Th1 cells in the intestinalmucosa compared to peripheral blood, and the amounts ofdetected cells were similar to previous reports [43]. We alsodetected an increase of Th1 cells in the mucosa at w6 com-pared to w2, concordant with reports on RA patients receiv-ing anti-TNF treatment [44]. These results, in combinationwith the increased percentage of CD4+CD25+CD69+ cells,suggest that anti-TNF treatment induces effector cells in themucosa of IBD patients. In recent years, the importance ofTh17 cells in inflammatory diseases such as RA, psoriasis andIBD has been recognized [45–47], and there has also been areport on a decreased Treg : Th17 ratio in patients with IBD[9]. We could not detect any changes in the percentages ofthe cell population designated as Th17 in peripheral blood,and we were not able to detect these cells in the intestinalbiopsies. Analysis of lineage-associated transcription factorsrevealed that the Th17 subset identified by our gating strat-egy included GATA-3-expressing Th2 cells. The inability toseparate Th17 cells from Th2 cells may be explained by thelow numbers of Th17 cells in our samples. Thus the cellpopulation identified as ‘Th17’ in the blood is probably alsoenriched for Th2 cells.

Despite a total of 29 patients included in these analyses,the number of patients with allergy, UC or not responding totreatment was small (n � 6 for each of the analyses). Wewere unable to link any patterns of T cell subsets or regula-tory mechanisms to either diagnosis (UC or CD), treatmentresponse (responding or non-responding patients) orallergy, but differences cannot be ruled out due to the lownumber of patients in these subgroups.

In conclusion, we observed an effect of anti-TNF therapyon CD4+ T cells in the intestinal mucosa demonstratinga decrease of CD4+CD25+TNF-RII+ and an increaseof CD4+CD25+CD69+ cells as well as an increase ofCD4+CXCR3+ Th1 cells. Our results indicate that there is aninduction of effector cells during anti-TNF treatment ratherthan a restoration of Treg functionality in treated IBDpatients. However, there may be a shift in the type of regu-latory activity during treatment, supported by the observedalterations in IL-10-dependent and CD25+ cell-dependentregulation of antigen-specific PBMC proliferation. Furtherstudies are needed to elucidate if the subtle changes withinthe T cell populations are of importance for inflammationresolution or if other cells, e.g. innate immune cells, are theprime targets for anti-TNF treatment in IBD.

Acknowledgement

The authors thank Martina Jones, Sandra Hammarstrandand Emma Lindh for excellent technical assistance, and theTheme Center for Inflammatory Diseases at KarolinskaInstitutet and University Hospital. Anti-CD3 and anti-CD28



for mRNA stimulation experiments were kindly provided byProfessor C. Schmidt-Weber. The protocol for quantificationof transcription factors had been developed within the EUGlobal Allergy and Asthma European Network (GA2LEN).This work was supported by grants from the SwedishResearch Council, the Stockholm County Council, theSwedish Cancer and Allergy Foundation, the SwedishAsthma and Allergy Association’s Research Foundation, theKing Gustaf V 80th Birthday Foundation, Karolinska Insti-tutet, Hesselman’s, Konsul Th C. Bergh’s and Tornspiran’sFoundations, Schering-Plough Immunology Stipend andImmune Therapy Holdings, Inc.

Disclosures

Michael Eberhardson has received lecture fees and partici-pated in advisory boards for Schering Plough ScandinaviaAB, Abbott Scandinavia AB, ITH AB, and Otsuka Scandina-via AB. Michael Eberhardson has received unrestrictedresearch funding from Schering Plough (Schering-PloughImmunology Stipend). All other authors declare no conflictsof interest.

References

1 Cho JH. Inflammatory bowel disease: genetic and epidemiologic

considerations. World J Gastroenterol 2008; 14:338–47.

2 Loftus EV Jr. Clinical epidemiology of inflammatory bowel disease:

incidence, prevalence, and environmental influences. Gastroenter-

ology 2004; 126:1504–17.

3 Bouma G, Strober W. The immunological and genetic basis of

inflammatory bowel disease. Nat Rev Immunol 2003; 3:521–33.

4 Sartor RB. Mechanisms of disease: pathogenesis of Crohn’s disease

and ulcerative colitis. Nat Clin Pract Gastroenterol Hepatol 2006;

3:390–407.

5 Loftus EV Jr, Silverstein MD, Sandborn WJ, Tremaine WJ,

Harmsen WS, Zinsmeister AR. Ulcerative colitis in Olmsted

County, Minnesota, 1940–1993: incidence, prevalence, and

survival. Gut 2000; 46:336–43.

6 Baumgart DC, Carding SR. Inflammatory bowel disease: cause and

immunobiology. Lancet 2007; 369:1627–40.

7 Doering J, Begue B, Lentze MJ et al. Induction of T lymphocyte

apoptosis by sulphasalazine in patients with Crohn’s disease. Gut

2004; 53:1632–8.

8 MacDonald TT, Monteleone G, Pender SL. Recent developments in

the immunology of inflammatory bowel disease. Scand J Immunol

2000; 51:2–9.

9 Eastaff-Leung N, Mabarrack N, Barbour A, Cummins A, Barry S.

Foxp3+ regulatory T cells, Th17 effector cells, and cytokine envi-

ronment in inflammatory bowel disease. J Clin Immunol 2010;

30:80–9.

10 Holmen N, Lundgren A, Lundin S et al. Functional

CD4+CD25high regulatory T cells are enriched in the colonic

mucosa of patients with active ulcerative colitis and increase with

disease activity. Inflamm Bowel Dis 2006; 12:447–56.

11 Makita S, Kanai T, Oshima S et al. CD4+CD25bright T cells in

human intestinal lamina propria as regulatory cells. J Immunol

2004; 173:3119–30.

12 Parronchi P, Romagnani P, Annunziato F et al. Type 1 T-helper cell

predominance and interleukin-12 expression in the gut of patients

with Crohn’s disease. Am J Pathol 1997; 150:823–32.

13 Fuss IJ, Neurath M, Boirivant M et al. Disparate CD4+ lamina

propria (LP) lymphokine secretion profiles in inflammatory bowel

disease. Crohn’s disease LP cells manifest increased secretion of

IFN-gamma, whereas ulcerative colitis LP cells manifest increased

secretion of IL-5. J Immunol 1996; 157:1261–70.

14 Duerr RH, Taylor KD, Brant SR et al. A genome-wide association

study identifies IL23R as an inflammatory bowel disease gene.

Science 2006; 314:1461–3.

15 Hanauer SB, Feagan BG, Lichtenstein GR et al. Maintenance inflix-

imab for Crohn’s disease: the ACCENT I randomised trial. Lancet

2002; 359:1541–9.

16 Rutgeerts P, Sandborn WJ, Feagan BG et al. Infliximab for induc-

tion and maintenance therapy for ulcerative colitis. N Engl J Med

2005; 353:2462–76.

17 Li Z, Arijs I, De Hertogh G et al. Reciprocal changes of

Foxp3 expression in blood and intestinal mucosa in IBD

patients responding to infliximab. Inflamm Bowel Dis 2010;

16:1299–310.

18 Hvas CL, Kelsen J, Agnholt J, Dige A, Christensen LA, Dahlerup JF.

Discrete changes in circulating regulatory T cells during infliximab

treatment of Crohn’s disease. Autoimmunity 2010; 43:325–33.

19 Ricciardelli I, Lindley KJ, Londei M, Quaratino S. Anti tumour

necrosis-alpha therapy increases the number of FOXP3 regulatory

T cells in children affected by Crohn’s disease. Immunology 2008;

125:178–83.

20 Boschetti G, Nancey S, Sardi F, Roblin X, Flourie B, Kaiserlian D.

Therapy with anti-TNFalpha antibody enhances number and func-

tion of Foxp3(+) regulatory T cells in inflammatory bowel diseases.

Inflamm Bowel Dis 2011; 17:160–70.

21 Saruta M, Yu QT, Fleshner PR et al. Characterization of

FOXP3+CD4+ regulatory T cells in Crohn’s disease. Clin Immunol

2007; 125:281–90.

22 Thunberg S, Gafvelin G, Nord M et al. Allergen provocation

increases TH2-cytokines and FOXP3 expression in the asthmatic

lung. Allergy 2010; 65:311–8.

23 Gronlund H, Bergman T, Sandstrom K et al. Formation of disulfide

bonds and homodimers of the major cat allergen Fel d 1 equivalent

to the natural allergen by expression in Escherichia coli. J Biol Chem

2003; 278:40144–51.

24 Burgler S, Ouaked N, Bassin C et al. Differentiation and functional

analysis of human T(H)17 cells. J Allergy Clin Immunol 2009;

123:588–95. 95 e1-7.

25 Wilson NJ, Boniface K, Chan JR et al. Development, cytokine

profile and function of human interleukin 17-producing helper T

cells. Nat Immunol 2007; 8:950–7.

26 Acosta-Rodriguez EV, Rivino L, Geginat J et al. Surface phenotype

and antigenic specificity of human interleukin 17-producing T

helper memory cells. Nat Immunol 2007; 8:639–46.

27 Mjosberg J, Berg G, Jenmalm MC, Ernerudh J. FOXP3+ regulatory

T cells and T helper 1, T helper 2, and T helper 17 cells in human

early pregnancy decidua. Biol Reprod 2010; 82:698–705.

28 Chen X, Subleski JJ, Hamano R, Howard OM, Wiltrout RH,

Oppenheim JJ. Co-expression of TNFR2 and CD25 identifies more

of the functional CD4+FOXP3+ regulatory T cells in human

peripheral blood. Eur J Immunol 2010; 40:1099–106.

29 Daniel C, Sartory N, Zahn N, Geisslinger G, Radeke HH, Stein JM.

FTY720 ameliorates Th1-mediated colitis in mice by directly



affecting the functional activity of CD4+CD25+ regulatory T cells.

J Immunol 2007; 178:2458–68.

30 Ogino H, Nakamura K, Ihara E, Akiho H, Takayanagi R.

CD4(+)CD25(+) regulatory T cells suppress Th17-responses in an

experimental colitis model. Dig Dis Sci 2011; 56:376–86.

31 Watanabe K, Rao VP, Poutahidis T et al. Cytotoxic-T-lymphocyte-

associated antigen 4 blockade abrogates protection by regulatory T

cells in a mouse model of microbially induced innate immune-

driven colitis. Infect Immun 2008; 76:5834–42.

32 Fantini MC, Becker C, Tubbe I et al. Transforming growth factor

beta induced FoxP3+ regulatory T cells suppress Th1 mediated

experimental colitis. Gut 2006; 55:671–80.

33 Shen C, de Hertogh G, Bullens DM et al. Remission-inducing effect

of anti-TNF monoclonal antibody in TNBS colitis: mechanisms

beyond neutralization? Inflamm Bowel Dis 2007; 13:308–16.

34 Powrie F, Leach MW, Mauze S, Menon S, Caddle LB, Coffman RL.

Inhibition of Th1 responses prevents inflammatory bowel disease

in SCID mice reconstituted with CD45RBhi CD4+ T cells. Immu-

nity 1994; 1:553–62.

35 Ehrenstein MR, Evans JG, Singh A et al. Compromised function of

regulatory T cells in rheumatoid arthritis and reversal by anti-

TNFalpha therapy. J Exp Med 2004; 200:277–85.

36 Valencia X, Stephens G, Goldbach-Mansky R, Wilson M, Shevach

EM, Lipsky PE. TNF downmodulates the function of human

CD4+CD25hi T-regulatory cells. Blood 2006; 108:253–61.

37 Nagar M, Jacob-Hirsch J, Vernitsky H et al. TNF activates a

NF-kappaB-regulated cellular program in human CD45RA–

regulatory T cells that modulates their suppressive function.

J Immunol 2010; 184:3570–81.

38 Housley WJ, Adams CO, Nichols FC et al. Natural but not induc-

ible regulatory T cells require TNF-{alpha} signaling for in vivo

function. J Immunol 2011; 186:6779–87.

39 Atreya R, Zimmer M, Bartsch B et al. Anti-TNF antibodies target

T-cell apoptosis in inflammatory bowel diseases via TNFR2 and

intestinal CD14+ macrophages. Gastroenterology 2011; 141:2026–

38.

40 Ling EM, Smith T, Nguyen XD et al. Relation of CD4+CD25+regulatory T-cell suppression of allergen-driven T-cell activation to

atopic status and expression of allergic disease. Lancet 2004;

363:608–15.

41 Akdis M, Verhagen J, Taylor A et al. Immune responses in healthy

and allergic individuals are characterized by a fine balance between

allergen-specific T regulatory 1 and T helper 2 cells. J Exp Med

2004; 199:1567–75.

42 Grindebacke H, Wing K, Andersson AC, Suri-Payer E, Rak S, Rudin

A. Defective suppression of Th2 cytokines by CD4CD25 regulatory

T cells in birch allergics during birch pollen season. Clin Exp

Allergy 2004; 34:1364–72.

43 Yuan YH, ten Hove T, The FO, Slors JF, van Deventer SJ, te Velde

AA. Chemokine receptor CXCR3 expression in inflammatory

bowel disease. Inflamm Bowel Dis 2001; 7:281–6.

44 Aeberli D, Seitz M, Juni P, Villiger PM. Increase of peripheral

CXCR3 positive T lymphocytes upon treatment of RA patients

with TNF-alpha inhibitors. Rheumatology (Oxf) 2005; 44:172–

5.

45 Chabaud M, Durand JM, Buchs N et al. Human interleukin-17: a T

cell-derived proinflammatory cytokine produced by the rheuma-

toid synovium. Arthritis Rheum 1999; 42:963–70.

46 Zaba LC, Cardinale I, Gilleaudeau P et al. Amelioration of epider-

mal hyperplasia by TNF inhibition is associated with reduced Th17

responses. J Exp Med 2007; 204:3183–94.

47 Kobayashi T, Okamoto S, Hisamatsu T et al. IL23 differentially

regulates the Th1/Th17 balance in ulcerative colitis and Crohn’s

disease. Gut 2008; 57:1682–9.



Altered immunoregulatory profile during anti-tumour necrosis factor treatment of patients with...

Documents

Transcript of Altered immunoregulatory profile during anti-tumour necrosis factor treatment of patients with...